Thyroid fine needle aspiration molecular assay

Abstract

The present invention relates to methods, compositions and articles directed to diagnosing thyroid carcinoma, differentiating between thyroid carcinoma and benign thyroid diseases, testing indeterminate thyroid fine needle aspirate samples of thyroid nodules, and determining patient protocols and outcomes.

Description

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

No government funds were used to make this invention.

REFERENCE TO SEQUENCE LISTING, OR A COMPUTER PROGRAM LISTING COMPACT DISK APPENDIX

Reference to a “Sequence Listing,” a table, or a computer program listing appendix submitted on a compact disc and an incorporation by reference of the material on the compact disc including duplicates and the files on each compact disc are hereby specified.

BACKGROUND OF THE INVENTION

This application claims the benefit of U.S. Provisional Application No. 60/683,173, filed May 20, 2005.

There are approximately 25,600 new cases of thyroid carcinoma diagnosed in the United States each year, and 1,400 patients will die of the disease. About 75% of all thyroid cancers belong to the papillary thyroid carcinoma type. The rest consist of 10% follicular carcinoma, 5% to 9% medullary thyroid cancer, 1% to 2% anaplastic cancer, 1% to 3% lymphoma, and less than 1% sarcoma and other rare tumors. Usually a lump (nodule) in the thyroid is the first sign of thyroid cancer. There are 10 to 18 million people in US with a single thyroid nodule, and approximately 490,000 become clinically apparent each year. Fortunately only about 5% of these nodules are cancerous.

The commonly used method for thyroid cancer diagnosis is fine needle aspiration (FNA) biopsy. FNA samples are examined cytologically to determine whether the nodules are benign or cancerous. The sensitivity and specificity of FNA range from 68% to 98%, and 72% to 100% respectively, depending on institutions and doctors. Unfortunately, in 25% of the cases the specimens are either inadequate for diagnosis or indeterminable by cytology. In current medical practice, patients with indeterminate results are sent to surgery, with consequence that only 25% have cancer and 75% end up with unnecessary surgery. A molecular assay with high sensitivity and a better specificity (higher than 25%) would greatly improve current diagnostic accuracy of thyroid cancer, and omit unnecessary surgery for non-cancerous patients.

Comparative genomic hybridization (CGH), serial analysis of gene expression (SAGE), and DNA microarray have been used to identify genetic events occurring in thyroid cancers such as loss of heterozygosity, up and down gene regulation, and genetic rearrangements. PAX8 and PPARγ genetic rearrangement event has been demonstrated to be associated with follicular thyroid cancer (FTC). Rearrangement of the ret proto-oncogene is related to papillary thyroid cancer (PTC). Down-regulation of thyroid peroxidase (TPO) gene is observed in both FTC and PTC. Galectin-3 was reported to be a candidate marker to differentiate malignant thyroid neoplasms from benign lesions. However, there are other studies demonstrating that Galectin-3 is not a cancer-specific marker. Many genes purported to be useful in thyroid cancer diagnosis lack the sensitivity and specificity required for an accurate molecular assay.

SUMMARY OF THE INVENTION

The present invention encompasses methods of diagnosing thyroid cancer by obtaining a biological sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.

The present invention encompasses methods of differentiating between thyroid carcinoma and benign thyroid diseases by obtaining a sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.

The present invention encompasses methods of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below predetermined cut-off levels are indicative of thyroid cancer.

The present invention encompasses methods of determining thyroid cancer patient treatment protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommend to treat the disease.

The present invention encompasses methods of treating a thyroid cancer patient by obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and treating the patient with a thyroidectomy if they are cancer positive.

The present invention encompasses methods of cross validating a gene expression profile for thyroid carcinoma patients by: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance.

The present invention encompasses methods of independently validating a gene expression profile and gene profiles obtained thereby for thyroid carcinoma patients by obtaining gene expression data from a statistically significant number of patient biological samples; normalizing the source variabilities in the gene expression data; computing for factor of interest on all variables that were selected previously; and testing the prediction model on the sample and record classification performance.

The present invention encompasses a method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients by: obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; and applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score.

The present invention encompasses methods of generating a thyroid carcinoma prognostic patient report and reports obtained thereby, by obtaining a biological sample from the patient; measuring gene expression of the sample; applying a posterior probability thereto; and using the results obtained thereby to generate the report.

The present invention encompasses compositions containing at least one probe set selected from the group consisting of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

The present invention encompasses kits for conducting an assay to determine thyroid carcinoma diagnosis in a biological sample containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

The present invention encompasses articles for assessing thyroid carcinoma status containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

The present invention encompasses microarrays or gene chips for performing the methods provided herein.

The present invention encompasses diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is an ROC curve of the LOOCV of the 4-gene signature in 98 training samples.

FIG. 2 is an ROC curve of the 5-gene signature in 98 training samples.

FIG. 3 a is an ROC curve of the 4-gene signature in 74 independent validation samples; 3b is an ROC curve of the 5-gene signature in 74 independent validation samples.

FIG. 4 a is an ROC curve of the 4-gene signature that is normalized to the three-thyroid control genes; 4b is an ROC curve of the 5-gene signature that is normalized to the three-thyroid control genes.

FIG. 5 a is an ROC curve of the 4-gene signature with one-round amplification in 47 thyroid samples; 5b is an ROC curve of the 4-gene signature with two-round amplification in 47 thyroid samples; 5c is an ROC curve of the 5-gene signature with one-round amplification in 47 thyroid samples; 5d is an ROC curve of the 5-gene signature with two-round amplification in 47 thyroid samples.

FIGS. 6 a and 6b depict the ROC curves for cross validation with the 83 independent fresh frozen thyroid samples.

FIGS. 7 a and 7b depict the ROC curves for signature validation with the 47 fine needle aspirate (FNA) thyroid samples.

FIGS. 8 a and 8b depict the ROC curves for signature performance in 28 paired fresh frozen and FNA thyroid samples.

DETAILED DESCRIPTION

In this study the goal was to identify signatures that can be used in assays such as DNA chip-based assay to differentiate thyroid carcinomas from benign thyroid diseases. 31 primary papillary thyroid tumors, 21 follicular thyroid cancers, 33 follicular adenoma samples, and 13 benign thyroid diseases were analyzed by using the Affymetrix human U133A Gene Chip. Comparison of gene expression profiles between thyroid cancers and benign tissues has enabled us to identify two signatures: a 5-gene signature identified by percentile analysis and manual selection, and a 4-gene signature selected by Linear Discrimination Analysis (LDA) approach. These two signatures have the performance of sensitivity/specificity 92%/70% and 92%/61%, respectively, and have been validated in 74 independent thyroid samples. The results presented herein demonstrate that these candidate signatures facilitate the diagnosis of thyroid cancers with better sensitivity and specificity than currently available diagnostic procedures. These two signatures are suitable for use in testing indeterminate FNA samples.

By performing gene profiling on 98 representative thyroid benign and tumor samples on Affymetrix U133a chips, we have selected two gene signatures, a 5-gene signature and a 4-gene signature, for thyroid FNA molecular assay. Signatures were selected to achieve the best sensitivity of the assay at a close to 95%. Except for fibronectin and thyroid peroxidase, the other seven genes from the two signatures have not been implicated previously in thyroid tumorogenesis. Both signatures have been validated with an independent 74 thyroid samples, and achieved performance that is equivalent to the one in the 98 training samples. The performances of the two gene signatures are 92% sensitivity and 70%/61% specificity, respectively. When these two signatures are normalized to the specific thyroid control genes the performances are improved relative to the ones of the non-normalized signatures. Furthermore, the signatures performed equivalently with two different target preparations, namely one-round amplification and two-round amplifications. This validation is extremely important for thyroid assays that are FNA samples, which usually contain limited numbers of thyroid cells.

The mere presence or absence of particular nucleic acid sequences in a tissue sample has only rarely been found to have diagnostic or prognostic value. Information about the expression of various proteins, peptides or mRNA, on the other hand, is increasingly viewed as important. The mere presence of nucleic acid sequences having the potential to express proteins, peptides, or mRNA (such sequences referred to as “genes”) within the genome by itself is not determinative of whether a protein, peptide, or mRNA is expressed in a given cell. Whether or not a given gene capable of expressing proteins, peptides, or mRNA does so and to what extent such expression occurs, if at all, is determined by a variety of complex factors. Irrespective of difficulties in understanding and assessing these factors, assaying gene expression can provide useful information about the occurrence of important events such as tumorogenesis, metastasis, apoptosis, and other clinically relevant phenomena. Relative indications of the degree to which genes are active or inactive can be found in gene expression profiles. The gene expression profiles of this invention are used to provide a diagnosis and treat patients for thyroid cancer.

Sample preparation requires the collection of patient samples. Patient samples used in the inventive method are those that are suspected of containing diseased cells such as cells taken from a nodule in a fine needle aspirate (FNA) of thyroid tissue. Bulk tissue preparation obtained from a biopsy or a surgical specimen and laser capture microdissection are also suitable for use. Laser Capture Microdissection (LCM) technology is one way to select the cells to be studied, minimizing variability caused by cell type heterogeneity. Consequently, moderate or small changes in gene expression between normal or benign and cancerous cells can be readily detected. Samples can also comprise circulating epithelial cells extracted from peripheral blood. These can be obtained according to a number of methods but the most preferred method is the magnetic separation technique described in U.S. Pat. No. 6,136,182. Once the sample containing the cells of interest has been obtained, RNA is extracted and amplified and a gene expression profile is obtained, preferably via microarray, for genes in the appropriate portfolios.

The present invention encompasses methods of diagnosing thyroid cancer by obtaining a biological sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.

The present invention encompasses methods of differentiating between thyroid carcinoma and benign thyroid diseases by obtaining a sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.

The present invention encompasses methods of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or

recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.

The present invention encompasses methods of determining thyroid cancer patient treatment protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommend to treat the disease.

The present invention encompasses methods of treating a thyroid cancer patient by obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and treating the patient with thyroidectomy if they are cancer positive.

The SEQ ID NOs in the above methods can be 36, 53, 73, 211 and 242 or 199, 207, 255 and 354, or 45, 215, 65, 29, 190, 199, 207, 255 and 354.

The invention also encompasses the above methods containing the steps of further measuring the expression level of at least one gene encoding mRNA: corresponding to SEQ ID NOs: 142, 219 and 309; and/or corresponding to SEQ ID NOs: 9, 12 and 18; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 130, 190 and 276 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25. The invention also encompasses the above methods containing the steps of further measuring the expression level of at least one gene constitutively expressed in the sample.

Cadherin 3, type 1 (SEQ ID NO: 53) is mentioned in US20030194406; US 20050037439; and US 20040137539. Fibronectin (SEQ ID NO: 242) is mentioned in US6436642 and US20030104419. Secretory granule, neuroendocrine protein 1 (SEQ ID NO: 76) is mentioned in US20030232350; and US20040002067. Testican-1 (SEQ ID NO: 36) is mentioned in US20030108963; and US20050037463. Thyroid peroxidase (SEQ ID NO: 211) is mentioned in US6066449, US20030118553; US20030054571; WO9102061; and WO9856953. Chemokine C (C-C) motif ligand 18 (SEQ ID NO: 354) is mentioned in WO2005005601 and US20020114806. Pulmonary surfactant-associated protein B (SEQ ID NO: 355) is mentioned in US20030219760; and US20030232350. K+ channel beta subunit (SEQ ID NO: 207) is mentioned in US20030096782; and US 20020168638. Putative prostate cancer suppressor (SEQ ID NO: 178) is mentioned in WO2005020784. Bone marrow stromal cell antigen 1 (SEQ ID NO: 142) is mentioned in WO2004040014; and WO2005020784. Leucocyte immunoglobulin-like receptor-6b (SEQ ID NO: 219) is mentioned in US20030060614. Bridging integrator 2 (SEQ ID NO: 309) is mentioned in EP1393776; WO02057414; WO 0116158 and US6831063. Cysteine-rich, angiogenic inducer, 61 (SEQ ID NO: 9) is mentioned in WO2004030615; and WO9733995. Selenoprotein P, Plasma 1 (SEQ ID NO: 12) is mentioned in US20040241653 and WO2005015236. Insulin-like growth factor-binding protein 4 (SEQ ID NO: 18) is mentioned in WO2005015236; WO9203469; WO9203152; and EP0546053.

In this invention, the most preferred method for analyzing the gene expression pattern of a patient in the methods provided herein is through the use of a linear discrimination analysis program. The present invention encompasses a method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients by: obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; and applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score. Other analytical tools can also be used to answer the same question such as, logistic regression and neural network approaches.

For instance, the following can be used for linear discriminant analysis: $p_{\left(\mathrm{CP}\right)}=\frac{e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$$p_{\left(\mathrm{CN}\right)}=\frac{1}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$ where, I_(psid)=The log base 2 intensity of the probe set enclosed in parenthesis. d_(CP)=The discriminant function for the cancer positive class d_(CN)=The discriminant function for the cancer negative class P_(CP)=The posterior p-value for the cancer positive class P_(CN)=The posterior p-value for the cancer negative class

Numerous other well-known methods of pattern recognition are available. The following references provide some examples: Weighted Voting: Golub et al. (1999); Support Vector Machines: Su et al. (2001); and Ramaswamy et al. (2001); K-nearest Neighbors: Ramaswamy (2001); and Correlation Coefficients: van 't Veer et al. (2002).

Preferably, portfolios are established such that the combination of genes in the portfolio exhibit improved sensitivity and specificity relative to individual genes or randomly selected combinations of genes. In the context of the instant invention, the sensitivity of the portfolio can be reflected in the fold differences exhibited by a gene's expression in the diseased state relative to the normal state. Specificity can be reflected in statistical measurements of the correlation of the signaling of gene expression with the condition of interest. For example, standard deviation can be a used as such a measurement. In considering a group of genes for inclusion in a portfolio, a small standard deviation in expression measurements correlates with greater specificity. Other measurements of variation such as correlation coefficients can also be used in this capacity. The invention also encompasses the above methods where the specificity is at least about 40%, at least about 50% and at least about 60%. The invention also encompasses the above methods where the sensitivity is at least at least about 90% and at least about 92%.

The invention also encompasses the above methods where the comparison of expression patterns is conducted with pattern recognition methods. One method of the invention involves comparing gene expression profiles for various genes (or portfolios) to ascribe diagnoses. The gene expression profiles of each of the genes comprising the portfolio are fixed in a medium such as a computer readable medium. This can take a number of forms. For example, a table can be established into which the range of signals (e.g., intensity measurements) indicative of disease is input. Actual patient data can then be compared to the values in the table to determine whether the patient samples are normal, benign or diseased. In a more sophisticated embodiment, patterns of the expression signals (e.g., fluorescent intensity) are recorded digitally or graphically. The gene expression patterns from the gene portfolios used in conjunction with patient samples are then compared to the expression patterns.

Pattern comparison software can then be used to determine whether the patient samples have a pattern indicative of the disease. Of course, these comparisons can also be used to determine whether the patient is not likely to experience the disease. The expression profiles of the samples are then compared to the portfolio of a control cell. If the sample expression patterns are consistent with the expression pattern for cancer then (in the absence of countervailing medical considerations) the patient is treated as one would treat a thyroid cancer patient. If the sample expression patterns are consistent with the expression pattern from the normal/control cell then the patient is diagnosed negative for cancer.

Preferably, levels of up and down regulation are distinguished based on fold changes of the intensity measurements of hybridized microarray probes. A 1.5 fold difference is preferred for making such distinctions (or a p-value less than 0.05). That is, before a gene is said to be differentially expressed in diseased versus normal cells, the diseased cell is found to yield at least about 1.5 times more, or 1.5 times less intensity than the normal cells. The greater the fold difference, the more preferred is use of the gene as a diagnostic or prognostic tool. Genes selected for the gene expression profiles of this invention have expression levels that result in the generation of a signal that is distinguishable from those of the normal or non-modulated genes by an amount that exceeds background using clinical laboratory instrumentation.

Statistical values can be used to confidently distinguish modulated from non-modulated genes and noise. Statistical tests find the genes most significantly different between diverse groups of samples. The Student's T-test is an example of a robust statistical test that can be used to find significant differences between two groups. The lower the p-value, the more compelling the evidence that the gene is showing a difference between the different groups. Nevertheless, since microarrays measure more than one gene at a time, tens of thousands of statistical tests may be asked at one time. Because of this, one is unlikely to see small p-values just by chance and adjustments for this using a Sidak correction as well as a randomization/permutation experiment can be made. A p-value less than 0.05 by the T-test is evidence that the gene is significantly different. More compelling evidence is a p-value less then 0.05 after the Sidak correction is factored in. For a large number of samples in each group, a p-value less than 0.05 after the randomization/permutation test is the most compelling evidence of a significant difference.

The present invention encompasses microarrays or gene chips for performing the methods provided herein. The microarrays can contain isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma or risk of relapse in a biological sample. The microarray preferably measures or characterizes at least about 1.5-fold over- or under-expression, provides a statistically significant p-value over- or under-expression, or a p-value is less than 0.05. Preferably, the microarray contains a cDNA array or an oligonucleotide array and may contain one or more internal control reagents. One preferred internal control reagent is a method of detecting PAX8 gene expression which can be measured using SEQ ID NOs: 409-411.

Preferably, an oligonucleotide in the array corresponds to the 3′ non-coding region of the gene the expression of which is being measured.

Another parameter that can be used to select genes that generate a signal that is greater than that of the non-modulated gene or noise is the use of a measurement of absolute signal difference. Preferably, the signal generated by the modulated gene expression is at least 20% different than those of the normal or non-modulated gene (on an absolute basis). It is even more preferred that such genes produce expression patterns that are at least 30% different than those of normal or non-modulated genes.

Preferred methods for establishing gene expression profiles include determining the amount of RNA that is produced by a gene that can code for a protein or peptide. This is accomplished by reverse transcriptase PCR (RT-PCR), competitive RT-PCR, real time RT-PCR, differential display RT-PCR, Northern Blot analysis and other related tests. While it is possible to conduct these techniques using individual PCR reactions, it is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA and analyze it via microarray.

A number of different array configurations and methods for their production are known to those of skill in the art and are described in U.S. patents such as: U.S. Pat. Nos. 5,445,934; 5,532,128; 5,556,752; 5,242,974; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,436,327; 5,472,672; 5,527,681; 5,529,756; 5,545,531; 5,554,501; 5,561,071; 5,571,639; 5,593,839; 5,599,695; 5,624,711; 5,658,734; and 5,700,637.

Microarray technology allows for the measurement of the steady-state mRNA level of thousands of genes simultaneously thereby presenting a powerful tool for identifying effects such as the onset, arrest, or modulation of uncontrolled cell proliferation. Two microarray technologies are currently in wide use. The first are cDNA arrays and the second are oligonucleotide arrays. Although differences exist in the construction of these chips, essentially all downstream data analysis and output are the same. The product of these analyses are typically measurements of the intensity of the signal received from a labeled probe used to detect a cDNA sequence from the sample that hybridizes to a nucleic acid sequence at a known location on the microarray. Typically, the intensity of the signal is proportional to the quantity of cDNA, and thus mRNA, expressed in the sample cells. A large number of such techniques are available and useful. Preferred methods for determining gene expression can be found in U.S. Pat. Nos. 6,271,002; 6,218,122; 6,218,114; and 6,004,755.

Analysis of the expression levels is conducted by comparing such signal intensities. This is best done by generating a ratio matrix of the expression intensities of genes in a test sample versus those in a control sample. For instance, the gene expression intensities from a diseased tissue can be compared with the expression intensities generated from benign or normal tissue of the same type. A ratio of these expression intensities indicates the fold-change in gene expression between the test and control samples.

Gene expression profiles can also be displayed in a number of ways. The most common method is to arrange raw fluorescence intensities or ratio matrix into a graphical dendogram where columns indicate test samples and rows indicate genes. The data are arranged so genes that have similar expression profiles are proximal to each other. The expression ratio for each gene is visualized as a color. For example, a ratio less than one (indicating down-regulation) may appear in the blue portion of the spectrum while a ratio greater than one (indicating up-regulation) may appear as a color in the red portion of the spectrum. Commercially available computer software programs are available to display such data including “GENESPRING” from Silicon Genetics, Inc. and “DISCOVERY” and “INFER” software from Partek, Inc.

Modulated genes used in the methods of the invention are described in the Examples. The genes that are differentially expressed are either up regulated or down regulated in patients with thyroid cancer relative to those with benign thyroid diseases. Up regulation and down regulation are relative terms meaning that a detectable difference (beyond the contribution of noise in the system used to measure it) is found in the amount of expression of the genes relative to some baseline. In this case, the baseline is the measured gene expression of a benign disease patient. The genes of interest in the diseased cells are then either up regulated or down regulated relative to the baseline level using the same measurement method. Diseased, in this context, refers to an alteration of the state of a body that interrupts or disturbs, or has the potential to disturb, proper performance of bodily functions as occurs with the uncontrolled proliferation of cells. Someone is diagnosed with a disease when some aspect of that person's genotype or phenotype is consistent with the presence of the disease. However, the act of conducting a diagnosis or prognosis includes the determination of disease/status issues such as determining the likelihood of relapse, type of therapy and therapy monitoring. In therapy monitoring, clinical judgments are made regarding the effect of a given course of therapy by comparing the expression of genes over time to determine whether the gene expression profiles have changed or are changing to patterns more consistent with normal tissue.

Genes can be grouped so that information obtained about the set of genes in the group provides a sound basis for making a clinically relevant judgment such as a diagnosis, prognosis, or treatment choice. These sets of genes make up the portfolios of the invention. As with most diagnostic markers, it is often desirable to use the fewest number of markers sufficient to make a correct medical judgment. This prevents a delay in treatment pending further analysis as well unproductive use of time and resources.

One method of establishing gene expression portfolios is through the use of optimization algorithms such as the mean variance algorithm widely used in establishing stock portfolios. This method is described in detail in US patent publication number 20030194734. Essentially, the method calls for the establishment of a set of inputs (stocks in financial applications, expression as measured by intensity here) that will optimize the return (e.g., signal that is generated) one receives for using it while minimizing the variability of the return. Many commercial software programs are available to conduct such operations. “Wagner Associates Mean-Variance Optimization Application,” referred to as “Wagner Software” throughout this specification, is preferred. This software uses functions from the “Wagner Associates Mean-Variance Optimization Library” to determine an efficient frontier and optimal portfolios in the Markowitz sense is preferred. Use of this type of software requires that microarray data be transformed so that it can be treated as an input in the way stock return and risk measurements are used when the software is used for its intended financial analysis purposes.

The process of selecting a portfolio can also include the application of heuristic rules. Preferably, such rules are formulated based on biology and an understanding of the technology used to produce clinical results. More preferably, they are applied to output from the optimization method. For example, the mean variance method of portfolio selection can be applied to microarray data for a number of genes differentially expressed in subjects with cancer. Output from the method would be an optimized set of genes that could include some genes that are expressed in peripheral blood as well as in diseased tissue. If samples used in the testing method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in peripheral blood, then a heuristic rule can be applied in which a portfolio is selected from the efficient frontier excluding those that are differentially expressed in peripheral blood. Of course, the rule can be applied prior to the formation of the efficient frontier by, for example, applying the rule during data pre-selection.

Other heuristic rules can be applied that are not necessarily related to the biology in question. For example, one can apply a rule that only a prescribed percentage of the portfolio can be represented by a particular gene or group of genes. Commercially available software such as the Wagner Software readily accommodates these types of heuristics. This can be useful, for example, when factors other than accuracy and precision (e.g., anticipated licensing fees) have an impact on the desirability of including one or more genes.

The gene expression profiles of this invention can also be used in conjunction with other non-genetic diagnostic methods useful in cancer diagnosis, prognosis, or treatment monitoring. For example, in some circumstances it is beneficial to combine the diagnostic power of the gene expression based methods described above with data from conventional markers such as serum protein markers (e.g., Cancer Antigen 27.29 (“CA 27.29”)). A range of such markers exists including such analytes as CA 27.29. In one such method, blood is periodically taken from a treated patient and then subjected to an enzyme immunoassay for one of the serum markers described above. When the concentration of the marker suggests the return of tumors or failure of therapy, a sample source amenable to gene expression analysis is taken. Where a suspicious mass exists, a fine needle aspirate (FNA) is taken and gene expression profiles of cells taken from the mass are then analyzed as described above. Alternatively, tissue samples may be taken from areas adjacent to the tissue from which a tumor was previously removed. This approach can be particularly useful when other testing produces ambiguous results.

The present invention encompasses methods of cross validating a gene expression profile and the profiles thus obtained, for thyroid carcinoma patients by: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance. In this method, preferably, the gene expression data obtained in step h. is represented by genes from those encoding mRNA: corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or recognized specifically by the probe sets from psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.

The present invention encompasses methods of independently validating a gene expression profile and the profiles thus obtained, for thyroid cancer patients by obtaining gene expression data from a statistically significant number of patient biological samples; normalizing the source variabilities in the gene expression data; computing for factor of interest on all variables that were selected previously; and testing the prediction model on the sample and record classification performance. In this method, preferably, the gene expression data obtained in step d. is represented by genes from those encoding mRNA: corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or recognized specifically by the probe sets from psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.

The present invention encompasses methods of generating a posterior probability to enable diagnosis of thyroid carcinoma patients by obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score. For instance, the following can be used for Linear Discriminant Analysis: $p_{\left(\mathrm{CP}\right)}=\frac{e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$$p_{\left(\mathrm{CN}\right)}=\frac{1}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$ where, I_(psid)=The log base 2 intensity of the probe set enclosed in parenthesis. d_(CP)=The discriminant function for the cancer positive class d_(CN)=The discriminant function for the cancer negative class P_(CP)=The posterior p-value for the cancer positive class P_(CN)=The posterior p-value for the cancer negative class

The present invention encompasses methods of generating a thyroid carcinoma diagnostic patient report and reports obtained thereby, by obtaining a biological sample from the patient; measuring gene expression of the sample; applying a posterior probability score thereto; and using the results obtained thereby to generate the report. The report can also contain an assessment of patient outcome and/or probability of risk relative to the patient population.

The present invention encompasses compositions containing at least one probe set from: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

The present invention encompasses kits for conducting an assay to determine thyroid carcinoma diagnosis in a biological sample containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25. The SEQ ID NOs. can be 36, 53, 73, 211 and 242, 199, 207, 255 and 354 and 45, 215, 65, 29, 190, 199, 207, 255 and 354.

Kits made according to the invention include formatted assays for determining the gene expression profiles. These can include all or some of the materials needed to conduct the assays such as reagents and instructions and a medium through which nucleic acid sequences, their complements, or portions thereof are assayed.

Articles of this invention include representations of the gene expression profiles useful for treating, diagnosing, prognosticating, and otherwise assessing diseases. These profile representations are reduced to a medium that can be automatically read by a machine such as computer readable media (magnetic, optical, and the like). The articles can also include instructions for assessing the gene expression profiles in such media. For example, the articles may comprise a CD ROM having computer instructions for comparing gene expression profiles of the portfolios of genes described above. The articles may also have gene expression profiles digitally recorded therein so that they may be compared with gene expression data from patient samples. Alternatively, the profiles can be recorded in different representational format. A graphical recordation is one such format. Clustering algorithms such as those incorporated in “DISCOVERY” and “INFER” software from Partek, Inc. mentioned above can best assist in the visualization of such data.

Different types of articles of manufacture according to the invention are media or formatted assays used to reveal gene expression profiles. These can comprise, for example, microarrays in which sequence complements or probes are affixed to a matrix to which the sequences indicative of the genes of interest combine creating a readable determinant of their presence. Alternatively, articles according to the invention can be fashioned into reagent kits for conducting hybridization, amplification, and signal generation indicative of the level of expression of the genes of interest for detecting cancer.

The present invention encompasses articles for assessing thyroid carcinoma status containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25. The SEQ ID NOs. can be 36, 53, 73, 211 and 242; 199, 207, 255 and 354; or 45, 215, 65, 29, 190, 199, 207, 255 and 354.

The present invention encompasses diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample. Preferably, the portfolio measures or characterizes at least about 1.5-fold over- or under-expression or provides a statistically significant p-value over- or under-expression. Preferably, the p-value is less than 0.05.

The following examples are provided to illustrate but not limit the claimed invention. All references cited herein are hereby incorporated by reference herein.

EXAMPLE 1

Materials and Methods

Tissue samples

Fresh frozen thyroid benign diseases, follicular adenoma, follicular carcinoma, and papillary carcinoma samples were obtained from different commercial vendors including Genomics Collaborative, Inc. (Cambridge, Mass.), Asterand (Detroit, Mich.), and Proteogenex (Los Angeles, Calif.). All samples were collected according to an Institutional Review Board approval protocol. Patients demographic and pathology information were also collected. The histopathological features of each sample were reviewed to confirm diagnosis, estimate sample preservation and tumor content.

RNA isolation

Standard TriZol protocol was used for all the RNA isolations. Tissue was homogenized in TriZol reagent (Invitrogen, Carlsbad, Calif.). Total RNA was isolated from TriZol and precipitated at −20° C. with isopropyl alcohol. RNA pellets were washed with 75% ethanol, dissolved in water and stored at −80° C. until use. RNA integrity was examined with Agilent 2100 Bioanalyzer RNA 6000 NanoAssay (Agilent Technologies, Palo Alto, Calif.).

Linear Discrimination Analysis

Linear Discriminant Analysis was performed using these steps: calculation of a common (pooled) covariance matrix and within-group means; calculation of the set of linear discriminant functions from the common covariance and the within-group means; and classification using the linear discriminant functions.

Plugging the chip intensity readings for each probe into the following equation can be used to derive the posterior probability of an unknown thyroid sample as either cancer positive or negative. For example, if a thyroid sample is tested with the assay and gives a p_(CP)>0.5 this sample will be classified as thyroid cancer.

For the 4 gene signature: d_(CP)=−50.9964+0.220424(I_(32128—at))+1.520185(I_{(209810—at)})+3.09431(I_{(210078—s—at)})+6.11283(I_{(213423—x—at)}) d_(CN)=−46.7445+0.374751(I_(32128—at))+1.010852(I_{(209810—at)})+3.645515(I_{(210078—s—at)})+5.337296(I_{(213423—x—at)}) For the 5 gene signature: d_(CP)=−135.931+4.737838(I_{(202363—at)})−1.23763(I_{(203256—at)})+1984148(I_{(203889—at)})+6.638082(l_{(210342—s—at})+10.7704(I_{(212464—s—at)}) d_(CN)=−128.978+4.610498(I_{(202363—at)})−1.28685(I_{(203256—at)})+1.656772 (I(203889_—at))+6.859133(l_{(210342—s—at})+10.24482 (I_{(212464—s—at)}) $p_{\left(\mathrm{CP}\right)}=\frac{e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$$p_{\left(\mathrm{CN}\right)}=\frac{1}{1+e^{d_{\left(\mathrm{CP}\right)}-d_{\left(\mathrm{CN}\right)}}}$ where, I_(psid)=The log base 2 intensity of the probe set enclosed in parenthesis. d_(CP)=The discriminant function for the cancer positive class d_(CN)=The discriminant function for the cancer negative class P_(CP)=The posterior p-value for the cancer positive class P_(CN)=The posterior p-value for the cancer negative class Two-Round aRNA Amplification

aRNA was amplified from 10 ng total RNA using the RiboBeast 2-Round Aminoallyl-aRNA Amplification kit (Epicentre, WI), a T7 based RNA linear amplification protocol, with some modifications. Total RNA was reverse transcribed using an oligo(dT) primer containing a T7 RNA polymerase promoter sequence and Superscript III RT. The second-strand synthesis was carried out using Bst DNA polymerase. An extra step of incubation with an exonuclease mix of Exo I and Exo VII was performed to reduce background. The double-stranded cDNA served as the template for T7-mediated linear amplification by in vitro transcription. For the second round of amplification, instead of using the RiboBeast reagents, the ENZO BioArray HighYield RNA Transcript Labeling kit (Affymetrix, CA) was used in place of the in vitro transcription step of Aminoallyl-aRNA. The aRNA was quantified by Agilent Nano Chip technology.

EXAMPLE 2

Microarray Analysis

Labeled cRNA was prepared and hybridized with the high-density oligonucleotide array Hu133A Gene Chip (Affymetrix, Santa Clara, Calif.) containing a total of 22,000 probe sets. Hybridization was performed according to a standard protocol provided by the manufacturer. Arrays were scanned using Affymetrix protocols and scanners. For subsequent analysis, each probe set was considered as an independent gene. Expression values for each gene were calculated by using Affymetrix Gene Chip analysis software MAS 5.0. All chips met the following quality control standards: the percentage of “presence” call, the scaling factor, the background level, and the noise level have to be within the range of mean plus or minus 3 standard deviation. All chips used for subsequent analysis have passed these quality control criteria. Sample collection for signature selection and independent validation is summarized in Table 1.

TABLE 1
Sample collection for signature training and validation
Category                        Number of Samples
Training Sample Set
Follicular Adenoma (FA)         33
Follicular Carcinoma (FC)       21
Benign Diseases (BN)            13
Papillary Carcinoma (PC)        31
Validation Sample Set
Follicular Adenoma (FA)         38
Follicular Carcinoma (FC)       5
Follicular Variant of Papillary 11
Carcinoma (FVPTC)
Papillary Carcinoma (PC)        20

EXAMPLE 3

Results Signature Identification

A. Gene Selection

A total of 98 samples including 31 primary papillary thyroid tumors, 21 follicular thyroid cancers, 33 follicular adenoma, and 13 benign thyroid tissues were analyzed by using Affymetrix human U133A gene chips. Five gene selection criteria were applied to the entire data set to obtain a limited number of genes for subsequent gene marker or signature identification:

1. Genes with at least one “Present Call” in this sample set were considered.

2. Genes with more than one “Present Call” in 12 PBL samples were excluded.

3. Only genes with chip intensity larger than 200 in all samples were selected.

4. Using genes that passed the above three criteria, we performed a variety of analyses, as listed in Table 2, to identify genes that are either up-regulated or down-regulated in thyroid tumors.

5. Finally, genes with expression change greater than 1.4-fold were selected.

TABLE 2
Summary of different types of percentile analyses
  Type of Percentile Analysis
1 20% FC vs 100% Benign
2 30% FC vs 90% Benign
3 30% PC vs 90% Benign
4 70% FC vs 50% Benign
5 70% PC vs 50% Benign
6 90% Benign vs 30% FC
7 90% Benign vs 30% PC

The final number of selected genes for signature identification is 322, described in Table 25, SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 335-363. The data obtained from the 322 selected genes are provided in Table 3 and summarized in Table 4.

TABLE 3
3a
SEQ ID NO:	800TT	801TT	802TT	804TT	805TT	806TT	807TT	818TT	819TT
354	10235.3	163.8	12.2	99.1	111.6	2506.3	1780.7	29.3	4.1
355	508.5	150.8	31.5	83.8	63.1	457.5	189.9	48.2	45.3
356	82.7	754	707.3	477.3	1120.7	827.5	246.3	1068.3	960.1
357	834	758.9	718	249.4	883.6	554.5	377.5	616.1	706.9
358	2490.4	593.3	565.5	540.3	1132.7	750.4	803.7	377.4	534.6
359	533.5	342	412	409.4	413.3	396.5	309.5	352.8	317.7
362	136.4	550	399.6	653.8	573.4	322.4	539.5	317.5	324.9
360	476.2	324.5	352.5	348.2	473.3	342.9	170.3	190.1	279.4
361	196.4	995.8	839.3	382.6	926.9	480.8	305.3	913.9	1123.4
363	642.7	392.9	410.2	742.3	447.2	504.9	457.6	397	490.3
1	57.5	694.1	410.9	413.8	950.3	946.6	351.2	317.7	346.4
2	854	3127.2	2912.3	675.3	4484	3866	950.5	2514.3	2438.1
7	6.6	584	1380.1	315.4	543	393.6	303.9	713.9	821.6
8	6606.3	941.2	1104.5	736.7	749.7	1740.5	1083.6	423.7	583.3
9	1852.9	10149.7	6856.2	2912.1	6808.7	1233.4	3010.6	3890.5	2225.4
10	213.9	56.5	66.8	70.8	121.8	102.5	426.1	58.3	149.9
11	463.3	163.4	131.5	187.4	350.7	210.3	129.1	340.2	336.3
13	286.2	180.9	111.8	233.1	197.5	335.1	173.8	70.7	108.3
14	1590.2	437.8	323.5	558.1	897.5	1161.3	642.8	105.9	170.6
15	9293.6	467.4	332.9	823.3	3718.3	204	959.7	506.8	670.5
16	180	1093.1	911.1	674.5	960.2	1600.8	467	1244.5	995.6
17	850.8	1221.7	2320.1	687.9	1614.9	1605.7	404.6	1911.4	2114
19	411.1	1415.6	184.1	723.5	1035.5	370.5	548.9	147	192.6
20	733.9	1.1	1.1	74.5	256.4	1.1	326.7	1.1	1.2
21	72.3	200.7	12.9	81.5	88.3	242.5	67	11.5	37.4
22	3094.8	9706.3	7329.5	3225.3	6075.3	6859.5	2406.5	6706.8	8884.7
23	4749.1	837.4	1.1	835.6	2674.6	364.3	1127.5	1.1	31.7
24	965.6	221	39.2	361.9	738.2	167.3	169.5	71.9	121.6
26	7416.9	7158.3	127.4	6838.8	8238	2252.3	5033.6	65.1	119.9
27	58.1	722.5	759	815.4	651.8	689.9	359.8	573	381.9
29	215.3	111.1	55.4	103.7	90.2	70.5	65.9	199.3	105.7
30	5508.4	259.4	11.7	410.1	853.5	143.9	596.3	20.7	45.8
31	141.5	311.1	66.8	198.7	183.8	290.6	464.1	50.5	108.6
33	20935.4	341.8	144.8	828.3	7608.5	425	359.1	89.7	315.9
34	82.5	4387.6	4002.6	2634.3	4784.6	4798	2420.6	3104.2	3558
35	289.7	142.4	32.9	436.5	220.8	143.9	838.9	24.4	27.4
36	760.5	205.8	124	156.6	338.1	167.8	148.6	42.9	140.8
37	339.4	237.6	117.2	340.6	200.9	294.7	332.7	183.3	276.3
38	15634.5	361.2	546.7	505.1	4617.1	382.4	256.9	914.7	676.5
40	622.8	479.8	437.7	682.8	423.9	523.7	477.9	481.4	742.7
41	217.2	359.7	234.4	221.2	757.4	528.7	139.2	226.1	164.4
42	219.8	238.2	203.5	163.5	270.5	212.1	176.6	169.7	210.4
43	234.7	301	366.1	430.4	277	390.7	298.8	366.6	431.1
44	1194.4	428.6	352.7	678.6	1038.4	590.6	502.4	312.5	412.6
45	93.2	348.4	537.2	498.2	362.4	526.8	286.3	593.7	721.8
46	353.4	362.7	228.1	486.3	390	348.8	264.3	223.9	308.2
47	1440	122.7	195.5	267.7	384.4	279.8	279.8	186	120.1
48	199.4	203.4	16.7	1371.4	795.6	261.9	2274.7	36.6	21
49	195.9	337.7	268	285.8	341.3	420.2	392.8	175.7	207.1
50	8413	277.9	72.9	481	1790.1	240.3	276.3	19.6	144.4
51	548.4	42	29	436.1	66.9	35.2	265.4	38.8	35.4
52	189.3	199.3	189.3	144.9	217.9	179.8	189.7	265.6	263.1
53	90.2	79.3	46.2	51	36.3	81.2	109.4	83.5	33.9
54	879.2	383	1133.4	796.7	378.8	853	508.4	1350.7	462.2
55	69.1	130.4	81.7	126.9	65.7	123.7	96.6	86.1	118.9
56	29.9	53.2	83.6	82.1	125.5	80.4	57	64.5	59.6
57	5589.3	468.9	208.8	519	338.3	2738.1	2814.6	95.3	120
58	25483	492.1	294.6	702.4	495.2	2804.2	3544.8	95.7	164.7
59	57.6	1695.3	1278.9	884.1	1841.6	2339.6	560.2	1800.2	2204
60	308	154.2	148.1	188	151.4	261	115.3	120.2	177.2
61	193.7	168.2	134.2	228	153.6	138.7	132.1	83.1	176.1
62	119.4	478.9	203.5	1627.2	1442.2	1810.1	903.6	75	2303.9
63	98.7	380.9	470	197.8	346.6	224.8	242.2	297.5	192
64	143.1	133.4	210.8	393.3	197.5	194.5	165.5	154.4	209.9
65	328.5	124	64.1	172.8	348.1	151.2	192.8	101.1	127.9
66	249.1	732	1332.3	450.2	923.7	721.7	524.1	1163.3	1056
67	293.1	31554.3	31050.5	34557.4	35093.9	33778.1	21708.9	33200.2	37492
68	63	2405	2694.9	2196.1	5092.2	382	1972.5	2314.2	2245.9
69	756.5	5955.8	7077.6	5234.2	6301.1	1133.5	5870	6218.4	8519.4
70	424.6	2064.6	2173.1	4141.4	1212.7	1829.6	2418	1388.8	1591.4
71	499.3	545.4	159.2	507.5	2187.3	258.8	298.2	106.5	73.5
72	431.6	355.2	472.7	512.9	768.2	712.7	665.7	1451.1	410
73	272.6	264.5	266.7	235	473.2	341	218	433.5	361.9
75	120.4	364.8	176	279	491.9	225.9	244.3	377.5	440.7
76	153.3	176.5	46	143.8	95.5	498	182.1	2	34.8
77	102.1	3322.2	3704.4	3549.3	7422.7	3279.7	2337.5	2786.8	6811
78	297.4	973.1	1410.8	487	1074.9	411.4	315	1025.7	834.1
79	126.7	120.4	132.9	181.3	166.4	87.6	155.4	114.9	113.9
80	153.8	328.9	160.6	571.7	267	307.1	430.9	345.1	451.1
81	179.7	181.8	101.5	996.9	161.1	619.2	1156.4	73	105.5
82	54.9	362.8	385.4	367	264.5	251.3	241.3	414.2	220
84	101.2	291.6	129.7	162.2	330.9	286.7	196.3	75.3	77.5
85	558.7	171.1	121.8	116.1	116.9	188.5	368.6	191	161.4
86	100.5	90.5	67.6	100.4	71.3	78.5	104.6	80.5	101.4
87	144.9	375.2	299.1	190	267	227.3	94.1	70.7	488.1
88	136.1	4022.9	4905.4	2121.4	4345.4	4155.7	1621.6	5239.4	7618.2
89	361.1	158.9	159.8	335	218.5	244.6	224.8	136.2	163
90	1105.6	113.4	92.7	212.6	301.1	131.7	229.6	81.7	75.7
91	41283.8	405.2	83.4	373.4	101.5	3129.9	2037.3	10.9	73.8
92	125.5	4171.4	3562.5	2666.8	2820.2	7133.6	1929	11013.3	6783.5
93	102.9	336.1	636.6	108.4	214.1	218.9	125.8	330.1	222.8
94	173.3	927	600.9	384.5	1060.6	985.2	285.3	819.3	759
95	43.6	796	225.2	699.2	229.7	1129	264.2	589.6	347.5
96	166.4	173.4	234	108.8	198.5	171.6	90.4	154.2	139.9
97	28.3	196.3	256.1	110.4	302.3	307.3	112.4	520.9	415.1
98	33	47.3	44.5	6.1	33.2	34.4	62.9	9.7	34
99	315.9	219.6	221.2	281.5	254.6	306.8	218.9	200	240.6
100	40.3	12275.1	7465.8	4158.8	5537.2	19961.1	1057.9	1835.4	28160.9
101	169.6	185	264.2	312.3	225.5	277.8	165.2	258.7	276.2
102	208.7	160.9	193	308.2	155.3	201.8	154.2	171.3	189.5
103	402	302.9	300.1	382.9	342.4	374.1	315.3	292.4	280.2
104	25.2	569	354.3	402.2	554.5	1086.3	407.5	469.3	840.9
105	46.4	550.9	418	437.1	724.9	1141	481.6	596	1001.3
106	15.2	622.8	398.8	419.8	577.5	1074.2	377.8	444.5	794.4
107	6337.1	255.7	210	448.7	353.8	639.6	315	91.3	155.9
108	167.9	316.2	436.9	315	429.5	269.2	221.7	417.3	467
109	64.8	1110.3	875.6	160.6	318.4	942.9	215.8	1481.1	53.8
110	1.1	1261.5	1589.1	263.4	923.8	4084.9	415	4417	6.3
111	33.1	1767.8	1964.9	1872.4	427.3	1690.7	1292.2	749.5	1008.9
112	1.3	407.2	104.1	401.9	271.4	454.9	209.1	219.9	30.2
113	139	51.3	189.9	275.6	197.3	169.2	225.7	104.1	185.9
114	268.1	679	853.3	378.5	772.9	883.3	311	353.1	443.1
115	357.8	569.5	376	383.7	574.8	380.6	337.8	221.5	323.5
116	291.2	223	163.2	334.1	242.5	288.6	199.1	177.2	195.2
117	289.8	5414.4	4654.4	1394.2	3310.6	2815.7	721.7	3557.6	5696.6
118	92	533.6	90.4	527.7	275.1	665.7	306.8	60.3	99.6
119	114.7	226.3	336.7	194.9	102.7	168.3	397.7	81.7	65
120	78.6	116.4	118.2	137	338.5	139	164.3	51.8	73.3
121	161.2	788.8	997.1	260.6	745.8	1450.3	199.5	403.7	483.3
122	90.3	263.5	89.9	186.6	106.4	226.4	124.7	51.1	205
123	172.4	136.9	175	193.8	162.9	133.6	111.5	92.3	143.1
124	182.9	130.4	129.2	229.5	137.2	159	182.4	106.9	127
125	771.9	885.8	846.9	1521.7	915.3	963.4	856.9	836.5	775.4
126	25.4	1583.4	1549.9	728	2100.4	1526.4	558.8	1490.2	1266
127	101.3	121.8	97.6	163.5	99.6	101.1	101.1	74.1	160.2
128	346	234	238.5	469	239.1	325	198.4	245.9	311.8
129	4494.1	248.8	234	274.6	301.2	383.9	270	72.7	148.1
130	117.9	100.2	138.4	121.9	98.9	104	97.7	33	120.6
131	95.6	67.8	71.9	133.7	83.3	81.3	92	127.2	160.1
132	232	188.4	200.5	251	174	266.8	171.5	186.5	257.7
133	31.9	91.9	61.8	130.6	56.7	175.5	98.6	96.9	108.1
134	68.7	109.8	181.9	126.1	162.2	149.1	117.5	169.9	162.7
135	342.4	599	423.7	336.6	593.1	454.2	196.2	246.7	390.2
138	376.2	149.8	97.5	172.2	167.1	141.1	170.9	102.7	126.1
139	109.4	107.8	120.5	114.4	131	110	134.2	47.6	78.6
140	50.4	4099.6	2561.4	1129.9	2225.8	4646.8	179.3	3587	3225.4
141	28.7	1684.3	2067.9	1954.8	1743.8	2519.7	838.9	2235.9	1940.3
144	530.5	489.8	450.9	680.6	482.9	521.4	406.9	3706.9	433.4
145	237.2	196.3	199.6	376.6	227.5	244	164	175.5	217.2
146	240	207.7	196.5	287	216.2	221.3	171.1	170.3	240.1
147	34.8	59.1	32.6	71.1	106.8	38	76.9	66.7	44.2
148	677.5	348.2	249.8	461.1	251.5	501.4	616.9	292.6	327.2
149	35.2	397.1	361.6	203.1	742.4	464.8	110.1	706.6	571
150	205.4	160.9	229.9	251	200.4	189.2	332.7	156.6	501.8
151	173.8	466.2	220	285.9	235.8	499.7	139.8	284.8	258.5
153	96.7	149.4	109.5	120	139.6	106.3	110.4	101.5	94.3
154	353.7	288.8	62.8	174.6	358.1	579.2	122.3	45.3	359.9
155	497.4	136.2	109.5	189.4	118.5	147.5	131.9	115.5	137.5
156	73	97.7	84.6	132.7	100.1	118.9	87	64.6	73
157	153	149.2	105	143.1	123.7	160.2	159	151.6	147.2
158	1.3	8.9	102.4	99.5	1.1	23.1	74.8	7.9	93.2
159	33	2887.3	3372.9	2710.7	3432.1	3979.2	1070.5	3809.9	4336.8
161	1.3	134.2	113.3	263.6	128.2	276.1	557.1	118.4	2.9
162	1735.6	170	24.1	264.5	702.3	122.3	365	31.1	85.1
164	94.6	209.1	2869.2	348.2	520.8	2102.6	33.2	1670.7	436.5
166	700.4	6433.5	9921.6	4090.9	7108.3	3609.5	3473.4	7815.7	5478.4
167	1.2	2320.4	1318	1994.5	3064.9	2291.7	729.2	3184.3	2565.5
168	190	593.2	775.5	598.1	769.2	610.1	414.8	1931.6	1123.8
169	512.2	4400.2	2669.8	2975.6	2812.9	6215.7	3878.6	1890.1	829.9
170	73.5	1014.4	2146.7	775.8	1454.9	1033.1	409.3	2535.1	867.2
171	5104.5	1332.2	272.6	2234.5	4145.4	565.7	3636.7	1.3	1.2
172	697.5	650.4	797.2	721.1	621.5	792.4	573.5	666.6	657
173	117	169.1	136.9	226.4	229	245.8	226.4	407.6	310.5
176	1.2	1.2	3906.6	275.7	74.8	809.2	3.4	2700.3	62.8
177	101	617.1	461.8	602.7	515.7	623.3	414	876.6	749.6
178	167.1	612.8	1577.1	197.3	112.9	554.5	318.8	310.2	64.7
179	153.4	58.6	90.9	90	66.8	93.5	114.4	42.3	93.2
180	501.7	70.9	72.4	141.5	208.3	85.6	126.3	91.4	102.8
181	624.8	12366.2	9356.2	8736.7	10384.9	9225.7	6284	9589	10736.6
182	416.7	513.2	472.4	300.9	658.9	537.7	246.8	533.1	527.2
183	2674.8	1193.3	1.1	989.7	2589.1	336.1	836.3	1.1	10.3
184	424.7	204.6	210.9	228.6	394.8	275.7	205.5	185.6	179.6
185	1535	1703.8	1133.3	2133.8	2209.6	911.3	1201.8	1162.9	1148.4
186	489.1	547.1	422.7	473	508.7	434.6	349.5	507.5	315
187	1394	260.6	57.1	168.9	226.7	84.5	424	34.5	60.7
188	257.6	162.3	197.5	380.9	488.7	103.9	313.1	102.5	160.7
189	66.4	86.3	121.9	244.8	239.7	78.6	190.3	75.4	112.2
190	78.1	83.5	429.5	280.5	102.5	357.6	91.9	97.6	84.8
191	5186	883.9	1804.8	892.9	1302.6	986.6	662.9	1537.4	1728.1
192	183.6	117.1	105.4	207.3	160.4	130.7	133.3	86.8	109.4
193	75.2	1034.1	1775.6	473	1246.2	728.5	400.4	2163.8	1704.8
194	35.4	141	109.3	203.6	162.4	216.6	81.4	282.5	166.3
195	166.4	286.5	375.7	319.3	152.4	274.8	209.4	184.4	172.6
196	3.1	6834.9	4672.9	5030.2	2309.2	6216.8	4103.7	6137.9	6356.5
197	99.9	104	74.8	123.9	144.8	74.6	78.7	42.6	76.1
198	64.1	63.1	53.4	170.6	81.1	107.7	53.7	58.8	105
199	831.8	240	58.3	107.9	91.4	602.1	232	56.8	73.6
200	526.8	384.3	120.9	388.4	798.8	293.1	355.9	148.2	153
201	8960.4	165	22.2	144.7	80.9	2818	2028.7	40.3	67.2
203	81.3	472.4	610.9	91.8	451.2	472.3	101.5	229.9	173.5
204	111.5	557.7	815	343.5	524.4	484.1	188.1	623.8	532.3
205	110.1	6177.9	4916.2	3074.2	4380.7	5662.9	2513.5	6031.4	4413.3
206	327.4	232	221.4	2279.4	1294.7	242.3	23853.3	182.8	201.2
207	140.6	1170.8	430.3	478	1596.2	1348.5	347.2	2523.2	2245.3
208	102.4	611.4	208	94.9	323	317.4	205.4	75	371.1
209	19.6	3466.7	4058.3	3621	1656.7	3787.3	1837.3	3395.9	2777.2
211	68.5	13748.3	30156	19158.6	20412.6	11472.5	5548.4	13311.6	18245.4
212	97.3	492.1	523.3	1191.7	274.3	490.1	563.4	430.6	523.7
213	118.2	98.7	138	131.3	79.4	72.3	107.5	56.1	87.5
215	74.5	1676.2	558.9	803.5	1642.3	2856.5	476.4	4663.2	3720.1
216	75.1	912.5	1082.4	602	874	1309.1	366.3	1248.6	1513.4
217	253.9	338.8	345.6	232.8	478.1	255.5	260.8	183.8	153.8
218	217.6	281.1	360.1	283.7	411.2	483.8	185.6	541.5	461.7
220	116.2	103.9	66.9	97.5	83.3	99.7	69.5	88.4	87.1
221	587	961.9	558.8	297.6	954.6	365.8	346.2	594	456.9
223	239.4	255	135.7	374.9	272.4	283.3	188.8	205.6	338.9
227	16526.9	687.5	402.1	801.2	8633.7	549.7	683	662.9	533.2
228	109.5	590.7	434.3	616.8	410.6	745.3	291.4	596.4	397.3
229	238.4	255.8	193.3	117.2	266.5	145.6	228.4	102.2	491.9
230	226.6	172.7	87.5	128.9	178.7	109	152.9	81.6	97.2
231	164.7	239.9	241	177.8	240.8	204.3	82.9	126.8	110.2
232	726.2	6011.4	69.4	4687.8	4109.5	1565.9	3685.2	55.1	121.4
233	1921.3	10660.6	3028	2711.7	7662.7	7862.6	1829	3283.3	5519.5
235	1985.5	721.4	238.4	931.8	2117.4	492.2	1437	77	96.1
236	111.5	389.5	124.3	281.9	194.3	199.7	268.5	87	132.1
237	678.2	2297.4	1864.1	1203	1986.1	1743	1173.9	1963.8	2872.9
238	100.7	1551.2	1160.8	572.2	1309.9	1228.5	451	1210.1	642.7
239	332.1	763.7	202	225.7	393.5	575.5	339	267.4	73.6
240	2452.6	853.2	251.5	167.9	951.3	599.5	378.3	208.9	113.2
241	3976.2	1815.3	487.3	320	1245.6	1299.5	844.5	423.8	113.2
242	22247.9	1204.2	676.7	2441.5	3900.1	2073.4	2060.1	1433.3	2211.8
243	500.8	602.3	147.7	417.4	460.7	206.9	420.7	210.1	264.1
244	408.8	194.7	250	139.3	215	163.3	362.3	191.9	185.1
246	346.4	311.5	153.6	129.5	426.7	193.8	297.6	237.1	115.3
247	228	128.5	128.2	180.1	149.8	122.1	119	95	82.6
248	84.9	198.9	142.5	115.1	171.7	266.5	76.9	113.4	199.3
249	1035.7	288.9	2257.9	857.3	1164	1466.9	537.1	513.5	696.2
251	264	88.8	78.2	123	232.6	138	74.6	121.3	124.6
253	108.7	314.2	326.6	251.4	350.9	226.2	192.2	227.9	226.6
254	141.8	397.1	285.7	91.7	668.4	932.2	144.2	644.2	128.5
255	158.7	631.9	1918.6	177.7	94.3	560.5	328.5	275.4	74
256	28050	525.2	120.3	424.5	151.7	1961.1	1539.7	156.2	137.1
257	114.5	99.8	83	100.6	201.5	126.4	86.7	157.4	157.6
258	158.6	49.9	1.2	230.7	87	162.9	312.2	9.5	188.6
259	1056.7	678.8	74.6	435	975.6	278.5	381.2	78.8	19.9
260	181.2	203.6	112.1	206.3	156.5	223.4	178.5	122.7	146.6
261	102.9	308.1	236.7	105	398.6	247.2	179	878.1	456.3
263	715.4	341.5	448.7	152.3	586.5	224.7	469.7	458.1	389
263	497.6	226.9	137.3	149.6	251	166.4	214.5	85.4	135.2
265	94.8	312.7	829.9	450.4	436.1	369.5	258.6	592.9	638.8
266	265.8	327	344.5	288.3	382.4	344.9	252.4	143.5	246
256	250.1	118.4	95.6	163.6	115.3	138.5	119.7	91.9	107.1
268	9.8	979.7	661.1	894.3	411.9	1696.9	366.1	409.7	1018.8
269	54	49.9	40.5	67.3	34.6	39.1	37.9	27	41.9
270	250	173.8	181.8	187.3	170	224.5	142.3	228.7	279.3
271	480.9	213.9	276.2	361	316	273.2	153.9	288.4	298
272	848.6	504.7	506.3	704.7	547.1	495.8	552.5	478.3	596.9
273	1.2	2102.3	4434.2	854.4	4432	2983.7	1404	2522.8	2416.9
274	1684.7	1062	218.2	668.5	812.7	391.8	925.2	159.9	290.7
275	287.7	447.3	282.7	622.1	481	245.2	328.9	276.9	234.7
276	24704.9	1039.3	565	1641.6	11368.8	805.3	1068.9	882.8	583
277	242	197.4	155.1	247.2	180.4	234.4	184.7	192.8	192.5
278	1231.4	973	145.3	901.4	1474.2	594.6	925.8	126	131.6
279	17.3	2232.4	2050.1	1268	1303.2	2923.4	900.4	2377.3	1977.2
280	59.4	2645.5	2730.2	1625.9	2545.4	3355.1	1233.4	2801.5	3378.5
281	11.1	384.8	65	38.7	71.4	100.9	103.7	14.1	17.9
282	608.4	296.3	256.6	463.7	205.6	325.1	415.2	194.5	210.3
283	332.9	264.5	234.2	544.1	264.3	374.3	400.4	291.5	271.4
284	78.3	67.8	69.4	78.9	68	92	71.1	59.9	88.3
285	128.1	76.9	110.6	115.5	106.6	107.8	83.1	89.2	95.8
286	136.9	882.8	1547.8	797.2	698	1112.3	458.4	673.7	251.9
287	133.4	121.2	112.9	117.4	91.9	158.2	87	70.4	94.5
288	171.7	149.6	158.2	178.1	157.8	201	117	123.4	124.4
289	2065.2	477.9	207.9	783.6	1036.1	420.3	2425.5	18.4	1.3
291	133.5	64.4	97.5	72.7	132.7	73.5	87.3	58.9	49.4
292	584.5	63.2	25	154.1	1191.9	660.3	757.5	27.5	40.9
293	85.6	186.6	107	288.9	87.8	189	235.3	128.1	55.8
295	99.7	791.3	242.3	325.4	327.2	175.4	230.6	133.1	144.9
296	676.2	918.1	709.4	934.2	1877.1	1141.7	589.6	753.4	857.2
297	208.1	61.9	45	125.1	78.1	67	128.8	33.5	56.2
298	486.9	293.3	320.6	257.4	410.5	356.9	211.9	196.2	400.4
299	238.1	923.6	448.9	1006.6	1054.5	910	660.9	696.1	686.7
300	215.4	203.8	395.4	255.6	312.3	188.4	202.2	244.5	347.9
301	212.9	290	820.4	372.3	708.3	367.5	860.1	1368.3	1185.7
302	29.5	25.8	10.5	19	34.5	45.7	38.4	9	11.2
303	244.8	782.2	902.3	349.1	907.8	713.9	323.7	823.8	976.6
304	1861.6	166.7	207.3	308.3	367.6	378.4	394.1	160.5	243.8
305	175.3	159.5	1205.8	156.7	144.6	223.3	176.9	191.7	180
306	257.6	154.3	146.1	240.3	149	206.8	136.3	126	182.9
307	140.9	142.6	126.5	207	130.3	179.3	122.6	127.1	144.6
308	51.2	1843.1	1030.9	1212.9	1456.7	2208.3	994.9	1319.8	3640.6
310	56.1	389.3	310.4	316.3	466.8	385.1	278.8	726.7	401.6
311	95.8	109.3	154.9	90	107.1	120.1	96.3	40.5	202.1
312	1.1	193.8	599	390.5	611.6	728.7	365.5	1657.6	289.8
313	114.1	119.7	208.9	142.2	124.9	120.7	102.2	171.4	137.5
314	228.4	414.8	146.7	189.2	419.3	985	268.1	164.1	805.7
315	106.4	758.2	540.2	634.9	351.4	466.9	317.2	369.3	322.4
316	87.3	363.4	151	353	425.1	312.8	284.4	214.7	159.2
317	349.5	178.8	142.4	246	187.7	213.8	173.4	172.5	170.8
318	41	165	47.1	88.3	62.8	174.6	58.9	29.9	36.8
319	434.9	249.1	85.8	420.7	189.3	189.1	249.8	96.7	149.6
320	107.4	586.7	418.3	403.8	488.4	523.9	404.2	689.4	494.1
321	543.8	319.1	469.7	514.1	488.3	438.7	255	599.8	413.8
322	143.6	271.4	269.5	298.2	237	237.4	211.8	133.2	239
323	70.7	3285.6	3624.3	1105.3	4318.5	2487.4	569	2285.5	3132.6
324	83.1	109.6	285.4	143.7	116.7	132.5	85.8	120.8	77.4
325	110.9	251.9	316.5	290	236.5	383.2	230.7	313.5	303.7
326	135.5	3242.5	8125.6	4127.5	5469.6	4502.9	1608.5	3693.9	2895.8
327	58.5	45	1.2	25	59.9	35	17.5	37.7	1.1
328	65.8	655.8	464.1	320.5	288.4	542.9	197.8	325.2	508.2
329	80	64.2	69	112.3	56	94.8	79.6	45.7	59.5
330	40.5	80.1	60.7	58	25.8	201.8	52.3	15.2	35
331	432.9	313.6	325.8	596	282.5	296.4	296.4	323.7	289.3
333	130.6	705.5	966.7	555.7	561.6	839.7	421.8	765.6	867.7
334	249.3	142.3	160.4	202.9	176.2	182.3	124.3	206.3	169.1
335	82.5	80.4	83	109.4	123.6	101.9	119.4	73.9	145.7
336	190.4	460	647.9	449.1	599.6	811.8	357.9	794.4	514
337	325.2	155.4	169.1	87.4	565.9	331.4	139.4	121	218.6
338	456.9	208.6	167.7	232	253.9	347.6	196.9	230.3	166.2
339	286.9	555.1	405.8	559	379.8	628.6	310.9	351.5	538.6
340	512.3	229.9	206.7	351.4	259.7	284.5	241.8	186.5	258.4
341	149.5	767.9	579.4	500.3	838.9	598.2	472.1	804.7	865.1
343	152.9	40.5	579	1479.8	52.4	120.2	411.9	326.7	85
344	233.7	1144.2	879.2	1306.4	1034.5	1267	1054.1	1516.9	1049.3
345	371.6	243.5	219	304.9	271.1	232.5	238.5	219.9	295.3
347	98.2	3633.1	2744.6	2838.4	3198.4	4569.8	1600.1	1448.8	3315.8
348	78.5	6124.8	6613.5	4006.5	4485.3	7289.4	3180.7	2561.5	5272.3
349	582.7	260	240.8	164.6	205.7	203.8	225.1	195.3	203.1
350	355.9	281.6	330.4	285.5	454.2	255	105.2	161.7	183.4
351	732.9	348.3	47.4	261.9	443.7	347.8	457.3	73.6	169.9
352	162.3	297	339.9	197.7	488.4	390.6	178.5	201.7	300.5
353	186.4	405.1	211.5	354.7	282.6	265.3	148.4	203	378.9
3b
SEQ ID NO:	820TT	821TT	822TT	823TT	824TT	825TT	827TT	828TT	829TT
354	101.8	32.1	469	263.8	1085.8	22	126.1	35	1609.8
355	50.1	45.1	504.2	78.3	2521.5	71	173	79.8	1017.3
356	697.4	939.2	1065.9	788.9	148.7	218.1	645.8	867.3	539.6
357	470.4	512.9	724.1	516.5	395.9	181	909.4	596	552.3
358	572.8	424.1	483.2	901.7	829.4	659.8	1454.2	582.7	1006.9
359	347.5	382.6	400.4	351.2	192.3	373.5	325.1	300.2	434.7
362	518.5	320.1	492.7	704.3	136.5	151.1	355.4	543.3	388.6
360	319.8	228.6	329.3	403.7	774.2	179.6	366.3	240.3	358.5
361	480.9	1229.9	857.7	620.4	288.1	256	1180.4	566.6	668.1
363	418.7	427.1	382.7	545	359	1019.2	338.9	487.8	695
1	693.8	684	807.9	656.3	335.6	360.3	549.1	242.6	662.7
2	1188.2	4262.8	2973.5	2345.3	485.6	836.8	2548.2	5155	2907.2
7	285	570.3	706.5	933.7	231.3	398	465.3	243.7	598.5
8	772	941.1	585.4	1410	767.6	899.7	976.4	715.3	1364.2
9	6790.1	6640.5	7386.3	3225.8	5435.7	126.3	4807.5	1611.9	3114.7
10	127.8	73.6	88.9	165.8	1940.4	149.4	211.5	105.7	161.7
11	219.2	282.4	325.1	111.4	558	78.5	557.8	260.1	213.2
13	97.3	102.3	156.9	158.8	964.8	160.6	157.6	106.2	231.8
14	280.4	281.5	511.4	335.9	1351.5	111.1	708.2	213	543.4
15	407.6	174.9	613.5	2405.8	5398.8	42.5	1013.9	261.5	818.7
16	996	867.4	1065.2	1313.3	639.8	600.3	893.2	655.3	1176.4
17	905	1286.8	1004.5	1341.4	3130.7	458.2	571.6	1357.1	567.7
19	176.2	160.5	2137	215.5	362.5	258.3	1756.9	171.6	407.1
20	2.8	1.1	5.6	55.2	3077.9	1.1	341.3	1.2	120.3
21	198.4	8.3	87.4	53.3	32.8	37.4	1005.1	37.9	87.5
22	6631.1	1931.6	3566.8	5632	5189.5	1534.9	4150.7	7366.1	5102.6
23	182.8	21.2	532.3	340.7	1711.8	1.1	1721.4	40.1	764.8
24	77.8	33.2	358.6	267.6	422.3	74.6	370.7	37.1	206.7
26	295.9	149.3	5582.1	822	2610.5	73.9	6672.8	337.8	2827.2
27	919.8	264.6	443.1	611.7	683.8	209.2	1842.7	221	356.4
29	70.7	70.7	74.8	144.2	604.4	984.4	261	138.9	191.1
30	121.9	25.4	650.1	375.7	4468.9	46.5	561.6	45.4	242.8
31	5697.5	123.5	224.1	147.9	1115.1	83.1	610.3	182	319.6
33	468.4	153	716.1	13385.7	6334.6	140.7	1847	224.8	1175.1
34	1720.2	2051.3	3037.5	1584.2	336.1	3724.7	2119	5586.2	2611
35	244.1	41.7	84.2	62.7	824.1	52.2	178.2	17.4	1328.5
36	119.6	118	169.3	230.6	1819.9	929.8	683	492.9	214.8
37	155.7	184.2	228.5	240.8	319.5	467.7	184.9	199.9	387.7
38	585.2	232.7	573.6	6068.7	4340.6	74.3	1214.6	360.9	671.8
40	591.8	535.9	446.1	487.3	508.4	640.3	459	382.6	707.6
41	125.3	451.1	286.6	226.1	178.8	297.4	551.6	110.9	268.1
42	208.6	409.7	329.7	258.1	211.2	288.8	404.4	466.9	264.3
43	1026.6	218.9	326.6	574.3	230.1	671.1	309	239.3	385
44	615.3	369.3	535.2	505	392.7	412.7	711.3	532.7	637
45	520.7	482.1	383.7	299.9	78.6	389.4	649.9	316.5	478.7
46	320.2	300.6	305.2	401.7	263.7	512.6	527.8	382.7	432.7
47	139.1	150.5	229.5	149.7	531.9	197.1	197.3	127	210.4
48	1.3	21.1	476.7	92.9	168.2	12.9	551.2	39.1	389.5
49	166.1	218.5	298.7	280.5	457.8	255.1	900.8	192.7	389.9
50	347.9	99.6	314.6	484.2	1930.4	50	732	80.5	471.8
51	242.8	1.5	41.1	67.7	580.8	328.7	355.4	25.4	109.3
52	192.8	248.6	243.7	205.8	370.9	381.6	276.2	205.6	177.2
53	96.2	87.9	70.9	47.3	43.3	73.7	337.6	95.3	151.9
54	407.4	1349.6	375.9	248.1	781	299.7	1508.8	490.7	389.2
55	121.8	106.2	97.6	87.5	86	144.3	103.2	108.1	117.5
56	45.3	148.5	66.5	67	89.3	49.7	49.3	42.5	86.4
57	676	281.8	885.5	948.4	804.4	353.9	504.6	82.9	3332.6
58	778.6	312.3	1214.5	1060.8	1872	293.1	691.4	84.7	3886.7
59	1030.8	2434.1	2195.8	1055.8	320	324.2	1155.1	1409.3	875.3
60	135.3	164.3	164.2	188.6	621.3	165.8	256	106.3	154.4
61	162.8	141.6	158.3	159.3	275.5	228.7	281.2	168.6	177.2
62	4949.9	24.3	607	1227.9	429.7	1067.9	763.2	300.6	2120.4
63	484.5	316.4	328.9	307.7	341.1	48.2	473.5	163.4	154.3
64	204.6	186.8	246.6	401.8	70.3	580.2	1442.7	100.3	242.1
65	65.5	179.7	174.9	187.7	722.1	50	248.4	72.4	115.2
66	773.7	1116.3	780.2	512.2	301	358.5	869.5	898.9	607.4
67	28999.8	29358.2	32402.2	37818.6	3337.4	25748.4	22954.2	36641	37486.1
68	416.7	3006.9	3943.7	3062.4	153	2880.9	1180.9	1284.8	2957.1
69	1079.4	7132.7	8048.4	4826.8	649.2	8495.4	5023.1	8078.4	7915.3
70	6077.8	1872.9	984	682.7	249.3	3261.4	4520.3	1401.4	911.7
71	132.3	112.4	422.9	210.1	2216.8	82.9	814.1	97.5	287.6
72	490.8	1451.8	1261.7	235.1	471.1	74.1	306.4	974.8	1198.6
73	348.5	369.6	410.2	281.9	216.9	255.6	357.1	221.4	359.5
75	419.5	82.9	224.3	363.6	248.7	233.6	379.3	555	287.7
76	11.9	119.6	100.8	434.7	2481.2	1185	1252.2	685.6	485.4
77	4580.1	3450.4	5301.7	6090.7	261.8	3157.9	2146	4545.6	3500.3
78	1117.1	545.1	716.9	909.9	254.8	255.9	868	1420.7	711.9
79	530	164.2	183.5	180.9	240.5	155.8	185.8	142.8	115.9
80	603.5	1468.6	828.2	186.8	153.5	1495.3	273.8	761.5	324.2
81	1295.1	100.2	158.7	133.6	628.6	130	314.3	106.5	383.7
82	337	330.3	245.9	228.3	61.7	460.2	141	303.9	207.5
84	106.4	568.8	287.1	105.9	114.1	486.2	497.7	114.6	176.9
85	172.3	125.3	120	175.2	169	193.1	218.4	131.9	194
86	87	87.2	53.6	86.3	89.1	131.6	85	639.6	137
87	214.5	168.9	252.9	285.8	1403.4	202.4	230.4	184.8	289.6
88	1660.9	2332	6323.6	5821	275.2	1272.1	4080.3	7866.9	5791.5
89	206	177.6	198	327.1	1314.5	479.1	253.4	182.8	368.1
90	115.4	102.5	134.4	235.2	2070.3	140.2	141	111.9	226.2
91	502.7	105.1	1042	284.8	1947.8	244.5	511.1	18.4	4872
92	6425	5848	4350.4	2893.7	766.3	1143	8256.4	4985.1	2390.7
93	205.6	230.3	307.5	325	218.5	186.3	253.4	252	154.8
94	357.1	1091.1	1411.5	311.1	158.3	46.1	509.8	632.4	557.7
95	241.3	283.6	505	576.3	62.8	172.8	115.5	216.1	532
96	280.5	181.9	147	142.4	142.7	170.7	216.5	116.6	156.5
97	466.6	344	322	221.4	70.5	218.7	225.5	294.9	178.2
98	23.3	32.5	29.3	22.1	31.8	317.2	35.8	22	26.8
99	200.6	212.8	216.1	258.2	243.6	366.3	323	184.2	327.9
100	1421.1	302.2	3029.1	5780.9	673.2	1623.5	2932.3	3304.8	11319.8
101	272	218	267.6	467.2	55.2	386.1	265.8	234.8	421.9
102	152.6	160.8	134.1	185.4	141.5	525.5	8297.9	131.6	193.5
103	330.3	366.8	262.3	438.6	370.5	687.6	328.6	308.6	379.9
104	678.2	302.2	864.8	623.8	62.2	907.1	333.9	1068.4	672.3
105	495.9	329.5	905.2	487.5	77.9	996.4	425	1136.1	616.5
106	612.3	277.5	775	557.3	34.6	814.9	280	957.1	583.4
107	308.9	188.7	250.9	591.6	1517.4	241.8	305	161.8	1102.6
108	388.5	475.8	557.1	574.6	533.2	365.7	509.2	634	321.6
109	47.9	211.4	334.1	275.6	373.3	113.2	1573	359.4	1203.1
110	1.1	367.7	820.1	614	750.8	2.3	2128.4	450.7	2481.1
111	105.4	111.5	1115.1	1085.4	31.9	1134.1	919.7	2507.5	1720.3
112	62.4	132.4	118.7	104.6	124.9	88.9	1090.7	12.5	512.4
113	149.1	66.5	145.6	225.3	1395.8	112.7	316.5	230.1	145.4
114	929.6	594	672	804.4	155.5	238.7	339.5	618.6	378.6
115	473.6	276.3	355.8	431	779.1	286.2	826.4	464.8	562.1
116	228.8	183.6	205.8	214.2	113.4	286	233.8	157.3	281.6
117	1259.3	645.9	2714.7	1854.7	284.3	889.6	776.5	5906.8	1981.4
118	165	99.4	148.2	154	104.5	952.7	926.2	63.2	218.8
119	74.1	55.5	95.2	192.8	129.2	122.6	138.9	69	252.5
120	154.7	88.6	159.7	229.3	533	78.8	126.8	101.7	185.5
121	470.8	523.4	1077.7	284.1	270.2	79.9	1935.6	440.9	773.2
122	139.1	32	51.8	203.5	559	116.7	160.9	98.4	167.8
123	127.6	127.8	146.6	223	86.8	290.5	147	161	152.7
124	323.6	121.6	123	147.7	138.1	317.3	2203.4	125.6	200.2
125	909.9	886.8	770.6	1100	653.6	1873.2	823.8	980.3	1308.7
126	865.4	1870.3	1455.2	950.6	132.1	353.6	443.8	1299.3	756.7
127	146.8	89.1	116.4	108.3	102.8	176.3	89.7	112.1	164.4
128	199.2	243.1	243.5	292.8	184.9	435.5	169371.4	255.3	380.5
129	201	129.2	160.1	346.8	964	143.6	229.7	180.9	349.9
130	436.5	199.9	143.8	114.3	61.5	134.4	300.8	73.2	120.4
131	133.9	92.3	74.4	88.5	83.4	229.7	410.5	60.2	101.7
132	170.5	183.6	217.5	279	177.9	291.2	172.6	176.3	285.9
133	76.5	158.5	71.8	115.2	44.6	280.4	133.9	76.6	58.9
134	177.7	117.6	92.6	87.1	47.4	135.3	194.3	131.1	125.4
135	668.9	332.2	491.2	604	177.1	258	426.2	374.2	376.3
138	89.5	107.6	139.2	104.1	252.7	204.2	408.1	146.3	173.8
139	94.5	61.7	100.1	154	66.7	109.2	217.6	69.7	69.7
140	488.1	5040.7	5478	884.2	19.9	864.2	414.1	2686.3	2320.6
141	1820.2	2069.9	1896.4	1208	195.6	666	1637.7	1312.8	1389.1
144	389.9	2941	519.1	509.5	290.3	566.4	3501.1	2333.5	594.6
145	176.7	233.5	205.8	273.5	163.7	364.5	169	239.5	307.6
146	180.4	184.7	182	241.3	165.7	371.9	208.9	218.9	287.1
147	60.6	67.5	36.5	35.9	45	33	48.8	39.7	84.2
148	218	311.7	680.6	305.9	613.6	301.8	333.6	170.7	855.4
149	389.2	615.3	612.9	411.2	46.9	38.6	377.1	483.8	290.4
150	292.4	123.3	170.9	249.3	169.9	382.6	1326	246.2	272.1
151	172.2	109.5	207.1	176.5	173	197.7	201.3	53.4	217.8
153	100.2	143.8	139	113.1	97.6	119	115.6	97.7	102.5
154	965.5	130.7	240.3	422.3	239.6	103.1	344.9	332	536.6
155	150.4	145.1	158.1	122	114.6	231.1	116.7	136.3	190.3
156	72.3	57.3	76.9	97.8	60.5	106.5	85.4	49.1	91.7
157	92.1	101.4	129.5	97.6	197.6	183.4	266.9	102.3	169
158	105.7	18.1	95.3	31	1.1	1.5	124	10.3	17.7
159	3118.9	2438.5	2254	4357.3	169.7	2658.7	1376.2	3763.9	2939.4
161	5.6	102	74.9	43.7	13.3	206.3	5.9	19.5	43
162	86.4	52.8	243.7	212.1	2021.6	52.6	430	59.9	191.7
164	75.9	635.3	125.4	46.6	62.7	90.5	4939.7	520.4	106.5
166	8478.4	8844.4	7517.8	9251.3	668.6	5048	2532	11114.9	5155.6
167	944.4	2088.2	2168.9	3078.3	35.4	2685.3	569.9	438.5	2149.5
168	981.2	741.9	536.9	381.5	101.8	263.9	1589.1	1090	1157.8
169	998.2	828.4	1558.6	3346.8	4596.6	373.2	2769.4	732.9	18910.1
170	1690.4	2036.1	1458.2	1172.6	1929.3	472.1	1536.6	1074.1	748.2
171	35.6	1.2	1357.1	179.9	2986.6	1.2	1399.7	39.7	3790.7
172	660.5	696.5	574.5	822	549.6	679.2	517.6	539	873.1
173	172.3	120.5	182.9	172.3	441.6	91	875.5	186.4	445.7
176	1.1	32.1	22.8	1.1	1.1	269.9	3233.2	1.1	160.9
177	675.5	641.9	541.6	1175.8	196.5	1163.3	437.1	345.5	599.4
178	144.2	121.8	72.4	360.4	1481.8	1025	2178.6	88.7	313.7
179	52.1	87.1	93.5	143.3	81.8	124.1	75.4	43.4	153.8
180	95.7	66.1	137.1	160.5	253.7	190.5	496.2	69.1	199.3
181	8377.6	9185.5	10162.2	11258.5	1081.7	11429.6	5621.9	12118.4	10006.8
182	458.5	488.6	593.1	336.2	742.2	148.2	383.4	287.6	393.9
183	41.7	8.1	711.7	110.5	624.4	1.2	1507	41.7	551.1
184	241.8	165.4	281.2	458.9	346.3	189.5	244.1	175.4	339.3
185	1648.2	527.4	1463	1633.2	3854.7	591.4	1805.1	1354.3	962
186	852.3	370.9	554.5	405.8	293.7	714.5	452.3	164.8	319.5
187	81.4	76.3	149.6	122.4	192.9	83.5	4783	75.8	136.5
188	325.5	64.9	281	153.1	548.5	72.7	239.9	148.5	260.2
189	179.1	36.6	199.4	99.5	226.7	74.1	111.4	100	151.7
190	65.2	56.7	57.5	206	147	170.8	473.9	107.2	158.5
191	1282.4	180.6	706.5	991.9	1859.6	193.4	671.8	1181.2	884.9
192	133.1	59.7	97.6	101	117.7	186.9	1346.8	80.1	111.3
193	2817	1551	1158.4	1627.3	211	677.6	728.5	2190.6	745.3
194	224.1	133.7	191.1	211.3	94.6	57.1	198.5	79.7	112.4
195	210.1	378.3	415.7	457.7	91.8	391.3	167.4	250.9	161.2
196	2059.1	6068.9	8250.3	6100.2	260.4	9272.9	4421.5	2709.1	7446.4
197	116.3	74.9	72.5	69.9	1094.7	92.5	126.6	97.4	137.7
198	69.1	54.5	79.3	90.4	64.8	142.2	658.4	74.2	125.9
199	73.1	63	674.4	113.7	3555.6	87.8	295.6	125.9	1666.8
200	152.4	193.6	440	136.7	1166.9	233.9	450.3	193.7	343.6
201	101.2	31	560.4	302.8	1214.5	17.7	90	30.4	1612.8
203	703.7	907.4	1270.8	514	92.1	126.9	1145.2	1552.7	207.6
204	1285.1	377.7	403	705.2	88.6	338.5	595.2	922.9	476.3
205	2463.4	3054.5	3730.8	4980.4	361.5	572.3	3463.4	6141.2	3833.2
206	187.4	167.3	168.6	267.3	1097.9	453.7	228.3	296.2	3177.1
207	288.4	3037.3	2123.7	206.1	61.4	218.8	485.6	2438.3	1258.7
208	190.3	97.4	336.5	323	109.9	9.2	306.2	227.8	548.3
209	3259.2	3551.6	5575.6	2237.4	150.6	4727.5	1832.2	732.2	3005.4
211	8683.6	22986.2	20317.7	33405.4	565	7384.7	9662.3	29932.5	20413.1
212	1572	515.7	339.7	208.5	80.1	1016.3	1086.1	339.2	299.9
213	94.5	90	92.1	102.5	61.4	224.9	80.9	66.5	121.6
215	366.7	5578.5	4327	285.6	78.2	266	478.1	3071.2	1903.3
216	633.5	670	697.1	660.4	547	267.5	566.7	785.5	412.5
217	235.7	147.3	281.6	384	479.9	98.7	277.7	221.7	271.5
218	191.6	481.1	295.1	384	112.2	335.8	274	687.3	319.7
220	74	79.4	131.9	86.9	109.2	139.9	74.3	78.7	98.2
221	739.7	775	1236	738.2	1516.5	159.5	796.8	459.3	439.4
223	226.1	262.3	230.6	220.4	235.4	419.6	210.6	191.4	360.2
227	784.7	236.7	712.8	3864	4971.9	50.2	2112.1	483.2	1731
228	427.4	369.6	410.7	756.3	119	453	308.8	321.2	777.9
229	121.4	178.2	180.7	386.6	270.9	497.6	489	353.6	172.9
230	85	63.3	105.6	210.3	1243.7	40.9	331.4	106.7	325.5
231	337.9	417.5	650	305	129.2	163.1	486.4	499	193.8
232	213	116.6	3960.5	604.6	1673.4	54.4	4508.4	185.8	2113.5
233	2564	1822.6	6196.9	2781.4	3667.3	1118.9	3084	6379.7	4116.8
235	137.6	63.4	580.8	361.2	1679.5	92.8	833	86.2	2441.7
236	160.2	120	182.2	264.3	417.6	254.8	288.4	125.5	310.6
237	2392.5	1737.2	1778.8	1851.2	3102.3	638.8	2558.1	2048.7	1204.1
238	934.8	1575.1	1087.9	1078.8	215.5	179.1	1369.6	2083.3	807.8
239	256.3	59.9	259.2	442	208.4	101.6	275.9	58.6	485
240	316.9	27.3	330.2	381.2	683	52.8	381.6	41.4	575.1
241	602.7	36.7	562.8	985.9	886.1	83.4	734.2	126.7	1214
242	2714.7	325	2278	12129	22000.8	874.8	2544.9	845.1	6760
243	477.1	168.4	373	453.4	7356.1	182.8	441.2	223	259.3
244	137.2	198.3	172.5	137.8	308.4	111.1	215.7	213.9	147.9
246	262	306.4	301.9	426.2	407.7	346.6	609.8	874.2	145.9
247	117.5	142.6	77	156.9	119.1	289.1	120.2	120.9	213.4
248	216.4	124.1	74.2	115.8	92.4	107.5	317.2	126.7	106.4
249	180	341.2	320.1	176.7	185.5	885.1	399.6	131.7	791.8
251	63.8	107.9	106.3	84.5	742.7	44.5	117.5	94.5	111.7
253	190.7	244.8	204.4	375.3	374.5	218.4	376.5	486.5	269.6
254	145.4	1957.1	1159.5	243.2	123.7	228.2	1365	142.3	312.9
255	170.9	82.9	51.9	379.1	1787.5	1107.5	2481.4	91.2	318.4
256	517.8	132.4	995.4	353.1	1340.6	331.8	499.8	141.8	3605.8
257	124.3	174.8	165.9	97.2	172.3	54	209.3	115.4	173.8
258	24	1.2	253.4	53.4	345.6	104.4	131.7	3.9	456.5
259	692.2	65.2	512.5	236.2	422.2	1.2	669.1	79.7	638.4
260	153.5	168.4	123.3	295.4	151.6	561.5	224.9	163.9	266.2
261	197.8	221.1	313.1	301.5	77.8	119.5	496.8	1094.7	301.6
263	698.9	553.8	407.2	370.6	1231.9	141.3	387.3	692.4	333.4
263	135.5	78.4	109.7	225.9	1211	201.2	434.5	96.2	404.4
265	362.9	618.8	519.4	342.3	102	258.8	178.2	477.2	588.4
266	246.8	201.9	307.4	607.3	257.6	820.3	300.7	537.1	367
256	115.8	100.6	138.3	134.8	325.1	134.2	161.2	75.9	165.2
268	209.2	366.9	653.7	922.5	10	480.6	333.1	299.5	775.9
269	40.7	48.5	42.3	72.2	126	90.5	30	60.5	91.4
270	466.8	148.2	169.3	215.5	180.7	290.2	237	153.1	262.6
271	340.4	250.6	292	363.1	191.9	147.4	231.1	338.8	278.4
272	419.7	600.7	550.3	549.6	590.7	925.3	506	506.9	675.1
273	1329.6	4064.8	5723.5	4200.8	53.9	141.9	2361.5	2682.8	4782.9
274	572.9	159.6	459.6	777.2	2112.5	590	1292.6	264.9	670.4
275	400.8	151.3	339.1	398	1769	221.5	415.8	329.2	264.8
276	1260.7	304	1311.2	5788.9	9405.7	142.2	3231.8	599.6	2504.9
277	175.4	164.3	192.2	231.9	150.5	254.7	152.2	197.2	281.6
278	1103	87.3	544.7	209.6	729.1	38.2	801.4	62.2	875.4
279	1853	3010.3	1676.6	3236.4	131.7	425.7	2072.3	2745.7	1987
280	2108.7	4444.5	2655.3	3526	338.9	391.3	2886.5	4540.8	2685.8
281	18.4	25	53.6	118.3	67.5	103.2	129.1	36	49.1
282	208.4	189.9	229.3	225.9	218	274.6	281.5	269.8	574.2
283	226.2	239	236.5	269.1	179.9	647.8	210.9	202.5	338.1
284	76.5	83	85.5	84.8	61.1	154.1	83.4	51.9	87.9
285	83.4	81.8	98.2	109.9	70.2	153.3	87	104.4	126.6
286	2043.9	638.5	1891.2	121.4	602.8	343.8	417.5	688.5	824.4
287	102.2	122.8	119.2	106.4	113.9	133.5	95.5	144.2	149.6
288	142	147.4	138.8	152.9	154.3	269	139.9	140.5	203.7
289	673.8	1.2	569.8	199.4	1260.8	269.4	831.4	65.9	2672.1
291	209.6	44	112.8	181.3	341.7	44	78.9	99.5	126.6
292	62.9	40.3	181.8	49.2	103.4	47.8	786.4	36.9	412.2
293	489.3	121.1	95.1	72.6	52.1	99.7	409.7	50.8	113
295	527.5	128.5	168	466.6	768.9	354.3	354.7	222.9	256.1
296	773.6	924.1	1329.9	843.8	1063	956.8	1070.2	873.2	688.9
297	52	51.9	85.2	60.1	2284.1	95.4	70.8	52.2	96.9
298	295.2	198.2	300.3	295.1	502.3	161.6	292.8	372.6	290
299	1170.6	1365.1	561.9	926.9	160.3	431.4	1139.9	604	851.1
300	79.1	638.7	458	158.4	272.1	104.6	617.9	383.6	205.3
301	1366.1	435.2	1418.5	798.3	317.5	423.3	664.2	750.6	2119.8
302	14.8	21.6	21.1	13.6	121.5	39.5	24.7	9.5	34.9
303	1272.6	1149.6	761.8	834.5	159.9	477.7	449.7	1072.6	432.1
304	1151.3	128.6	230.5	335.2	454.3	186.6	1221.7	235	379.7
305	151.1	238.9	140.3	950.2	110.9	1077	1043.9	166.7	211.5
306	136.4	144.5	117.6	155.2	192.6	291.2	118.6	150.5	228.4
307	132.8	177.7	207.1	196.3	120	249.1	112.4	122.8	281.5
308	2569.4	1758.7	2241.2	2859.3	230.6	2770.2	677.2	2894.9	1090.1
310	980	334	456.4	390	114.5	278.1	997.8	654.8	472.6
311	142.6	73.1	84.3	121.4	78.4	146.9	148.3	200.6	115.7
312	2560.4	57.2	426.8	89.2	18.4	574.8	506.6	402.8	956.5
313	209.5	119.1	121.2	222.7	91.7	201.4	478.6	92.9	117.2
314	158.8	162.7	249.8	188.5	309.4	89.2	547.1	122.9	576.3
315	702.8	557.9	900	546.6	104	247.6	529.5	657.3	404.1
316	250.6	332.6	259.8	311.9	69.6	518.6	460.2	314.7	248.1
317	150.5	169.2	177	177.5	133.8	233	171.7	173.6	261.6
318	40.7	117.2	213.8	44.5	47.3	18.6	57.8	59.8	9.1
319	309.7	173	162.4	217	97.8	1038.4	828.1	117.5	167.2
320	822.5	511	664.1	815.9	185	371.3	845	592.1	437.2
321	629.1	258.6	321.1	511.8	309.4	452.1	355	573.3	321.3
322	195.9	274	200.6	228.2	502.2	565.2	318	241	250.5
323	5483.1	3828.6	3464.5	1733.4	233.8	941.9	1329.5	2376	2289.1
324	224.9	61	44.8	85.4	32	56.6	246	103.9	70.2
325	342.8	379	339.3	282.9	230.2	339.8	313.3	331.3	331
326	2895.3	6732.3	6959.5	716.8	385.8	689.6	1354.3	3462.4	810.2
327	14	26.8	9	107.3	745.3	31.8	92.3	30.5	40.5
328	281.4	393	463	538.5	44.8	160.9	160.6	240	510.8
329	83.3	80	72.1	51.7	315.4	197.3	209.5	65.5	97.5
330	51.4	40.9	62.5	38.8	64.6	86	49.8	45.3	75.4
331	310.9	265.9	292.9	290.5	301.2	1151	377.7	262.6	363.2
333	770.8	635.6	1012.3	910.6	190.7	762.8	346	908.1	711.7
334	207.8	219.4	166	215.4	137.5	112.8	565.2	135.4	170
335	155.6	80.9	114.5	131.9	90.7	718.1	215.7	922.8	155.9
336	340.7	427.2	563.8	689.1	96.3	436.7	487.1	782.5	499
337	2849	76.8	200.7	463	932.4	112.2	638.2	474.2	194.5
338	177.2	183.9	190.4	175.1	273.4	59.6	256.4	142.1	229.6
339	395.4	525.8	437.1	581	225	445.4	326.7	362.3	485.5
340	223.5	251.1	290.8	318.2	197.1	253.7	187.5	285.3	397.3
341	473	874	1273.4	721.4	508.7	1207.3	566.8	660.8	584.1
343	469.4	161.5	78.2	124.9	366	1807.9	1281	53.8	117.8
344	1783.5	1064.1	1156.4	1751.4	281.3	986.5	1814.7	1291.3	1259.5
345	244.8	232.7	258.2	265.4	279	383.5	225.4	192.1	278.1
347	939.3	1308.9	2012	2968.2	324.4	1367.9	2442.7	1031.3	2634.6
348	1619	2746.3	3836	4352.3	628.4	2022.4	5951.2	4142.1	3535.5
349	208.6	294.7	249.4	334.4	413.9	154.9	222.4	262.8	343
350	265	151.9	221.4	354.3	1016.4	1.2	367.5	179	283.6
351	121.2	184	512.2	66.7	230.2	220.7	229.7	69.7	320.1
352	468.7	405.1	432.1	461.6	124.7	253.5	262.2	439	377.6
353	422.8	154.1	375.8	272.6	206.3	272.5	306.9	342	275.3
3c
SEQ ID
NO:	830TT	831TT	832TT	834TT	835TT	836TT	837TT	838TT	839TT
354	1607.7	1269.4	69.2	410.9	2189.2	23.1	352.6	432.9	560.6
355	1226.2	9155.4	818.2	3259.7	4192.9	60.2	6955.8	2712.6	387
356	589.5	420.2	584	481.7	485.2	628.1	781.8	356.3	432.6
357	639.1	496.4	606.3	873.1	453.3	762.3	556.9	747.8	483.8
358	1141.1	1537.2	2093.3	1332.4	1450.6	785	1727.4	1490.9	867.6
359	410.8	324.8	302.5	275.6	347.4	372	401.6	274.5	352.8
362	433.7	1188.9	809.4	714.8	722	536.8	1286.6	790.9	408.6
360	355.3	785.8	548.6	473.7	527.2	237.8	648	589.2	258.9
361	669.1	117.2	502.4	332.7	153.1	491.8	673.8	155.9	634.6
363	624.8	516.7	452.9	386.1	575.4	348.2	555.6	423.3	578.6
1	681.6	1339.4	926.7	1627.5	1378.3	825.9	1180.5	1556.8	483
2	2308.2	2517.8	2273.1	5347	1263.4	2813.7	1449.6	2931.3	2339.6
7	760.1	396.2	691.3	1209.2	602.6	682.5	797.8	924.6	504.6
8	1540.3	559.2	932.1	520.1	496.7	1011.1	563.4	319.8	942.6
9	2980.9	1665.3	5198.9	2703.9	1212.7	4689.7	7367.2	4021.7	2722.5
10	122.4	197.5	65.2	110.5	139.5	59.4	99.3	137.7	236.6
11	376.8	703.1	345.6	651.8	578.7	208.4	539.6	862.8	174
13	181.2	792.6	515	259.6	570.1	291.6	711.6	596.7	310.5
14	618.3	2196.3	1802	1423.9	1281.3	1502.7	2410.1	2087.7	533.5
15	807.1	1589.6	1001.5	828.3	1241.5	307.4	2913.4	4498.6	625.1
16	1484.5	3932	1622.5	2238.6	3413.6	1419.6	2274.4	2625.1	831.6
17	699.7	876.3	1400.3	1300.9	988.9	1281	1049.5	2078.4	694.1
19	482.6	465.6	2749.2	461.1	810	290.3	1716.7	1582.7	1076.2
20	84	450.8	263.1	290.5	360	1.1	182.4	324.9	165.7
21	91.3	3467.2	514.9	1814.1	3225.9	499.2	2094.7	1840.3	181.3
22	3156.1	4671.9	5203.4	6611.6	3435	2468.1	9279.3	6745.6	4447.3
23	495.3	1234.6	1083.4	798.1	1519.6	356.2	1191.8	2950.2	871.6
24	274.4	317.3	405.7	185.5	432.2	235.1	795.2	871.3	137.7
26	2752.2	4302.1	8189.5	1864.3	3917.4	2490.7	6974	5535.2	4706
27	424.6	749.9	1258.8	1611.9	871.3	505	1476.7	1146.7	506.1
29	165.7	162.7	75.4	90.5	104.2	94.3	114.4	146.2	101
30	312.4	592.5	409.5	348	418.1	136.7	1284.6	1307.6	408.1
31	331.7	12536.5	1834	9042.7	16967	303.8	5146.5	6843.3	352.9
33	1256.2	4507.9	1474.3	2328.6	4981.8	451.7	4542.5	11875.5	544.7
34	2831.9	492	3213.2	870	569.7	1873.2	2278.6	454.6	2785.1
35	1217	1751.1	260.4	933.6	1418.4	120.2	423.2	768.6	680.3
36	145.6	258.1	974.8	3626.3	913.3	524.5	893.8	1391.4	185.2
37	286.6	268.9	312.8	203.1	264.8	203	424.3	264.8	270.4
38	709.7	3086.6	1199.9	882.2	1931.9	384.4	1810.3	7524	348.4
40	603.3	849.4	466.7	631.9	695.6	357.4	654.4	633.1	633.2
41	285.5	513.6	628.4	721.9	2482	1004.7	621.2	2126	360.3
42	229.9	548.9	402.2	516.1	450.5	519.8	332.6	612.9	222.9
43	390.1	489.1	363.3	192.2	399.6	388.1	369	222.3	314.1
44	652.8	952.5	925.3	1044.2	930.7	784.2	962.5	1223.4	468
45	691.2	1619.8	791.5	1433.2	1616.2	618.5	1030.5	1531.9	335.2
46	351.6	412.4	339	330.5	453.3	276.5	345.7	346.9	376.6
47	256.3	423.2	349.8	448.9	546.2	138.6	305.9	635.7	188.2
48	297.1	112.1	708.1	397.5	367.9	134.4	1885.5	680.1	1204.7
49	497.2	2981.6	1179.9	712	5248.7	553.9	1047.2	640.1	381.8
50	350.3	659.2	627.4	427.2	665.1	230.3	1754.6	2654	228.2
51	80.2	1018.5	175.1	392.4	669.4	374.5	326.8	448.4	77.7
52	219.7	261.6	189.5	266.9	275.7	214.6	245.4	224.4	208.5
53	97.5	1385.3	1668.8	2690.6	1207.6	509	1096	2281.1	132.5
54	401.9	1101.6	1148.7	1527.2	880.3	1550.3	682.6	1648.3	318.8
55	87.2	79.5	120.6	81	64	126	101.5	117.8	130.8
56	41.5	356.3	290.8	220	321.6	255.3	116.9	178.9	114.6
57	4709.8	826	3670.5	13995.1	2735.5	1208.7	2495.3	8987.2	1600.1
58	5493.8	942.8	3824	13347.2	3431.8	1473.6	2604.6	9793.3	1896.9
59	990.8	4570.9	2467.2	2820.8	3584.1	1578.8	2600.2	2511.9	1043.9
60	86.6	409	328.3	697.7	313.2	195.4	394	769.5	205.8
61	148.6	102.4	113.5	119.1	96.3	180.5	151.5	144.5	90.7
62	2552.4	3419	2087.8	1947.4	3982.4	632.7	4686.3	1552	893.8
63	138.1	500.7	504.9	621.5	477.8	416.2	765.6	623.8	200.9
64	194.3	430.2	1152	334.2	1238.6	157.1	225.5	301.4	184.8
65	119.3	275.4	393.9	220.9	330.6	146.6	362.6	472.9	192.6
66	644.5	1716.5	799.8	2089.9	1882.3	860.9	884.9	1790.8	494.1
67	33664.7	18698	25385.3	29495.1	22746.1	32326.6	35830.4	25673.3	30440.8
68	4863.4	757.4	639.2	500.3	628.5	1067	877.5	537.2	2729.1
69	7538.6	1746.3	2633.5	2161.4	1446.6	3285.4	3619.9	2224.2	3873.7
70	1167.7	4005.5	2775	4480.9	5935.2	2888.4	2408.7	3524.2	1112.2
71	331.3	7296.2	3308.3	4722.7	6620.9	641.7	3323	7752.1	521.9
72	867.2	2722	587.7	1727.1	2480.6	715.1	1071.1	2441.2	729.3
73	248.7	702.4	513.9	998.3	674.5	351.8	560.2	646.8	291.3
75	191.9	299.8	1021.2	2627.9	481	184.1	684.5	3040.4	241.4
76	602.9	419.6	424.1	687.6	576.5	1929.4	374.1	1713.5	249.7
77	3969.7	1046.9	2803	1502.3	1123.7	3525.2	3967.9	610.4	3028
78	461	260.7	681.4	434.3	255.4	719	658.2	440.9	425.5
79	112.1	359.7	118.8	269.2	354.3	241.7	238	391.9	129.7
80	211.4	800.8	565.5	1265	877.2	479.3	445.8	1163.2	181.6
81	381.4	8963.9	1038.9	7150.5	8082.3	289.1	2966.6	5268.9	339.8
82	204.4	189.8	246.1	203.2	216.8	260.9	253.2	152.4	345.8
84	167	297.3	276.3	381.1	417.7	274.7	303.1	497.5	238.9
85	186.4	1174.1	201.5	1066.1	1674.8	143.6	434.1	306	203.8
86	75.7	748.2	119	174.2	654.4	84.9	219.2	164.9	102.9
87	252.7	2338.9	668.2	445	1007.4	249.1	1199.6	589.5	215
88	6167.9	470.3	4262.6	1023.8	548.1	5577.9	4604.6	683.8	3916.7
89	267	506.7	193	233.1	541.1	192.3	266.6	262.9	321.8
90	190.7	110.5	214.3	244.9	280	124.7	260	290	113.5
91	7102.8	1126.2	1543.8	6389.7	2050.8	529.2	760.6	7087.2	1108.2
92	1861.9	9980.6	9744	7280.9	5486.5	7913.2	7006.7	5412	2498.8
93	163.2	108.9	245.5	157.5	112.4	254.2	250.4	119	193
94	839.4	577	1488.5	1006.1	405.5	1082.5	1126.2	964.8	634.9
95	515.4	1234.6	807.9	454	959.8	864.4	770.5	494.4	662.2
96	144.9	212.1	199	351.5	306.3	223.8	227.7	302.5	175
97	130.8	471.3	333.4	484	448.6	329.5	480.1	568.4	147.1
98	15.8	32.4	37.6	34.4	51.3	39	38.4	65.9	38.2
99	318.3	435.4	289.7	489.3	399.5	198.2	351.7	473.1	298
100	12916	51.7	13251.4	1990.7	423.3	4429.8	13164.2	230	5552.1
101	532.8	290.8	329.4	342.8	316.8	363.7	300.1	234.7	333.5
102	229.2	186.8	199.6	138.3	206.2	149.6	226.5	175.3	202.1
103	342.5	406.4	434	355.9	371.1	306.7	526.4	435.6	362.1
104	596.1	90.6	698.7	267.8	65.4	947.3	366	148.9	436.1
105	533.9	86.9	770.1	333.9	108.7	831.3	274.7	239.4	443.9
106	573.6	70.7	537.2	270.6	112.2	911.2	341.9	194.3	486.5
107	1027.4	294.7	183.4	222.5	716.1	250.8	263.1	280.6	335.9
108	241.6	145	283.6	211.1	169.4	333	276.2	235.5	308.9
109	1066.5	2807.4	2388.4	1135.5	1428.2	2931.4	1315.4	2683.7	95.3
110	2960.7	7199	6101.1	2633.5	3373.8	5614	5706.1	6310.8	130.7
111	2125.4	189.5	742.5	359.1	253	1180.3	925.2	140.9	1262.1
112	523.3	2050.6	1308.3	1693.4	1084.8	1386.3	718.3	1809.1	394.9
113	74.8	326	591.7	308.2	365.7	404.6	253	437.5	190.6
114	494.6	580.3	510.6	830.3	436.6	489.3	361.3	460.5	588.4
115	501.5	966.3	740.2	1215.5	1149	363.5	1225	1118.5	466.4
116	279	621.8	666.9	515.9	520.1	199.1	1091	891.9	310.3
117	1708.9	122.3	1731.3	467	162.6	817.7	1395.5	183.9	1888.5
118	136.1	129.6	287.9	133.8	97	154.8	231.6	230.9	391.1
119	250.9	375.2	298.4	289.2	272.3	298.3	279.5	171.8	367.9
120	135	98.5	266	117.9	142.2	119.8	265.8	210.2	170.8
121	925.3	1636.7	2341	5981.4	2305	1239.6	3217.7	4469.4	424.6
122	146.6	403.5	321.9	294.5	387.4	169.6	475.8	415.8	99.5
123	185.4	288.7	188.9	285.9	269.3	240.8	291.1	457.9	164
124	178.1	141	152.7	97.1	156.7	104.4	167.4	144.7	176.4
125	1161.1	1141.8	2587.8	5502.6	1399.3	689	1600.7	2696.8	1040.4
126	656.8	38.1	771.3	130.6	17.2	1187.1	477	64	905
127	102.9	244.7	132	189	183	113.8	209.9	130.6	133
128	387	69514.5	255.7	68429	281	269	317.9	214941	338.3
129	357	1983.4	2117	559.5	1969.4	382.4	899	1412	221.4
130	80.2	488.5	349.7	368.2	469.6	255.7	169.9	378.5	109
131	97.6	577.1	413.3	535.1	592.4	154	308.1	504.5	115.2
132	259	267.5	225.2	362.6	285.3	231.6	294.2	316.4	233.1
133	62	284.1	126.4	152.8	224.7	170.9	160.7	281.1	70.9
134	129.3	363.2	256.8	186.3	308.2	228.3	147.2	117.2	137.1
135	398.3	284.6	523.7	620.2	375.8	623.2	554.6	638.2	372.3
138	150.3	205.6	166.6	165.6	244.7	180.3	238.1	192.4	141.7
139	87.2	82.8	324.7	238	168	198.4	204.8	178.3	147.6
140	2117.8	107.3	1157	1151.6	68.3	2112.4	1062.3	199.7	2021.8
141	1371.7	677	2205.3	517.1	203.1	1460.2	1313.5	110	1344.6
144	487.8	6712.6	9651.1	13878.1	3393.4	9082.5	5985.5	22188.6	513.2
145	262	429.3	287.6	252.2	268.9	217	336.2	203.2	226.4
146	194.8	463.3	178.9	314.7	540.9	163.7	240.6	520.1	224.1
147	59.7	56.9	119.9	366.3	152	50.5	148.4	263.9	103.4
148	821.7	868.3	548.5	469.3	1125.9	334.8	1013.8	676.8	741
149	242.9	174.5	271.1	252.6	219.5	363.8	434.4	169	218.3
150	183.1	227.8	233.6	259.9	424.1	141.2	359.8	423	249.3
151	211.4	1131.6	570	576.6	580.9	369.8	475.6	262.8	327.6
153	81.4	122.6	274.3	196.9	115.5	453.6	156.4	725.7	123.9
154	687.5	4823.4	1405.3	5742.3	4211.6	942.8	2873.5	9112.2	480.4
155	139.2	1013.1	289.7	320.7	766.9	289.3	405.9	264.7	116.9
156	77.8	638.3	346.5	465.6	740.7	128.6	262.3	511.3	127.6
157	210.4	137.4	176.3	144	198	97.2	246	151.5	150.2
158	14.7	1191.6	243.3	631.9	852.7	303.1	733.1	924.1	12.1
159	3335.3	1313.5	2648.7	1400.3	1293.6	2577.5	2106.8	1174.1	3077.4
161	58.4	6972	2447.5	5870.8	5806.5	3314.6	521.9	4390.4	98.3
162	145	582	315.4	818.2	813.3	91.8	982.1	2165.6	316.3
164	75.4	1096.7	5139.7	1786.4	674.5	836.8	3086.4	577.7	211.6
166	5882.4	1758.7	3139.9	1274	662.7	3213.1	4469.7	1150.4	3810.8
167	2593.9	1006.1	2947.1	987	1134.4	2040.2	2587.3	1035.8	2569
168	1092.3	472.4	620.1	812.6	879.6	719.1	508.4	613	801.1
169	16935.6	11084.6	7798.3	11788.6	6525.4	4941.2	10219	13134.4	4408.7
170	640.4	2234.2	2081.1	2242.8	2170.8	2086	1389.5	2450	684.4
171	4002.8	860	1755.1	540.2	1265.9	373.5	3814.4	1969.2	2887.5
172	871.6	562.5	496.9	524.4	536.8	741.7	618.8	487.5	795.1
173	575.8	843.7	419.7	1448.7	916.9	512.9	1159.7	2172.2	361
176	217.5	1069.1	1369.4	1083.4	461.5	2385.1	823	271.7	71.1
177	712.3	592	497.4	495.9	559.8	651.8	489.3	372.4	574
178	333	1722	1370.5	2400	1863.3	1852.3	1112.4	2050.7	135.6
179	148.9	1165.2	914	1121.1	1438.7	84.3	739.1	1727.8	116.9
180	178	394.9	592.7	482.6	468.6	261.9	679.3	584.8	124.9
181	8559.6	3563.7	9515.2	5496.6	3150.6	6350.8	8535	5034.9	9024.4
182	303.1	363.2	607	437.8	284.5	355	547.5	405.8	347.6
183	463.4	743.1	1416.6	409.4	692.8	313.6	1066.3	1567.7	752.9
184	321.8	771.5	17054.7	1022.1	346	4736.3	714.2	527.3	221.3
185	858.5	7670.7	3976.3	3238.8	6074.4	967.8	6474.3	5307.2	1275.6
186	422.8	223.9	502	187.1	245.8	411.1	334.5	155.1	496.2
187	130.6	301.4	247.9	382.4	430.9	98	251.4	429.4	499.9
188	231.3	443.1	490.2	209.5	672.4	207.6	460.1	490.2	230.3
189	186.2	290.4	253.1	112	418.8	162.1	356.5	338.2	129.7
190	115.7	719.2	278	442.3	529.6	419.8	501.5	634	110.1
191	762.2	2944.3	1482.9	1491	1153.8	593.3	2253.3	2972.3	855.8
192	90.9	135.5	169.1	82.5	159.1	122.1	164.6	95.6	111.4
193	830.6	156.9	650.7	332	73.5	1566.3	778.2	246.1	749.5
194	116.9	307.8	210.6	367	243.7	248.1	220.6	242.1	121.1
195	167.1	213.3	230.4	93.7	205.8	349.5	194.4	147.8	226.8
196	8492.8	4271.5	4837.9	4245	4837.6	5613.6	5166.8	2741.2	7143.4
197	126	137.6	88	126	163.1	62.4	170	153.7	99.7
198	77.9	1237.6	107.3	1714.1	2069.7	160.7	379.3	3850.1	42.8
199	1975.9	15850.1	1067.1	3670.6	6331.3	92.9	10936.9	4209.3	574.9
200	442.4	367.6	806.6	641.4	731.8	272.8	852.3	608.7	378.9
201	1717.3	1466.3	62.7	409	2205.6	81.5	409.1	388.1	531.5
203	185.5	1325.5	1994.8	2659.6	1146.7	553	426.7	1650.6	294.4
204	640.5	373.8	990	1221.5	639.1	971.7	716.9	673.8	413.2
205	3638.5	3132.4	5021.1	4836.2	2548.8	4867.6	5773.1	5664.6	4500.1
206	4305.4	266.2	226.9	194.4	2367.5	186.1	1565.6	1933.1	13603.8
207	991.4	24.6	637.6	252.9	75.4	1349.4	407.4	119.4	589.5
208	589.9	1696	384.8	2423.4	990.6	458.5	465	2841.2	361.9
209	3044.4	1250.1	3110.3	684.4	220.2	3097.8	4613.7	225.9	2810
211	21702.9	163	6106.7	1726.7	272.3	20338.2	14214.4	218.1	13108.3
212	363.1	1146.1	984.2	1161.8	1648.5	1165.9	720.9	1062.1	324.3
213	117.5	85.6	93.1	80.5	140.7	104	160.1	103.1	133.2
215	1547.8	71	895.2	308.8	53.3	2847.9	790	201.2	863.8
216	466.2	184	743.2	255.8	157.4	648.4	522.1	231.6	528.4
217	253.9	1156.6	956.5	1388.7	916.7	655.7	993.9	1488	283.6
218	273.9	156.2	297.3	168.4	134.5	253.5	206.7	182.5	309
220	111.8	108	178.4	87.6	87.4	78.9	114.5	73.1	95
221	401.7	980.8	956.6	1765.3	1118.9	944.1	2190.1	2120.8	463.1
223	313.8	693.9	257	526.7	856.5	230.4	725.6	679.9	230.5
227	1309.4	2741.4	829.9	1455.7	2656.4	513.5	2644.7	7955	811.4
228	788.4	341.7	662.1	341	400	605.3	554.8	321.3	480.1
229	165.7	231.4	242.7	245.2	169.4	132.9	206.6	199.8	256.2
230	378.3	3159.3	602.9	2495.6	2807.6	427.9	1760.9	2607.2	253.5
231	179.7	503.8	1002.1	932.9	465.2	263.4	286.4	683.6	168.8
232	2120.5	2917.6	6467.5	1163.8	3285.8	1825.2	5213.4	4175.9	3969.4
233	3812.2	8994.9	10159.2	16687	8022.5	3071.4	10101.6	14509.8	5294.2
235	2787.4	609.3	1195.2	414.8	721.3	253.4	2159.8	921	1447.2
236	205.5	420.9	541.4	310.6	425.8	168.2	568.3	431.3	257.5
237	1075.9	1872.5	2343.1	2170.9	1947	1599.7	1714	1850.9	1457.9
238	595.7	686.4	1928.8	1067.3	636.7	1278.6	1084.7	907.4	839.5
239	408.9	910	1240.6	343.7	979.2	698.3	1207.4	1043.8	297.9
240	439.8	896.6	923.9	386.1	1012.3	671.2	1029.8	1706.7	346.5
241	1039.9	2207	2261	786.1	1746.5	1431	2286	2914.4	614.4
242	6785	25733	9423.8	18037.6	23053.8	1044.8	22442.7	27313.9	3641
243	172.2	719.2	374.5	427.7	727.7	198.8	793.6	730.7	379
244	117.1	158.2	359.4	1692.5	225.5	224.6	205.9	781.3	255.6
246	205.2	1124.9	754.6	1864.1	1124.1	998.2	993.1	2067	192.7
247	158.1	122.8	98.9	90.5	167.3	80.1	192	119.8	170.2
248	93.3	964	2395.2	4780.4	1534.5	1401.2	1160.4	3767.9	132.8
249	628.3	275.9	966.5	609.4	278.5	1711.8	1017	717.3	746.2
251	86.7	1115.8	467.4	572.2	1064.5	196	697.9	947.7	78.7
253	180.8	267.8	313.8	390.7	438.7	298.7	304.7	693.5	229.6
254	323.1	411.8	1816.5	1559.8	527.5	2075	1017.1	1776.1	350.4
255	307.7	1612.2	1295.2	2395.7	1944.5	1881.3	1003.5	2216.6	117.3
256	4984	885.5	1242.8	5330.6	1414.4	583.9	717.6	2463.5	988.4
257	229.6	347.5	146.2	392.4	283.4	105.2	231.5	331.8	93.6
258	467.5	1932.3	306.9	580.9	1669.9	50.7	1440.1	419.2	185.1
259	656.1	739.8	1239.2	816.5	649.5	213.6	1710.4	612.8	550.2
260	211.1	149.6	119.9	165.1	155.4	190.5	169.4	142.4	201.5
261	304.8	92.6	456.1	380.7	123.1	205.9	183.4	133.3	296.1
263	416.5	696.6	508.2	595.2	545.5	479.7	789.5	725.8	408.1
263	565.6	2856	535.6	2244.5	2669.9	321.7	1544.8	2324	280
265	470.5	69.8	209.8	116.1	97.9	338.5	324.8	100.9	325.4
266	256	195.2	345.7	246.5	313.5	349.5	292.8	235.5	347.8
256	173.1	291.4	341.1	568.6	490.5	185.1	300.4	785.2	162.7
268	527.3	595.7	2023.3	935.8	545	1146.6	808.3	526.4	721.4
269	32.6	266.5	71.6	170.1	494.5	52.6	298.3	240.8	65.9
270	279.9	197.9	274.9	183	205.6	244.4	305.9	202.5	162.7
271	242.7	1141.1	567	357.7	1086	274.5	625.4	1269.3	250.7
272	700.4	967.8	477.4	599.8	826.1	428.3	698	698.6	480
273	4697.9	211	2811.9	916.2	234.7	3500.5	4802.8	1550	1104.3
274	603.8	1411.8	1737.5	867.4	1091	321.9	1389.7	1216	664.2
275	225.9	3619.5	1297.8	806.9	2484.1	321.7	2165.1	1639.8	396.9
276	2732	4767.8	2036.4	2069.3	5010.2	844	6695.5	12351.9	1238.7
277	255.2	264.7	225.8	355.7	325.1	200.6	250.2	259	206.6
278	765.8	1291.5	1132.1	1008.7	1492.3	255.4	1550.7	1198.8	598.7
279	2233.9	1837	1527.8	2169.7	1934.2	2261.9	1828.4	2407.2	2843.7
280	3349.3	2489.9	1693.7	3130.8	2269.8	3147.5	2337	3287.7	2513.8
281	37.7	385.1	326.7	815.7	570.2	488.3	255.1	762.4	74
282	523	447	277.8	1273.6	749.8	235.4	421.2	3058.5	317.7
283	447.5	340.8	310	351.6	440.4	246.8	393	386.9	348.1
284	74.4	83	130.8	103.8	100.8	71.2	141.1	145.8	89.2
285	116	109.8	107.8	96.2	136.8	95	105.2	105.6	93.8
286	1056.7	63.5	148.9	68.8	54.6	307.6	176.7	60.5	344.1
287	126.9	81.8	136.5	115.2	128.5	110	153.7	95.5	99.4
288	172.6	145.5	166.4	146.9	195.1	144.4	165.3	173.2	184
289	2816.8	4208.5	1023.7	2660.2	4312.6	404.1	3191.6	3539	1715.5
291	120	338.3	132.7	186.1	234.4	129.8	203	425.5	113
292	473.6	820.1	4181.1	6680.4	826.4	110.4	8212.2	16919.5	977.5
293	120	1421.4	1229.9	592.8	1834.6	509	674.6	986.7	171.8
295	341.6	1948.4	1254.9	2043.1	2299.8	1064.4	1671.9	2245.9	229.1
296	552.7	1443.5	1644.1	1603.5	1908.8	822.2	1505.8	1432.6	753.8
297	45.3	90.8	94.6	50.3	139	53.5	88.5	154.3	116.4
298	440.1	517.5	501.4	487.3	470.9	471.4	489.6	506.6	219.8
299	725.6	819.4	1275.9	4386.6	3103.3	1663.7	910.5	4069.9	1147.8
300	177.4	1033.2	826.4	1230.7	1114.8	748.3	543.4	1306.1	250.1
301	2124.1	211.2	358.6	194.9	158	913.5	300.7	228.4	485.7
302	37.2	267	6.5	240.6	211.9	26.1	121.2	193.6	46.4
303	324.2	270.8	472.7	273.6	263	997.6	487	248.9	581.6
304	344.9	585.6	322.9	461.8	884.2	214.1	543	356.5	364.9
305	175.5	190.4	287.7	598.2	791.2	551.1	859.4	2550.8	158.7
306	189.2	803.1	191.1	557.8	620.8	163.1	322.9	218.6	195.4
307	302	238.1	145.1	553.9	295.1	159.8	280.9	449.1	226.3
308	1190.6	794.8	1165.2	705.2	515.1	1800.1	914.4	520.9	1641.8
310	362.3	134.8	505.7	103.4	125.4	229.5	318.3	62.5	326.1
311	62.7	499.8	263.8	932.2	246.8	162.7	224.5	1036.4	115.8
312	902.2	50.7	593.6	151.6	54.4	843.6	810.1	19.4	523.1
313	132.9	517.9	687.5	313.3	244.1	457.1	385.1	576.9	131.9
314	522.6	650.8	980.1	1264.1	1058	586.8	1856.2	1354.1	372
315	391.8	154.3	554.7	155.4	153.4	591.4	395.7	235.9	458
316	210.3	558.3	491	565.6	525.6	484.4	470.4	509	234
317	314.7	271	195.4	240.9	303.1	168.8	387.8	1026.2	214.7
318	45.9	383.2	425.9	527.9	428.5	97	264.8	364.3	127.7
319	174.9	528.4	259	454.7	535.4	302.5	225.5	319.9	223.3
320	572.9	159.3	518.2	278.5	211.4	569.8	518.8	239.3	464.9
321	307.2	232.7	332.4	169.5	222.3	311.8	367.9	203.1	354.6
322	164.7	350.9	214.6	345.1	354.5	264.7	257.5	318.3	243.3
323	2580.9	1349.5	3402.6	2592.2	1137.5	3939.8	2125.9	1848.5	1426.6
324	69	597.2	475.4	645.4	435.8	233.3	224	688.1	72.4
325	317.1	681.6	505.4	818.9	491.5	395.8	558.8	605.8	254.6
326	790	1838.6	2873.2	3607	2251.9	4068.7	6144	3552.4	3136
327	6.7	409.3	78.4	615.9	402.1	10	18.7	342.6	30.3
328	751.2	151	376.6	307	255.2	542.9	560.4	300.2	662.8
329	85.3	109.9	91	74	63	94.7	77.9	45.9	80.6
330	54.9	951	436.1	1119	408.8	55.7	678	877.4	141.4
331	403.9	382.1	215	302.1	371.7	380.3	325.4	324.5	332
333	571.4	156	462.8	160.5	140.1	1058.8	443.4	150.5	603.1
334	195.4	500.9	1027.6	250.9	655	196.6	332.8	432.2	161.6
335	155.1	109.1	732.5	572.2	165.5	62	194.8	923.7	127.6
336	668	210.4	480.1	280.3	175.5	389.2	344.2	252.7	445.1
337	197.1	220.6	207.5	266.7	387.8	309.2	374	240.3	256.6
338	217.2	890.9	464.6	1427.6	896.6	189.4	1039	1728.1	231.7
339	377	346.8	345.1	332.7	324.7	435.1	457.4	277.5	454.9
340	330.6	95874.2	237.5	123339.8	92245.2	222.4	696.6	74884.9	304.2
341	657.2	434.5	521.8	461	442.6	785.8	552.9	485.6	713.7
343	109.4	4793.6	207.9	601.9	2590	773.6	1138	1171.9	57.1
344	1167	249.7	893.9	545.2	581.2	963.4	1019.3	554.7	1114.2
345	252.6	620.5	437.9	408.2	509.3	204.8	544.8	404.8	294.1
347	2279.3	1845.7	6453.3	3490	1999.5	3041.5	2644	1859.9	2280.8
348	2856.1	2533.8	7636.1	6329.8	3556.3	5813.9	5133.1	4694.9	5037.6
349	353.3	256.7	290.3	316.7	301.8	407.4	319.1	485.8	258.4
350	386	804.7	473.6	475.2	611.1	257.1	657.4	638.3	199.2
351	308.4	2206.4	1213.1	2566.3	1996.9	246.9	1150.3	2079.9	292.1
352	355.6	83.4	314.2	140.3	111.5	364	265.6	231	294.5
353	232.6	402.1	295	294.2	423.7	229.4	384.5	414.6	243.7
3d
SEQ ID NO:	840TT	842TT	862TT	863TT	864TT	865TT	866TT	867TT	869TT
354	413.4	103.1	28.5	89.1	50.8	119.4	632.2	9.2	48.7
355	518.1	63.6	16	83.3	29	114.5	55.8	49.5	44
356	617.8	1163.1	1507.8	789.4	1313.2	1067.3	1224.9	824.3	740.8
357	750.6	663.3	1662.6	876.7	839.2	1660	1243	1043.5	843.5
358	647.8	509.5	567.7	1088.7	1049.5	795	1349.4	535	1699.5
359	330.5	214.7	472.1	313.5	373.5	481.3	371.9	361.8	235.3
362	288.4	245.9	172.7	589.6	377.5	866.5	666.6	454.5	954
360	434.1	305.6	182.5	297.3	370.2	347.1	290.1	218.1	444.6
361	682.3	740.4	589.9	765.7	495.7	894.5	527.5	1472.7	327.2
363	435.5	328.8	483.4	387	360.5	673	502.1	431.2	367
1	532.1	658.9	827.5	640.1	768.3	484.6	619.1	510.9	964.5
2	4059.8	3830.7	4516.5	3770.5	2512.9	3756.6	2448.4	3524.2	3003.6
7	483.8	209.7	470.6	825.4	484.2	153.7	393.7	965	873.7
8	1199.1	1312	934.6	1643.2	1176.8	871.7	1342.3	768.5	732
9	8223.9	2596.3	7524.8	6220.9	3456.3	6027	7023.5	7427.5	3975.6
10	51.2	96.2	67.9	101.6	111.8	139.3	75.7	46.4	157.4
11	171.2	198.5	495.5	218.3	206	597.6	634.9	288.5	318.8
13	537.4	265	36.3	777.1	442.1	95.7	614.9	65.2	238.9
14	1233.6	1157.9	134.4	2731	1781.1	837.6	2365	195.6	747.9
15	699.2	133.5	191.7	417.5	408.8	260	185.5	349.2	539.4
16	662.4	1257.3	1518.2	1301	966.8	1066.2	1385	714.3	1347.5
17	1194.5	1224.2	2909.6	1355.9	1395.5	1413.2	1584.1	1543.7	1301.1
19	1305.5	169.4	164.2	167.4	153.8	335.4	192.4	217.8	159
20	11.1	1.1	55	1.1	1.2	69.6	36.1	1.7	2.7
21	240.8	87.2	45.6	290.6	14.9	100.6	193.6	1.2	665.2
22	9947.1	7799.8	11063.4	5454.8	5808.5	5943.2	5158.2	8719.7	4509.2
23	956.7	1.1	48.1	157.6	1.1	4.3	28.8	77.3	62.7
24	218	30.6	818.7	223.9	55.2	225	83.6	138.2	313.6
26	9557.1	76.6	228.7	772.1	58.3	169.6	349.8	241.6	342.1
27	776.7	416.1	446.1	321.7	837	194.8	624.3	214.8	248.9
29	59.3	307.6	113.8	111.9	151.8	93.7	155.2	94.7	165.9
30	1162	61.1	36.1	74	37.7	338	95.9	132.1	81.4
31	656.3	70.7	13.1	264	24.8	107.5	243.8	63.6	1804.1
33	863	622.5	646.3	338.4	225.9	1364.6	528.1	298.3	824.1
34	4801	4062.8	7041.9	2172.2	2709.9	7154.6	4874	3483.4	1898.9
35	349.5	48.6	21	69.1	220.8	140.3	127.8	42.4	29.6
36	247.6	112.1	70.6	952.1	127.4	437.9	132.7	244.9	2851.6
37	359.5	154.3	129.5	201	163.4	356.6	166.6	166.1	147.5
38	818.9	343.8	681	579.2	1066.9	635.4	454.1	452.9	944.3
40	584.7	371.3	337.3	437.1	313.3	551.1	403.2	378	412.8
41	247.9	211.8	28	324.9	206.9	141.2	142.1	246.9	1045.2
42	201.2	77.8	271.3	370.1	220.5	370.8	243.3	311.3	477.7
43	319.5	237	319.5	348.9	367.9	367.4	376.6	359.5	514.5
44	340.2	338.9	375.8	466.7	295.2	1064.8	611.2	385.6	862.4
45	387.6	484.6	587.1	607.2	566.7	339.3	634	461.7	686.8
46	312.8	273	211.3	310.6	243.5	430.8	275.4	232.3	243.1
47	267.1	166.9	95.5	209.9	200.1	356	306.7	200	468.1
48	586.4	32.7	36.8	85.4	15.6	170.4	44.6	128.7	52.4
49	559.1	182.8	87.8	323.1	320.3	292.7	479.7	171.1	244
50	183	51.5	313.7	151.2	54.7	307.2	159.4	147.7	107.5
51	50.2	57.3	25.1	53.5	27.6	365.3	326.7	129.5	249.3
52	195.7	196.6	173.8	234.1	186.2	225.4	159.6	208.9	221.8
53	82.5	34.1	142.8	294.3	73	168.9	158.4	50.3	1001.9
54	497.5	1164.8	197.8	1471.8	1002.7	709.6	1166.2	163.1	1728.2
55	119.7	111.7	100	104.8	90.9	118.7	116	94.5	92.2
56	50.4	78.9	15.7	207.8	125.4	69.1	86.5	91.8	155
57	913.7	120.1	39.3	348.7	96	112.4	648.3	63.7	1449.6
58	937.3	144.4	33.7	395.5	111.4	501.8	1139.1	62.2	1741.7
59	1524.7	2456.9	2314.6	1572.7	1908.7	1437.1	1816.2	851.3	1581
60	239.9	177.8	101.9	208.9	122.9	164.2	115.8	114.4	341.6
61	138.8	102.4	167.6	195.1	161.4	602.8	171.7	220.1	121.5
62	3218.4	1230.8	93.3	144.4	1893.7	776.3	1111.1	1116.3	275.7
63	476.2	251.9	390.8	305.5	390.5	446.7	360.3	186.2	416
64	260	108.5	72.5	133	186.3	125.9	184.1	121.4	174.1
65	130.1	114.1	115.9	113.8	100.7	57.6	84	103.6	167.3
66	736.8	1620	528.8	1200.9	1060.8	922.4	1062.5	613.3	1936.4
67	36967.4	32327.9	35416.1	33262.7	33086.4	50663.1	33055.8	33098.2	33842.1
68	3604.6	765.6	2711	2612.8	1433.6	3309.4	1090.5	3575.3	2217.7
69	4370.2	2244.8	8123.8	4669.2	2913.3	9134.7	2674.3	9458.6	4732.4
70	2223.5	1376.4	751.7	2378	1890.8	2166.2	2162.9	1456.9	3220.2
71	1018.7	90.7	156	1072.2	120.5	96.6	145.6	125.6	898.5
72	552.9	1523.3	537.5	355.6	575.3	229.2	397.7	248.8	869.3
73	447.7	234.9	263.5	297.8	293.7	265.4	305	231.6	465.4
75	260.1	159	459.2	194.5	212.8	460	245.4	508.2	472.1
76	273.6	135.4	1.1	2171.1	611.1	559.9	220.4	108.3	1748.8
77	4806.2	4952.7	7485.3	2585.4	4993.9	9359.9	6144.5	5753.5	2422
78	623.9	418.4	269	898.4	765.7	441	601.4	703	1341.8
79	121.6	161.5	129.6	160.7	133.3	143.3	133.6	130.7	177.4
80	132.5	767.8	1091.7	413.8	130.3	423	489.5	238.5	763.7
81	512.5	282.4	123.8	218.8	242.4	297	1287.3	81.3	806.9
82	309.9	198.2	168.6	248.4	267	111.1	195.8	299.2	260.3
84	387.2	136.7	73.1	108.8	68.4	133.5	96.7	102.1	324.1
85	248.9	142.3	90.9	119.5	146.4	305.5	231.4	148.7	109.4
86	128.2	81.2	328	73.6	54.4	101.3	98.7	95.6	101
87	389.7	249.9	208.9	161	233.2	395.2	213.6	276.9	167.9
88	3944.8	2735.3	8374.9	5614.3	5926.1	7145.8	6096.2	9499.1	4340.8
89	354	171.2	148.1	205.8	141.7	276.5	145.7	180.3	128.5
90	115.9	91.9	105.1	103.9	93	163.4	108.3	110.6	69.3
91	1164.3	208.6	1.2	284.2	96.6	444.2	1453.8	67	464.2
92	4085	6778.2	2708.1	9676.9	5168.6	3758.8	6575.2	2375.7	10249.7
93	301.2	226.8	421.5	194.9	232.2	375.5	171.1	428.1	163.7
94	995.1	541.1	897.8	657.7	595.7	381.9	809	335	1275.8
95	1045.2	582.5	118.6	543.6	452.1	179.3	209.1	188.8	345.6
96	151.5	196	167.6	244	181.7	245.6	205.7	171.9	230.8
97	166.6	276.5	308	289.5	386.8	228.9	347	249.1	374.6
98	60.4	31.5	27	23.1	9.2	31.1	20	38.2	21.7
99	253.6	187.7	194.3	246	183.1	311.2	227.1	164.5	250.1
100	19287.6	6400.4	8181.3	2605.3	10229.3	7403	9672.3	11255.4	738.2
101	266.7	227.3	183.5	187	210.8	246.9	215.4	175.2	303.8
102	171.5	108.4	168.3	145.6	139.2	216.4	161.6	192.6	129.1
103	278.8	262.5	300.2	251.6	305.7	614.4	341.7	296.7	354.3
104	443.1	801.2	207.5	609.2	639.4	662.8	235.7	480.5	507.8
105	463.1	1053.8	415.1	584.5	740.7	772.3	384.2	617	387.3
106	518.9	705.8	207.9	540.7	585.7	524.4	227	513.5	481.3
107	364.9	105	41.3	163.2	64.4	139.2	185.1	113.3	132.5
108	330.2	330.9	645.2	275.1	408	425.5	324.6	567.1	309.2
109	67.3	6034.5	117	7025.2	3555.9	130.1	4629.2	56.5	4997.5
110	28.9	11743.3	96.5	11643.7	6913.6	1.2	6469	1.1	12381.4
111	1421.1	1571	367.8	1848.8	3058.4	428.3	1123.4	1923.1	1485.6
112	527	115.6	213	921.9	582.1	50.6	951.8	441.7	1495.5
113	455.9	246.9	53.3	182.6	309	119	257	158.9	473.4
114	507.9	943.6	1193	488.7	600.7	470.7	525.8	646.5	1445.6
115	579.2	287	238.3	468.6	331.5	339.6	406.9	347.8	648.7
116	323	237.9	245	203.6	210.8	323.5	238.4	227.4	251.7
117	2477.5	2049	5384.6	1932.8	2356.6	2151	1724	4147.6	916.2
118	442.9	1260.5	217.3	146.6	481	247.5	132.8	138.7	375.2
119	196.2	294.2	59.3	102.7	207.4	22.6	112.9	103.5	412.3
120	173.7	63.5	76.2	116	85.4	51.5	83.3	88.4	65.8
121	572.4	1198.8	854.2	827.2	1024.8	671	1242.7	359.7	1485.9
122	290.1	202.3	237.7	134.1	153.2	200.7	314.3	99.7	125.7
123	49.5	102.7	113.5	109.8	125.4	167.4	124.8	161	127.5
124	122	156.7	104.5	141	126.9	183.5	129.5	127.1	87.6
125	901.7	798.3	548.8	603.5	613.7	1170.8	823	708	576.3
126	1558.5	2022.3	1906.6	1073.1	1537.3	1698.3	1203.7	1574	734.6
127	67.5	94.2	121.1	129.3	177.1	229.6	142.1	113.2	149.3
128	270.3	227.2	174	236.1	175.5	523.6	265.8	219.6	215.4
129	252.6	119.8	55.2	205.4	120.9	238.2	283.6	118.6	158.2
130	71	74.9	81.3	173.4	64.2	151.7	101.2	72.2	206.8
131	99.7	56.1	56.9	101.9	71.1	71.4	85.6	39.6	410
132	179.1	167.2	163.5	226.3	168.3	291.1	198.8	168.5	289.6
133	65.3	135.6	129.8	134.1	108.6	90.5	155.9	90.6	247.7
134	141.8	67.6	374.3	220.5	242.9	331.8	297.9	192.8	232
135	323.6	502.2	986.3	429.9	398.9	720.6	576.6	551	856.1
138	179.5	85.7	141.7	111.3	90.4	263.4	150	100.7	95.9
139	106.9	129.9	131.6	116.9	120.4	167.8	111.3	119.2	214.6
140	1721.8	3036.3	2185.5	2508.8	4344.2	551	489.1	3284.4	2492
141	2410.6	3225.5	1665.6	1916.7	2935.3	1825.5	2844.6	1474.7	1924.7
144	467.5	2221	378.9	13755	448	595.3	8268.8	333.6	24504.7
145	184.9	199.7	201.3	201.7	182.6	355.7	205.2	181.5	193.7
146	199.9	232.9	156.3	218.2	193.1	318.3	215.5	183.7	234.1
147	39	23.2	35	23.8	39.4	81	29.4	8.2	43.7
148	623.9	168.1	255.4	231.2	256.6	443	311.3	211.5	208.8
149	298.4	748.7	946.9	488	781.4	682.8	843.3	449.2	418
150	271.8	256.3	118.7	145.6	239.5	283.8	224.4	131.5	178.9
151	386	739.9	194.8	394.3	448.1	199.1	376.1	165.6	142
153	101.1	82.9	117.5	170.7	94.7	158.3	93.7	98.7	124.8
154	696.5	806.1	188.7	316.4	89.7	503.2	343.3	153.6	615.8
155	126.3	91.9	134.1	121.4	87.9	243.6	235.9	104.5	96.7
156	119.2	40.6	68.7	94.7	77.3	67	131.6	62.7	173.3
157	77.5	165.7	132.1	100.7	88	103.8	133.9	113.1	166.4
158	30.3	9.6	1.4	158.3	97.2	41.9	159.9	1.2	1019.8
159	3785.9	3917	4901.3	3467.1	3669.5	3653.4	3209.2	3643.5	3005.3
161	90.5	73.4	50	2779.2	176	170.6	3362.6	1.2	4114.9
162	165.6	48.8	50.3	49	23.6	75.1	52.8	83.8	63.7
164	274.7	1048.7	159.5	2491.4	3031	446.5	2413.5	213.4	2997.7
166	5679.8	5894	6666.6	4629.2	8306.1	5972	3859.7	5542.7	4096.6
167	2803.8	865.7	583.6	1447.2	1517.1	468.1	1020.9	895.3	1756
168	664.5	1070.8	946.4	1307.6	1154.7	804.8	787.3	1131.5	1135.4
169	4025.8	9912.9	783	3510.5	4082.6	1690.6	3122.8	3606.3	3273.9
170	630.2	1665.5	1244.3	2308	1487.7	895.5	1906.2	884.1	2192.6
171	1597.9	18.2	1.3	52.3	123.4	3	174	103.7	50.6
172	648.7	336.4	566.3	568.5	546.7	747	570.3	569.6	634.3
173	301.5	351.8	502.4	419.8	242.7	82.9	106.8	377.3	1153.3
176	205	103.6	37.4	2372.3	1244.7	431	2046.7	1.1	6658.9
177	657.2	340.2	225.5	561.7	411	195	319.8	255.7	474.3
178	133.2	340.8	44	588.7	77.1	236.2	156	90.1	2026.1
179	114.7	48.7	65.5	86.7	56.7	89.4	59.6	95.5	53.8
180	85.1	88.5	71.9	296.6	369.5	193.3	269.4	71.5	700
181	13466.7	11481.6	14492	10957.2	9935.2	21897	10184	12851.6	7312.1
182	654.9	653.9	427.9	406.4	491.3	347.1	403.3	562.8	449.5
183	1741.8	1.2	72	216.6	1.5	13.4	127.3	74.7	60.8
184	210.8	167	156.2	4707.4	163.4	275.2	340.4	183.2	408.7
185	2742.8	559.8	331.2	1091.6	875.4	2220.6	1051	563.7	1819.8
186	540.1	408.4	119.6	379	511.7	293.6	378.6	390.8	334.8
187	461	78.3	76.6	73.6	56.4	324	75.8	168	671.7
188	583.1	57.1	288.4	239	128.3	224	113.7	356.9	137.6
189	194.8	29.2	85.5	119.5	62.4	143.8	67.8	131.3	68
190	123.9	206.8	248.5	85.4	260.6	70.6	194.8	276	275.5
191	1270.2	2209.5	1240.3	741.8	1132.9	3308.2	2393.3	694.6	828.7
192	119.5	81	147	79.8	63.3	171.5	100.5	89	245.3
193	572	747.2	2493.9	1776.2	1406.7	2749.4	771.4	2411.6	1560.3
194	156.3	196.3	74.6	184.9	231.7	72.8	155.2	181	247.3
195	308.3	259.1	115.5	265.8	182.4	266.7	269.9	321.4	172.6
196	8888.9	1967.3	1862.4	4252.6	4150.7	1524.3	2417.5	2838	4062.6
197	123.1	56.4	64.3	55.9	63.4	61	92.7	88.5	67.4
198	72.7	46.7	59.1	128.1	86.2	134.7	76	89.2	1231.8
199	715.5	149.9	77.4	200.9	99.1	117.1	93.7	83.2	58.1
200	436.8	119	110	279	144.7	161.1	188.8	132.1	183.8
201	420.4	136.7	34.5	76	82.5	105.4	714.7	46.9	48.3
203	216.9	328.6	478.5	1783	339.6	318.5	429.8	215.3	696.8
204	424.2	534.9	2224.1	826.2	1409.9	1071.2	1167.6	730.8	1179.7
205	5342.3	6991.4	6610.9	7662.4	6557.2	4601.1	6434.7	5994.9	5922.6
206	196.9	136.2	256	226	167.3	461.3	381.3	255.3	194
207	856.9	2195.1	498.1	3374	2428.9	655.5	1311	1015.2	1559.2
208	394.5	627.5	228.8	462.5	481.5	375.3	249.2	214.1	366.3
209	4454.3	1325.4	400	2326.1	2927.3	297.9	2136.1	2044.2	4109.1
211	9691.9	10693.8	23350.1	14624.2	22270.2	30888	17057.7	24224.7	20568.5
212	572.3	271.2	156.5	584.8	425.7	440.5	458.5	393.6	829.4
213	67	114	61.5	73.5	71.3	151.9	87.1	81	82.8
215	822.1	2240.3	284	3771.2	3251.7	364.9	1154.1	891.6	1823.7
216	1084.8	1208.4	774.3	825.1	931.3	1019	1459.9	886.9	394.2
217	263.5	128.1	178	388.9	253.4	229.3	192.2	287.8	619.7
218	247	369	430.6	309.9	285.4	378.5	371.4	431.1	300.2
220	192.1	65.1	72.8	82.9	64.6	195.1	82	97.9	152.1
221	874.9	273.4	348.7	610.2	398.6	589.1	442	576.1	781.3
223	203.5	216.6	257.1	227.9	193	239.1	307.3	269.5	181.6
227	1491.4	508.8	973.3	663	611.5	1289.2	657.2	715.4	1113.4
228	479.7	346.7	305.5	399.5	432.4	168.3	334.5	406.8	398
229	344.9	179.3	263.5	202.7	135.8	258.4	146.7	307	178.3
230	408	173.8	53.4	230	72.6	146.6	89.4	72.6	1044.4
231	60.9	169.5	179.7	565.7	166.8	279.1	189.2	170.4	295.4
232	7655.5	69.6	144.4	522.1	6.3	156.1	223.7	143.5	237.3
233	10823.9	8532.5	7380	6335.2	4653	14890.4	6151.6	6357.9	8900.2
235	964.3	116.8	99.5	118.8	232	172.3	135.3	109.6	68.6
236	284.7	110.1	85.2	190	113.2	251.9	125	160.6	109
237	2149.2	2342.6	1981.7	1910	1532.6	1925.6	1630.1	2187	2001.9
238	1376.8	1774.9	1294.3	1639.9	1873.9	1331	1069.9	1075.9	920.9
239	677.1	102.3	55.7	598	88.8	415.3	790.4	144.5	446.3
240	910	202.5	215.3	1413.1	146.1	590.9	1856.1	149.8	658.9
241	1746.2	288.3	229.3	1845.3	213.4	1394.4	2581	292.1	1300.3
242	3459.7	3959.5	1573.1	930.4	1419.2	4708.4	2169.8	1081.9	3241.5
243	789.8	205.4	201.9	189.4	191.5	359.6	385.6	187.1	231.5
244	166.8	289.4	346.4	297.2	266.9	336.1	253.7	298.8	291.7
246	735.5	339.5	415.4	754.5	305.6	434.1	389.1	182.4	1612.5
247	152.5	91.8	114.1	105.7	117.4	162.4	111.1	109	77.5
248	113.4	311.4	156.1	827.2	163.8	295.1	550.6	57.7	969
249	546.3	2609.6	77.3	1171.4	2406.9	1453.1	2505.9	1690.1	2558.1
251	114.6	75.4	190.3	144.5	67.4	139.8	164.5	86.3	272.4
253	343.5	454	621.6	336.8	375.4	294.5	353	308	370.8
254	634.2	878.2	135.8	1836.5	1289.6	195.3	904.4	151.2	1561.8
255	104.9	294.1	41.8	691.5	87	372.2	205.6	116.5	1995.4
256	859.7	310.3	98.5	401.3	162.4	559.4	1488.4	155	514.5
257	100.3	86.9	144.3	100.1	101.5	226.9	206.1	125.7	172.8
258	150.3	110.9	556.9	31	96.4	364.7	435.1	1.3	56.5
259	1252.6	22.5	14.5	71.4	242.1	53.8	318.2	52.7	72.5
260	153.5	162.6	101.6	142.8	117.7	170.7	162.1	100.8	140.1
261	284.9	426	473.6	367.3	285.2	584.1	539.9	954.5	991.9
263	387.1	519.8	1024.7	612.1	575.4	914.8	292.9	533.1	500.2
263	443.5	164.6	135.3	170.4	102.9	275.3	155	114.2	855
265	418.7	323.5	784.9	1333.6	878.4	655	510.2	758	222
266	365.9	238.9	328.9	335.6	303.6	404.8	506.9	500.5	362.2
256	232	48.3	68.8	144.5	86.5	161	74.1	81	263.7
268	789.4	359.6	223.2	619.4	600	188.7	380.9	385.6	616.2
269	29.5	23.7	45.2	37.7	42.9	141.6	73.5	56.7	27.4
270	318.9	330.1	251.6	249.2	249.1	310.4	140.9	168.8	208.5
271	239.6	226.6	272.6	240.3	278.2	416.5	239.5	262.2	282.4
272	529.2	443	502.9	351.9	421.7	790.6	423.8	540.7	390.3
273	2412.2	538	5359.4	2677	2738.3	2513.7	2568.7	3343.1	6538
274	860.6	187.6	415.1	523.9	197.7	408.9	297.8	848.1	225.6
275	810.8	120.9	107.2	223.4	149.2	360.4	213.5	132.2	481.2
276	3000.6	430.1	824.6	833	608.9	992.7	603.1	628.9	1368.2
277	143.4	150.6	195.4	175.5	161.1	288.2	217.2	177.8	321.7
278	1181.4	13.4	74.4	130.2	391.9	174.1	641.2	103.4	104.3
279	3167.2	3036.4	3286.5	3373.9	2195.2	1542	1783.5	1888.5	2287.8
280	2799.6	4372.9	8233.1	4783.5	3720.7	5792.3	3596.6	2627.6	3750.3
281	198.3	45.4	21.1	878.5	124.3	131.5	432.7	26.2	503.4
282	262.4	214.2	212.7	210.6	257.2	367.2	315.7	214.2	206
283	200.9	307.7	203.2	180	205.1	205.9	289.5	199.1	361.3
284	86.1	79	44.8	62.9	58.3	68.8	54.7	64.2	67.5
285	87.3	96.6	120.5	99.3	90.3	149.5	127.6	90	82.7
286	786.2	1509.2	1245.6	480.5	1419.1	1355.4	1398.3	986.2	463.7
287	130.9	88.7	115.7	133.4	101	206.6	124.4	129.4	95.2
288	121.5	110.5	133.2	130.9	129.7	239.3	147.4	130.8	98.9
289	817	97.8	1.2	264.2	130.1	209	209.4	93.1	162
291	128.3	84.3	184.7	105.8	127.5	140.4	106.4	110.2	175.4
292	325.5	712.8	127.1	172.1	269.8	126.4	1240.7	58	79
293	169.4	70.3	44.4	339.3	157.8	14.6	329.2	57	289.7
295	1114.8	74.6	91	388.6	176.3	215.7	303	129.7	708.9
296	1100.3	1475.6	747.1	869.3	1179.1	893.3	1093.5	664	1046.4
297	80.1	103.7	60.5	51.8	26.9	86	54.9	51.9	60.9
298	262.5	378	262.4	322.1	347.3	553.8	442.5	361.5	482.8
299	1244.6	880.6	660.4	1666.7	1114.4	999.2	1190.8	835.1	1409.5
300	221.5	287.8	78.8	1021.2	396.7	142.9	552.3	600.2	1201.1
301	345.6	176.4	916.7	791.8	996.1	2261.6	747.6	1879.6	867.3
302	30.1	11.5	9.6	1.2	9.5	52.1	8.2	31.1	20.4
303	659.7	792.4	1951.7	791.9	1024.8	1077.6	1052.7	1025.2	591.6
304	338.3	113.8	145.9	218.3	159.1	368.5	315.3	213.9	279.5
305	126.3	179.5	829.3	410.1	205.7	213	328.4	168.9	2353
306	137.6	129.3	119.7	111.1	136.2	360.3	171.7	145.8	121.9
307	116.1	98.9	137.8	143.6	128.3	221.3	155.3	111.8	121.6
308	1839.8	1691.4	3877.1	1787.2	1771.6	990	1269.4	1210.9	1188.7
310	746.5	649	365.2	639.4	842.4	331.6	428.2	770.7	283.9
311	148.4	156.4	215.3	228.8	178.6	94.4	194.5	255.6	341
312	960.4	1273.3	387.3	768.1	1668	504.5	546.2	772.8	843.7
313	116.8	110.3	118.2	691.9	301.6	156.3	349.8	120.8	1297
314	813.7	765	104	454.5	738.3	343	480.5	177.9	358
315	511.2	104.2	79.8	249.6	127.6	186.6	134.3	235.8	364
316	333.7	362.7	292.4	420	274.7	331.6	438.9	346.4	445.6
317	135.8	140	147.1	152.2	131.7	314.3	145.4	127.2	161.3
318	177.4	80.7	163.7	110.3	146.9	54.5	212.4	38.7	48.6
319	137.7	159.9	208.9	347.1	302.7	212.6	492.3	225	299.2
320	786.7	569.4	419.9	576.6	664	261.9	358.7	564.8	362.1
321	430.1	418.3	554.5	345.7	495.1	766.8	520.2	522.1	417.8
322	313.5	258.9	206	327.9	350.1	237.1	317.3	284.4	302.2
323	1640.1	3893.2	6623	4933.3	4083.6	4146.3	4123.6	2877.7	8765.3
324	191.6	52.6	89.7	451.6	184.5	161.8	224.9	94.8	485.6
325	252.3	394.8	205	336.6	342.2	306	382.9	200	472.4
326	6503.5	4515.1	5659.1	3116.9	4025.8	4887.6	5753.4	5207.4	3124.3
327	32.7	114.3	47.6	44.2	34.9	28.1	45.1	32.7	122
328	572.1	311.6	141.9	444	207.9	70.7	242.6	305.2	432.5
329	55.7	56.6	98.4	87.9	54.4	253.9	95	87.8	62.1
330	248.9	21.4	18.4	33.3	71.6	70.8	50.4	26.1	41.6
331	262.5	211	258.2	272.6	238.9	488.3	289.6	242.5	276.5
333	527	469.3	712.6	701.7	769.3	702.2	868.3	980.3	1069.6
334	178.8	178	143.4	202.5	157.4	217.1	144	129.4	147.4
335	109.7	80.4	65	59.9	71	237.8	69.3	69.9	140.5
336	478.1	1866	439.4	413	717.7	515.6	725.6	440.9	491.5
337	250.5	86.1	605.5	216	112.1	769	301	201.7	436.9
338	207.4	381.7	182.5	222.8	212.2	291.2	398.5	122.7	422.9
339	491.6	370.5	242.7	371.6	357.1	291.6	301	329.6	333.1
340	262.2	228.9	221.7	277.5	209.8	433.8	234.6	244	238.8
341	553.7	859.2	680.7	749.1	833.5	945.2	877.8	1040.5	836.3
343	82.4	129.6	166.7	112.2	227	121.6	417.5	99.3	261.1
344	1494.7	1234.1	923	1174	1290.7	695.2	1049.8	1243.6	776.1
345	229.2	243.3	208	263.4	197.6	424	253.1	228.2	190
347	2522.7	2002	1475.1	3154.4	2419.4	3643.7	3353.4	2213	2257.1
348	5357.3	8676.5	4846.9	7151	6595.2	9416.2	8225.1	8754.7	7625.2
349	199	234.6	342.6	366.5	251	342.4	222.3	330.6	366.8
350	425.9	228.7	186	194.8	307.5	295.9	344.4	186.6	478.3
351	639.7	438.8	120.8	247.4	113.3	139.6	323	154.5	311.5
352	383.1	438.1	904.1	394.6	424.3	618.5	412.3	428.9	250.7
353	440.7	413.1	270.3	281.2	203	315.4	237.6	265.9	206.9
3e
SEQ ID NO:	871TT	879TT	881TT	882TT	883TT	884TT	885TT	886TT
354	116.3	981.8	502.2	324.4	156.7	786.8	376.6	642.7
355	66.1	8420.7	2645.1	6152	13553.8	2564.7	3412.8	12344.6
356	338.5	1495.5	623.7	501.4	743.6	903.3	1811.4	741.6
357	443.4	1347.3	566	608.2	679.7	484.6	1559	983.6
358	700.6	1921.2	2381.5	2373.2	1674.3	2027.6	3756.9	1590.4
359	376	185.1	264.6	206.9	308.2	331.9	281.8	247.9
362	655.5	1294.9	729.9	1088.1	864.4	1725.1	1214.9	1246.6
360	266.2	611.8	464.8	543.6	452.1	537.3	693.4	474.9
361	152.3	149.9	338.7	186.5	167.3	256.5	235.5	312.1
363	570.7	493.8	575.1	513.3	517.2	615.3	759.7	454.4
1	130.2	622.4	1944.7	1584.5	1981.6	1283.3	420.9	1894.3
2	411.7	1993.4	3797.1	2512.7	4511.4	2897.7	1254	3862.9
7	372.9	193.8	680.5	596.1	614.8	129.5	2.7	504.2
8	2363.3	511.5	342.5	363.9	358	497.4	221.6	355.6
9	381.6	1198.7	1487.5	781.6	985.4	2024.6	3933.7	1448.2
10	171.5	160.4	133.2	137.6	129.1	154.3	182.4	107
11	324	858.2	937	906.4	953.3	1879.7	1481	2251.2
13	126.1	303.3	531.1	319.9	664.9	496	223.2	472.7
14	295.2	932.1	1713.8	1521.7	2129.6	2134.5	1840.1	2225.4
15	95.6	2064.6	1333.1	540.9	265.7	569.7	709.8	1795.9
16	511.2	3919.7	2909.7	3131.8	3773.6	3125.2	3619.3	3331.5
17	214.6	800.5	1475.1	1075.3	1483.6	1162	1482.8	1281.8
19	198	274.5	768.1	268.8	208	509.4	276.1	570.1
20	1988.3	739.3	319.5	316.5	192	142.3	242.8	575.4
21	34.6	2492	1542.8	2495.1	1851.5	2668.6	1631.9	2770.3
22	1078.1	4211.3	4116	3543.7	3242.1	4723.4	3467.8	4881.8
23	1.1	825.2	1432.3	370.9	163.9	1192.4	221.9	1517
24	74.6	391.1	433	388.2	211.7	258.7	300.5	572.7
26	48.4	921.9	4466.3	587.5	349.2	1513.7	644.9	1870.3
27	495.1	654.3	1266.2	1076	1461.5	696.9	334.7	1531.4
29	381.5	152.8	91.8	35.9	162.7	135.1	152	238.5
30	31.3	686.6	444	223.3	222	321.8	356.5	825.6
31	635.6	18297.7	14048.6	8744.1	15394.7	17798.2	16472.5	12208.2
33	439.9	7923.9	4124.5	3804.6	3932.5	2361.7	3149.1	7173.6
34	3213.6	825.9	1104.9	697	285.8	603.4	436.7	1025.5
35	22.6	2143.6	1770.3	1187.9	1220.4	1620.3	1651.3	529
36	492.1	322.5	1635.1	387.3	554.6	818.8	268.4	1021.4
37	429.6	140.1	245.5	191.1	224.1	241.8	207.1	178.5
38	237.9	1844.2	2220.8	794.4	644.7	984	292.1	3477.4
40	451.5	617.3	495.8	1186.4	725.4	800.6	880.8	1036.1
41	252.1	1258.8	943	4956.1	2394.2	566.6	987.6	3025.4
42	579.4	532.8	258.1	1104	396.5	335.9	491.3	504
43	1029	384.9	273.6	344	416.5	403.9	517.2	325.7
44	565.3	1802.4	1501.6	1596.1	1100.9	1275.9	1583.2	1199
45	1500.8	1346.9	1175.4	1573.6	2053.9	971.8	332	1783.9
46	307.7	539	343	380.7	553.4	414.6	398.2	340.8
47	67.8	1213	521.9	742.8	498.1	507	1389.1	810.8
48	6.2	645.9	561.5	325.6	92.6	189.4	537.5	190.6
49	192.1	1573.1	2319.6	1719.2	1210.4	6469.1	1691.6	1799.3
50	2	1030.9	954.7	379.1	309.7	799.1	597.4	2116.3
51	772.5	259.7	304	170.3	108.1	1357.1	408.8	394.9
52	193.2	298.8	343.6	347.9	276	289.4	348.2	335.9
53	153.5	1632.6	2144.7	2293.9	2026.5	1732.8	446.5	1982.9
54	809.7	1147.3	1387.6	2014.6	1631.7	1524.6	1231.9	2093.8
55	147.7	86.2	101.7	108.3	85.2	103.3	116.6	62.5
56	130	94.8	277.7	121.8	341.8	98.5	180.9	241.4
57	777.3	1976.6	14161.4	3909.2	3643.6	667.8	1053.7	5922.8
58	1225.7	5418.7	14855.8	6952.4	4309.6	3516.6	6571.6	9242
59	271.6	3644.3	3754.4	4801.4	3817.3	6657.4	4444.2	3360.8
60	159.2	218.9	601.1	529.4	311.4	171.9	231.9	506.7
61	138.9	159.4	118.4	73.6	104.8	116.1	164.5	81.1
62	3244.1	5818	1646.1	2645.7	3666.2	3358	2535.7	4029.7
63	157.2	628.9	667.9	804.6	516.3	778	703.2	578.3
64	994.5	119.1	251.9	202.5	258.2	236.6	151.1	722.1
65	35.2	209.3	234.7	217.1	113.7	118.8	146.7	305.4
66	437.5	2105.5	1849.4	2646.8	2322.7	1754.7	1801.8	1830.2
67	13299.5	26691.3	29363.4	21948.4	30861.2	27520.3	32791	27456.3
68	1527.1	379.2	840.8	286.8	238.8	383.7	53.6	2104.6
69	5084.1	1418.5	1727.3	964.1	782.1	2036.1	478	3532.1
70	9067.8	5289.8	5151.5	5378.2	4923.7	7248.8	5765.7	6685.7
71	356.7	3218.2	6059.4	4739.2	7588	3114	2518	4665.5
72	126.9	2024.9	3174.2	2185.2	2596.3	2512.4	2145.9	1991.3
73	163.4	917.4	942.3	785.8	642.5	1021.7	1109.2	1059.2
75	234.3	480.2	1234.8	2124.7	1532.8	329.3	830.5	2611.1
76	1819.9	1037.3	1473	1162.8	2498.4	959.8	921.6	1764.5
77	5259	3101.8	1035.9	1814.1	885.5	1999.1	3528.7	1319.6
78	568.7	520.5	454.4	245.9	225.2	250.6	256.7	390.8
79	402.6	303.3	288.4	416.4	496.9	377.6	309.8	241.7
80	141.1	1486.2	1527.9	1160.9	747.9	1195.7	1756.4	792.8
81	189.9	13371	7841.3	9074.6	16493.4	8121	5097.9	11272.1
82	435.3	141.8	224.9	197.1	249.7	31	6.8	170.9
84	71.2	138.6	259.2	151.7	138.9	415.1	303	326.8
85	187.8	1315	612.4	336.4	240.8	318.3	399.8	1550.2
86	93.5	90.2	120.7	294.3	724.1	302.7	89.1	261.7
87	539.5	1122.1	581.5	1395.1	1476	1619.4	1043.7	2328.9
88	3161.6	561.1	1162.2	632.3	466	750.6	597.3	1050.6
89	317.9	237.2	318.3	196.3	337.5	343.7	255.7	239.7
90	111.8	266.6	953.6	334.9	123.2	226	325.2	129.6
91	1023.4	3728.1	4506.6	4033.4	2043.2	2095	2191.9	3082.3
92	2374.9	4865.1	6296.6	8454.9	11642.6	11587.7	9943.6	10568
93	103.8	133.1	109.8	121.6	41.7	69.9	17.1	166
94	59.2	296.8	784.9	944.1	600.5	776.8	481.1	1257.8
95	69	126.3	450.5	453.8	310.8	189.3	165.4	142.4
96	147.8	682.4	387.8	387.3	404.3	357.9	565.3	420.4
97	204.3	883.1	454.1	708.8	421.4	468	686.4	732.8
98	728.4	10.5	42.6	72.2	43.5	29.7	53	36.4
99	210.6	821.1	369.4	814.2	595.6	485.9	696.6	541.1
100	995.9	102.8	3585.7	89.5	34.3	2798.5	112	3456
101	133.4	146.6	270.3	174.9	310.3	198.2	121.7	192.7
102	190.6	110.7	244	152.9	172.3	180.7	158	123.8
103	379.6	430.7	535.3	399.6	560.3	572.8	586.9	406.8
104	252	69.6	93.2	189.4	28.6	67.4	16.2	92.3
105	363.6	168.9	116.4	217.8	70.2	146.4	118.2	171.8
106	442.3	95.1	136.6	154	56.3	79.8	12.9	109.4
107	301	538.7	356.6	408.6	301.5	322.4	420.8	596.8
108	255.8	236.3	168	137.3	106.8	179.7	237	170.7
109	169.9	1482.1	544.7	1597	294.1	1205.6	1691	683.9
110	322.7	1903.7	1404.2	4278.2	691.9	2791.8	2817.9	2504.6
111	252.7	25.4	233.3	24.4	63.4	101.2	47.1	118.3
112	633.2	1314.2	1405.6	2124.5	1859.3	1085.3	587.6	1601.9
113	164.4	330.6	333.5	268.5	218.6	285.2	237.3	350.6
114	88.6	309.3	1164.6	333.2	513.7	630.7	664.7	778.3
115	326.5	1299.5	1101.1	1198.8	1051.2	817.4	1102.2	1084.6
116	252.3	360.5	666.1	1347.3	817.6	327.9	554.6	825.9
117	42.1	101.1	493.9	114.6	74	399.7	133.8	234.5
118	1176.7	116.7	300.6	130.5	200.8	470.8	207.3	112.5
119	98.3	184.2	281.1	245.5	317.6	213	191.2	336
120	99.5	98.8	155.8	124.7	95.6	98.9	123.9	78.9
121	234.8	2992.4	4320.2	4055.8	3020	5336.5	3158.4	5803.1
122	645.9	446.7	248.2	356.4	312.1	428.7	329.5	346.1
123	300.8	313.4	352.6	504.1	413.5	386.8	444	417.5
124	4390.2	96.1	118.6	125.8	161.7	134.4	182.6	94.9
125	1484.8	805.4	27732	982.2	7375.5	984.2	1310.9	807.1
126	278.6	56.9	192.9	24.9	31.8	77.8	104.9	66.8
127	114.5	332.1	225.5	171.6	237.5	193.8	339.3	225.1
128	318.6	181.2	386.4	213	69850.3	108521.8	356.1	93954.5
129	176.1	1916.3	1120.7	2375.9	2049.1	1464.3	1602.6	1660
130	114.6	735.8	381	595.7	599.3	446.9	434.4	456.6
131	236.1	156.9	297.1	426.8	385.2	268.2	149.3	279.8
132	169.8	303.3	464.3	423.7	368.6	256	428.6	304.5
133	102.5	245.3	224.6	394	186.7	265.2	300	269.3
134	175.1	516.6	316.3	534.3	524	626.6	679.7	687.4
135	170	964.7	971.6	756.7	562.2	683.1	1544.5	931
138	145.9	173.1	201.3	127.5	189.1	187.4	173.9	166
139	66.8	286.4	170	167	270.8	159	281	340.1
140	26	16.5	135.6	163.6	1.2	183.8	98.2	1064.1
141	407.3	178	380.3	594.8	275	1127.7	586.1	346.3
144	370.2	23200.8	7070.4	20031.2	20055.7	5695.1	21008	16416.4
145	203	197.5	215.6	241.1	234	295.8	284.7	197.3
146	299.6	606.7	853.8	1054.9	249.3	683.3	966.5	411.5
147	34.5	138.1	361.4	219.1	120.1	69	110.2	51.6
148	200.3	1072.9	641.5	371.8	309.3	1298	734.4	563.6
149	147.1	811.8	330.1	243.5	389.9	584.1	960.6	374.5
150	243.6	194.2	614.8	339.8	227.4	390.5	510.2	508.8
151	103.4	200.9	536	659.6	1097.9	831.2	572.5	1463
153	102.7	134.4	117.8	319.9	659.8	147	158.2	276.8
154	64.7	5340.9	7684.3	4496.6	6819	3595.6	1313.4	7444
155	155.1	604.1	224.8	527.6	443.5	980.8	352	708.4
156	117.9	162.1	382.4	213.5	503.7	174	219.3	257.1
157	134.1	215.4	212.5	227.7	257.4	258.4	309.6	331.4
158	857.5	149.9	598.8	544.5	850.2	506.6	301.4	728.3
159	1385.8	1366	1517.3	1101.7	1387.1	1799.8	2020.5	1476
161	950.1	6758.6	7657.2	10885	16984	4705.2	7562.3	6065.7
162	12.5	256.2	584.1	235.7	456.1	369.3	231.2	451.5
164	47.5	347.7	1040.5	4140.2	1526.9	2205.5	1430.7	7468.9
166	4175.2	1086.4	1301.1	700.5	641.4	1360.7	585.8	1191.3
167	545.5	254.9	1335.1	355.9	1787.4	118.5	231.5	771.1
168	140.6	1535.5	1213	549.9	594.1	1616.8	2190.3	639.2
169	582.9	12292.6	13216.5	15240.1	14867.1	7648.8	9941.3	13159.9
170	857.8	2119.5	2344.7	3361.9	2260.9	2642.5	1920	3323.2
171	1.1	1063.9	967.8	79.8	105	514	339.5	801
172	489.3	575.3	552.3	483.9	608.6	582.7	664.1	514.2
173	168.3	410.3	1713.9	878.7	690.8	1123.5	254.3	2373.9
176	50.7	173.8	993.1	155.4	1107.2	1814.1	400.9	1423.1
177	610.5	234	350.8	201.7	455.2	147.8	113.6	315.4
178	670.2	457.3	1924	1409.8	1033.8	1365.3	281.5	700.6
179	188.9	540.8	1136	1826.7	836.8	964.6	165.7	1383.2
180	208.1	750.5	880.8	997.3	460.6	628.8	717.2	618.1
181	9102.8	4805.7	6228.9	4111.8	3157.6	5112.8	5426.8	4235.7
182	244.4	524.8	434.5	395.3	395.9	340.8	570.4	455
183	1.1	286.3	920.2	156	69.6	540.1	211.4	691
184	202.5	365.3	361.1	2170.5	3042.7	341.2	479.3	909.8
185	707.4	2338.2	5269.7	5295.8	3116	6542.9	3238.5	6677.1
186	1338.6	98.2	262.6	165.5	183.3	170.6	131.9	218.6
187	301.2	421.4	792.2	247.6	123.3	291.1	366.9	720.2
188	54.4	507.9	399.8	687.8	469.2	348.4	605.1	684.6
189	68.7	209	287.2	379.3	305.1	161.4	160.7	404.9
190	199.8	242.2	483.5	455.5	631.9	241	71.1	375.7
191	1726.7	4039	3532.7	2210.1	1524.2	4609	6889.4	3737.3
192	89.6	89.6	157.2	211.4	92.6	233.7	145.8	105.4
193	85	216.9	219.4	119.4	69.2	392.2	176.5	239.5
194	49.9	282	251.7	297.8	199.9	135	172.5	243.3
195	712.1	117.7	174.3	152.9	85.3	174.3	73.7	152.1
196	2873.3	845.8	1650.6	1499.5	1608.9	962	584.5	1404
197	483.3	253.5	190.9	146	112.4	139	144.8	141.2
198	126.6	4231	1176.9	1159.9	1263.8	999	925	2035.1
199	87.2	9967.3	4014.3	8315.9	19492.1	4175.4	4540.2	17229.4
200	344.7	460.3	1008.1	823.2	437.1	394.5	655.2	945.4
201	122.7	1085.1	434.8	378.2	229.8	766.3	506.3	515.7
203	678.5	1088.3	1322.9	1133.7	3167.7	436.2	563	3185.7
204	634.2	3003.4	1397.7	1339.9	1300.3	1299.2	2900.2	1073
205	946.3	5589.7	3415.4	3931.9	4602.2	5034.5	4943.8	6059.1
206	278.8	299.7	268.4	293.8	350.2	398.3	635.4	241.1
207	125.7	79.6	212.3	46.6	106.6	58.1	57.3	679.7
208	5.4	3861.8	679.2	3099.7	462.3	711	799	604.6
209	648.2	26.6	610.8	71.6	104.3	77.3	72	161.4
211	5817.8	134.3	575.9	84.6	135.1	1200.4	233.2	1507.1
212	1458.6	689.4	1135	1092.6	988.6	986.3	460.6	1341.5
213	7576.6	117.6	121.9	100.6	96.3	151.6	183.1	136.2
215	71.8	73.2	323.2	71.1	161.2	100.5	30.8	676.7
216	415.9	276.5	268.1	173.7	199.3	277.1	434.2	282.3
217	78.7	959.5	2746.7	1024.9	2616.6	671.5	359.6	850.8
218	268.3	172.1	161.1	189.2	123.2	160.7	128.5	186.8
220	134.5	72.8	184.9	96.1	84.3	650.4	100.4	81.9
221	207.5	1438	1268.5	2111.3	963.7	1155.3	1048.4	1581.4
223	308.1	673.6	497.3	535.5	748.5	534.7	710.2	869.9
227	474	3740.6	3123.8	1451.8	740.1	1207.8	1221.4	3703.7
228	553.9	202.8	342.4	247.9	322.9	245.3	315.9	260.5
229	978.6	365	204.1	229.3	104.9	176.7	197.5	149.4
230	157	4381.3	4364.6	3469	4117.2	2984.9	4092.3	2935.6
231	299.2	338.1	519.6	436.9	1304.6	261.4	183.1	1209.9
232	1.2	479.7	2967.9	397.7	283.8	1161.6	447.9	1442.7
233	1408.3	17920.3	13126.5	7241.8	19318.8	13487.2	18348.9	15152.5
235	22.6	659.3	624.9	172.2	155.8	342.8	152.7	485.3
236	244.8	153.5	397.3	304.6	449.7	331.3	200.6	282.5
237	841.8	1675	2348.2	1931.5	1633.1	2253.2	749.1	1687.1
238	606.8	847.7	670.6	582.6	625.6	723.4	726.5	667.2
239	455.9	304.4	1179.8	492.8	201.3	464.9	311.9	376.9
240	756.3	795.3	1590.4	747.3	330.3	1193.3	846	709.6
241	1604.8	957.3	2984.8	1412.5	619.3	2269.1	981.8	1321
242	13722.5	46283.3	32477.3	33142.3	38026.7	42087.5	49249	39172.5
243	322.6	586.6	483.3	483.6	499.4	723.7	534	603.1
244	80.8	1208.5	771.3	1636.9	1032.2	928.2	507.9	553.8
246	167.7	2506.3	1683.7	2500.3	1675.8	557.3	1133.6	1677.5
247	116.8	115.5	128.4	104.8	125.8	135.7	147.3	96.5
248	309.3	1728.9	1916.3	3434.3	3874.7	1004.6	2401.7	5089.3
249	432	681.6	804.8	479.8	417.3	1208.2	1265.1	742.5
251	134	671	368.8	2493.8	784.3	1646.7	587.9	1794.9
253	375.8	544.2	623.3	589.2	333.1	383.4	859.9	310.8
254	716.8	989.8	1029.3	1067.7	790.5	817	991.7	1396.7
255	777.9	706	2286.6	1766.1	1100.5	1765.9	286	948.3
256	645.4	3136	3129.7	3456.4	1905.4	1995.5	3000.3	2611
257	107.8	348.2	360.1	289.9	300.9	240.8	403	750
258	83.1	3074.5	844.5	2046.8	1476.7	3628.7	3511.2	2536.1
259	1.2	668.5	1027.2	351	524.2	1117.3	356.7	500
260	185.4	108.7	158.6	251.8	168.6	182	256.7	116.2
261	73.8	130.7	187.3	61.6	210.2	242.6	130.1	258.1
263	919.6	1233.9	819.4	1299.4	572.7	912.1	1233	872.7
263	199.8	4626.1	3402.3	3087.9	3813.2	3582	6403.5	3036.9
265	310	125	156	135.2	128.1	234.7	96.8	155.8
266	381.6	899.6	433.3	530.4	242.9	358.6	641.2	241.1
256	130.8	141.8	211.4	344.3	408.2	195.6	211	388.4
268	155.9	135.7	783.8	251.7	990.9	145.6	77.9	262.5
269	70.4	137.9	127.4	87.5	920.7	144.7	106.4	123.1
270	906	197.1	177.3	148.3	194.1	214.8	161.2	198.9
271	197.7	411.2	613.2	278.3	1153.3	2568.1	824.5	1254.6
272	530.2	865.4	861.9	814.5	776.6	929.7	1402.4	1012
273	2.1	207.7	884.3	165.7	2070.8	969.7	200.6	1967.3
274	1050.2	932.1	1127.6	1151.3	1481.1	2100.5	1603.4	1010.4
275	277.8	674	1507.8	1511.2	956.4	1603.8	960.9	2338.9
276	496.5	4907.8	5071	1824.8	921.9	1584.4	1043	6199.7
277	159.6	251.2	318.9	445.6	355.2	318.1	503.6	277.7
278	15.3	1224.6	1434.2	602.7	1133.3	1898	1401.1	984.1
279	678.5	1074.4	1101.7	1030.5	1878	1425	1541.1	2160.3
280	1096.5	3203.9	2152.5	2126.2	3768.5	4309.6	7516.9	4768.7
281	38.3	590.9	605.4	938.5	832.1	257.9	315.3	385.4
282	407.5	416.5	704.2	1079.1	1604.5	485.4	482.3	1146.7
283	603.1	605	593.6	521.9	638.2	488.6	789.7	516.5
284	131.4	59.7	136.2	49.9	188.8	106.8	101.5	85
285	154.1	117	110.9	109.1	135.7	131.9	163	116
286	530.4	43.8	59.5	27.7	22.9	109.8	66.7	34.6
287	102.4	116.9	133.6	99.1	113.6	295	171.3	79.7
288	160.1	126.6	179.5	153.3	164.7	202.8	216.9	139.7
289	1536.2	4488.8	4944.9	1532.8	3646.8	5911.3	4344.5	8246.5
291	102.7	248.4	286.1	208.5	228.9	130.1	253.2	374
292	42.7	732.8	8793.1	18089.3	3318.5	3787.1	10588.9	8088.8
293	271.4	344.8	740.3	493	462.9	499.8	453.7	383.2
295	727.5	890.4	2593.2	1314	3115.5	310.9	729.5	1143.9
296	887.9	2346.4	1719.1	1863.5	1576.8	2166.6	2085.1	1930.4
297	96.5	59.7	110.1	83.1	71.1	60.1	112	82.2
298	546.1	730.6	785.4	968.7	730.8	563	1034.8	859.8
299	691.2	3305.3	2824.9	5439.5	1735.1	1756.8	2682.4	4873.4
300	323.5	1392.4	991.4	1256.6	1607.8	1164.4	1068.3	1558.2
301	728.3	209.7	186.7	221.8	162.3	294.8	281.5	306.3
302	7.7	347.9	205.9	264.9	249.4	213.4	340.1	128.4
303	488.4	309.5	299.3	350	256.8	366.4	288.4	319.4
304	190.4	376.7	480.7	406.4	314.9	1106.8	764.9	973.2
305	478.8	246.1	628.7	2896.4	633.1	802.4	305.6	892.8
306	159.1	618.4	450.3	475.8	439.9	1419.5	763.8	450.3
307	132.8	254.7	425.8	462.3	354.6	254.6	307.1	237
308	5822.9	744.5	524.5	787	589.2	606.8	354.7	424.9
310	1068.6	151.4	133.4	116.4	77.7	177.3	68	124.3
311	36.2	641.7	499	622.8	349.4	351.8	356	454.7
312	4778.5	245	143.2	236.8	4.3	250.7	224.5	335
313	136.4	173	383.6	419	537.8	354.8	230.1	549.2
314	485.9	926.3	1589	956.6	1048.3	1458.6	629.4	877.4
315	125.9	82.4	187.2	88	58.7	77	93.2	43.3
316	367.6	574.4	633.7	462.8	337.8	583	763.4	450.7
317	145.2	202	1956.5	215.8	199.9	250.1	242.6	647.4
318	22.4	277.6	212	450.5	289.2	439.1	285.9	458.3
319	1838.4	512.3	276.4	733	268.8	487.6	670	354.9
320	477	181.1	267.8	128.4	160.8	244	142.2	214.4
321	718.7	163.3	292.4	134.5	159.2	263	227.2	257.6
322	440.4	379.6	285.7	360.6	238.3	342.7	305	208.4
323	1582.3	3954.1	3885.8	3447.2	3490.5	3121.3	3460.9	3724.3
324	112.2	445.5	257.9	704.3	519.5	235.2	528.1	737.5
325	190.1	374.9	430.9	503.9	541.5	326.1	367.3	610.4
326	422.9	4053.9	6121.7	4456.6	1364.3	5707.5	3498.2	4848.9
327	5.6	292.7	203.1	609.7	707.7	133.8	263.6	273.5
328	72.2	52	299.8	94.6	299.9	87.1	27.6	114.9
329	216.1	65.5	49.1	96.4	60.5	118.7	102.7	76.4
330	74.1	438.1	1060	824	632	896	708.8	558.4
331	783.2	297.5	466.2	372.3	422.4	374.2	562	297.2
333	216.1	167.4	206.9	194.6	174.5	38.1	190.6	149.2
334	107.8	126.8	470.1	153.1	513.7	220	141.5	193.3
335	570.7	191.9	697.3	783.9	505.5	208	243.3	414.7
336	491.6	342.6	210.4	272.6	218	256.8	428.3	243
337	127.4	619.5	632.8	711.3	511.9	972.3	606.6	804.8
338	180.6	1559	1838	1292.5	2158.9	837.9	1460.8	1632.3
339	303.9	217.3	347.8	220	329.4	258.1	219.3	184.2
340	185.5	137573.8	177311.9	54500.9	184533.6	59673.9	314613.6	86723.1
341	412.2	585	708	530.7	576.4	437.9	557.3	684.6
343	7951.1	2880.9	1575.6	1520.5	3477.9	2425	2379.2	1087.2
344	1755.5	649.1	436.9	434.5	285.2	463.7	452.7	599.1
345	236.2	296.5	511.3	662	580.8	429.8	424.2	488.6
347	821.3	1063	3642.7	1447.8	4119.2	1163.9	1210.2	1782.6
348	1679	4474.7	7575.3	4999.7	6225.7	3803.1	3979.1	4537.5
349	256.8	526.7	376.5	477.4	483.9	423.5	503.2	641.4
350	210.5	768.8	682.2	677.9	628.8	579	671.7	500.6
351	119.8	929.5	1553	2794.5	1558.8	1728.2	788.7	1446.6
352	435.7	264.1	190.3	177.4	180.3	233.4	304.2	190.7
353	385	500.7	566.6	574.8	346.1	382.1	487.3	473
3f
SEQ ID
NO:	892TT	893TT	894TT	896TT	898TT	899TT	900TT	901TT
354	838.5	571.4	438.3	31.6	78.4	438.1	332.3	995.7
355	5801.6	1326.3	4267.6	187.6	121	2990.3	3907.9	3595.2
356	672.9	416.1	1076.3	2648.9	200.3	682.2	309.3	200.9
357	815.8	844.6	869	1303.9	212	719.3	729.3	131.3
358	1742.6	1693.2	2440.3	1481.7	366.4	2077.8	2415.2	704.2
359	186	222.6	304.4	405.5	466.7	343.4	245.5	236.6
362	2087.5	1335.3	1239.7	326.8	171.4	870.6	879.2	101.1
360	472.7	502.8	559.4	1042.8	290.1	549.2	506	174.5
361	390.4	80	162.4	329.8	212.1	162.1	138.5	149.9
363	335.6	549.7	748.6	666.9	742.2	461	356.5	506.8
1	1364	864.1	2300.1	1111.5	725.5	1891.2	735.8	1211.8
2	8223.2	2863.6	1612.1	3492.1	669.6	1116	3477.7	10076.1
7	621.3	68.9	83.5	28.3	339.5	548.2	237.7	108.6
8	434.3	297.2	236.7	314.4	1057.9	469	735.8	1382.2
9	2209.5	1428.7	2874.5	9019.8	219.4	1483.2	931.8	299
10	87.4	318.6	123	113.9	359.9	132.2	797.4	116.1
11	2437.4	1234.9	867.7	1328.7	332.7	722	898.4	645.5
13	397	162.2	347.3	290.4	118.5	313.3	718	1070.4
14	2294.4	977.8	1525.3	1055.3	256.2	1105.9	2608.5	4093.2
15	828.3	416.9	482.6	728.2	16.4	502.2	3166.5	179.1
16	3234	2475.7	4710	1027.1	239.9	3055.6	4422.5	721.2
17	2718.1	742.6	607.2	522	240.9	762.6	1568.9	129.7
19	1086.6	248.6	333.5	226.7	290.8	444.8	7182.8	1716.2
20	192.8	641.7	12.5	39	1.2	792.4	372.3	36.3
21	1826.1	4120.6	1923.8	941.2	238.4	2518.7	2236.8	94.6
22	8192.1	2215.6	1368.7	1592.1	753.1	5336.9	2477.2	299.2
23	687.5	415.7	227.3	1.1	1.1	709.6	2476.1	179.7
24	326.7	113.9	163.5	127.1	110.4	165	803.4	105
26	1128.9	408.7	398.2	63.7	106.1	1433.6	5983.2	1234.8
27	1213	865.2	488.6	772.5	725.7	1107.3	619.8	58.3
29	134.2	85.5	245.2	242.8	215.1	196.6	356.2	198.7
30	362.2	248.6	151.7	102.9	16.7	261.5	1169.1	236
31	9692.5	20154	18540.6	1550.9	250.2	15669.5	3557.5	5.2
33	1841.1	2277.7	1079.8	442.8	137.2	3329.2	14318.3	588.8
34	826.4	839.3	441.4	624	4011.4	566.1	579.8	2078.9
35	1512.1	1217.1	1163.2	194.2	132.8	1055.6	1451.8	26.9
36	2188	735.7	379.8	646.9	507.5	1041.8	675.2	8116.1
37	133.7	152.8	191.6	188	737.6	240.4	318.6	263.7
38	776.1	895.4	248.4	519.4	99.4	1003.5	6688.2	339.4
40	910.9	789.8	648.8	518.5	810.2	652.7	553.1	417.3
41	922.5	3053	1250.6	119.4	254.6	779.1	3979.3	333.2
42	343.8	889	400.7	444.1	260.1	318.1	535.4	200.6
43	219.4	422	417	1244.1	1305.2	310.9	593.5	1335.2
44	1388	1454.8	1175.7	1009.9	401.4	945.2	1312.6	316.6
45	1335.6	1007.6	839.8	405.9	730.7	1723.4	1554	740.1
46	281.1	267.6	425	376.4	402.6	326.4	1021.7	863
47	739.5	340.9	354.1	543.9	308.4	485.9	555.9	1064.5
48	570.5	23	230	40.3	27.6	142.1	56.8	273.5
49	2690.8	7059.8	2365.9	162.5	247.7	3550.1	610.3	195.8
50	582.4	319.5	412.6	124.5	80	377.8	1255	230
51	530	1015.7	325.9	138.5	2289.9	333.2	623.9	65.3
52	333.7	327.9	286.2	281.6	329.4	221.1	347.5	493.3
53	3598.9	1864.6	1743.5	365.8	89.1	1567.9	1670	73.1
54	1988	1754.5	1175.5	286.1	91.4	1181.1	1478.9	2364.4
55	85.9	96.8	95.9	124.3	145	85.6	80	140.6
56	213.9	163.6	156.6	39	62.8	229.7	214.4	57.5
57	6568.1	82.1	618.1	951.4	256.7	1930	764.7	814
58	10305.1	843.3	1639.6	3341.1	274.3	2514.5	1398	1879.6
59	4632.7	8361.8	4125.6	1656.3	319.1	4755.6	2037.8	1675.3
60	510.1	221.7	136.9	117.4	148.1	354.9	336.7	187.1
61	98.3	111.4	123.3	179.6	275.5	108.5	72.9	74.6
62	5423.2	3854.1	2373.9	8567.7	2395.3	3812.3	2208.6	1481
63	830.4	1299.6	461.4	605.2	69.5	803.8	256.1	37.7
64	479.7	114.8	188.8	126.9	488.9	197.6	329.8	245.9
65	389.5	110.3	87.8	50.1	50.1	176	383.4	101.2
66	1831.2	3206.9	2835.9	601	634.9	2474.7	1318.9	103.3
67	26156.4	24869.8	31314	34527.1	10176.9	25736.9	1905.1	173.4
68	821.8	40.7	2360.3	789.4	2432.7	943.9	68.9	1.1
69	2579.5	781.6	1976.3	1894.3	5728.2	2305.4	397.5	111.3
70	5688.9	8491.7	8887.2	2267.9	5973.9	8571	4098.7	128.4
71	3496.6	5511.6	2751.2	100.6	65.6	3748.2	10193.5	626.2
72	3296	2026.7	1766.1	530.8	106.1	922	2699.1	99.9
73	763.6	839.9	660.7	520.4	264.6	888.6	359.2	419.4
75	4452.7	1125.7	275.2	310.3	145	804.4	156.6	359.9
76	2427.6	2043.5	940.2	329.2	2388.1	841.4	3184.4	22133.7
77	563.4	2247.6	3062.3	6825.9	2972.1	1722.2	280.8	2325.7
78	623.5	124.1	227.5	554.4	340.2	302.3	207.6	170.9
79	297.9	552.3	257.1	484.8	185.7	287.4	938.8	230.9
80	2294.3	1015.3	932.1	949.4	267.8	937.2	1004.6	2105.3
81	8681.4	6802.8	13448.3	318.1	159.4	16138.8	9121	168.3
82	128.2	99.7	135	270.9	561.7	187.3	146.7	52.5
84	308.9	120.8	130.3	138.1	893.7	256.5	336	131.7
85	410.7	2865.5	317.4	179.7	186.4	225.1	1173	198.2
86	71.5	641.8	296.9	391.1	257.7	123.2	2621.8	23448.8
87	689	3701.3	2676.7	616.5	261	857	2313.9	324
88	712.7	622.2	840	1105.6	1000.6	639.5	272.4	1569.4
89	295	186	158.6	179.6	961.8	277.3	453.9	155.9
90	215.5	68.7	167.8	107.4	122.9	164.7	1000.2	289
91	7519.7	924.8	1647.3	799.8	217.9	817.9	2001.9	2046.3
92	11830.9	13031.1	13383.8	7238.6	302.1	3811.1	5046.1	174.3
93	115.5	87.8	34	89.4	211.9	78.4	109.2	75.8
94	767.1	1362.1	410.1	191.2	97.7	553.9	380.2	39.9
95	299.5	345.9	216.6	55.5	193.5	512	708	62.4
96	353.2	438.1	419.9	460.6	210.2	326	144.2	304.2
97	808.2	693.9	524.2	2786.4	252.2	405.5	344.9	189.9
98	20.1	38.9	44.1	21.6	22.7	45.4	14.9	853
99	1151.9	1198.4	389.3	273.9	337.4	383.1	950.5	207.7
100	152.9	90.9	122.7	552.8	61.1	313.3	41.7	36022.7
101	260.8	135.8	150.6	140.2	234.4	326.1	275.4	121.1
102	117.3	164.9	193.6	214.6	452.9	190.4	161.9	15084.6
103	359.7	366.5	553.1	618.6	458.1	556.4	352.4	349.3
104	72.3	85.7	95.1	84.2	660.1	174.1	49.8	301.7
105	76.8	146	192.9	201.7	396.4	190.8	55	576.1
106	80.9	148.1	99.6	97.2	589.1	212.8	79.7	301
107	207.3	184.2	599.8	177.7	156.9	201.1	710.6	224.5
108	163.3	204.4	177.6	565.4	277.2	123.7	285.7	396
109	1770.9	611.2	2356.1	78.1	65.3	737.6	812.4	1225.9
110	3284.9	1445.7	5145.6	1.2	1.3	2012.1	2144.5	3019.9
111	125.1	46	62.7	29.8	254.8	274.1	161.3	39.9
112	616	1456.3	1415	289.8	56.8	1850.3	2408.5	94.2
113	484.5	533.3	277.4	98.1	241.5	317.7	339.8	66.4
114	600.1	371.3	562.4	290	103.7	987.5	502.2	156.9
115	1041.7	1742.3	1015.4	1023	384.6	1053.1	733.8	268.3
116	932	296	381	243.7	236.9	432.4	1273.7	147.7
117	339.7	124.5	167.1	263.6	190.4	177.4	107.7	55.5
118	69.7	220.3	177.8	130.5	3113.8	104.8	101.3	865.7
119	298.6	219.6	301.2	94.8	80.9	379.1	460.6	53
120	98.3	53.4	99.6	177.4	150.1	98.1	1050.9	126.1
121	5866	1900	3972.7	505.4	92.2	6630	207	2844.8
122	322.1	911.3	404.3	385.8	240.5	366.3	568.3	63.3
123	404.9	634.2	345.1	149	392	340.4	234.3	311.6
124	131.4	129.1	160.1	787.8	2835.4	130.4	121.4	150.7
125	723.6	926.1	1036	939.9	2182.9	947.8	12974.8	522.7
126	141.1	30.5	89	159	1503.2	35.6	3.1	355.9
127	191.9	184.3	258.1	319.5	139.6	201.4	155.4	104.9
128	179	235943.8	208.7	264	359.9	236127.3	90211.9	230929.7
129	1267.5	3432.6	1214.7	246.9	149.3	1110.6	5445.8	153.6
130	540.5	632.3	587.9	375.8	113.6	347.2	1074.4	82.4
131	856.8	607.9	246.2	90.3	123.9	357	480	54.8
132	387.6	420.8	334.4	228.4	227.3	360.2	314.6	225.9
133	237.3	363.1	302.2	130.6	230.6	311.5	218	603.9
134	594.4	1140	498.1	384	104	345.6	401.6	224.8
135	1075.3	533.8	887.3	1588.4	220	677.5	175.4	301.4
138	231.7	110.1	175.8	232.6	169.6	171	141.3	203.3
139	298.9	162.7	156.5	459.8	119.7	182.1	162	227.8
140	762.9	725.5	154.5	31.8	1.2	92.1	35.4	1.1
141	621.6	930.7	688.4	687.8	23	420.1	36.5	666.8
144	37803	9899.9	22316.3	645.5	490.7	13084	9054.7	316.7
145	177	368.3	269.9	232.7	310.9	289.2	250	219.2
146	243	250.9	892.8	185.8	329	1096	513.5	231
147	120.4	64.3	79.7	78.1	34.2	140.2	94	23.6
148	677.9	631.3	630.4	298.9	225.4	335.1	307.8	192.7
149	398.6	217.3	602.8	1656.9	31.3	377.5	134	54.5
150	374.1	454.4	196.3	972.4	157.6	149.2	283.3	5740.8
151	1052	1195	656.8	163.7	191.8	924.2	636.7	216.6
153	139.4	146.7	146.2	319.5	194.7	88.4	724.1	99.2
154	8645.2	16591.3	5176.3	424.8	109.1	3577	4066.1	75.6
155	246.6	937.6	813.8	187.8	175.2	624.4	381.4	146.7
156	295.3	187.6	212	76.1	53.7	543.4	250.4	52.4
157	223.9	203.1	318.4	199.3	184.1	199.3	122.6	224.2
158	537.6	821.6	265.2	1.4	27	713.1	498.5	9.4
159	1344.7	1973.3	1599.7	3234	904.2	1579.4	405.5	1.3
161	3301.2	7782.7	14054.5	63.2	66.7	8990.6	4295.2	228.4
162	701.6	131.2	171.7	65.8	32	330.5	1161.7	70.7
164	8016.9	3022.2	1600.5	253.8	89.7	771.6	851.6	88.2
166	1326.9	1067.9	409.9	3604	3611.9	1114.7	1254.5	258.6
167	457.9	95.7	482.2	1592.1	1309.9	959.2	81.5	1.2
168	1090.3	935.1	1205.2	793.6	90.8	552	89.1	34.2
169	13698.9	8961.4	4979.8	1588.3	221.9	15295.7	6424.9	919.2
170	2889.3	2125.1	1875.6	2018.5	38	2738.1	2166.4	1941.3
171	575.6	86.9	234.3	1.3	1.2	326.8	1162.6	272.5
172	480.7	479.3	537.5	625.7	696.9	476.9	451.9	506.7
173	1793.3	647.9	338.5	142.8	256.6	1057.8	862.7	492.4
176	1468.4	1365.5	272.9	1.2	75.3	744.9	117.3	10085.2
177	275.1	98.7	141	183.5	592.4	278.4	235.9	131.1
178	1912.6	1129.2	203.6	86.2	728	1472.4	2389	12289
179	485.6	1376.2	243.4	60	153.3	1065.3	3098.7	53.9
180	1011.7	464.5	526.5	263.1	154.4	957.8	1085	118.1
181	5130.4	3292.8	3724	13102.1	11246.2	5277.8	2419.3	389.1
182	530.4	324.9	404	767.8	204.4	388.4	384.7	169.2
183	447.6	199	135.7	1.1	1.1	259.9	1258.2	281.4
184	620	357.8	340.4	291.6	192	428.8	14293.9	682.8
185	3627.9	10011.6	2963.4	729	355.6	10614.7	3033.4	880
186	173.9	184.8	258.3	1106	716.2	173.4	287.8	2619
187	333.3	525.2	136.5	200.2	239.2	314.3	689.4	176.4
188	435.3	350.4	378.3	132.3	145.2	161.9	1419.6	133.9
189	181.3	130.5	201.3	91.3	144.2	92.7	674.1	79.5
190	359.9	238.5	312	108.8	110.1	485.5	163.7	58.4
191	5707	3740.1	3029.6	3256.5	886.2	2447.8	3778.5	97.4
192	150.4	95.8	139.2	130.9	129.3	109.1	506.3	2753.6
193	361.7	114.3	88.9	6063.3	105.9	289.6	160.1	46.2
194	261.5	249.3	203.6	200.9	134.1	251.6	372.2	471.3
195	132	110.9	158.3	96.7	440.4	150	189.2	297.3
196	1327.6	1039.5	1104	311.8	7746.9	3084.9	1670.6	448.2
197	132.2	98.3	139.2	194	218.3	141.3	868.5	520.5
198	532.6	1476.5	1624.7	83.8	94.6	2377.6	755.4	70.4
199	7184.6	2171.3	7934.6	482.3	52.5	4537.3	5623.9	4564.9
200	975.6	370.7	300.2	182.2	210.4	482.6	427.5	1652.6
201	957	604.8	467.3	35.1	11.1	420.7	334	1094.3
203	3711.3	1570.8	1229.6	5308.7	248.9	965.6	1358.9	47.1
204	1750.8	1898.9	2112.9	4011.7	204.1	1174.1	290.9	27.1
205	6039	4435.4	3880.5	6493.9	2337.3	4612.6	1166.9	3.2
206	163.8	374.4	608.3	472.7	308.5	390.5	250	327.8
207	480.6	47.7	74.7	206.6	34.9	103.4	58.1	59.8
208	585.4	1688.4	1780.1	191.9	58.9	866.4	278.1	1.6
209	197.5	4.4	60.6	353.2	5030.7	400.5	66.4	207.9
211	1550.5	219.1	1271.8	1356.7	942.5	164.7	120.1	87.4
212	1426	1312.8	870.1	225.4	1412.1	2035.3	1106.7	52.1
213	104	191.1	118.8	124.5	3087.3	123.3	121.9	77.7
215	475.1	55.9	84.6	15	9	131.4	77.7	93
216	397.6	259.8	310.5	423.2	377.9	179.3	226.1	222.2
217	1130.5	517.6	725	187.5	173.5	2109.1	1336.7	189.2
218	159.4	224.9	205.2	353.5	294.1	236.6	199.5	89
220	79.6	70	204.6	1293.4	119	128.5	270.9	68484.3
221	2459.4	1795.5	739.3	429.3	254.4	1453.4	860.5	219.7
223	981.9	680.4	687.3	439.1	267.8	500.2	459.3	290.4
227	1489.9	1104.5	879.4	1033.7	822.7	1224.7	5386.3	435.5
228	186.1	178.2	271.2	198.1	433.9	318.4	220.6	177.1
229	180.5	334	201.9	302.5	172.6	189.2	253.5	582.6
230	3245.4	2835.9	3394.8	163.3	99.6	3274.1	4388	147.1
231	1258.8	702.6	436	985.6	204.9	418.8	591.9	75.2
232	704.3	266.5	271.6	59.5	31.8	1000	4104.9	782
233	15997.8	9251.8	21829	5239.6	15022	18292.9	3490	3738.3
235	405.2	135	205.3	218.8	77.9	242.7	688.4	216.2
236	345.4	176.8	244.3	51.8	289.1	251.1	569.9	355.3
237	2087.1	2074.2	977.3	667.1	647.6	2376.1	1252	2105
238	1029.7	709.6	957.5	1263.7	456.5	1002.9	733.2	417.9
239	398.5	111.4	252.1	162.3	97.3	806.1	929.5	1253.4
240	590.8	219.9	517.4	355.8	74.6	973.1	1561.1	1235
241	1224.2	353.4	781.2	558.8	62.3	2210.8	2833.8	2772.1
242	31599.6	34700.3	41193.8	1998.1	39786.8	38117	29127.6	4032.5
243	496	1167.3	574.5	293.2	363.2	674.9	937.7	478.8
244	619.3	993.1	600.4	303.2	63.1	271.1	782.3	352.7
246	1856.6	1243.2	1238.1	641.8	111.2	2226.5	1235.4	797.6
247	90.8	89.3	158.9	200.2	539.1	130.5	88.4	2091.6
248	3748.4	2617	1198.3	214.5	80.7	1744	935.6	108.1
249	2042.6	468.9	513.5	50.4	326.4	336.8	254.7	971.7
251	595	1004.5	592	56.1	35	1047.9	2445.5	71.5
253	465.8	497.1	469.6	410	220.1	449.3	295.9	531.1
254	2043.5	910.3	939.7	363.4	86	1038.8	861.8	107
255	2304.8	1354.8	344.7	122.3	762.2	1679.9	2631.1	14516.5
256	7209.5	1050.3	1841.6	927.6	282.3	701.3	1193.8	1494.3
257	856.2	248.4	216.9	662.9	150	341.6	378.8	234.1
258	1862.6	2711.5	2864.4	273.4	23.2	1388.3	3786.6	38.9
259	690.8	1255	315.5	8.9	8.9	666.1	567.4	35.6
260	171.5	136.4	233.1	141.7	251.1	174	130.8	576.4
261	647.4	192.8	70.8	118.2	87.7	108	72.5	91.1
263	797.9	1445.4	889.1	1265	3327	572.6	1048.4	4844.5
263	2900.5	3388	4354	382	258.7	2740.8	3471.4	176.5
265	89.2	115.6	179.2	394.1	219	100.9	131.6	85.6
266	213.6	237.5	772.5	877	652.8	477.8	159.6	124
256	293.8	159.8	170.3	96.7	137.6	266.6	612.1	111.9
268	427.2	47.3	133.1	64.4	531.8	497.3	80.3	18.9
269	144.1	171.6	184	64.4	137.5	256.6	159.2	47.1
270	149.1	221.6	249.7	540.1	727.4	204.9	126.7	413
271	928.9	1477.3	659.3	228.8	157	361	939.9	257.9
272	2065.5	769.5	961.5	709.2	889.7	644.3	583.3	1336.4
273	460	254.4	1932.6	1972	55.7	1557.3	1.2	1.1
274	1272	1303.2	959.1	381.8	692.6	817.7	3288.6	1936.2
275	1067.2	3809.3	819	189.7	89.6	3279.9	984.3	183.6
276	1560.5	1665.4	856.1	437.3	864.3	1770.9	8639.5	830.5
277	420.2	373.4	347.1	255.6	230.4	352.6	225.8	197.8
278	1479.6	2479.2	413.9	38.1	16.1	1327.7	1485.3	1104.2
279	4418.5	1252.4	1647.9	1229.2	826.2	1907.3	690.5	1.2
280	6980.6	3103.2	5603.5	9202.3	973.7	3117.3	1054	1.4
281	893.5	469.5	390.8	50.9	76.1	645.6	28.3	2949.8
282	436.5	866.2	712.4	604.9	432.1	429.3	4533.3	239.2
283	378.5	494.1	618.3	438.7	610.6	397.3	345.7	2247.9
284	86.5	78.4	84.7	59.9	151.4	121.6	104	90
285	100.1	125	140.6	171.6	130.3	107.2	95.4	109.5
286	21.9	47	34.4	361.5	622.2	17.4	51	14.1
287	85	103.5	147.3	266.3	140.8	110.4	90.8	52593.6
288	106.7	108.9	226	255.8	302	141.1	141.3	161.5
289	16536.4	1225.1	3454	1845.6	187.6	1317.1	1594.5	336.7
291	197.9	131.8	167.2	170.5	27.6	264.2	372	222.7
292	10808.4	363.8	202.4	174.8	66	1720	15444.1	227.7
293	409.1	361.7	288.2	206.3	82.6	711.2	306.9	55.7
295	812	283.8	1193.9	554.6	477.9	2370	701.1	344.9
296	2134.1	3003.7	1806.5	1160.2	1121	1902.2	1362.4	253.2
297	38.5	59.7	102.3	75.6	2740.8	70.7	113.3	39.2
298	610.2	990	998	952	469.4	525.7	390.2	600.9
299	2108.9	4536.4	3222.2	2152.4	419.3	4258	1379.7	77.2
300	1679.8	1409.5	1107.2	90.1	244.2	1361.8	952.6	239.4
301	221.2	271	284.8	845.7	261	211.4	223.5	162.3
302	216.8	246.1	174.8	34.5	40.3	171.5	310.6	21.7
303	266.3	414.9	259.1	1838.2	984.5	263.8	215.7	52.1
304	1007.4	636.1	791.1	1190.1	791	396.5	803.9	2631.2
305	2780.8	1913	203.5	627.5	451.4	213.2	4287.8	28703.6
306	600.9	1369.7	510.6	266.5	278.1	451.2	469.4	196.1
307	427.2	183.4	239.2	150	194.3	189.6	485.2	145.3
308	296.6	711.6	941.5	559.6	3583.4	734	515.2	1057.1
310	71.1	164.3	307	1005.9	1091.8	92.5	194.1	204.9
311	819.5	309.6	177.4	119.9	48.5	805.6	148.5	343.4
312	35.7	488.7	553.3	5485.3	1957.5	229.2	282.3	1084.7
313	624.7	219.7	192.2	247.3	117.1	393.7	632.5	548.7
314	1060.4	958.7	775.5	190.2	164.3	1171	521.3	302.7
315	208.4	52.1	72	131.8	117.4	149.4	73.1	78.3
316	967.1	497.3	525.1	285.3	123.4	509.3	313.1	1093.3
317	1983.8	165	184.2	186.9	201.3	230.5	235.8	160.7
318	535.8	1159.4	335.7	57.8	34.2	275.6	327.6	202.1
319	303	615.9	648.6	565.7	660.6	420.7	486.2	82.1
320	250.3	171.3	229.3	898.4	581.8	283.3	182.8	91.2
321	153.9	170.4	222.1	487.3	395.4	195.2	275.7	152.1
322	272.1	366	269.8	234.9	505.1	327	291.7	323.8
323	4149	2529.2	4790.2	11767.2	291.7	2101.2	1031.5	36.9
324	597.9	1026.6	425.6	216.6	66.4	520.2	374.4	38.3
325	600.8	475.6	489.7	427.7	333.3	614.4	461.4	102.3
326	6135.2	4645.8	2435.9	4623.7	489.7	3385.8	361.8	54.9
327	137	39.2	140.2	11.6	18.1	772	1166.8	47
328	139.5	41.9	42	35.3	115.4	264.6	82.5	28.1
329	45.1	69.1	52.6	106.4	190.4	59.3	53.4	158.6
330	1850.5	187.5	197.4	57.5	63.1	611.9	92.7	48.8
331	306.7	290.7	381.2	458.9	680.9	301.1	355.5	305.4
333	168.8	202.7	113.7	654.4	440.1	99.6	101.7	733.2
334	157.4	151.2	147.9	185.5	154.5	491.6	227.7	175.6
335	355	141.1	215.2	128.2	621.4	273.8	122.1	95.7
336	199.6	235	357	392.5	544.7	194.9	201.4	419.4
337	529.5	776.2	670.2	5029.2	12.6	247.4	1259.7	37.2
338	2393.6	467.5	1714.9	222.6	93.8	1228.2	573.6	80.8
339	268.9	201	224.4	249	562.8	317.5	248.1	316.4
340	108216.2	107282.5	151414.7	284.8	351.6	104374	125245.9	415.7
341	557.6	400	640.4	937.5	796.5	538.1	314.8	530.6
343	4739.2	4407	2670	1153.2	3880.9	3677.6	847.9	199.5
344	535.4	284.2	615.6	2191.3	1660.9	465.9	413.9	155.3
345	437.9	418.5	469.5	233.5	318	503.8	379.4	297.9
347	2204.6	607.2	2427.6	366.1	1391.9	1925.4	461.5	76.1
348	7719.8	2494	5392.3	378.6	2314.6	5267.1	1183.1	125.8
349	570.2	609	636	458.1	172.2	320.7	665.1	493.5
350	497.3	566.4	585.7	901.1	105.7	491.3	539.6	37.9
351	1925.2	1358.6	1065.7	133.7	96.1	1962.8	717.3	32.9
352	177.5	197.1	290.5	1585.5	569.8	165.4	101.5	302.3
353	734.5	602	399.5	357.6	924	415.5	202.7	175.3
3g
SEQ ID NO:	902TT	903TT	904TT	907TT	908TT	909TT	910TT	913TT
354	1260.9	3539.8	3818.1	9.2	180.3	221.3	64.7	837.9
355	83.5	5857.1	8246.9	48.4	247	60.3	53.8	151.4
356	105.3	500.4	419.6	781.6	797.8	102.4	278.5	575.7
357	249.4	689.9	517.8	798.6	569.9	361.7	600.7	655.3
358	975.3	2387.6	1281.2	823.5	857.3	1419.9	874.2	849.4
359	419.6	370.8	337.1	471.8	328.4	383.9	347.2	356.6
362	373.2	1448.2	359.4	401	473.1	781.6	303.4	262.5
360	268	446.7	558.4	242	366.4	1651.7	276.5	241.5
361	172.3	318.3	567.6	1196.1	670.7	316.5	236.7	426.2
363	1097.1	422.7	450.5	468.3	468.2	570.7	425.1	561.6
1	242.7	1509.1	565.3	1975.2	843.7	742.5	644.2	516.1
2	425.6	4753.1	2426.5	2640.2	3242	1866.5	1738.3	2465.6
7	96.7	1020.9	322.7	1442.2	913.4	2.1	688.8	390.1
8	1309.4	1177	1828.8	572.9	1092.8	1041.7	904	1781.9
9	496.7	2818.2	4872.6	1566	6508.7	2940.7	542	8678
10	150.7	81.4	218	97.4	90.5	118.5	139	57.6
11	623.6	578.7	535.7	283.7	341.2	219.9	168.8	310
13	173.4	526.7	1528.1	95.2	286	227.3	1018.4	322
14	424.5	1784.7	2754	255.4	584.8	1148.7	2517.6	721.5
15	192.6	231.1	6970.4	559.7	866.8	2354.9	135.8	2247.9
16	814.4	2337.1	1020.3	571	1207.1	216.6	1179.9	947
17	417	1095.8	1202.6	1279.3	1125.9	1162.1	297.9	1237.4
19	320.6	619.6	2250.9	274.2	4651.6	16678.5	159.1	586.3
20	41.5	263.6	1643.5	94.1	70.4	35.5	1.3	42.3
21	128	2017.2	451.4	191.3	326.9	52.2	97.2	172.4
22	2089.5	4271.9	6617.2	4571.3	6361.4	2003.9	1809.4	7708.1
23	1.1	427.6	5067.6	455.9	966.7	2190.6	113.7	2551.2
24	140.7	218.4	963.7	245.9	328.3	456.7	114.4	572.7
26	110.4	1938	14240.4	1024	7609.6	17839.9	409.3	5874.4
27	736	1194.6	387.1	374.1	866.3	660.5	336.8	622.3
29	1746.3	207.1	150.7	96.2	129.5	375.2	87.3	132.6
30	60.4	204.1	7348.8	247	268.9	1830.2	51.2	900.4
31	250.5	4640.9	1272.4	54.2	361.6	246.2	125.6	11511.9
33	726.1	1138.2	22827.9	1763	1784.5	2090.6	172.6	8499.2
34	1224.5	1241.4	1284.7	2615.8	4040.9	1589	2170.1	3921.1
35	265.2	1740	1410.3	169.9	408.1	178.3	49.7	274.5
36	306.6	2846	753.6	141.1	241.3	516.5	112.2	307.4
37	441.8	182.5	666.4	164.8	262.4	355.8	217.6	253.3
38	390.4	378.8	13610.5	1317	946.6	761.7	296.8	5444.7
40	678	819.1	540.9	3014.7	512.9	629.2	400	556.2
41	644.1	499.6	729.1	155	425.8	379.6	508.2	453.1
42	291	418.9	301	279.7	205.7	234	453.1	140.6
43	2139.6	206.7	327.3	675.6	397	893.4	362.6	369.2
44	737	1115	1144.4	735.2	636.8	1352.5	377.3	421.9
45	1766.4	1105.2	390.4	587.3	440.9	35.5	1234.1	598.6
46	871.9	344.7	382.8	237.1	318	362.4	260.5	359.7
47	157.7	796	425.9	228.6	277.4	458.4	103.4	356.2
48	100.3	309.2	2616.3	124.4	634.6	1634.5	65.7	281.8
49	270.1	6992.3	2626.6	317.7	377.3	697.2	177.2	387.6
50	165.6	199.9	3637.3	652.6	305.4	478.1	71.2	1362.6
51	678.9	706.6	252.1	581.3	55.1	329.7	103.8	97.2
52	336	238.2	225.3	231.8	202.9	192.7	152.9	196.9
53	318.6	1664.1	277	119.1	102.4	73.8	168.1	127.6
54	230.9	1387	467.5	296.1	274.5	242.3	1255.6	479.9
55	100.5	82.4	82.1	91.1	106	121.4	99.6	99.4
56	18.8	321.8	83.3	126.2	51	49.7	267	79.7
57	2055.1	6894.7	1056.4	181	1040.6	898.5	320.9	6449.5
58	3611	7181.8	1246	192.6	956.8	1419.1	257.5	8484.9
59	652.5	2674.1	1061	813.9	1612.9	824.9	505.6	837.7
60	153.4	426.9	592.3	113.9	288.1	186.2	123.5	328.9
61	248.3	108	110.1	157.8	116.1	86.1	104.3	147.4
62	892.6	4240.6	2145.8	4532	1616.2	180.2	167.4	1671.5
63	43.1	696.1	228.6	152.7	248	203.2	222.5	1249.7
64	754.3	484.8	96.8	136.8	172.4	8787.9	99.3	336.8
65	83.2	218.3	730.9	106.4	207.9	403.2	75.9	215.4
66	493.5	1210	670.5	495.6	581.9	1176.5	951.4	686.8
67	10133.8	33324.8	24242	34583.3	33362.6	3068.3	31350	37066.4
68	2389.5	1201.4	1568	9401.9	2614.5	46.9	4918.3	1993.1
69	6293.3	2834.3	3650.8	13600.4	4671	198	6730.8	2110.2
70	7326.8	5218.4	1465.6	2301.9	1698	1562.6	3047.7	1292.1
71	109.3	5006.6	1167.7	193.9	743.9	3907.9	456.8	458.4
72	207.7	2313.9	1722.7	291.3	396.6	781	109	349.6
73	194.2	657.8	526.2	409.4	339.5	863	203.3	363.5
75	76.6	1227.8	331.8	313	290.4	824.9	86.8	175.5
76	2053.9	1453.3	198.2	1.4	166	90.4	4285.2	181.1
77	1780	1586	1427	6365.7	5262.6	227.6	2010.2	3182.5
78	481.4	317.2	437.6	789.5	715.2	564.6	535.8	202.4
79	461.6	214.6	214.2	96.5	110.5	1271	235.9	128.6
80	121.1	746.1	294	272.1	130.4	80.8	247.6	349.5
81	125.1	6473	2165.1	112.4	380.6	161.3	327.9	257.7
82	704.3	216.5	171	431.3	318.7	149.5	340	308.5
84	221.9	611.2	399.9	105.1	228.8	2138.2	106	204.7
85	269.2	233.6	1982.8	169	149.9	211.7	137.7	320.8
86	135.5	108.9	106.9	95.7	105.4	93.8	73.7	117.7
87	127.6	465.3	323.2	95.3	403.9	62.8	157.6	1429.6
88	1283.6	2522.4	1743.7	11815.2	3616.8	446.2	3870.7	3025.4
89	256.7	275.1	477.6	154.3	289.3	541.1	134.8	307.1
90	116.5	131.5	622.1	230.7	165.3	129.6	92.9	171.2
91	1291.4	6737.9	681	75.2	942	526	142.5	8893.2
92	127.7	8921.7	3533.8	2067.5	4220.7	3041.6	9733.8	1770.2
93	120.4	181.9	160.9	277.6	309.8	97.6	147.2	189.7
94	1.3	950.7	333.4	626.4	1123.6	927.6	636	725.2
95	63.1	671.5	509.6	309	1194.2	87.6	1502.3	486
96	163.4	343.5	183.1	221	134.2	332.6	215.1	172.7
97	174.6	412.9	129.6	240.3	192.1	109.1	232	131.9
98	269	46.9	23.6	5.9	40.3	461.4	247.8	29.4
99	317.3	330.4	345.2	231.4	230	327.3	224.5	258.3
100	278.9	5487.5	4658.3	2977.6	17708.1	533.6	704.6	14117.2
101	148.9	470.7	172.2	240.4	366.1	137.6	433.1	297.3
102	267.2	130.3	143.5	163	138	256.5	184.4	174.4
103	345.9	454.6	332.2	322.3	296	331.9	319.9	317.1
104	620.8	254.8	155.1	500.3	426.6	538.2	415.4	490.4
105	676.6	264.2	231.1	551.9	371.6	831.1	467.2	475.1
106	832.7	268.5	316.9	494.6	516.3	767.4	474.1	471.9
107	214.1	396.6	1610.7	203.7	296.7	656.5	164.1	329.5
108	430.9	225.7	420.7	408.9	306.7	300.6	149.3	296.7
109	144.5	5293.3	3445.6	49.3	99.8	63.9	4951.6	88.8
110	156.2	13367.4	4936.4	1.2	133.1	66.6	10420.4	80.6
111	31.1	449	319.1	972.4	1746.3	72.4	634.6	1582.3
112	1208.7	915.8	358.6	513	445.2	79.8	1002.1	451.1
113	257	526.1	411.1	260	302.4	165.9	228.3	166.5
114	219.5	492.8	315.8	675.8	574.1	743.9	193.5	408.5
115	266.9	1153.1	535	357.9	489.5	1534.5	313.6	476.9
116	239.1	559.7	345	285.6	292.6	498.3	203	270.4
117	451.4	852.5	1167.1	3758.5	2636.4	220	694.6	1851.1
118	691.9	236.5	502.4	98.3	512.6	440.9	312.8	488.6
119	125.2	496.5	189.8	66	278.8	218.8	77.4	289.7
120	643.2	122	264.2	153.9	186.9	624.7	139.7	154
121	749.5	2913.7	860.2	336.8	764	1394.6	129.9	463.5
122	460.8	265.7	184.8	120.8	246	58.9	86.9	235.1
123	207.9	251.7	204.8	140.6	122.2	149.6	111.5	124.4
124	5670.9	155.5	148	368.2	165.8	183.3	107.3	167.1
125	1479.5	3998.5	753.1	813.4	967.4	1104.9	793.8	1004.9
126	762.9	199.8	558.9	519.5	1369.1	191.1	682.8	864.4
127	111.6	161.4	71.8	154.2	116.4	116.1	96.1	113.7
128	270.9	268.1	265.5	253.8	194.8	249.5	193.3	261.6
129	178.9	974.6	1280	192.4	245.5	216.2	155.5	1485
130	93.9	415	135.9	64	98.9	84.4	187.3	78.1
131	79.9	649	99.1	56.7	110.5	120.9	82.5	81.5
132	246.1	248.4	231.5	176.3	238.7	261	172.1	211
133	132.4	196	55.9	78.8	66.9	67.3	116.7	83.1
134	80.7	357.4	130	244.7	105.4	224.6	226.1	57.7
135	206.7	527.6	330.5	525.9	476.5	254.4	334.4	358.2
138	146.5	176.3	495.1	127.6	180.2	387	83.2	571.2
139	125.6	176.9	93.3	107.1	113.1	161	90.5	99
140	1.1	2124.9	375.1	3699.3	699.4	58.6	710.1	1623.8
141	39.2	1376.8	980.8	1472.7	1866.8	95.6	1265	1674.3
144	438.1	9635.2	440.9	420.6	469.1	364.9	21511.5	484.8
145	295.9	239.9	182.7	181.3	218.7	151.5	152.5	257.7
146	298.9	424.8	178.8	181	250.5	196.8	180.3	248.8
147	48.8	115.3	160	38.6	86.5	34.7	27.4	52.8
148	301.5	1046.2	1135.9	223.2	407.2	165.1	181.9	387.1
149	47.3	241.2	214.2	458.8	455.6	29.3	104.5	303.3
150	170	537.9	266.4	204.9	218.7	213.6	102.9	241.9
151	89.2	551.3	254.9	165.8	534.6	208.7	145	347.2
153	86.5	128.6	144.8	102.4	114	131.9	482.5	102.5
154	89.9	4360.8	958.8	781.1	686.3	354.2	99.8	1301.7
155	231.3	491.3	148.5	113.4	129.9	135.7	457.7	250.3
156	106.4	562.9	116.7	63.7	114.5	94.8	103.6	100.3
157	215.1	148.4	161	134.5	165.7	219	111.3	154.4
158	32.9	1321.3	40.5	1.2	17.3	60.4	325.4	9.7
159	599.7	2783.1	1317.4	2648.2	4295.6	54	3352.4	1844.5
161	46.4	2664.3	142.6	105.4	37	79.3	12174.8	49
162	70.2	205.9	2154.4	120.2	230.1	302.5	26.7	575.3
164	97.2	4519.6	284.1	80.3	241.1	136.1	4278.6	145.2
166	1463.3	1937	2689	6646.8	6511.9	2436.2	4573.3	3272.4
167	213.4	1628.1	728.3	2340.5	4783.1	39.7	2419	1862.8
168	46.2	1573.6	390.5	1142.4	452.1	470.9	298.3	741.5
169	5537.1	13680.4	14101.2	2418	4999.2	901.3	1483.3	4751.3
170	246.1	2210.5	661.2	1664.4	916.3	216.4	2618.5	589.3
171	163.7	592.2	6989.4	403.5	2812.8	5944.7	1.2	2024.1
172	503.1	636.3	612.7	637.8	678.8	382.4	649.1	592.8
173	438.7	1492.9	435.8	581.6	451.6	406.1	375.7	321.6
176	1.2	4078.3	151.3	721.4	41.7	21.5	659.5	126.2
177	504.8	573.3	573.5	497.6	548.9	188.7	524.1	641
178	763.2	2581.3	274.3	130.1	130.5	395.3	1441.3	106
179	143.7	1098.5	182.3	83.9	71.1	89.7	62.5	528.9
180	146.2	930.7	373.3	106	151.6	300.6	164	186.4
181	9206.5	6564.9	6165.7	13167.3	11548.7	1304.8	7115.7	9061
182	263.8	376.5	668.2	414.6	507	1400.6	232.9	393.9
183	1.2	395.2	3392.4	216.2	953.9	3944.8	144.7	1249.2
184	228.5	3067.2	599.8	207	334.4	400.4	10162.8	380.1
185	931	4108	3749.7	1981.6	1615.9	3634.4	834.2	6945.4
186	493.3	324.2	396.2	656.7	709.1	1183.3	453.3	462
187	96.3	258.3	1535.7	409.2	314.3	2757.2	67.4	650.9
188	66.9	405.5	832.9	151.3	247.2	306.9	89.3	144.4
189	70.6	239.2	289.3	112	199.7	237.6	59	78.6
190	1.3	1113.6	243.5	38	52	103.1	101.1	159.9
191	898.6	2228	2806.6	1788.2	1533.1	466	498.6	1912.7
192	103.7	377	267	65.3	134.7	128.9	66.1	119.5
193	140.5	752.9	580.6	2185.8	876.8	67.5	271.5	561.8
194	60.2	320.3	198.5	159.6	173.5	96	126.9	140.9
195	308.8	210.3	178.6	401.4	266.1	175.7	367.5	230.8
196	5889.2	6514.4	4504.5	4416.3	7685	183.7	6854.2	7068.9
197	374.5	81.9	129.2	108.8	122	174.9	68.1	178.1
198	95.3	300	73.2	42.5	55.8	86.5	39.2	77.1
199	87.1	7825.9	10594.6	51.3	344.6	74.9	63	274.1
200	130.8	511	514	170.4	544.7	475.6	154.9	259.7
201	1208.7	3427.4	3404.4	38.8	160.1	168.6	42.3	918.4
203	6000.1	982.6	359.1	96.8	204.8	46.1	331.8	188.3
204	206	700.4	262.9	650.9	591.3	846.3	674.6	437.2
205	1762.1	5866.2	3715.3	2132.7	5805.3	149.5	5381.1	2955.4
206	597.2	208.1	13097.8	301.2	1950.7	2675.5	252.6	329.8
207	77.6	602.1	745.6	352.7	484.2	308.4	1182.9	575
208	283.8	306.2	451.2	156.5	329.6	1044.1	156.9	149.8
209	254.3	1864.3	892.2	4970.4	5671.9	5534	2026.3	2662.4
211	262.3	3358.1	4615	29093.4	15999.8	393.6	7278.5	12689.2
212	1608.1	1431.5	332.2	551.6	514.2	482.4	786.4	353.9
213	3281.6	97.3	108.3	107.5	105.4	160	99.5	104.5
215	89.6	862.3	617	432.2	796.7	441.3	1738.3	806.2
216	333.1	284	385.1	651	910.8	264.4	588	601.9
217	224.3	1692	513.5	290.3	372.2	448.4	238.7	272.8
218	271.4	191	194.3	230.9	353.1	288.6	279.7	263.7
220	26824.2	132	73.9	124.1	470.8	129.2	103.4	350.5
221	215	1009.5	780.2	674.9	632.3	1487	406.7	578.3
223	352.8	388.2	438	286.9	203.4	160.1	124.3	1200.6
227	565.2	503.9	16406	1473.6	1813.5	2226.4	314.3	5151.9
228	624.4	455.2	331.2	808.6	799.2	205.8	683.1	604
229	1426.6	209.6	275.1	972.8	180.9	357.1	249.2	538.6
230	281.7	1542.1	611.5	209	207.8	215.8	97	574
231	2885.2	380.6	200	67.8	164.2	95.5	166.1	101.5
232	58	1351.9	13448.1	771.8	6104.8	19484.1	294.7	4379.3
233	2461.3	14608.9	11362.4	5629.1	11330.5	8712.7	1500.9	5870.1
235	317.4	465.1	5668.6	250.5	1690.5	2382.3	71.8	932.8
236	179.8	493.3	282.1	229.7	368.1	466.5	98.5	194.2
237	734	1979.9	2226.6	2347	1794.9	1757.7	790	2552.2
238	269.2	1084.1	803.1	718.3	1198.8	688.1	706.9	861.9
239	101.2	896.8	1025.8	156.8	1210.1	429.8	176	647.7
240	117.5	1116.1	1919.1	210.2	1169.1	420.8	189.3	1162.5
241	173.9	2109.5	3105.6	444	2419	956.7	341	2001
242	43673.6	18485.8	19181.5	4555.3	1630.4	3478.5	1273.2	10481.9
243	157.3	341.9	1232.7	219.9	483	699.2	82.1	1003.1
244	115	746.8	224.6	148.2	196.6	321	261	166.4
246	153.2	1046.6	224.3	103.9	143.7	173.8	1360.9	276.9
247	446	126.1	129.3	102.9	139	134.8	77.7	138.1
248	202.4	3011.8	309.9	182.5	128.8	133.9	1016.4	127.7
249	196.3	2527.3	1726.5	1395.5	337.1	271.3	233.7	469.7
251	386.5	1104.2	346.8	127.5	90.8	190.6	175.2	116.5
253	173.5	286.7	365.9	263	403.6	544.3	306.8	269.1
254	121	1348.6	394.8	73	434.2	259.8	554.3	264.1
255	953.8	2792.9	253.9	137.5	120.4	451.3	1497.2	98.4
256	1230.9	5411.2	704.5	85.2	918.6	465.8	224.1	7960.4
257	196	284.4	209	154.9	200.8	57.7	75.2	165.8
258	596.3	1068.8	1617.2	24.7	209.4	33.6	45.7	129.9
259	3.3	934.8	2120.9	131.2	687.3	806.3	46	531.9
260	248.3	182.9	167.4	127.1	173.3	209.8	128.2	198.6
261	19	401.9	345.1	1066.3	184.5	629.8	66.6	326.5
263	3859.5	516.2	662.8	577.5	720.7	535.7	488.6	407
263	418.6	1350.1	772.4	214.4	221.7	353.8	173.2	599.8
265	369.8	167.3	372.9	453.3	248.6	93.4	268.9	414.8
266	1779.8	263	318.1	407	491.3	511.1	236.7	401.1
256	117.2	391.4	130.1	92.5	181.8	142.5	146	152
268	120.1	1119	310.7	819.2	1655.3	121.7	645.8	1264.1
269	333.7	121.5	82.3	48	46.9	55.7	27.4	63.7
270	521.6	206.4	175.2	475.9	301.9	165.7	234.5	239.6
271	251.7	2043.7	362.9	255.5	197.7	227	225.6	192.4
272	620.4	563.5	600.9	411.3	451	639.9	426.2	524.5
273	136.7	2008	783.2	9402.2	3170.7	37.5	2967.5	1970.3
274	436.6	1279.4	1048.7	803.4	803.2	1605	278.3	616.8
275	267.1	1400.8	971.4	450.3	462.3	1341.1	238.2	2631.7
276	711.3	764	25930	2051.7	3808.8	5060.2	400.3	7898.3
277	188.1	213.8	210	151.7	217.1	196.7	161.8	199.4
278	65.7	1341	3512.1	262.6	1386.1	710.4	64.3	510.5
279	577.5	3255	2105.6	1256.3	3760.9	49.6	3058.3	2014.5
280	876.1	4218.8	2673.7	1739.2	3129.6	176.5	3883.1	2142.3
281	33.4	653.2	169.7	48.5	118.7	39	363.8	289
282	387.6	472.5	331.7	252.3	284.5	371.6	219.7	694.4
283	584.8	297.3	224	322.6	357.9	395.3	382.4	244
284	124.9	130.1	89.2	53.1	74.7	68.2	61.3	104.6
285	154	100.9	114.9	90.5	98.7	114.7	98.4	113.9
286	14.5	91.5	472.1	1032.5	277	1968	1525.5	442.2
287	744.2	114.2	131.4	94.7	147.1	127.5	65.1	206.5
288	245.8	103.9	143.6	161.5	162.8	177.7	112.5	161.4
289	231.3	5107.2	4629.4	93.7	1685.9	4764.5	141.9	2073.7
291	67.2	135.6	201.2	185.4	144.5	245.6	73.8	128.4
292	43.6	1910.5	2535.8	72.3	371.6	4192.7	50.7	206.7
293	63.9	1213.8	284.1	54.5	117	102.3	188.8	561
295	329	1994.3	668.6	211.8	267.3	97.1	684.5	3454
296	1451.1	1263.3	1341.5	761.3	1067.5	1967.3	758.9	687.7
297	593	73.8	109.1	49.4	123.5	88	42.9	364.8
298	360	444.6	275.9	300.9	273.2	358.5	306.5	436
299	1094.3	2223.7	794.8	1242.1	1051.7	1871.6	1233.7	605.2
300	186	1200.8	322.3	408.7	137.5	150.8	1157.7	233.1
301	250.2	525.4	365.9	4246.8	594.8	155.1	545.6	329.5
302	28.2	82.4	44.3	22.7	36.1	25.7	6.3	27.7
303	1397.3	375.7	390.8	921	836.9	531.6	689.2	589
304	485.2	1102.9	799.5	659.6	239.7	1106.9	120.6	501.1
305	1523.9	661.1	201.8	144.2	192.3	247.8	195.8	173
306	222.8	363.6	184.3	150.2	197.8	184.8	128.9	208.3
307	180.1	571.1	188	169.2	150.6	127.7	165.3	198
308	3026.7	857.8	1219.5	1191.4	1726.2	64.1	1855.4	1201.9
310	932.8	136.9	271.1	1036.8	498.7	99	290.2	343.2
311	48.5	360	99.1	180.9	152.4	76.1	167.7	104.5
312	4628	5	236.7	2257.7	1039.8	66	643.8	643
313	126.7	420.1	135.6	121	78.1	101	622.3	132.7
314	119.1	1765	872.1	133.6	629.1	211.4	112.9	473
315	141.7	212.9	441.6	286.4	519.9	1377.8	271.7	192.2
316	119.8	562.5	354.9	220.7	270.5	441.8	189.1	436.3
317	178.4	694.3	216.3	177.3	204.7	218.1	156.9	178.7
318	28.3	646.1	105.3	30.6	143.4	43.8	88.5	101.1
319	1682.7	339.1	154	339.5	190.3	129.4	447.1	293.2
320	816.1	326.7	425.5	913.6	680.7	459.9	482.1	501.5
321	360.2	245.2	811.4	486.9	413.3	931.3	260.1	454.2
322	604.1	279.1	205.3	203	203.2	198.1	215.6	180.1
323	620.6	4592.1	1478.5	13669.8	1883	297	3464	1551
324	106.1	478.7	118.1	131.8	77.6	74.8	294.8	56.2
325	255.2	515.4	238.4	250.8	279.1	142.4	597.5	247.7
326	318.5	3462.4	2655.2	2527.1	3852.6	220.7	891.6	2803.7
327	64.1	44.3	86.6	1.3	52	25.3	11.5	100.1
328	58.8	534.2	264.2	543.1	719.4	95.4	544.4	515.6
329	122.4	66.8	60.1	62.8	59.5	91.3	45.4	74.1
330	49	1131.8	126.4	41.5	57.5	131.5	31.9	64
331	632.1	258	263	307.2	275.1	480	248.3	284.1
333	147	285.7	369.3	854.9	519	285.3	603	413.2
334	129	302.9	300.5	121	170.3	145.9	129.4	211.5
335	215.5	628.5	174.5	108	107.2	135.9	51.5	116.8
336	358.7	245.7	230.7	382.1	500.4	819.1	394.5	415.4
337	105.8	1112.7	1023.2	358	235.6	1517.6	97.2	364
338	134.6	567.8	499.9	131.2	238.2	332.7	132	278.1
339	335.4	352.2	311	385	625.4	323.2	314.7	428.2
340	303.2	343.2	263.9	231	263.3	223.5	177.2	315.9
341	408.4	464.7	438.1	1146.6	803.2	349.7	511.1	757.8
343	1287	814.6	228	123.5	59.8	75.2	658.4	97.9
344	2683.4	670.4	822.4	1937.2	1561.2	1319.5	1187.9	1110.2
345	270.8	356.3	270.7	213.6	219.2	281.7	199.4	223.6
347	321.3	3161.8	1516.8	2286.9	3928.3	682.1	1998.6	3960.1
348	592.8	6727.1	3096.6	4465.5	7652.3	3345.7	4616.8	6087.1
349	213.8	458.9	441.6	165.6	239.7	177.8	310.8	270.7
350	139.5	477.9	625.9	282.7	381.8	1996.1	328.4	149.7
351	45.6	2277.1	515.7	158	453.8	105.4	294.7	668.6
352	470.6	167.1	213.9	516.8	305.7	2359	246.1	210.6
353	792.6	308.9	297.2	170.8	260.9	153.9	208.2	337.5
3h
SEQ ID NO:	914TT	915TT	917TT	918TT	919TT	920TT	921TT	922TT
354	71.9	52.3	102.4	6332.8	339.5	28.3	586.4	1.1
355	77.9	90.7	59.8	865.8	218.8	75.4	827.6	77.1
356	309.5	389.3	791.7	762.2	694.7	578.2	1581.5	949.2
357	238.7	565.6	645.2	593.2	611.7	800.3	666.9	768.9
358	812.3	933.3	620.4	729.2	758.3	710.1	556.9	571.9
359	399.3	508	376.9	330	320.8	353.6	299.6	506
362	527.8	508.3	517.3	1171.8	669.6	758.3	407.4	431.6
360	287.6	262.1	276.8	458.5	477.6	256.8	248.9	297.3
361	153.4	816.8	853.1	453.3	532.5	1170.9	1300	542.2
363	631.4	726.4	557.1	448.6	429.4	599.4	429.9	590.7
1	770.6	362.7	797.9	661.6	799.3	756.1	848.9	856.2
2	481	3910.3	1810.9	1338.3	3134.1	3947	4719	2783.8
7	299.1	2389.1	790.1	343.4	419.8	1494.7	829.3	845.9
8	614.3	810.2	763.6	1902.7	1081.7	629.1	831.6	938.2
9	524.5	1890.1	9055.3	9890.7	8192.7	2264.6	3685.8	10424.8
10	169.8	317.6	42	79.2	58.4	136.2	120	40.5
11	146	141.2	351.8	282.6	234.9	269.5	274.6	155.7
13	104.4	96.3	115.4	412.7	501.8	91	136.4	182.4
14	150.5	149.2	276.7	1839.8	1222	149.8	335.3	427.4
15	83.6	639.9	331.3	203.1	1168.9	304.5	277.5	582.7
16	834	740.5	1080.2	1040.9	977.4	761	1018.5	1197.7
17	95.8	775.8	1324.9	1290.5	1245.3	1170.3	1306.3	917.3
19	261.4	404.1	541.1	316.8	4263.1	155.9	150.6	3899.9
20	1.3	44.2	15.6	83.6	83	31	1.4	1.1
21	383.4	16.8	145.6	554.6	432	35.5	42.5	144.6
22	483.4	7044.6	9872.2	5621.2	6671.8	7593.9	4117.5	6209.5
23	1.2	758	271.8	277.7	2394.8	1.1	325.3	627.9
24	29	304.7	103.5	271.5	469.3	49.8	178.9	196.8
26	161.3	2148.7	2238.7	435.1	15713.7	60.3	774.4	7022.3
27	2027.3	253.6	510.6	701	703.8	324.3	324	728.4
29	167.6	74.4	68.6	190.8	125.6	73.1	84.8	170.1
30	1.1	246	188	525.7	759.9	74.5	129.7	286.6
31	256.3	146	449.7	1402.9	328.4	110.8	218.2	222.7
33	69.4	1248.9	534.4	1635.5	1154	322.1	691.6	434.8
34	2249.5	2411.8	4154.5	3039.8	4215.7	4564.8	2908.5	3979
35	118.8	296.6	55.5	1050.9	413	100.2	126.5	95
36	230.8	313.4	160.9	183.5	250.9	153.4	140.4	242.6
37	313.2	317.7	214.6	190.8	269.8	183.3	173.6	197.9
38	61.3	851.9	351.3	1044.4	981.7	465.1	612.9	276.6
40	719.3	813.3	549.5	535.4	513	829.2	442.3	543.7
41	172.6	171	190	284.7	581.1	145.2	362.8	549.8
42	343.9	273.7	144	130.6	210.4	229.7	202.5	160
43	1155.5	721.6	513.5	373.6	260	617.8	269.7	355.8
44	467.8	606.3	633.6	727.9	790.8	640	420.7	335.6
45	1102.5	638.1	519.3	594.7	368.8	478.2	608.5	404.8
46	443.3	467.6	402.9	285.6	318.8	295.6	260.9	360.4
47	246.9	143.9	102.7	241.9	285.2	145.3	226	182.5
48	48.2	197.7	222.2	49.7	1024.9	23	23	465.8
49	234.5	355.6	207.3	1446.9	736.1	344.1	252.2	364.3
50	42	399.9	174.3	301.5	536.5	71.4	207.3	223.1
51	444.2	59.2	128.9	228.8	73.7	65.9	19.4	52.1
52	203.3	187.7	224	202.7	200.7	180.8	198.3	190.4
53	186.9	1.2	213.7	202.1	69.2	75.4	108.4	128.1
54	684.7	417.1	501.3	720.5	410.5	294	509.8	366.4
55	129.4	96.5	115.6	98.9	115.5	100.7	94.9	72.2
56	247.2	93.8	50	62	65.7	100.5	74	62.3
57	713.4	745.5	417.1	4396.2	674.3	127.1	1311.9	226
58	679.3	672.7	334.5	5289.1	905	113.7	1260.3	158.8
59	1114.3	488.5	1847.4	1440.1	1675.2	906.2	2348	1103.1
60	160.5	166.8	216.5	231.6	179.7	142.2	165.1	203.4
61	293.8	239.7	136.1	128	145.9	155.4	122.5	116.8
62	2975	2562.6	1652.4	1873.2	1527	526	60.4	3206.2
63	144.6	161.3	490.3	578.9	239.3	242	239.6	251.9
64	1905.1	179	138	290.9	184.1	124	138.2	156.2
65	54	106	187.6	155.7	243.6	75	166.3	146.9
66	676.3	527.1	840.5	1026.2	765.5	627.5	1284.4	290.3
67	33082	52249.5	37966	30570.8	32361.9	42996.5	29286	39242.9
68	4579.1	7275.8	2857.3	1137.2	4016.2	7822.9	2361.2	3436.9
69	7472.6	15249.7	5078.7	2335.4	5252.6	10446.3	7213.9	6679.9
70	9607.7	1458	3227.3	1337.8	1473.1	1664.6	444	1375.9
71	234	129.9	307.4	332.1	2083.3	87	105.8	493.5
72	117.7	616.5	195.6	1937.6	446.3	359.7	707	166.5
73	299.5	310.6	290.6	264.1	473	267.6	370.2	457.7
75	167.6	215.7	252.1	193	312.5	406	77.3	143.2
76	987.1	33.3	18.9	74.9	191.4	9.9	122.1	134.1
77	3486.8	9405.2	5866.2	3917.2	3054.2	10710.9	3845.4	7445
78	322.9	806.6	1125.4	721.3	791.7	1090.1	887.2	548.7
79	156.3	75.4	84.6	199.2	122.3	105	76.6	133.8
80	577.4	115.1	104.4	407.6	226.3	186.6	758.9	124.9
81	120.4	121.1	187.8	1222.5	315.8	185	177.3	358
82	480.2	436.7	398.1	285.9	256.1	480.6	350.3	306.7
84	122.6	108.4	185.4	180.2	503.7	117.8	89.6	217.3
85	172.1	158.7	146.6	1050.6	166.4	134.4	197.3	142.6
86	99.3	87.7	80.9	78.1	93.6	56	77.2	98.4
87	346.4	214.6	478.3	693.6	282.7	172	329.4	231.5
88	2119.7	12099.4	6271.8	3285.9	4646.7	8968.2	1915.3	9385.7
89	308.6	290.4	303	232.4	299.7	233.4	163.8	190.9
90	98.7	279.4	108.4	89	113.4	81.7	100.6	149.5
91	582.6	482.3	275	6847.8	528.1	61.1	1397.9	71.5
92	2641.5	1419.6	2112.8	3432	3134.2	1442.4	4677.3	2547
93	88.7	211.3	338.9	402.7	236.9	286.5	297.3	310.6
94	89.7	1072.4	937.7	516.7	1228	974.1	1427	1237.6
95	510.2	756.1	652.5	461.5	647.6	779.5	500.1	747.8
96	142.3	129.6	170.2	169.9	161.5	179.1	155.6	168.2
97	169.9	186.3	239.2	240.4	173.7	176.8	317.9	243.4
98	37	25.2	39.9	87.1	52.8	25.5	28.4	39.9
99	287.4	268.3	235.3	210.6	248.3	226.3	210.8	292.3
100	289.9	8016.1	3817.9	5438.1	6332.1	6494.4	1146	13390
101	271.7	593.1	444.8	210.9	231.5	571.7	327.5	268.8
102	244.7	270.9	155.8	164.2	185.3	197.2	148.5	149
103	359.8	424.3	368.8	345.3	325.6	402.3	249.8	390.8
104	582.6	395.2	757	373.7	448.9	715.7	422.8	1046.9
105	605.4	439.1	711.2	498.5	563	713.5	478.7	844.5
106	573.3	421.3	707.9	394.3	496.4	727.1	411.8	1158.6
107	342.9	313.4	232.5	633.3	349.9	97.4	256.3	159.1
108	374.4	509.1	404.5	447.5	424	395.3	507	313.7
109	70.1	48.4	100.4	1071.3	216	52.3	605.8	112.2
110	1.3	1.1	56.4	2298.1	314.9	11.2	1496.5	175
111	618.4	1832.7	1179.5	1928	929.6	2094.9	301.9	2011.4
112	925.8	306.9	118.6	634.8	404.2	186.5	159.1	438
113	222.3	166.6	157.8	240.9	191.7	283.5	59.8	260.2
114	192.2	388.8	475	452.6	701.1	833.9	536.1	428.3
115	744.1	403.4	380.9	477.3	722	354.5	316	403.1
116	74	256.2	288.5	251.7	354.9	244.7	200.7	290.2
117	124.2	3117.3	3370.9	1392.1	2479.3	3139.4	3082.9	1506.6
118	45.9	127.9	220.2	543.8	654.1	106.6	76	302.5
119	73.6	109.6	79.5	187.2	253.7	129	89.7	180.1
120	63	151.9	118.9	83.3	329.6	139.5	96.5	196
121	49.1	198.1	1209.5	1344.6	731.2	553.5	930.8	1026.3
122	325.5	74.7	168.8	279.7	220	128.3	73.4	226.7
123	191.5	158.6	161.6	149.7	200.5	180.6	123.1	147.8
124	208.1	325.2	147.4	136	144.3	215.6	157.8	152.9
125	1661.5	1623.3	1124.6	933.3	856.1	1323.7	974.7	1239.4
126	336.6	998.6	1518	1111.4	1195.1	749.3	1734.3	1307.5
127	114.1	160.9	127	108.1	99.9	108.8	94.3	121.3
128	377.5	502	304.4	273.4	240.5	360.7	256.7	248.3
129	152	156.1	228.4	614.3	248.8	187.1	182.1	174.4
130	201.8	125.2	123.1	91.1	86.5	146.4	126	102.5
131	171.6	96.4	92.7	100.4	74.1	81.2	64.7	62
132	194.7	290.5	224	204.2	202.2	246.9	198.3	213.9
133	185.3	28.5	90.5	95.6	99.8	53.6	115.1	67.8
134	108.7	105.8	146.2	129.8	136.1	152.6	101.4	104.9
135	329.3	300.4	422.9	350.2	459.4	315.2	405.3	583.7
138	141.3	138.1	148	138	261.5	129.3	112.3	140.1
139	64.7	72.7	91.7	113	89.4	72.3	78.5	70.3
140	12.8	3594.2	546.1	1731	1815.6	2735.6	7476.3	1203.1
141	765	2165	2264.2	1694.9	2113.3	2212.9	1964.9	2552.8
144	557.3	658.9	531.9	445.9	506.1	576	448.1	498.5
145	293.6	414.8	253.6	213.1	181.7	238.7	218	282.1
146	346.7	292.7	269.6	217.1	213.1	208.1	211.4	258.4
147	62.7	79.5	46.1	53.8	81.9	58.5	49.8	63.7
148	269.9	289.4	334.4	865.9	508.3	260.4	407.4	281.3
149	97.4	236.4	437.2	418.5	394.6	307.1	973.7	534.2
150	137.6	243.5	188.6	496	186.8	175.5	160	154.5
151	127.6	135.7	166.9	264	342.2	154.3	155.1	238.1
153	123.6	100.3	115.7	116.3	102.4	89.5	160.7	101.3
154	85	197.4	1113.2	453.2	438.4	272.8	68.6	476.9
155	278.9	193.9	179.6	197.2	142.9	121	155.5	125.7
156	223.2	67.3	125	73.3	134.8	87.9	62.7	94.5
157	191.4	141	80.7	108	126.5	132.4	139.9	153.4
158	120.4	27.9	18.7	22.2	13.5	8.3	48.3	1.1
159	2173.3	3351	4458.5	2838.9	3155.5	4574.9	3436	5276.1
161	321.7	4.9	48.5	38.3	51.1	73.2	32.3	115.5
162	57.7	109.5	90.4	127	451.2	53.5	97.4	109.9
164	18.3	107.3	133.5	945.5	294.7	100.8	471.3	145
166	1789.6	8438	8113.2	9464	4481.5	10514.2	6218.7	8586.9
167	1221.4	1687.4	2694.8	870.2	2235.2	3402.4	2967	3999.6
168	1134.1	1571.9	233.8	389.6	470.2	1162.3	676.1	517.9
169	1299.1	3874.8	2937.3	20149.3	4579.7	3975.5	5507.1	3449.1
170	496.6	1040.8	993.1	1421.7	1194.6	1747	1725.6	975.7
171	1.7	726.5	381.8	1172.2	3538.7	1.7	311.2	923.1
172	787.9	831.5	671.7	556.8	576.2	725.4	702.2	758.7
173	325.2	174.5	231.2	453.8	404	104.2	388.1	164.7
176	1.1	61.7	1.1	901.4	45.4	116.1	25.7	13.1
177	1168.1	892.5	744.8	380	424.7	794	561	663.6
178	1040.7	147.4	125.3	225.6	118	65.1	137.1	105.3
179	175.2	142.5	80.7	229.8	86.5	162.9	95.4	82.1
180	219.9	159.1	69.7	168.4	130.9	108.4	102	102.9
181	7935.3	13498.8	13730.6	11985.5	10419.5	12804.4	11323.8	12979.3
182	150.3	447.5	499.1	465.6	614.8	394.1	697.3	535.6
183	1.2	302	315.6	55.7	3038.8	1.1	111.6	870.4
184	164.6	304.5	220.8	214.1	342.7	208.6	235.9	282.7
185	339.5	1227.3	1316	2812.4	2324.1	1291.1	801.3	951.8
186	1007.5	586.1	520.9	357.3	592.2	596	427.6	531
187	105.8	150.7	121.4	138.6	346.7	114.5	71.7	179.7
188	90.9	117.6	131.9	111.7	401.8	185.4	95.3	186.5
189	44.7	89.1	89.1	75.5	222.5	76.8	62.8	140
190	387.4	103.3	160.9	193.8	110.4	132.3	17.1	290.6
191	1052.5	301.2	1095.5	2271.6	1145.2	677.5	637	486.6
192	630.6	99.9	111.6	214	209.1	70.9	85.5	102.3
193	74.3	2980.5	1451.8	1464.1	967.9	3258.6	1246.7	1115.3
194	103.9	95.6	148.6	197.7	173.4	182.1	182.9	151.6
195	232	517.9	233.4	227.6	231.8	371.1	311.1	252.3
196	14368.7	9559.4	6515.4	4725.2	6534.5	6168.5	3594.5	10426.2
197	174.7	101.2	74.1	54.7	170.5	108.4	82.8	122.4
198	91	135.6	56.6	60.3	89.4	59.6	45.6	59.4
199	61	139.7	76.3	1103.8	315.1	93.4	1137.5	145
200	174.8	227.8	166	143.6	811.9	124	150.7	494.8
201	97.8	40.6	125.1	6018.8	363.4	16.6	745.3	54
203	248.8	51.5	202.6	274	233	114.9	678.6	137.4
204	355.2	445.7	563	594.4	551.8	780.5	259.1	741.3
205	3081.7	3669.5	4544.7	4530.2	5821	4180.6	2864.1	6443.9
206	635.1	335.2	212.1	203.2	2002.9	327.3	212.8	296.9
207	108.8	465.2	1154	1017.8	856.5	253.4	2406.9	982.7
208	376.1	87.8	163.3	235.1	433.7	162	209.8	341.4
209	4098	6563.6	5001.8	2151.6	3441.1	5849.7	5350.8	5424.3
211	13293.2	56352.5	27543	16362.2	12402.5	30128.4	25478.3	26582.6
212	3366.9	504.5	937.3	451.1	493.9	512.1	182	356.5
213	557	72.1	102.2	72.7	87.2	125.6	68.6	84.7
215	69.6	611.1	1358.5	1255.1	1026.1	288	5253.8	1589.5
216	307.4	418	1035.4	885.1	913.2	784.3	771.5	663.5
217	122.9	221.4	276.8	282.9	382.1	276	250.6	310.7
218	405.2	348.1	325	389.5	308.3	374.2	366.4	279.9
220	133.1	120.1	104.4	90.8	74	87.2	60.6	104.9
221	202.1	462	707.8	738.8	744.5	462.6	507.6	536.4
223	401.3	290.1	265	373.6	219.2	205.5	250.1	279.2
227	96.8	1403.6	588.9	742.9	1379	767.3	484.7	435.2
228	744.1	1944.7	680.2	365.7	418	1097.5	375	675.9
229	192.8	268	148.6	179.1	300.2	245.5	147	234.8
230	587.1	143.8	108	519.8	327.3	137.2	90.6	168.9
231	159.4	112.3	101.9	123.3	147.3	95.5	310.1	105.2
232	86	1502.8	1501.4	235.4	15668.2	38.8	605.2	4886.3
233	813.8	1781.7	6349.7	5834.7	8518.5	4215.2	3924.8	4770.7
235	19.1	393.8	248.5	975.6	1843.2	72.6	302.8	584.4
236	135.6	172.6	172	178.6	303.1	218.4	107.7	240.4
237	1106.1	1789	2038.4	1890.3	2100.8	1798.9	1370.4	1717.2
238	366.2	375.6	1127.2	1261.7	1343.5	899.5	859	1414.4
239	61.2	182.2	230.2	474.9	731.7	98.3	176.9	251.2
240	91.7	193.4	362.9	596.3	923.8	202.3	144.4	289.6
241	26.6	324.2	559.9	1218.5	1761.7	170.8	321.8	584.8
242	4172.9	1891.1	1654.2	11791	2788.1	2452.4	1809.2	1758.5
243	248.1	152.6	323.5	711.2	510.7	217.7	135.2	244.7
244	68.8	98.9	183.4	204.9	179.5	139.4	209.7	132.7
246	385.3	80.7	187.9	227.3	218.7	122.1	230.3	250.4
247	115.2	187.8	109.8	134.8	162.4	139.5	154.3	176.4
248	175.8	124.7	211.6	157.6	122.1	213.7	119.3	151
249	78.8	1316.1	1303.2	1406.5	646.5	1094	89.7	316.7
251	41.9	62.5	102.3	171.4	129	87.1	73	44.9
253	297.4	222.6	147.6	339.3	377.1	276.6	218.4	296.8
254	170	132	351.7	258.6	501.3	45.2	529.9	460.2
255	1140	47	85.6	207.2	108	89.8	121.1	51.6
256	509.5	559.2	396.4	6461.4	596.9	143.8	1128.1	72.8
257	111.3	113	208.1	145.8	103.3	155.1	204.9	122
258	373.9	20.9	71.2	831.4	206.8	7.3	19.2	134.7
259	1.2	346.7	153.9	329.1	1431.2	189.1	51.2	376.3
260	269.3	188.5	157.8	133.8	179.4	168.2	152.1	211.1
261	363.1	886.3	408.2	266.3	337.5	580.5	238.9	222.6
263	350.7	311.2	391.8	381.3	340.2	408	301.8	534.9
263	560.3	220	122.6	491.3	334.4	187.2	129.9	227
265	305.3	771.9	487.2	449.1	359.5	453.8	572.3	448.6
266	587.1	510.1	304.8	271.5	354.2	346.8	203.3	606.6
256	110.1	118.2	141.4	183.8	193.4	156.1	104.6	141.6
268	829.5	440.5	993.8	821.4	1312.7	938.4	407.2	1476.7
269	58.4	43.6	32.7	52.3	48.9	47.7	35.4	31.4
270	414.3	315	208	162.5	188.1	275.9	132.5	378.4
271	184.7	216.5	242.4	350	268.7	323.9	246.1	211.3
272	673.6	752.9	549.8	450	534.1	526.4	507.2	463.9
273	667.9	4430.8	2398.6	2278.9	2835.2	5763.4	3170.9	10524
274	309.4	563.1	382	416.7	1158.9	634.4	198.9	501.8
275	150.9	343.1	349.7	862.7	617.9	370.3	217.2	282.6
276	144.2	2577.7	914.9	1262.7	2706.1	873.2	822.4	731.1
277	221	264.6	204.6	186.4	182	199.3	212.4	205.9
278	5.1	445.5	286.4	951.3	2040.1	322.7	97.9	556.9
279	1964.2	1929.5	1874.1	1425.7	2873.1	2411.1	2753	4215.2
280	1725.8	1807.2	1790	2026.6	3105.8	3426.9	3401.6	4521.1
281	299.6	10.6	61.7	159.3	165.8	22.7	10.9	56.8
282	253.1	287.7	240.7	553.9	252	245.3	295.4	310.6
283	451.8	310.2	223.6	224.6	261.3	262.4	300.3	265.8
284	107.2	65	79.3	94.4	77.1	95.2	88.3	68.2
285	126.9	108.2	89.2	90.8	95.7	83.3	101.1	56.8
286	207.5	742.2	937.4	1260.1	840.3	441.7	1221.8	518
287	147.3	167.1	130.2	109.1	90	112.1	102.3	113
288	171.6	203.3	136.7	135.2	166.9	154.6	140.7	158
289	371.3	670.5	83.5	1902.3	2036.5	48	228	264.6
291	80.2	126.4	72.5	78.8	132.2	210.1	63.6	112.7
292	38.1	110.7	46.9	472.6	1250.2	27.4	126.2	66.3
293	222.5	84	110.2	187.1	124	59.9	126.5	88.8
295	1213.6	281.8	785.8	379.3	174.4	535.7	147	292.6
296	898.3	582	827.5	972.1	1280.1	738.6	1194.8	908.9
297	58.4	68.5	79.3	128	150.2	55.4	43.3	58.5
298	389.2	195.7	352.2	318	292.9	275.4	295.4	345.4
299	1008.9	952.4	435.5	935.9	1207.2	1276.8	1004.8	874.4
300	616.3	416.1	93.2	235.8	253	285.2	321.8	218.3
301	787.4	7692.9	760.9	597.6	582	4161.5	866.6	1551.4
302	8.2	20.2	20.5	26.4	38.3	11.5	48.2	19.3
303	667.1	584.1	822.2	624	674.3	794.9	891.8	698
304	184.1	237.5	283.8	497	280.3	200.5	163.9	170.7
305	158.6	187.4	179.4	240.3	128.9	137.5	171.4	144
306	177.6	272.7	152.9	164.2	148.6	151.8	118.4	196.2
307	232.6	294	179.7	177.7	166.7	143.1	269.6	156.1
308	3916.9	1024.8	1901.6	978.1	2018.2	1367	1084.7	2030.4
310	840.8	1027	434.4	345.5	351.7	775.7	403.9	604
311	1.4	100.4	111.4	207.4	110.6	112.7	85.5	48.2
312	3441.6	2815.6	597.5	664	496.5	1479.8	176.1	1442.5
313	100.5	123.2	112.4	128.1	112.7	146.2	83.4	132.5
314	271.3	291.9	302.3	543.9	514	181.8	157.4	408.4
315	194.3	265	553.7	442.1	676.9	352.4	338.1	580.4
316	190.3	130.5	393.5	448.9	461.5	184.7	184	326.6
317	187.8	207.7	143.5	1020.4	167.2	168.1	180.4	189.7
318	41.3	18.4	63.6	115.2	161.2	34.4	15	117.9
319	860	151.7	173.4	206.1	185.7	184.2	193	172.4
320	509.6	854.4	499.3	516.6	643.1	697.6	512	842.6
321	856.4	633.2	596.3	403.9	477.8	545.6	282.5	377.9
322	433.2	202.4	278.6	249.3	234	227.3	234.3	199.3
323	841.5	2787.9	2937.2	1793.4	1324.1	4240.9	2486	2525.8
324	34.6	20.8	38.8	166.5	195.2	110.1	85.5	75.9
325	493.2	226.8	266.8	301.9	256.4	292.2	312.9	251.6
326	107.7	1500	4118.2	5094.1	4992.3	1863.8	3521.7	2850
327	8.4	1.2	6.1	58.1	53.1	10.1	1.1	19.4
328	448.4	1313.7	690.6	383.9	558.3	678.1	451.7	643.7
329	242.5	67.9	67.9	52	61.7	53.9	71.2	50.2
330	17.8	47.2	39.7	282.1	70.4	42.8	119.6	47.7
331	733.3	495.8	278.9	232	273.6	280.6	257	242.5
333	302.3	1043.4	1067	536.5	739.2	789	589.6	857.9
334	135	171	185.4	142.8	175.4	125.4	150.7	191.2
335	114.3	112	135.6	198.2	140.2	65.3	82.4	146.1
336	273.5	427.6	549	929.9	527.7	486.6	685.7	484.4
337	127.6	450.5	304.7	308.8	228.9	259.2	192	337.1
338	122	131.1	153.1	314.9	206.1	109.7	203.8	162.9
339	589.7	576.7	629.8	367.4	474.8	496.3	533.8	528.2
340	345.7	362	289.7	277.4	243.4	291.8	246.1	272.2
341	601	1030.1	896.3	495.4	536.5	1091.4	1222.4	1064.8
343	4100.7	199.4	431	1240.1	83	30.4	75.2	123.1
344	1624.5	2249.2	1044.5	1143.8	1222.6	1571.5	1112.9	1923.9
345	238.1	412.6	253.9	217.5	231.2	189.6	247.2	211.3
347	2041.8	1350.1	3062.9	2896.2	3974.1	2601.7	1109.2	3899.9
348	2985.8	3296.8	7137.1	7441.2	9015.9	4507.6	2225.5	6141.5
349	242.2	171.3	270.3	274.6	214.3	206.7	232	284.3
350	145.3	165.3	253.4	465.2	473.9	247	260.1	349.3
351	221.5	71.2	134	484.9	440.9	92.2	237.3	182.5
352	302.8	377.2	355.1	306.4	343.9	332.8	471.2	707.4
353	485.1	155.6	246.1	298.4	282.3	160.5	283	245.4
3i
SEQ ID NO:	923TT	924TT	925TT	926TT	927TT	928TT	932TT	933TT
354	4999.2	948.9	8.5	8107.3	357.6	741.1	2903.8	582.1
355	1542.9	255.1	105.5	4694.4	98.3	91.6	1287.2	466
356	955.2	717.8	1055	1279.5	479.1	524.8	624.3	654.8
357	742.1	866.6	793.6	981.1	533.1	757.7	765.3	734.4
358	619.2	1731.9	778.3	770.2	675	559.4	2309.3	1072.7
359	393.4	300.3	283.4	311.1	437.6	326	298.3	314.7
362	382.2	940.4	368.8	968.1	747.1	473.3	3226.3	666.7
360	305.2	656.7	364.5	362.7	233.2	217.2	638.3	448
361	455.4	543	660.9	437.4	376.4	1699.9	116.7	462.7
363	425.6	414.8	478.3	461	574.2	432.5	334.7	437.1
1	730.2	1032.9	682	844.1	393.9	674.5	1344.9	1001.2
2	3449	1961.4	3686.9	2642.7	1807.9	3449	6464	2719.4
7	354	463.2	545	364.5	928.7	902.8	291.2	1104.3
8	2391.2	881.8	994.1	2512.8	1239.1	1078.9	1105.4	1030.3
9	7066.7	3621.1	8955.9	10216	6146	1554.6	3073.1	2224.4
10	76.1	133.7	48.5	112.3	70.9	40.5	125.8	84.2
11	423.1	502.3	256.7	620.1	215.5	224.5	1442.7	450.7
13	208.3	631.4	132.2	270.3	127.5	202.1	244.8	524.1
14	1772	3284.9	595.1	1382.8	378.2	703.9	1281.9	1396.6
15	273.3	253.1	691.6	629.7	624.5	137.9	1375.3	988.3
16	1155.7	1826.6	1298.2	1503.2	766.7	976.8	2803.3	1587.5
17	981	1525	1084	1110.8	713.8	1879.1	2006.1	958.6
19	295.3	325.4	2332.9	154.5	766.2	143	5450.6	1516
20	5.6	231.8	1.1	406.2	93	7.7	717.2	285
21	216.9	1426.9	466.2	1058.3	233.1	89.3	2805.3	820.1
22	5541.1	5019.9	7633.3	7736.7	4422.4	4997.7	6683.9	5281.2
23	418.4	128.7	924.7	522.4	263.1	95.8	1540.6	1482.2
24	124.7	262.2	466.7	332.9	277.9	112.7	502.5	370
26	2003.6	326.4	9052	447.2	1915.3	199.6	1793.9	5637.4
27	903.7	1325.6	731.2	620.3	523.4	499.5	1436.8	1142.6
29	77.9	153.4	131.3	265.8	339.2	91	278.2	113.3
30	244.5	111.3	342.6	1082.1	219.4	136	880.6	493.2
31	717.2	5693.4	185.8	2809.1	627.1	214.1	13720.9	4115
33	942.9	1061.8	704.6	3949.8	244.3	466.4	5262.7	2453.2
34	3136.1	702.3	4502.9	3384.3	2498.9	1817.4	204.4	1637.3
35	823.2	709.6	179	1649.8	528.8	173.2	2586.2	722.3
36	196	1335.4	173.1	183.3	431.8	189.1	339.1	986.2
37	190.3	178.3	281.4	264.8	256.3	166	142.8	210.3
38	764.6	1248.7	543.5	2191.9	232.8	763.6	2898.9	1375.1
40	454.8	644.3	481.5	529.5	897.3	467	541	618.6
41	324.4	539.9	467.9	199.6	143.9	2803.9	331.2	668.8
42	245.1	482.5	178	170.4	246.6	572.5	528.4	345.2
43	312.4	237	363	359	522.3	337.5	229	305.9
44	485.5	1587.5	666.9	778.7	788.5	427.7	1308.4	1173.2
45	523.4	1739.2	564.2	954.7	723.9	426.5	1423.9	1045.9
46	219.6	289.5	291.3	270.7	363.6	297.2	236.2	308.8
47	358.3	1203.3	261.6	420.8	219.8	231.9	811	565.7
48	132.2	32.9	529.4	17.2	481.9	15	768.8	1447.3
49	502.3	3238.8	380.6	5448	761.8	211.7	13066	3743
50	203.5	179.7	458.7	481.9	247	130.4	1359.3	491.3
51	36.1	495.5	36.6	477.9	354.1	190.1	860.5	367.9
52	217.6	305.8	203.1	178.1	145.5	199.2	266.4	254.3
53	135.2	1943.2	130.6	584.4	98	144.2	2628.1	714.3
54	980.6	1795	433.4	795.1	591.6	1643.8	1486.9	1394.9
55	106.3	85.4	98.8	76.5	97.2	90.8	86.4	81.5
56	72.3	168.2	54.5	77.8	70.1	175.9	120.4	338.8
57	4530.2	5218.3	281.2	4508.1	1636.4	1547.5	4191.4	4170.2
58	8556.8	6205.1	264.9	5634.2	1765.7	2033.7	8482.4	4433.9
59	1700.3	4628.3	2056.3	1693.4	800.8	1336.9	5450.1	2540.6
60	185.2	235.6	229.2	272.6	145.4	296.3	224.9	319
61	115.2	98.8	149	130.4	193.6	134.3	90.8	139.6
62	3145.7	4454.6	2756.3	2855	5821	142.2	5129.2	2442.2
63	379.2	744.4	325.8	938.2	356.1	502	1395.4	539.9
64	238.6	3544.9	113.1	512.4	242.4	124.5	661.9	573.5
65	113.4	390.1	172.8	433.7	95.5	201.5	506.6	282.3
66	712.9	1199.2	529.5	816.9	392.7	1636.5	1229.2	1158.8
67	29201.1	24240.4	35951.3	30300.5	39570.8	34590.3	12924.3	33523.7
68	369.9	258.4	3692.3	955.1	3718.5	2125.3	13.8	2527.3
69	1786.8	1413.7	5838.9	2685.9	9047.2	4524.2	193.4	5503.7
70	1299.1	4941.4	1670.8	1399.3	4204.2	2761.2	1891.3	3217.7
71	319.8	3969.9	1361.7	304	214.9	196.2	7882.8	2439.7
72	858.1	2076.7	424	1838.1	291.2	256.6	4680.6	1518.6
73	330.7	633.1	342.2	295.9	422.6	202.3	561.1	512.8
75	160.9	1925.8	332.6	236.1	224.7	510.6	2680.7	1504.4
76	186.2	576.1	105.9	163.7	609.8	358.6	809.9	826.1
77	3237.7	1390.9	5841.2	3756.2	8578.9	3419.8	278.9	3072.7
78	390.6	630.4	1085.3	608.2	792.8	957.2	640.8	631.7
79	149	230.2	167.8	234.3	145.3	153.8	436.8	205.9
80	335	1124.8	139.3	306	338	751.9	1832.2	582.1
81	756.3	1099.9	314	2079.9	1185.6	169.3	5642.3	1783.2
82	204.4	219.8	346.6	218.1	417.4	382.9	97.4	242.2
84	161.4	305.1	329.2	121.2	177.5	155.6	567.2	276
85	268.5	148.9	131.5	9338.9	157.7	130.4	841	209.5
86	63.7	60.1	90.7	94.7	77.3	63.7	128.2	210.3
87	336.8	563.4	358.3	784	227.4	345.8	6260.3	351.1
88	2065.9	1415.1	5272.5	2763	4806.2	6097.4	444.1	3528.8
89	170	217.9	167.4	265.8	193.2	219.7	218.7	301.1
90	125.6	103.3	107.3	195.6	166.8	106.5	188.5	236.2
91	14152.6	4927.9	66.9	6763.6	1057.9	1430.5	7192.3	2761
92	4155.7	9975.4	3017.4	2430.3	1461.8	5499.5	10750.2	6764.7
93	253.7	200.3	376.1	458.2	173.2	390.5	123.5	213.3
94	2143.2	1723	1215.4	1528.1	389.5	566.5	1579.9	1152.9
95	493.2	509.2	582.1	343.1	199.5	575.4	147.5	827.4
96	154	286.2	193.1	193.6	157.8	242.7	283.8	221.5
97	289.4	1005.4	259.4	282.6	167.4	291	674.7	490.2
98	16.8	18.8	39.8	36.2	26.9	32.4	20.3	129.5
99	254.8	406.1	225.7	255.7	266	219.6	745	306.1
100	12961.3	633.2	23136.5	13157.8	4258.2	18457	92.1	9157.9
101	199.2	366.4	205.1	247.6	410.2	348.6	240.2	460.8
102	169.7	159.1	125.6	126.2	215.3	150.2	91.5	222
103	283.5	423.8	297.5	295.3	439.2	325.4	387.5	411.3
104	480.4	470.1	825.8	374.7	462.5	333.1	196.7	465.7
105	619.1	605.5	855.3	445.7	366.9	360.7	367.7	428.9
106	431	505.5	776.2	415.5	433	341.7	213.9	403.2
107	543.7	258.5	162.4	1100.5	444.6	341	846.1	327.4
108	369.2	171.8	356.8	273.4	382.3	416.2	184.3	269.6
109	2753.8	628.9	228.3	4738.3	100.4	1962.4	446.6	1981.7
110	4958.7	1350.1	414.3	7933.5	114.9	2744.5	1064.5	3917.5
111	1702	404.9	1150.9	1477.8	1041.7	814.8	162.5	988.1
112	1008.4	1893	534.7	114	706.3	402.2	1536.4	1239.5
113	151.5	782	135.7	174.6	265.6	218.3	1021.9	721.6
114	530.5	317.9	811.7	453.1	335.8	512.2	419.4	481.1
115	303.3	874.1	578.9	468.1	458.5	324.9	1401.9	823.6
116	268	457.4	242.4	317.8	206.9	239.4	1630.2	331.4
117	2483.3	467.5	3516.8	1446.4	1615.1	4189.5	228.4	1398
118	165.1	112	513.5	378.2	458.6	641.7	191.7	241.8
119	231.3	494.5	171.7	189.4	195.2	333.6	346.5	301.3
120	87.4	99.3	267.3	72.4	98.9	75.7	52	227.3
121	967.4	3533.9	789.3	1797	301.9	588.6	4329.5	1463.8
122	139.2	473.8	265.9	361.2	315	76.3	341.7	238.2
123	119.5	215.8	183.1	128.8	119.8	265.2	182.7	263.7
124	109.4	166.6	139.1	148.2	604.8	130.2	108.7	169.3
125	722.7	763.1	1037.4	1010.3	1402.8	848.6	637.5	908.8
126	1296.7	159.8	1627.8	874.6	884.3	818.1	110.9	767.8
127	104.8	194.8	105	95.2	146.2	98.1	305.7	145.8
128	224.9	308	285.9	277.2	363.9	241.5	136.6	243.7
129	545.4	2482.1	213.2	2357.2	237.7	1139.4	5618.8	1929.5
130	76.7	408.1	75.2	90.5	165.7	222.2	490.8	419.5
131	85.8	1368.9	53.3	125.2	103.8	83.8	726.3	483.3
132	172.5	245.6	197.9	213	230.3	179.6	212.1	210.3
133	146.7	108.3	66.2	57.7	106.6	66.4	177.9	79.6
134	143.3	290.6	125.8	87.5	146	152.7	489.7	203.5
135	483	571.2	802.1	590.4	416.8	293.2	388.6	465.7
138	139.2	119.6	184.4	178	169.6	75.2	370.9	179.5
139	121.1	452.7	115.4	122.7	113.3	162.6	239	194
140	4146.1	1876	1951.6	1338.3	211.9	1.2	179.7	833.9
141	1804.4	1208.1	1688	1567	2363.3	1017	699.3	1291.8
144	380.1	9550.3	459.6	472.6	561	7295.8	9513.3	10388.7
145	194.4	2091	162.4	172	259.9	188.3	229	274.5
146	205.4	202	199.5	239.1	259	184.3	149.4	241.4
147	52	107.5	75.7	55.9	66.3	46.2	53.6	102.4
148	718.7	437	450.1	1743.3	388	408.3	1716	259.8
149	513.6	418	556.5	723.8	170.1	284.3	345.2	370.6
150	340.8	469.1	189.2	647.8	337.7	133.8	357.6	199.7
151	378.3	501.3	350.8	284.8	186.5	295.1	1725	566.4
153	135.8	159.4	124.9	120.8	128.2	109.1	403.4	1078.5
154	315.7	3650.2	708.6	1687.8	203.3	594.7	7527.9	3225.5
155	173.6	320.6	127.8	180.3	169.7	101.4	200.9	264.6
156	45	254	61.8	80.7	117.5	103.3	127.8	570.5
157	136.9	129.1	120.6	168.2	166.4	137.2	114.9	166.3
158	1.2	666.7	6.7	71.9	42.6	71.2	1801.9	533.3
159	1953.4	2285.3	3885.5	2682.2	3034.8	3946.6	1345.5	2577.3
161	319.4	1302	72.9	3.4	29.5	683.5	715.7	2665.9
162	110.3	41	257	370	123.6	69.8	481.8	259.5
164	1671	9328.7	183.5	423.7	105.2	5095.9	2963.9	3993.3
166	4942.9	5074.8	7381.4	6040.8	6386.6	3311.8	2123.6	2331.2
167	749.2	988.4	3046.3	1523.6	2291.6	1961.5	174.8	2118.3
168	751.1	1098.9	495.4	268.2	581.5	558	495.7	1402.7
169	7503.7	2997.6	1624.4	7311.5	4532.9	8835.6	8236.4	8878.2
170	1092.7	3984.7	914.4	1353.1	1072.7	3583.1	6780.1	2356.3
171	1091.9	103.2	2345.5	1683.7	1336.1	67.4	1413.4	1527
172	647.2	545.2	686.6	676.8	882.2	643.6	381.4	537.6
173	310.1	807.9	316.1	454.7	125	570.2	2254.5	686.8
176	352.8	3659.5	161.7	682	66.9	511.8	1820.1	1938.3
177	266.4	422.7	627.2	464.7	698.3	660	182.2	629.9
178	78.1	2301.7	104.6	251.2	360.2	1258.1	2294.6	1651.5
179	128.9	1233.1	66.2	511.4	130.9	58.8	1647.2	1137.8
180	105.8	710.8	107	181.6	146.8	78.7	1093	420.8
181	9757	7620	13164.3	9078.6	11540.2	7914.9	4064.3	8345.1
182	496.8	473.5	600.9	574.6	265.4	353.5	605.3	428.7
183	392.6	39.9	1783.8	80.3	243.4	23.2	486.1	1115.1
184	259.1	22002.2	275.3	392.4	236.8	191.2	3061.9	2469.9
185	1311.7	3109.9	1695.2	2606.4	1042.9	801.2	1663.7	6383.1
186	309.2	248.2	731.9	456.2	752.1	448.3	238.7	330.6
187	360.2	80.5	282.7	112.1	108.2	52.7	216.2	310.5
188	146.5	209	366.3	96.4	142.6	103.3	898.6	358.8
189	84.1	133.6	168.1	73.6	133	48.1	304.3	209.3
190	66	370	79.8	99.8	90.5	387.4	665.7	640.7
191	1054.3	1687.1	1089.6	4008.9	457.1	1051.3	4042.4	1869.4
192	101.9	78.1	134.8	200.9	179.1	65.7	775.6	145.6
193	815.2	514.5	1367.9	1552.3	1059.7	2629.4	354.5	944.3
194	138.2	264.9	193.5	255.5	125.4	157.6	270.8	185.4
195	269.8	168.4	314.1	235.5	344.1	291	109.8	242.7
196	1835	1891	3022.5	2154.7	3025	5691.1	1224	6848.2
197	78	67	146.6	89.4	111.8	94.4	72.1	99.4
198	59.7	349.1	117.3	72.4	77.7	65.9	89.4	217.4
199	2202.9	301.5	120.6	6209.3	190.5	91	1705.6	642.7
200	369.9	467.8	572.4	164.5	285	358.3	533	694.8
201	4783.4	1093.3	42.1	7327.6	380.1	865.7	2830.3	670.3
203	229.2	565.9	244.9	314.3	126.5	350.8	4025.7	1159.8
204	1028.9	1353.2	742.4	630.8	467.1	794.8	1093.2	723.2
205	4521.1	3738.9	6165.2	5757.6	2714.1	3696	4479	5109.5
206	286.5	137.7	822.1	155.9	838.5	245.4	1616.9	203.7
207	1415.9	489.1	680.7	771.5	469.4	789.4	93.7	464.5
208	1235.8	212.4	285.9	104.7	204.8	139.6	283.2	359.2
209	833.2	1350.4	3254.1	1747.4	5771.7	1318.9	86.5	2452.8
211	11370.8	683.4	10746.5	11683.6	36602.3	14294.3	496.2	11150.1
212	417.3	1679.4	495.3	397.9	1235.8	814.5	486.7	989.5
213	80.3	68.5	84.3	144.4	80.3	59	74.4	100.7
215	1765.1	754.5	1147.4	1032.5	842.1	953	108	565.1
216	976.1	385.3	1162.1	844.6	488.1	945.3	574.9	513.2
217	246.7	1309.8	268.5	563.9	267.1	1014.6	687.1	752.5
218	309.8	166.4	348.5	328.9	276.7	314	111.9	166.4
220	75.3	89.1	81.1	68.8	102.4	64.6	58.5	66.7
221	711.2	968.6	587.7	780.3	463.3	617.2	1979.7	1046.5
223	360.9	409.7	327.9	542.2	323.6	203.4	535.9	305.2
227	720	681.3	761.1	2095.7	501.1	532.7	2050.6	2295.1
228	319.6	300.8	802.4	439.9	916.7	403.2	157.7	507
229	228.5	277.6	251.1	185.2	164.1	200.4	180.1	258.6
230	277.5	1169.1	166.3	609.9	138.4	112.4	1313.4	1176.2
231	146.9	281.7	111	166	120.6	124.9	1309.9	513.5
232	1325.8	198	6317	350.3	1427	140.7	1196.8	3680.1
233	6765.2	7965.7	6520.5	7610.7	2523.6	3946.5	15970.8	5207.9
235	798.9	137.6	1126.6	2196.9	740.6	73.9	877	866.4
236	109	495.7	368.7	241.9	407.9	187.5	496.9	426
237	1643.3	2222.9	1846	1647.1	1467.4	1755.2	1820.3	2097.6
238	1432.8	1140.6	1085.2	1024.6	592.9	1468.4	1314.4	1287.1
239	83.3	421.5	345.8	665.5	279.4	372.4	776.5	766.3
240	140.9	406.6	453	953.8	285.9	481.1	1780.9	951.5
241	234.7	932.4	931.7	1944	457.3	892.7	2797.1	2091.7
242	3314	21699.6	1079.3	21653.5	3263.3	3729.4	21913.7	24536
243	354	246.6	412.2	1107.5	269.7	217.5	691.3	311.1
244	222	388.3	205	223.8	105.6	325.5	474.4	399.6
246	472.3	1406	305.7	434.6	199.4	177.4	1088.7	901.8
247	92.8	98.8	151	126.2	202.2	107.4	83.4	102.1
248	212.2	3753.3	158.2	227.2	186.1	449.4	2480	3964.5
249	1409.4	1281.8	405.1	1043	649.5	1270.8	1958	1894.7
251	99.7	776.5	96.3	222.9	77.6	219.8	1995.8	859.5
253	275	293.5	302.1	128.1	252.8	311	316.4	291.9
254	695.9	1525.8	629.1	370.5	121.7	2570	1228.6	1090.4
255	60.9	2489.7	89.7	245.4	289	1251.3	2613.6	1698.6
256	12009.8	3823	76.1	6109	998.6	1154.1	6963.6	1470.4
257	181.8	218.1	208	382.8	124.9	107	369.9	216.5
258	864.1	663.9	212.2	1288.3	130	47.2	2891.5	350.9
259	235.3	658.4	1209.1	373.2	212.5	143.5	1662.8	1191.8
260	151.4	161.7	168.5	138.6	240.5	128.7	127.1	189.1
261	200.6	567.6	409.5	332.1	282.3	256.2	194	303.8
263	524.9	637.2	549.3	697.3	354.8	473.9	797.2	691.2
263	262.8	1110.6	213	541.8	164.6	154.5	1268.5	980.9
265	278.9	105.6	510.8	504.8	664	337.3	59.8	364
266	414.8	163.6	326.2	220.7	601.9	433.1	158.4	283.7
256	126.6	169.2	102.6	129.7	138.6	131.2	232.7	376.5
268	455	1366.4	1736.7	757.1	890.5	1003.2	289.5	1318
269	29.7	103.9	37	84.9	68.8	46	87.8	154.9
270	198.8	186.3	209.5	175.8	440	234.1	176.8	287.7
271	239.3	1388	167.3	2027.5	279.7	256.3	3061.5	829.7
272	368	514.5	501.9	443.2	535.3	513.2	464.6	370.6
273	3575.1	1142.1	4935.8	2965.1	4032.3	5489.5	628.9	5515.9
274	369	1242.3	929	638.7	910.6	393.1	3068.9	1428
275	331.8	1186.4	419.7	790.1	385.7	210.6	387.1	2099.4
276	1037.3	821.9	994.3	2971.4	802.9	655.6	3409.5	3911.4
277	154	235.3	180.6	192.9	222	146.1	209.9	210.9
278	393.7	2185.4	1095.9	1106.9	475.5	287.1	2762.2	1290.3
279	1931.9	1574.6	2162.6	1696.4	1482	1484.1	2472.1	2330
280	2954.9	2033.6	2673.9	2531.2	1688.4	1936.3	3691.5	2628.7
281	76.5	295.7	134.9	81.7	87.5	993.9	793	372.3
282	295.3	214.1	295	3209.3	379.2	245.1	981.6	261.1
283	249.5	269.5	265.3	232.1	431.8	208.7	205.3	271.7
284	73.5	112.2	61.9	75.7	76.4	97.7	57.1	92.7
285	111	99.4	75.2	101.1	94.7	68.6	93.9	98
286	629.8	52.2	799.8	1994.7	465.5	828.9	53.1	264.8
287	115.5	113	87.7	122.5	134.4	100.9	81.5	95.9
288	109.4	141.8	130.1	140.7	149.8	126.1	108.4	112.5
289	1666	1269.4	941.6	5416.8	893.2	209.9	5258.5	2320.1
291	79.6	122.1	96	292.2	114.6	97.9	167.1	160.9
292	226.5	5489.8	317.3	841.6	96.1	81.2	4786.4	2366.7
293	173.9	986.8	92	624.7	212.3	203.9	667.1	929.4
295	312.6	1375.5	229.5	1024.5	598	569.3	688.5	1755
296	1129.7	1734.4	1277.5	815.2	602.9	561.5	2271.7	1202.6
297	81.6	53.9	53.8	152.2	91.5	62.5	118.6	45.6
298	394.3	619.7	407.5	404.3	288.6	242.2	506.9	419.7
299	869.8	1276.7	1226.2	959.5	865.1	1714.9	2366.2	1985.2
300	273.3	1444.8	240.7	364.3	206.4	660	1568.7	998
301	354.5	293.6	797	439.2	5202.8	496.9	215.5	810.2
302	43	69.4	22.9	53.4	24.2	8.5	116.5	61.8
303	635.7	390	1008.6	773.9	568.9	855.4	413.7	576.5
304	565.4	436.2	225.3	950.6	633.7	252.3	868	425.2
305	213.5	1945	86.7	250.1	230.8	450.4	693.3	661.4
306	150.6	895.3	136.6	156.5	236.5	135.1	1745.4	158.5
307	127.6	203.9	134.7	192.6	264.9	138.8	211.5	228.6
308	1248.1	607.6	1715.7	815.5	1207.6	1667	526.5	1140.3
310	323.3	105.3	561.9	412.8	554.5	441.2	95.6	355.5
311	187.1	409	134.4	246.2	66.9	232.4	864.3	176.7
312	215.6	35.7	964.5	512.9	1442.3	743.1	1.2	712.1
313	102.1	614.8	77.9	187.7	226.5	400.1	210.6	454.4
314	681	1706.8	671.1	751.7	185.6	303.4	684.7	792.1
315	211.5	216.7	421.9	234	416.7	500.7	245.9	280
316	435.5	619.5	376.2	536.9	395.4	330.2	704.9	460.6
317	168.8	203.4	167.5	2721.9	212.3	142.8	142.3	295.9
318	129.1	300.4	132.8	150.6	54.1	39.7	1463.9	297.9
319	438.9	357.5	187.5	180.3	354.2	257.4	855.9	322.5
320	533.7	201.6	562	465.6	667.1	655.6	266.9	475.1
321	320.6	174.3	471.9	402.1	561.7	371.6	180.9	319.4
322	257.1	275.3	249	193.6	264.7	232	267.4	249.9
323	2838.3	3740	2267.7	2105.4	2020.1	7965.7	2455.6	6172.4
324	139.6	720.8	116.1	87.9	66.3	225.9	269	421.6
325	325.1	538.7	346.6	353	241.9	342.5	547.1	466.2
326	6936.9	3406	3724.5	6176	2949	3655.6	1280.4	2870.4
327	29.3	28.4	40.5	34.8	1.1	43.1	50.5	85.2
328	323.8	284.6	596.2	451.7	857.7	576.7	72.6	488.6
329	76	83.5	69.9	71.3	81	78.7	65.1	41.9
330	148.3	861.9	37.4	251.5	19.5	53.5	1666.2	255.1
331	232.2	284.6	291.4	279.4	449.1	243.7	257.3	263.5
333	420	491.9	777.5	589.6	728.3	591.1	250.1	419.1
334	179.2	509.5	135.4	165.9	136.1	152.8	170.2	551.5
335	109	243.2	144.4	104.1	452.1	72.9	710.8	914.6
336	765.5	230.7	670.7	465	499.8	294.9	129.3	318.8
337	312.9	1159	419.7	497.2	178	165.9	990.9	1049.7
338	577.4	617.7	185.9	401.6	177.5	251.9	956.2	491.5
339	392.3	332.8	470.3	340.9	615.4	377.2	170.7	322.8
340	246.7	275.9	213.8	279.9	271.3	234.8	170.6	251.1
341	539.3	411.3	601	608.3	542.6	515.2	389.8	567.6
343	244.1	385	83	562.5	1435.6	259.1	2195.3	417.3
344	1212.4	452.6	1195.1	997.3	1945.3	1246.2	594.8	932
345	264.5	585.5	216.6	239.2	204.1	247.3	398.5	204.5
347	1738	3503.5	5107.2	2563.1	2564.3	2751.2	1484	4149.2
348	3976.7	7721.4	6875.5	4637.6	3708.3	6099.2	5834.6	7036.6
349	273.4	377.5	176.5	381.9	233.3	415.6	597.8	380.1
350	321.2	741.3	399.7	390.9	121.3	191.6	653.8	456.2
351	524.9	2215.5	274.7	977.6	159.5	507.2	2220.4	809.3
352	503.6	131.4	464	399.1	339.9	347.1	171.6	202.5
353	362.5	223.7	256.6	221.7	248.9	379.2	318.9	224.1
3j
SEQ ID NO:	938TT	940TT	941TT	945TT	946TT	947TT	948TT	954TT
354	124.7	131.5	68.5	1831.3	2991.1	1970.3	4151.3	697.9
355	60.5	58.5	18.7	651	2959.8	3221.3	3037.9	91.9
356	930.6	668.1	621.5	1481.2	524	619.9	852.9	343.7
357	668.5	1037.6	614.1	992.7	744.6	692.6	698.9	500.3
358	534.1	2157.9	778.4	766.2	2015.3	1757.9	1431.4	322.3
359	630.5	285.6	377.6	284.2	331.2	319.5	309.2	503.3
362	416.8	682.5	687	883.5	1080.8	836.2	746	476.8
360	275.7	208.2	221.9	220.7	571.6	596.9	804.3	159.4
361	583.8	838.6	283.7	134.5	371.1	271.3	137.7	156.1
363	425	358.8	438.2	340.4	460.3	536.2	369.7	849.5
1	912.1	505.2	651.7	1316.8	1552.6	1201.3	1465.6	256.1
2	2300.4	2928.6	1830.4	985.5	3226.8	1970	1555.6	876.4
7	656.3	686.7	1076.6	47.5	1068.9	536	365.4	1299.1
8	1044.1	2152.8	933.8	991	820.3	808.2	739.8	1547.8
9	4509.2	1083.6	1954.2	1300.1	2078.3	3908	1283.1	685.2
10	140.1	88.1	122.4	1873.2	92.1	150.4	164.5	113.4
11	70.2	163.3	140.5	707	443.9	558.3	863.6	82.9
13	151.7	615.2	230.4	207	349.6	491.1	268.6	107.8
14	292.7	1519.9	379.4	942.7	1077.9	1723.4	1237	119.8
15	287.3	218.1	204.7	3524.8	341.4	2287.5	744.4	147.9
16	1093.9	1353.6	1394.3	376.6	2242.4	2345.1	4508.1	532.5
17	1167.2	1155.9	933	517	1588.4	984.5	1068.3	312.3
19	241.1	159.7	215.2	431.1	311	2812	648.8	285.5
20	1.2	13.8	1.1	238.8	388.1	452.5	759.1	1.2
21	13.1	453.2	114.2	12979.2	1497.1	2096.8	4503	98.9
22	3034.3	2692.9	7458.4	7149.4	3919.7	5688.1	5625.7	1444.4
23	240.2	50.1	1.1	2306.1	246.9	2461.4	936.2	1.1
24	167.4	59.1	67	383.4	283.5	552.3	205.8	59.9
26	1363.1	333	155	3026.1	1238.7	9164	2694.5	66.1
27	664.2	691.5	441.3	957.5	1357	954.3	1589.7	352.8
29	89.7	109.7	122.7	3754.7	40.3	136.4	202.8	163.6
30	132.2	43.3	144.7	1236.6	203.1	1185.3	426.3	73.8
31	70.5	216.2	85.5	16661.7	8943.3	13168.1	16458.7	70.6
33	754.7	291.7	496	10017.8	2060.8	7990.6	3081.2	83.8
34	3799.4	1463.1	2114.5	557.9	529.3	1398.3	512.3	4496.7
35	49.6	245.8	449.4	283.1	1235.6	706.1	239.4	71
36	319.6	311.9	235.6	621.1	2677.9	398	273.3	356.8
37	165.2	175.1	219.1	198.1	231.1	292.9	220.8	375.8
38	588.7	850.6	583.8	5243.7	1146.5	3990	1615.2	79.3
40	474.3	418.3	456.1	5232.8	561	592.8	854.7	557.2
41	145.4	200.5	95.4	209.9	739.6	1408.3	703.3	263.3
42	259.7	422.1	296.8	134.4	388.8	299.2	320	346.4
43	312.7	469.7	413.4	844.8	254.3	342.2	278.6	1487.4
44	513.5	424.1	470.7	554	1223.3	1138.7	885.5	455.5
45	890.2	736.7	547.2	940.6	1426.2	1512.1	1930.9	1179.9
46	245	310.6	350.6	275.4	289.5	350	292.2	348.2
47	282.9	220.4	144.2	180.6	703.3	454.3	694.6	183.6
48	65.9	25.3	41.1	147.2	354.7	1468.6	413	15.7
49	257.1	1250.1	224.5	12537.4	5118.7	2265.3	4031	294.4
50	174.5	90.2	118.5	1385.9	212.4	962.9	427.9	32.6
51	95.1	552.7	56.4	170.8	478	419.9	827.7	730.2
52	197	196.4	147.1	401.4	251.1	232.6	352.8	240.3
53	48.5	381.9	96.1	1013.6	2192.5	931.3	1091.5	1.7
54	826.4	1710.8	514.8	1477.3	1185.6	797.4	1536.4	340.4
55	115.1	111.9	94.4	164.7	94	80.6	89.7	130.4
56	64	268.4	79.2	90.4	219.3	188.7	175.5	63.7
57	617.9	1038.1	375.9	868.2	12415.3	3983	1493.6	579.1
58	584.4	972.6	292.8	2931.7	11316.3	5093.9	2162.2	939.4
59	1552.8	1358.2	1824.4	3299.3	3044.8	3483.9	4854.3	122.2
60	123.4	154	130.4	239.2	412.9	378.4	248.4	139.6
61	193	106.4	98	402.3	130.9	79	142.9	155.7
62	1365.1	178	2305.2	2981.4	3752.1	2025.7	3563.2	4345.7
63	145.2	365.5	174.3	650.2	742.9	588.7	744.3	153.8
64	143.1	168.7	146.9	198.1	479.3	303.3	288.3	1482.7
65	149.3	80.8	54.7	446.7	254.3	265.4	155.3	56.9
66	834.1	822.9	752.9	332.7	1793.6	1625.8	2019.9	272.4
67	35954.4	28315.7	36691.2	2509.3	29331.4	28689.2	19265.7	24099.5
68	2348.5	1225	3289.6	23.4	760.4	1000	260.1	1110.3
69	3844.9	1911.7	4757.3	675.4	2667.4	3541.2	1114.3	7548.2
70	2817.2	5474	2510.6	6068.1	4627.5	5853	4221.9	8610
71	194.3	578.8	125.9	216.5	9508.5	3820.8	1470.2	84.3
72	588.1	1284.2	401.1	327.2	2278.5	1343.5	1418	131
73	258	239.7	218.8	232.7	766.7	694.8	726.4	198.6
75	252.1	212.9	239.3	123.9	1227.9	463.3	938.9	272.6
76	2962.6	845.5	915.9	198.8	1587.9	1178	574.9	3611
77	16342.3	2666.5	15026.8	503.1	1235	1954.2	2093.6	4483.2
78	729.3	762.4	748.4	157.2	758.2	290.5	576.4	1050.6
79	174.2	122.2	114.9	257.1	232.1	270.7	344.5	138
80	1248	787.5	1009.5	282.2	770.1	649.9	1098.8	266.3
81	115.6	272.3	127.3	229.2	5071.1	11031.3	7637.7	43.7
82	610.7	314.6	210.5	232	257.3	258.9	135.4	1823.3
84	94.2	94.6	92.6	83	304.7	340	208.7	87.3
85	140.2	169.4	138.1	2066.1	1108.1	1254	441.8	428.8
86	39.9	71.9	99.7	82.2	84.5	383.5	141	293.5
87	298.4	166.5	180.3	11204.7	1172.7	669.1	1630.9	199.4
88	5196.8	3340.8	5827.4	127.5	1059.3	1704.6	635.3	1431.5
89	235.6	196.8	215.8	267.6	325.5	267.5	617.5	237
90	115.4	85.7	96.9	368.5	152.8	292.9	344.8	75.4
91	522	538.6	254.8	3408.3	6047.2	2646.8	1460.5	1153.4
92	3787.5	7863.1	2264	316.1	7435.1	5854.5	5932.4	213.6
93	338.7	224	230.8	159.4	208.2	159.2	161.6	162.1
94	635.6	617.5	996.8	254.1	860.9	768	1265.5	29.8
95	699.7	1108.4	462.4	81.3	719	569.5	312.2	76.1
96	333	207.6	214.4	289.7	323.1	290.3	295.4	231.9
97	416.2	279.5	425.1	563.7	405.6	387	496.6	170.1
98	27.3	37.6	37.7	36.2	18.7	37.2	39.6	211.1
99	301.5	228.7	224.2	752.5	370.7	398.9	427.9	210
100	2314.7	3267.4	16920.7	300.1	254.3	4199.9	860.3	2812.9
101	330.3	321.7	727.2	74.4	500.6	272	225.2	171.9
102	169.4	127.4	144.6	162.3	150.2	178.5	170.9	171.9
103	381.1	314.1	488	277.5	491.6	397.1	366.3	377.4
104	692.9	415.8	921.4	315.6	185.7	234.9	58.6	310.2
105	372.6	381.6	637	159.3	149.3	300.4	79.5	455.3
106	646.1	411.7	1024.2	213.3	167.6	292.1	69.4	362
107	267	257.5	123.5	748.7	451.6	527.6	584.4	230.2
108	573.6	195.9	332.9	184.1	209.2	219.8	263	536.8
109	61.9	1019.9	56.4	186.2	3392.9	1439.4	1742.7	27.8
110	25.1	2062.4	22.9	215.1	7704.2	3177	4011.8	1.1
111	143.5	479.3	2111.4	41.4	269.7	337.1	266.3	190.6
112	551.8	742.9	559	155	1022.1	1281.4	1187.5	1294.4
113	99.7	563.8	103.4	189.8	444.1	262.8	316.1	223.5
114	503.8	603.2	350.4	104.9	714.7	677	361.5	212.4
115	401.8	436	616.1	1714.8	863.7	903.2	724.2	444.3
116	209.7	203.7	150.5	2167.8	763.4	502.8	591.3	201.2
117	3806.6	1057.1	3146.1	179.1	561.9	533.2	197.2	320
118	138.9	49.5	85.3	477.1	265.1	194.4	119.2	509.1
119	81.2	371.2	135.5	216	567.1	144.4	163.5	165.4
120	160.6	114.3	71.9	92.6	176.6	216.8	101.4	84.2
121	164.4	411.2	437.2	213.3	3724.5	1512.3	3717.5	67.3
122	98.8	80.1	243.2	1399.7	264.3	428.5	386	304.3
123	228.3	146.3	183.8	86	273.3	303.5	160.2	337.2
124	151.3	149.7	152.5	120.2	120.6	139.9	109.1	1219.8
125	909.1	689.8	819.3	575.9	33514.1	1041.2	939.8	1157.9
126	1425.9	1166.4	900.7	103.3	147.1	234.7	109.9	694.2
127	99.1	86.5	106.2	122.9	202.2	163.7	251.1	114.5
128	231.7	208	253.1	214	261.3	71697.2	219.5	291.6
129	202.2	353.5	133.8	1125.3	2440.8	1025.8	1063.6	165.3
130	345.4	395.1	121	69	388.5	391.7	446.8	121.4
131	168.1	194.1	81.9	126.4	965.8	403.9	495.8	134.7
132	181	188.5	164.5	532.9	286.9	263.7	252.1	213.2
133	101.3	107.4	143.6	234.5	193.6	164.6	236.4	134.6
134	208.4	308.8	149	144	300.6	320.7	552.5	107.9
135	238.9	233.2	326.6	225.1	687.6	468.7	352.5	301.7
138	96.3	108.4	108	222.7	408.8	249.3	192.4	170.3
139	165.6	99.9	76.6	136.8	269.3	296.3	159	95.6
140	2802.5	2059.9	1086.6	36.8	599.5	750.1	666.1	1.3
141	2290.9	2263.4	2358.9	108.9	934.1	627.7	325.8	732.5
144	7698.2	8602.5	444.5	323.9	12464.5	11467.6	7038	368
145	193.7	146.1	183.3	157.9	225.5	228.7	268.8	245.8
146	240.8	175.6	204.2	249.1	261	358.4	743.9	242.2
147	47.8	28.4	34.3	55	200.2	100.2	51	64.4
148	229.4	308.8	238.2	263.9	480.4	561.5	358.6	145.1
149	551.3	349.3	339.3	928.4	251.7	301.5	518.5	137
150	164.4	207.3	163.4	141.1	291.4	208.5	289.6	323.1
151	126.6	323.1	102.9	132	599.9	423.7	877.9	89.4
153	115.7	114.6	91	123.5	136.1	115.3	108.6	154.4
154	96.3	720.7	304.7	130.9	1984.8	5390.1	6547.4	79.7
155	97.9	124.5	101.4	112.9	272.1	587.2	922.9	167.6
156	87.7	90.5	95.8	49	682.8	491.1	331.1	59.2
157	111.6	117.5	128.1	151.8	208	161.9	186.4	149.3
158	65.6	1732.5	86.6	324.9	473.6	737.6	1773.8	15.3
159	3116.8	3452	5239.7	900.3	2646.8	1464.2	1902.5	980
161	14481.9	1741.5	2880.9	1.1	4831.7	8199.7	3949.6	50.7
162	89.7	55.3	28.4	589.7	490	589.7	221.5	35.9
164	177.5	8435.5	104.7	76.7	5265.1	293.6	4062.9	88.1
166	4359.3	2839.1	6163	1137.7	1081.2	2208.2	2366.9	3751.1
167	1749.1	1818.8	3470.5	1.2	1723.1	1291.3	832.1	565.3
168	710.2	1123.1	423.8	59.3	1688.4	894.7	1924	122.3
169	1524.8	2200.3	2148.9	1401.8	11518.5	12728.9	6382.1	1374.4
170	1062.4	2335.7	758	1597.8	2005.8	2041.3	3494.1	467.3
171	3638.6	58	1497.1	1638.6	545	2916.5	723.7	1.4
172	663.9	679.9	727.5	420.9	685.3	596.1	496.1	610.3
173	416.9	738.3	140.5	328.5	1336.6	772.4	1320.3	267.7
176	1.1	6520.4	150.5	99.2	3722.2	368.3	1845.4	29.3
177	545.8	562.4	1099.7	185.2	574	488	384.2	598
178	1775.4	1955	376.9	512.6	2127.5	1048.9	1852.4	1565.3
179	180.3	138.6	117.4	2012.3	1196.7	828.9	1163	106.1
180	74.4	892.7	105.8	237.5	803.4	419.6	473.4	114.3
181	9404.2	6484.3	10300.3	941.7	4892.7	6450.6	4354.9	9168.5
182	372	308.8	208.5	248.4	424.6	399.7	405	287.1
183	264	49.6	27.6	849.9	182.8	2050.1	619.5	1.1
184	340.2	3360.4	202.1	1220.7	1934.2	441.7	306.9	181.9
185	955.1	847.9	908.6	8586.1	5990	6583.4	4156.5	642.7
186	377.1	397.9	305.4	331.6	290.1	282.2	230.3	953.8
187	63	83.5	54.1	487.3	334.1	525.2	118.2	375.2
188	135.2	163.5	93.8	278.1	334.8	593.6	565	40.8
189	97.4	79.7	73.5	170.6	247.6	288.5	313.7	63.8
190	71.9	271.7	441.9	766.9	331.8	397.9	570.8	70.8
191	1184	1205.3	431.3	1127.3	2057.1	2357.6	1735.3	1441.4
192	637.6	81.1	90.9	98.5	97.8	124.5	152.4	136.2
193	1083.7	1465.1	2071.9	376.7	704.1	341.3	284.4	528.8
194	105.9	174.3	134.6	104.3	225.4	234.8	239.8	67.9
195	513.2	534.1	382	172.8	221	202.4	154.9	532.6
196	6150.6	6442.8	10030.2	655.3	4512.8	2383.7	1783.6	3777.8
197	119.9	70.8	66.6	405.3	140.1	126.5	270.4	248.4
198	86.4	67.1	56.7	167.2	622.1	1324.8	1830.6	65.7
199	63.7	49.5	36.5	946.4	3952.8	4557	3993.9	70
200	141.2	131.1	93.9	326.4	480.8	559.4	384.1	118.8
201	99.9	125.1	64.3	1769.6	3178.7	2044.9	3554.3	746.9
203	205.7	2333.5	101.7	55	1633.6	575.7	143.9	68.5
204	536.9	539.6	677.1	33.9	1308	734.6	891.1	781.5
205	2519.6	5145.4	5497.1	266.3	3930.6	3699	1755.2	3034.5
206	161.9	155.6	164.4	948.8	1321.7	387.6	243.4	466.4
207	632.9	3069.3	716.5	82.8	354.7	315	82.2	99.4
208	414.1	294.1	69.8	102.5	523.4	2129.8	361.4	69
209	2353.2	3015.8	3230.6	167.6	1434.9	1049.6	343.5	3631.8
211	25849.9	14301.8	31677	367.5	805.9	1538.7	536.8	17099.2
212	806.2	1682.7	669.3	1766.7	1465.3	1682.1	1111.3	2465.1
213	95.8	142	90.3	97.7	93.5	71.1	127	3700.6
215	908.3	4183.7	1058.1	54.1	546.4	345.5	127.3	143.3
216	474.8	805.2	456.5	290.5	173.7	292.6	242.1	234.8
217	310.4	448.5	198	253	2353.6	1241.6	1337.2	128.5
218	356.8	253.7	304.9	121	189.9	218	303.7	349.5
220	88.7	59	60.1	118.1	89.5	87.6	93.5	429
221	480.5	659.6	319.4	233.3	1004.2	1199.6	880.1	240.6
223	244.2	220.3	254.2	2169.6	392.2	560.5	572.7	233.1
227	757	501.6	622.8	6541.8	749.4	5527.9	2138.8	93.6
228	608.7	551	1481.7	131.1	431.4	377.7	265	587.1
229	493.1	133.9	211.8	452.4	129.8	269.4	179.7	599
230	161.6	103.2	123.8	1187.9	2084.8	2370.1	4149.4	75.2
231	118.2	789.1	176.3	80	752.2	257.9	129.9	148.9
232	941.1	198.3	129.7	1787.8	868.5	6851.2	1950.1	5.6
233	7265.5	4514.5	2133.7	1354.4	13569.2	13328.5	4088.9	897.7
235	824	100.3	178.6	1170.4	445.6	1811	569.9	75.9
236	205.3	143.9	239.7	348.8	434.4	422.2	446.1	266.4
237	1942.7	1890.5	1088.6	2229.9	2092.3	1996.6	2088.9	774.4
238	939.7	1507.6	905.5	237.4	920	814.4	934.8	213.8
239	155.3	1246.4	106.2	990	1304.2	963.5	415.2	125.6
240	105.3	1516.5	105.5	2154.1	1232.9	1172.8	394.5	111.2
241	298.2	3242	161.3	3194.2	2781.8	2574.4	962	156
242	6684	765	2229.5	13301.5	22076.9	31987.1	27579.2	969.6
243	154.1	116	133.6	2751	287.9	733.2	891.1	152.3
244	177	177.5	176.5	466.1	826.4	342.9	309.4	68.7
246	291.6	200.2	283.7	627.1	1322	1294.2	1779	143.8
247	98.8	89.9	132.5	88.7	163	133.7	73.4	283.9
248	126.4	1414.5	201.1	404	3465.6	1012.6	1020	178.9
249	782.4	3162	1403.3	76.1	1097.8	767.3	537.1	537.9
251	161.5	155.1	63.5	1785.1	627.7	1481.5	1000.6	82.3
253	264.5	218	442.9	168.6	424.5	446.9	362.6	279.9
254	105.6	2093.1	81.7	82.5	1493.7	652.8	622.8	398.9
255	1747.2	2263.9	395	659.6	2271.9	1148.5	1978.8	1845.7
256	435.9	539.6	279.6	2547.3	3827.2	1885.7	1217.9	1110.2
257	56	110.7	80.2	207.2	269.3	316	390.9	8.1
258	9.3	1.3	118.2	870	206.6	1331.3	3545.5	38.6
259	108.7	29.1	63	254.6	602.2	1965.4	1032.4	1.2
260	164.7	153.3	244.8	156.4	212.5	156.2	106.4	401.2
261	991.9	382.7	312.5	75.3	207.2	161.7	238.6	71.9
263	714.7	331.8	539.2	1150	469.9	540.1	765.1	394.2
263	186.9	138	97.6	1287.2	1762.6	2495.8	3807.6	183.3
265	788.6	425.8	473.1	76.4	87.4	170.1	56.1	398
266	353.2	233.3	346.6	277.1	270.4	331.4	210.9	954.6
256	72.3	174.2	105.6	365	383.6	281.3	202.2	129.4
268	281.1	1707.5	870.9	706.9	2068.2	688.8	318	283.3
269	39.1	44.6	40	54.8	173.2	430.9	328.8	58.9
270	215.2	272.7	184.8	275.7	242.6	247.3	201.7	957.5
271	235.7	337.1	250.4	160.2	871.9	511.6	907.5	198.1
272	413.3	461.6	314.7	697	411.8	753.7	501.7	539.4
273	1403.7	2489.3	5667.8	24.3	1615.9	2911.3	1683	814.1
274	614.7	410.3	702.2	2259.7	916.5	1540.8	1573.5	855
275	249.7	229.2	228.5	8716.5	2253.7	2452.5	1476.9	255.5
276	1102.2	729.4	823	8564.6	1180	8452.9	3389.5	78.2
277	166.3	154.9	175.4	443.3	274.9	287.7	236.4	171
278	409.1	57.7	133.6	461.1	1337.1	1922.6	1313.9	21.4
279	3251.5	3522.3	3542.3	82.4	1789.5	2134.1	1300.8	1253.5
280	3966.4	3899.2	3833.5	208.1	1888.5	3042.7	1982.8	1794.8
281	19.5	547.7	210.9	28.9	707.3	438.3	349.4	158
282	204.3	211.2	288.1	298.4	427.8	422.4	236.1	272.7
283	238.5	204.2	254	221.9	351.9	341.6	284.8	456.3
284	74.4	60.6	95.4	58.4	2258.3	84.1	82.5	93.7
285	116.8	93.3	101.5	95.5	93.9	98.8	108.7	120.7
286	151.8	621.9	136.9	73	31	112.7	64.6	214.1
287	106.5	73.4	112.1	121	113.4	88.9	92.4	149.7
288	165.7	147.9	139.4	188.3	157.7	159.2	153.4	210.6
289	361.8	386.8	175.9	1115.3	4422.6	4190.9	1131.9	143.3
291	48.4	122.1	79.7	80.2	146.2	305.5	248.8	57.2
292	105.8	222.9	15.8	2034.2	2474.9	1817.6	494.7	16.9
293	79.2	522.4	59	729.5	1441.8	926	922.7	76.1
295	337.6	458.1	827.4	131.1	2369	2332.1	1528.5	122.4
296	383.8	625.7	393.8	207.2	1441.2	1567.1	2234	1401.5
297	53	59	28.1	437.4	57.3	124.9	58.8	72.5
298	391.9	287.2	290.1	297.6	584.3	544.1	371.3	310.6
299	923.9	1489.6	612.9	234.9	1909.5	2964.3	2109.9	599.9
300	418.5	788.5	191.3	336	1170.1	795.1	1388	351.3
301	991	481.9	1125.5	359.4	219.4	308.6	234.6	849
302	23.5	10.4	20.2	207	135.3	153.1	376.5	9.2
303	1127.8	805.7	1035.8	76.4	260.7	316	336	830.1
304	168.9	328.4	141.9	2398	458.1	665	1628.3	347.3
305	615.6	310.9	1835.6	139.9	1686.4	577.1	314.2	187.1
306	157	151.3	142.3	1385.7	410.9	361.9	901.3	131.6
307	130.6	104.8	192.1	1073.9	343.2	232.4	160.4	141.2
308	2650.8	1762.2	3182.2	208.5	559.7	737.4	291.1	2599.7
310	283.4	464.8	253.6	85.6	100.7	156.8	136.2	1022.4
311	179.3	173.4	57.1	111.3	657.6	321.6	401.6	52.1
312	292.8	760.1	295.9	36.9	34.2	289.2	131.1	2976.1
313	430.3	1430.7	249	92.5	552.3	277.7	267	157.2
314	226.3	371.8	186.9	342.8	2406.4	1007.7	840.8	106.5
315	309.4	351.9	325.9	30.1	395.5	278.5	274.6	535.1
316	209.5	432.1	259.5	113.1	414.1	508.4	795.4	296.6
317	144.3	130.5	141.8	227.4	261.4	240	204	160.6
318	107.5	220.6	62.4	340.5	222.2	300.4	303.5	33.3
319	498.2	410.5	297.8	132.9	340.8	346.8	430.1	820.9
320	581.2	637.7	414.9	113.7	262.1	263.9	280.4	504.6
321	733.9	546.4	690.4	441.5	201.4	365.2	236.3	491.1
322	217.9	299	263.9	192.8	327.7	307.9	337.2	518.8
323	3187.2	4533.5	2223.1	758	4003.9	2801.5	1477.2	1113.1
324	69.4	506.8	68.6	123.4	493.6	420.7	324.7	47.1
325	450.9	358.4	218.3	215.6	509.5	446.4	622	185.7
326	2420.8	2944.2	761.2	377.6	2798.7	2211.2	3775.5	127.9
327	67.4	1.1	3.5	294.9	23.8	104.1	48.9	1.1
328	488.9	519.1	682.6	28.9	478.5	335.1	132.2	219.6
329	22.8	62	67.7	356.2	65	51.2	64.3	179.2
330	40.2	11.3	38.3	50	722.3	567.2	650.1	45.5
331	273.9	221.2	263.6	301.3	394.4	336.3	281.2	667.1
333	901.4	799.4	1778.7	71.1	251.5	317.3	197.7	472.4
334	142.6	391.3	161.2	132.6	683.2	297.3	816.3	123.4
335	92.1	83.6	139.7	122.3	635.2	109.4	93	650.1
336	415.5	361.2	472.6	55.1	215.3	220	144.3	242.6
337	248.1	1107.3	362.9	456.2	546.9	381.8	2046.3	137
338	116.6	210.1	98.7	249.2	759.2	1019.7	678.9	129.6
339	410.3	355.2	381.9	207.7	358.5	303.8	255.2	422.3
340	222.1	232.5	256.4	303.1	602.9	95894.7	123847.4	268.6
341	340.4	368.3	779	229.7	428.7	419.5	322	798.8
343	351.3	283.2	67.9	210.7	808.4	2720.6	7228.2	3446.2
344	1130.7	1272.9	909.5	155.6	531.7	706.2	595.7	1725.9
345	214.4	187.9	216.5	326.2	289.7	349.2	223.2	308.6
347	780	4322.6	1880.3	3519.1	4904.6	2435.8	1042.8	1057
348	2033.1	8452.1	3722.6	8444.3	8098.7	3669.4	2324.6	2993.4
349	414.1	298.8	450	384.7	420.6	314.2	331.6	323.1
350	193.6	155.1	166.7	164.9	603.4	717.3	1008.9	102.4
351	149.8	87.7	51.7	177.8	1787.4	975.6	863.9	113
352	305.1	222.3	426.3	134.8	158.9	214.2	127.4	1132
353	228.2	245.9	178.8	150.1	197.2	301.1	428.1	413
SEQ ID NO:	955TT	956TT	957TT	959TT	960TT	961TT	962TT
354	87.9	200.9	8.7	55.2	27.7	427	68.1
355	94.6	90.3	49.7	131.5	43.1	452.4	87.9
356	581.7	511.3	566.1	708.3	716.3	1212.4	709.2
357	586.6	1247.1	595.1	664.9	783	891.1	787.2
358	714.8	1339.8	621	733.9	978.3	526.4	1369.9
359	451.3	315.7	386.8	424.9	420.5	309.2	381.1
362	290	512.7	459.8	835.1	394.4	252.8	419.6
360	221.5	346.6	132.9	201.9	228.2	220.9	348.6
361	182.4	412	1902	403.3	846.8	964.3	1117.4
363	416.2	327.3	406.2	502.2	548.9	506.1	522
1	675.4	869.8	676.6	267.5	452.3	717.4	496.3
2	1844.7	3591.1	3028.1	3641.6	3980.3	3803.6	3593.4
7	309.8	581.3	550.1	630.4	1040.2	1288.9	1720.8
8	1337.3	1229.5	1489.8	865.2	743.2	1080.8	1023.5
9	2938.3	3522	7292.5	1627.8	13667.8	4833.1	816.2
10	58.5	57.9	102.2	97.4	77.9	90.8	91
11	237.4	291.8	198.6	338.4	478.9	402.4	127
13	245.4	217.8	83.9	97	110.5	141.1	325.4
14	1390	1022.1	201.2	221.1	188.4	343.3	1201.7
15	92.3	394.2	192.7	775.3	322.5	337.5	375.9
16	1190	2000.9	686.2	1137.7	815.9	1366.2	1403.6
17	298.5	665.4	989	1727.8	1644	1382.7	773.2
19	176.4	249.5	161.8	245.1	209.8	154.9	170.7
20	1.1	58.3	1.4	133.8	1.1	2.2	1.1
21	354	1554.7	106.9	1.3	129.6	94.6	88.3
22	1772.4	3116.7	5851.7	6314.1	10192.9	7077.5	2802.8
23	44.4	809.8	34.3	489.7	33.2	163	1.1
24	86.3	453.2	147.6	353	90.7	121.5	117.5
26	645.4	2180.5	47.8	1478.1	169.6	380.5	74.7
27	278.1	1212.1	159.1	236.2	335.3	339.4	261.4
29	78.4	81.9	23.5	82.1	53.5	68.7	59.6
30	71.2	234.9	129.8	239.5	51.6	114	15.5
31	294.9	587.2	48.2	138.9	86	174.5	43.6
33	162.4	998.1	428.5	1117.4	279.9	251.3	313.6
34	3053	2498.1	3095.7	2119.5	3047.9	2373.9	1094.7
35	181.9	491.2	74	441.4	22.7	965.8	17
36	127.6	209.5	637.3	2400.3	139.2	157.6	1485.1
37	166.9	139.5	190.8	131.7	237.7	198.7	233.9
38	130.1	678	413.5	1057.4	365.3	316.8	662.7
40	257	450.6	6557.8	482.9	628.5	522.6	591.2
41	134.2	455.4	123.4	163.6	368.6	605.8	254.3
42	257.3	576.9	200.4	398.3	154.3	212	244.1
43	446	239.2	748.7	367	323.5	371.3	664.8
44	546.1	682.4	841.1	846.6	457.9	413.3	620.1
45	1085.8	897.1	601.8	484.8	436.6	816.9	845.3
46	294.3	214.6	267	376.1	303.2	283	320
47	96.5	206	140.7	192.8	168.4	247	213.3
48	18	313.8	21.5	378.3	15	41.1	1.5
49	303.8	472.1	236.5	221.8	366.2	411.7	363.7
50	78.2	293.2	108	497.3	147.7	127.2	66.9
51	342.3	124.4	234.4	45.5	54.4	36.3	156.3
52	194.3	158.4	311.6	182.3	216.4	212.3	171.6
53	153.6	347.3	19	83.6	112.1	196.9	251.8
54	1255	1165.2	316.5	359.8	277.1	598.1	1248
55	116.8	117.3	120.3	89.7	118.2	109.3	88.7
56	219.8	182.9	88.1	65.6	49.5	53.3	172.8
57	257.9	611.8	345	831.2	168	1240.7	159.2
58	242.6	710	490.1	2548.4	205.5	1436.5	82.1
59	1047.2	2248.5	1125	813.5	918.1	1999	1120.9
60	97	300.2	154	85.5	160.5	117.3	185.6
61	90.4	103.2	161.9	145.1	203.2	134.9	108.2
62	300.7	1868.2	953.7	574.1	642.8	1633.8	139
63	297	536.7	193.6	228.4	311.9	261.2	255.9
64	109.8	100.1	170.4	227.4	176.6	190.7	115.1
65	87.5	158.6	150.9	81.8	71.6	67.2	102
66	1355.7	951.2	564.5	797.6	309.4	509.5	1530.7
67	34223.4	31838	24742.4	36682.2	36457.8	32604.1	43684.2
68	3348.2	1692.5	1286.8	3946	5683.4	2624.1	1368.7
69	7947.5	4162	3970	11781.2	10279.8	7055	5076.1
70	4104.3	2568.6	4964	2477.4	881.6	933.2	2792.2
71	619.9	681.8	113.5	372.3	137.1	72	319.9
72	229.3	609.4	1269.4	639.7	229.4	694.7	159.4
73	260.4	365.9	207.3	238.1	275.9	264.9	416.7
75	149.7	302.2	171.8	538.4	453.7	249.2	115.4
76	2162.3	1321.7	189	2328.1	12.2	54.4	1010.4
77	5244.7	2705.9	4944.6	4760.4	4771.9	3213.4	3514.8
78	310.5	589.3	1329.2	1771	866.2	805.1	952.5
79	231.8	135.6	383	134.3	114.6	119.6	116.4
80	667.1	355.6	404.3	450.5	85	239.4	268.7
81	1253.3	1566.6	84.2	100.9	194.3	384.9	263.5
82	333.1	228.4	350.7	215.3	247.9	520.6	252.5
84	147	325.5	277	141.8	114.9	106	153.2
85	163.8	102.1	111.6	119.6	149.3	210.2	180.5
86	193.8	55.9	95.3	298.1	298.3	70.2	71.1
87	156.9	158.6	353.7	164.2	293.6	482.8	160.9
88	3325	4358.2	4541.7	6014.1	7677.1	10815.9	5006
89	140.5	120.8	185.6	259	178.4	199.4	228.6
90	68.4	170.5	91.9	205.9	87.5	144.7	114
91	249.8	383.1	110.8	1269.1	70.9	1429.6	73.4
92	4953.4	6959.3	1774.3	2917.7	2117.8	7949.3	7560.6
93	201	209.6	400.5	170.5	283.1	293.5	163.4
94	260.4	3158.7	52.2	867.5	660.8	606.6	836.7
95	593.4	622.7	577.7	104.7	388.1	646.7	1203.2
96	165.4	233.3	200.5	123.7	184.7	171	372
97	273.3	336.6	287.9	296.3	132.3	317	370.1
98	70.8	41.8	25.4	16.5	25.6	32.7	30
99	164.8	189.4	116	167.2	280.8	245.9	257.1
100	610.8	12721.1	16769.4	9378.2	4271.4	15550.1	1798.6
101	232.4	238.6	434.5	383.4	434.1	504.6	729.3
102	147.5	132.7	112.2	180.7	209.4	215.6	169.1
103	309.3	255.1	195.4	418.3	293.4	404.3	381.3
104	631.5	573.5	522.3	415.2	370.9	830.3	589
105	655.3	488.2	398.8	564	421.8	540.9	516.4
106	562.5	491	440.4	361	470.2	736.1	469
107	170.3	157.5	207.8	405.5	147.6	558.5	118.6
108	260.5	430.5	385.5	555.3	419	273.4	323.9
109	6189.1	2697.1	42.6	65.5	78.8	577.2	6878.3
110	10703.6	3965.4	1.2	28.1	19.7	1384.5	13039
111	1743.4	1684.3	944.4	1390.4	2754.7	1147.9	3105.8
112	823.1	805.8	41.7	109.8	237.7	59.8	620.1
113	246	445	478	246	90.9	253.2	214.1
114	239.9	397.1	452.5	688.8	1076.1	566	830.3
115	441.3	600.8	435.6	627.2	408	348.9	523.2
116	223.5	218.9	200.8	251.8	236.2	182.6	216.1
117	413	582.6	4938.9	5309.2	2714.3	3839.8	902.6
118	203.1	268.2	141	148.8	118.4	34.2	105.3
119	45.1	322.8	110.9	119.5	75.9	246.3	233
120	63.4	106.6	118.6	184.1	122.3	82.1	114.7
121	461.9	1324	1289.4	211.1	422.1	737.7	749.7
122	243.1	213.9	52.5	140.8	84.5	274.4	144.3
123	189.9	195.8	480.9	135.7	146.6	163.4	216.1
124	130.1	117	258.6	193.4	182.9	170.1	178
125	984.3	573.5	539.9	1065.4	967.5	1025.7	1172
126	1322.2	965.1	1360	738.2	631.3	1011.4	682.8
127	131.7	96.4	132	117.3	113.4	116.7	127.7
128	194.1	182.2	236.4	276.3	285.9	310.1	367.6
129	130.1	229.7	252.6	224.8	171.9	522.6	200.2
130	185.4	150.7	162.7	99	93.7	89.6	207.8
131	95.8	152.7	148.3	47.3	74.7	96.5	94.2
132	163.2	168.1	192.6	193.3	258.1	217.7	272.4
133	204.5	249.2	84.8	160.3	70.8	65.2	75.8
134	287.4	159.6	98.4	197.6	118.4	129.9	184.5
135	373.8	551.6	416.6	392.1	459.3	328.2	406.9
138	137.1	115.6	126.5	195	133.1	149.9	117.4
139	116.4	142.3	79.7	71.6	80.2	87.7	77.6
140	74.5	3607.6	2148.2	1275.7	3106.6	2235.3	1653.3
141	1566.1	2429.4	761.5	1182	2077.2	1681.8	1605.6
144	12425.9	7539.3	395.2	417	450.5	512.8	7238.7
145	160.5	137.2	206.9	220	255.1	198.3	239.2
146	182.1	147.4	169.7	202.3	262.8	225.5	211.9
147	28.6	43.9	91	66.4	26.5	59.8	20
148	205.3	553.1	180.2	198	270.3	668.6	306.4
149	325	326.5	236.6	362.1	407.1	765.1	342.1
150	197.1	234.6	172.3	171.9	270.8	246.9	159.2
151	123.1	264.2	95.7	127.8	158.8	148.1	257.2
153	103.8	118.2	112.8	119.6	110.6	115.4	113.9
154	304.4	1676.6	2431.9	408.8	152.5	2641.1	142.4
155	498.7	158.7	136.4	138	136.6	144.9	139.3
156	95.4	89.8	63.6	51.8	74.1	120.8	65.3
157	178	115.2	155.5	132.3	138.2	159.9	181.3
158	283.4	1174.2	19.8	16.2	1.2	13.6	578.5
159	1776.8	2641.6	1398.3	1601.9	3134.9	3315.7	3396
161	9817.8	2623.3	177.1	129.7	6.7	152.9	1887.4
162	45.7	101.6	27.6	150.8	40.3	76.2	46.9
164	78.1	707	463.5	110.3	193.8	333.7	3770.9
166	6384	2992.4	4919.5	5671.4	6028.1	6429.2	3769.1
167	1191.3	1999.3	1864	686.4	1834.7	2207.6	2362.6
168	1167.3	843.3	2714.3	1862.4	1004	922.5	1487.6
169	3437.7	4365.5	1880.1	3159.8	1921.4	5836	1307.9
170	1488.1	2441.6	1019.6	1307.1	1150.4	2496.9	1953.8
171	1.2	722.2	1.2	760.4	1.2	725.9	1.2
172	590.7	573.3	719.5	631.6	816.5	666.4	904.9
173	408.8	355.1	171	213.4	406.9	481.6	564.2
176	1175.5	1461.1	175.7	8.4	704.9	850.3	2537.2
177	536.9	672.1	597.5	376.7	544	817.5	635.8
178	385.8	730.5	91.3	209.5	184.7	233	1073.8
179	74.1	84.7	60.3	70.3	71.4	127.1	145.7
180	156.8	498.8	119.5	132.1	72.9	109.4	609.9
181	8682	7928.2	10784.9	10442	14140.4	12487.9	12014.6
182	323.1	400.6	375.2	349.8	535.4	405.4	334.3
183	128.7	461.7	1.2	388.5	15.5	53.1	1.3
184	279.4	565.1	227.8	327.3	211.1	272.9	2642.9
185	1142.8	848.2	1463.7	1098.5	1043	1044.1	911.4
186	444.5	436.7	360.3	324.6	419	403	314.3
187	214.8	123.4	366.1	170.7	79.5	90.4	76.6
188	94.7	141.3	105.2	357.2	157	110	170.5
189	49.2	74.3	80	146.6	60.9	66.5	88
190	267.8	422	71.2	95.9	85.5	102.1	152.5
191	825.2	845.3	1874.8	739.8	734.8	1020.6	520.6
192	67.8	308.7	77.4	94.4	80.7	77.4	79.8
193	695	1573.5	2485.3	1849.3	2885.4	3460.8	1615.5
194	173.6	299.7	106.6	134.3	150.7	122.6	175.9
195	248.2	343.9	371.7	347.9	320.2	194.4	297.7
196	7207.4	7285.3	5142.4	2474.2	6626.6	8775.3	11352.4
197	50.6	93.6	113.8	142.3	96.4	86.5	58
198	56.8	44.6	36.9	51.1	66.8	47.9	128.9
199	135.2	104.6	57.8	204.7	35.2	599.8	103.1
200	110.8	310.7	104.4	327.5	121.9	121.6	147.5
201	125.9	200.1	46.9	69.2	25.3	505.3	54.7
203	163.6	319	130.2	85	252	312.1	621.1
204	826.2	879.7	567.6	726.8	704.1	434	980.1
205	4963.1	7695	2785.7	6249.9	6069.1	6172.2	6469.8
206	384	1284	196.8	1397.4	323.3	282.2	224.9
207	1180.7	1623.7	402.1	2190.2	453.5	1652.9	1647
208	495.8	653.7	150.2	227.7	257	340.5	253.6
209	1608.4	2981.5	2844.2	445.8	5286.9	4175.6	6653.1
211	7731.4	15392.6	3699.2	33617.1	23929.6	28201.9	37299.8
212	911.5	692	1485	440.7	207.7	396.6	971.4
213	58.3	77.2	150.2	91.5	119.6	83.2	84.4
215	1364.9	1835.2	477.2	1858.8	394.4	2522.1	2910.2
216	540.7	636.6	665	441.7	610.8	635.7	494.3
217	196.1	494.8	258	300.8	260	97.9	424.1
218	359.4	357	308.6	572.5	327.9	346.3	318.6
220	87.6	66.5	71.4	89.9	106	86.7	88.5
221	195.8	787.9	397	518.1	651.9	372.5	497.7
223	248.3	279.5	456	247.2	226.7	308.9	202.1
227	326.2	1074.9	579.8	1616.2	517.9	516.4	447.3
228	377.5	502.7	583.4	486.6	764.6	521.7	871.2
229	311.2	113.4	1212.9	377.4	152.7	93.4	149
230	417.2	297.5	120.9	131.8	135.8	242.5	285.4
231	108.5	189.8	88.2	67.4	140.1	160.7	309.4
232	465.5	1573.3	41.4	973.5	118.3	273.3	78.3
233	728.9	3634.1	7030.2	1396.1	3819.1	5175.1	2235.4
235	37.3	474.7	88.2	526	120.4	662.1	42.3
236	199.7	143.3	108.3	196.9	220	171.3	142.5
237	1614.8	1725.3	2189.4	1342.6	2031.3	1672.9	1475
238	823.6	1424	1041.5	1173.3	691.2	1142.2	1169.5
239	56.1	641.7	183	140.5	95	88	683.1
240	98.3	853.8	155.4	330.5	155.1	106.4	574.8
241	84.4	1914.8	289.8	519.5	207.1	95	1367
242	2194.8	989.6	2107.8	1991.2	1042.5	1474.6	688.1
243	89.9	263.3	247.9	268.6	679.7	287.2	89
244	209.3	288.3	89.9	209.1	146.5	131	131
246	1348	810.8	270.7	434.5	85.9	160.3	487.6
247	113.4	92.8	68	145.3	125.8	139.4	150.2
248	503.9	571.2	120.3	199.5	153.6	226.1	529.7
249	650	1958.3	945.4	442.8	746.9	674.2	1861.5
251	149.3	159.2	98.7	67	54.5	98.7	133.7
253	458.5	369.7	392.2	512.7	189.7	171.8	255.1
254	759.1	1048.2	56.3	201.5	144.1	322.5	1876.1
255	395	847.1	92.8	241.2	190.6	204	937.8
256	497.3	504.3	202.9	1243.9	138.2	1112.8	153.2
257	96.8	170.3	61.6	110.7	240.3	224.1	83.2
258	80.1	318.2	1.1	4	1.2	194.6	1.3
259	31.3	422.4	35.1	291.4	170	194.9	6.1
260	144.2	118.9	152.1	196.1	181.1	162.3	192.9
261	72	118.5	599.4	788.2	759.5	233.2	707.9
263	414.9	536.2	500.4	605.6	316.7	492.7	460.5
263	550.2	391.2	170.3	206.7	218	261.4	299
265	334.6	245.7	405.7	534.5	619.5	1119	574.8
266	546.7	433.1	317.8	513.8	421.9	266.6	397.7
256	69.3	168.9	137.2	94.2	115.1	101	97.3
268	570.4	855.7	334.9	287.8	801.2	1200.2	1032.6
269	17.8	25.5	51.2	32.6	33.8	37.9	56.8
270	313.9	169.7	378.4	245.5	183.8	220.5	267
271	197.8	175.4	205.9	317.3	297.9	247.6	263.9
272	537.8	303.4	368	416.8	596.6	461.6	589.2
273	2896.5	2422.4	2113.9	4788.3	2936.5	2726.7	6835.9
274	736	340.7	226.1	863.7	465	215.6	180.7
275	312	220.3	428	292.8	254	301.5	300
276	290.2	1528.1	727.2	2093.9	539.5	692.9	622.8
277	171.5	177.3	190.4	200.2	228.4	201.6	245.6
278	57	615.1	90.6	495.4	201.9	350.4	20.5
279	2553.9	3673.6	1781.1	3550.4	3051.6	3161.9	3164.5
280	4112.4	4496.7	2693.5	6671.4	4029.9	3715.1	3402.8
281	420.9	478.9	381.7	99.3	24.7	76.5	829.5
282	284.1	237.5	220.4	467.3	243.1	183.4	280.3
283	320.7	247.3	262.2	267.1	257.1	287.9	255.5
284	86.1	60.6	66.9	82.5	68	91	102.6
285	74.5	84.5	78.8	98.8	132.4	97.7	89.8
286	140.3	125.8	856.5	479.2	1253	1123.8	337.3
287	82.7	68.3	104.9	131	118.4	100.2	124.1
288	112.6	131.8	109.3	132.3	203.1	166.3	157.2
289	329.1	523	74.6	1912.1	5	1194.8	79.2
291	72.9	135.9	147.6	116.3	111.7	106	91.2
292	61.3	181.2	49.9	155.8	43.9	982.9	77.4
293	210.2	267.7	100.5	70.6	87.4	91.2	418.7
295	880.3	560.6	520.9	266.4	534.9	307.3	261.4
296	1067.2	1234.6	688.7	782.9	718.7	604.5	724.8
297	47.9	64.8	51.5	87.2	38.6	69.1	58.3
298	551.5	344.5	386.7	324.7	241.8	269	394.7
299	1468.8	1771.8	787.5	1048	935.5	572.9	948.9
300	817.3	680.9	461.3	248.2	137.3	294.2	748.4
301	608.4	1624.7	1490.7	3382.6	4444	1930.7	1769
302	10.4	26.6	30.4	33.2	26.3	35.7	24.2
303	710.1	705.1	1706.6	859.3	577.5	788.3	425.1
304	95.7	466.8	190.4	187.2	124.8	202.8	143.5
305	157.1	529.4	493.4	795.6	163.1	69.8	249
306	131.8	108.5	180.6	143.8	154.4	173	206
307	191.4	207.2	84.5	181.7	133.4	205.1	178.9
308	2703.4	1485.8	1302	2184.2	756.3	1330.1	1074.7
310	549.2	417.5	612	811.3	723.1	576	409.8
311	145	132	126	159.1	101.9	148.1	113.9
312	1216.9	574.9	992.1	892.8	612.7	695.2	1340.7
313	307.7	190.1	158.9	201.8	115.6	112.7	1437.5
314	416.9	725.7	134.8	157	168.8	428.1	448.6
315	192.5	412.2	496	467.2	366.2	506.8	341.4
316	444	470.1	95.3	286	281.8	131.4	291.2
317	157.9	142	150.3	197.9	191.9	177.2	201.1
318	140.5	334.7	56.9	29.1	73.1	87	78.1
319	706.9	280.3	127.7	267.6	70.7	164.5	199.4
320	535.8	590.3	887.9	568	592.8	742.2	577.9
321	340.3	326.5	372	793.8	460.1	414.9	375.2
322	352.2	258.3	185.4	237.2	248.6	152.6	280.9
323	2455.7	4246.4	3485.2	2786.2	4469.1	2754.2	4942.2
324	348.9	411	169.2	70	73	87.9	460
325	449.5	519.2	168	216.7	282.5	299.4	469.4
326	1603.6	3167	3571.4	404.9	4260.9	3099.9	1692.6
327	26.8	44	10.3	12.2	25.7	20.6	8.2
328	277.9	499.5	114.4	194	624.6	445.4	617.5
329	63.1	51.9	64	54.1	56.3	67.2	81.9
330	26.8	398.3	51.1	38.3	53.4	44.1	28.4
331	353.6	211.8	246.9	326.3	313.7	256.2	346.2
333	628.2	817.1	534.6	764.7	963.2	1039.8	993.5
334	129	131.6	121.3	127.9	171.5	135.9	210.2
335	61.5	83.3	276.3	550.9	108.1	127.9	116.4
336	877.3	835	262.7	397.8	457.2	330	598.7
337	119	244.5	349.6	426.7	114.8	364.1	225.7
338	213.7	307.5	152.1	190	160	264.1	213.2
339	337.9	298.3	253.4	278.6	421.1	490.3	476.5
340	161.4	161	248.4	316.2	277.8	273.6	290.1
341	575.9	645.8	726.6	782.5	1057.6	767.6	465.1
343	1203	450.3	740.9	103.8	137.1	178	105
344	1275	1111.4	1819.2	1393.5	1260.3	1521.1	1289.7
345	164.6	211.9	210.1	208.7	288.4	221.3	290.7
347	2603	3049.5	1135.9	1212.8	2982.6	3471.6	2440.3
348	4636	4968.1	2088.3	2517.8	4998.7	6143.9	5642.9
349	231.2	321.5	329.2	238.9	199	275.7	273.9
350	306.8	357	165.3	139.9	214.3	201.7	315.7
351	661.6	248.9	70.2	75.7	64.2	140	76.9
352	228.8	337.7	313.8	812.7	340.3	238.1	322
353	268	118.5	158.9	211.1	171	284.3	124.5
3k
SEQ ID NO:	967TT	968TT	969TT	970TT	982TT	983TT
354	23.2	55.9	169.3	22.6	1.2	136.2
355	28.5	50.2	1052.4	81.6	25.9	96.4
356	625.8	410.2	2722.4	190.1	528.5	449.5
357	301.6	385.5	990	299.7	781	321.6
358	855.6	468.3	570.2	419.9	530.5	768
359	336.5	327.4	464.6	420.5	326.9	556.2
362	247.8	386.1	248.5	248	355.4	570.5
360	219.2	183.9	501.1	198.9	170.3	376.9
361	248.2	544	730.9	108.3	746.6	231.5
363	716.9	541.2	438.2	3964.4	373.4	824.2
1	469.7	405.7	1234.4	133.8	970	527.9
2	135.1	2759.1	3994.4	239.3	3662.3	264.1
7	1.3	402.8	129	94.8	1127.5	460.2
8	1162.1	811.3	967.4	854.4	644.1	915.3
9	2702.9	1018.8	4839.3	217.3	1823.6	997.2
10	190.7	504.6	237.6	195.3	126.1	271.3
11	1104.8	1435.3	2566.4	297.7	275.4	422.7
13	198.3	136	54.3	73.1	68.5	266.9
14	545.3	572.6	232.1	73.2	69.4	676
15	82.9	465.9	409.7	155.7	537.1	134.5
16	981.5	987.6	1149.6	167.1	888.7	1443.1
17	178.5	639	1677.1	125.2	2064.5	437.9
19	289.1	542.1	212.7	359	106.4	291.4
20	1.1	118.7	73.8	1.2	19.5	6.1
21	928.1	1108.3	1144.3	77	10.6	499.2
22	1063.2	3119.6	4358	872.9	8269.8	577.8
23	1.2	379.9	35.2	1.2	1.1	61.4
24	73.7	59	226.7	57.2	297.5	65.5
26	117.4	453.2	143.8	58.4	89	440
27	1699.9	830.8	811.4	403.5	511.2	509.3
29	594.6	288	325.3	378	112.4	982.9
30	86.9	82.7	124.5	10.9	45	97
31	1573.7	38.8	497.9	471.5	34.3	72.6
33	441.8	872.9	1130.8	75.9	411.7	352
34	1018.8	2164.1	2701.3	2309.9	2634.9	4374.3
35	99.6	70.4	393.2	80.2	13.2	133.7
36	167.8	137.3	152.5	203.8	1201.5	111.3
37	329.9	181.7	190.5	777.4	172.2	464.8
38	240.2	1359.2	1110.5	89.7	1069.5	51.1
40	666.4	451.5	462.6	593.8	349.6	703.8
41	180.9	1696.6	333.6	178.9	730	231.9
42	176.5	403.8	214	306.2	308.2	287.7
43	821.9	483.9	321	1489	232.8	1352.9
44	467.5	380	471.5	555.7	360.3	455
45	770.8	434.4	558.1	1817	1071	1373.8
46	411.4	330.8	255	409.7	273.6	401.2
47	166.6	296.7	247.1	277.4	321.6	130.9
48	1.2	116.9	1.2	69	28.9	111
49	627.1	965.5	130.2	225.8	251.8	772.3
50	142.5	216.3	192.3	15.1	77.1	161.5
51	57.4	149.4	38.2	2101.5	1490.9	1190.6
52	308.7	413.6	298.7	307.9	217.7	234.6
53	84.9	100.2	159.9	93.3	102	217.6
54	870.3	607.4	345.8	269.3	669.6	529
55	161.6	94.8	98.6	115.2	110.3	144.3
56	106.7	36.5	54	42.1	150.1	33.6
57	343.8	1228.1	103	770.3	171.3	966.7
58	392.8	1366.3	238.3	1256	263.5	1149.6
59	605.2	1677.6	2094	285.7	1088	1273.8
60	202.7	198	164.7	124.8	168.1	155.5
61	542.2	245.6	124.9	288	103.9	201.2
62	1650.5	7509.1	3612.1	1170.1	318.8	9459.8
63	259.6	202.4	365.9	187.3	388.3	316.8
64	540.3	166.5	122.8	1276.6	123.7	1611
65	88.4	78.4	66.1	90.1	66.4	98.4
66	351.3	424.5	843.2	182.5	1223.8	103.2
67	8409.7	26223.6	34005.1	9041.4	32601.5	3094.7
68	2810.9	3260.1	2929.3	4961.6	4818.8	513.1
69	11767.3	6789.1	10957	11079.3	10388.2	3855.9
70	2845.6	1603	1889.8	8120.7	1927.8	1628.7
71	268.6	92.8	207.5	74.8	92.7	322.2
72	139.6	120.7	919.8	113.4	282.2	275.2
73	237.7	278.3	786.2	192.5	388.7	263.9
75	91.9	141.7	446.1	57.6	157.7	455.9
76	554.2	24.1	14.5	498.3	903.9	2000.7
77	2410.2	1463.1	4948	4569.6	2755.1	5975.3
78	315.7	431.5	516.1	324.3	1188.7	81
79	162.4	146	171.7	204.3	106.5	265.2
80	100.7	790.8	491.3	95.1	372.8	933.3
81	2776.2	78.6	226.5	49.7	116.4	232.7
82	1230.5	231.4	120	1479.5	468.6	3720.2
84	308.9	961.7	101	78.7	204.4	653.1
85	350.3	125.3	159.1	154.7	129	484.4
86	91	85.7	73.9	126.3	52.9	189.6
87	296.2	320.3	1151.2	607.3	338	598.1
88	1909	1350	5707.2	1415.8	10923.2	860.8
89	206.8	203.5	145.5	160.9	154.6	303.9
90	95.9	93.9	95.8	99.7	108.7	108.2
91	362	346.8	219.6	491.8	78.8	550.5
92	3647.7	833.5	7305.9	83.4	3870.6	3178.4
93	158.2	341.1	321.3	94.2	217.3	459
94	199.5	488	854.3	71.2	251.2	114.4
95	90.1	99	154.9	131	686.8	242.9
96	152.2	124.4	172.1	130.6	192.9	111.2
97	251.1	342.4	429.8	95.2	143.5	354.9
98	240.9	37.1	30.6	67.9	14.8	257.9
99	321.4	281.7	244.4	316	192.3	311.7
100	288.5	356.2	13918.1	777.1	7145.1	1884.5
101	158.2	192.6	116.4	133.6	117.1	224.1
102	353.9	153.6	142.8	363.4	159	275.5
103	351.3	300.2	333.9	367.9	291.8	152.5
104	274.1	45.1	405.3	200.1	1282.8	873.3
105	449.3	51.2	538	259.7	701.6	1037.6
106	297.6	32.8	390.4	273.1	945.8	933.9
107	169.5	176.1	188.6	213.6	121.6	426.3
108	160.8	676.4	409.7	356.4	505.9	328.9
109	3423.5	49.2	4125.3	130.2	29.4	301.6
110	5966.7	10.7	4569.2	200.4	25.8	956.3
111	253.1	609.4	71.4	158.5	134.5	223.5
112	1062.8	94.2	773.3	1195.8	507.3	1.2
113	221.5	123.7	67.4	210.1	274.1	7.7
114	123.6	108.3	382.3	250.2	272.6	105.3
115	397.9	320.1	369.8	242.8	282.1	292
116	279.4	395	237.5	165.5	184.5	311.1
117	200.4	1406.9	3545.8	607.8	2324.7	349.8
118	336.5	116.3	86.4	5808.9	64.9	2556.4
119	365.6	76.7	50.2	122.9	83.3	80.8
120	48.1	344	49.8	99.6	3044.7	110.5
121	259.6	336.7	403.1	87.6	1213.5	143.5
122	292.8	185.3	455.1	158.5	34.9	507.8
123	139.7	152.8	81.1	352.1	126	366.5
124	172.2	143.6	148.2	5160.7	124	172
125	1555.3	978.9	878.3	1620.9	867.1	1453.5
126	87.5	59.3	1558.6	257.7	1842.3	258.4
127	140.3	83.5	117.6	156	105	192
128	320	249.4	167.1	365.5	265.9	418.6
129	189.6	189.4	161.7	86	198.2	224.2
130	122.9	84.1	71.2	115.6	87.4	72
131	140.1	39.7	182.4	236.8	71.2	535
132	243.2	184	208.8	237.5	218.6	256.7
133	174.8	338.7	113.2	82.8	67.1	321.5
134	182.1	160.9	497.9	87.7	278.3	109.1
135	286.8	205.4	723.3	307	241.7	336.9
138	146.4	136.3	144.8	124	114.4	176.2
139	202.8	189.9	152	72.1	169.5	132.4
140	18.2	1010.6	2927.9	23.6	1469.1	1.5
141	178.6	283.5	2257.9	3.4	1606.2	310
144	6356.1	261.5	311.4	419.2	349.3	527.5
145	298.7	186.1	180.4	255.9	190	279.2
146	272	229.4	195.1	295.7	196	343.1
147	42.5	44.6	35.8	58.6	44.5	29.3
148	357.4	192.1	831.9	156.5	464.4	1068.9
149	272.6	184	1807.9	33	284.7	171
150	182.2	502.5	356	148.7	526.3	948.6
151	265.1	174.8	181.4	138.7	143.7	162.4
153	132.4	185.7	157.8	103.5	113.3	218.6
154	145.6	46.6	390.9	121.8	68.4	160.8
155	226.6	139.4	130.3	224.6	96.3	238.7
156	81.5	50.5	20.5	169.1	107.5	88.7
157	226.7	170.6	136.4	131.5	112.2	189.1
158	236.4	237.1	1.1	202.4	39.1	650.6
159	1520.9	4126.2	3171.7	755.4	4600.4	3258.9
161	31.6	790.1	3.5	12.1	2.5	1.3
162	62.1	71.5	45.6	40.8	21.6	57.1
164	391.7	235.7	1236.8	91.4	215.8	40.9
166	4422.1	4880.3	7064.9	2557.6	3776.6	8467.5
167	544.2	1623	684.2	1035.6	3875	2178.2
168	2410.7	82.3	985.8	19.1	523.6	43
169	485.1	1840.5	7446.2	1266.9	1301.4	2686.1
170	971.7	643	1478.2	166.9	2916.1	760.7
171	38.2	233.9	733	1.2	1.2	503.5
172	492.3	472	656	483.1	510.4	757.2
173	542.8	375.8	794.6	114.4	595	647.8
176	10.6	32.1	1.2	69.1	991.6	1.2
177	224.2	1237.4	236.6	1044.6	789.8	993.8
178	1934.6	409	470.7	650.5	1387	941.3
179	145.3	412.9	60.7	161.2	85.7	245.7
180	161	92.4	67.4	128.2	94.3	131.7
181	9117.6	8152.5	11035.8	13798.5	15093.4	8202.9
182	189.4	445.2	574.2	128.1	524.1	227.5
183	1.1	64.7	11.7	1.2	1.1	72.1
184	215	541.8	290	167.9	286.9	190
185	973.9	711.7	1014	679.8	914.9	1030.3
186	377	560.6	395.4	1755.4	302.8	732.2
187	53.8	67.3	41.8	81.4	33.1	104.6
188	43.6	33.7	103.2	61.3	1218.5	94.9
189	86.4	37.9	69.2	84.5	695.6	108.4
190	407.6	372.7	283.5	135.6	90.2	162.9
191	359.8	2605	2070.6	919.3	2961.2	4325.2
192	856.8	383.6	183.3	146.2	69.3	827.1
193	75.8	1538.4	2686.5	638.6	2367.3	33.3
194	121.6	135.5	230	28.4	238.5	127.6
195	159.5	372.6	180	614.6	333.1	355.6
196	7404.9	4791.5	952.5	7933.6	7823.2	8113.2
197	133.6	44.6	130.5	218.5	71.7	113.9
198	129.4	323.2	103.3	138.9	56.8	123.9
199	105.7	36	1584.1	2.7	42.7	162
200	251.1	102.9	160.6	270.3	374.1	170.5
201	70.3	49.7	172.9	58.1	1.6	125.6
203	155.2	84.1	172.2	202.8	393.4	343.4
204	258.9	711.5	1093.8	268.3	710.3	515.6
205	1215.1	1501.8	7081.6	570.2	5009.6	1308.5
206	328	173	298.2	310.4	185.1	597.2
207	172.9	68.6	1428.1	46.5	2541.6	144.3
208	1492.3	7	24.8	10.1	783.8	45.3
209	667.1	1776.2	311.6	1203.9	2745	1499.4
211	1193.2	2651.6	12245	343.1	25458	17479.9
212	837.5	433	245	2353.6	512.9	728.8
213	203.3	87	71.4	3629.9	93.5	468.6
215	176	71.1	554.7	57.5	3381.9	202
216	611.8	308.3	915.4	490.4	896.8	690.5
217	118.5	146.7	191.2	121	293.9	120.7
218	252.2	466.5	274.1	124.9	335.3	428.6
220	125.2	75.4	108.2	10561	77.9	131.8
221	139.2	264.1	452	146.5	699.3	143.9
223	415.6	845.6	362.8	477.7	165.6	689.8
227	314.8	2480.3	1008.1	182.6	1091.2	223.2
228	432.9	294.9	213.2	461.6	568.4	517.8
229	143.7	774	171.7	1810.6	305	446.6
230	179	63.3	79.4	202.4	63.6	37.6
231	136.2	113.7	127	180.7	207.4	205
232	45.3	272.3	86.5	8.9	63.8	337.4
233	1483	4545.5	6134.3	1579.1	7762.7	3649.3
235	85.7	443.4	423.8	66.6	211.8	323.6
236	110.2	202.4	106.8	196.1	123.9	257.5
237	1495.9	564.8	1641	1057.2	1533.6	704.4
238	744.2	349.2	899.4	244.1	1354	349.4
239	186.3	100.4	196.3	93	124	153.1
240	195.9	71.5	727.2	65.8	131.3	148
241	237.2	205.2	1034.3	94.1	300.5	145.6
242	5003.3	13867.1	2129.7	15742.7	4086.9	11985.6
243	803.1	288.9	174.5	134.2	226.2	143.1
244	97.8	194.6	282.9	8.3	256.1	109.7
246	359	276.8	388.3	169.2	115.4	448.4
247	170.8	140.7	109.7	303.9	118.1	139.1
248	245.6	109.7	217.3	113.2	196.9	135.7
249	96.3	216.6	223.8	135.9	48.3	585.6
251	187.9	61.1	115.5	59.8	112.5	93.9
253	260.8	275.7	327.1	165.6	468.1	240.6
254	63.2	64.3	465.3	121	2267.5	15.9
255	1923	352.4	648.8	811.1	1499.8	1126.3
256	563.4	448.2	228.9	490.4	82.7	573.9
257	378.8	648.4	475.3	161.3	185.7	145.8
258	582.1	257.2	5241.4	168	40.2	1024
259	30	73.9	532.4	28.9	44.5	13.3
260	209.5	228.1	128.5	237.3	114	618.7
261	135.7	834.3	320.6	115.8	259.6	134.1
263	320.6	673.5	537	470.6	473.9	2280.3
263	316.2	103.4	161.5	369.4	123.6	137.2
265	106.3	287.4	601.3	317.4	934.8	119.6
266	216.8	145.8	179.8	955	181.8	470.8
256	147.4	89.7	97.7	81.8	124.2	119.5
268	304.8	19.7	60.1	175.6	2929.8	220.9
269	61.3	84.9	35	57.5	38	158.7
270	276.1	144.9	183.1	1394.4	176.9	726.2
271	139.7	191.4	249.6	243.4	292.7	190
272	1068.5	485.1	605.5	722	403	558.4
273	145.8	421.9	4104.1	1.3	1705.7	34.7
274	178.2	517.1	426.4	468.2	206.6	681.6
275	271.4	219.3	164	299.8	209.9	428.2
276	396.3	3030.8	977.3	188	1246.2	307.4
277	228.6	153.3	181.7	212.1	199	244.3
278	50.3	1164.1	1019	52	88.6	105.7
279	985.7	1407	2129.1	232.5	2794.6	1002
280	1510.7	2192.5	6373	286.6	3920.2	1434.5
281	24.5	1.2	32.8	20.6	66.1	40.3
282	4703.6	248.3	312.9	291	241.6	404.4
283	413.8	290.4	220	660.8	232	552.8
284	106.4	84.7	78.8	140.9	65.1	99.7
285	148.4	92.7	162.5	143.5	104.4	219
286	129	10.1	1134.4	36.1	1.3	510.6
287	127.8	111.9	67.9	468.2	86.5	147.5
288	267.1	129.5	153.3	256.4	171.7	231.2
289	91.1	390.9	271	465.5	214.2	1306.3
291	133.2	72.5	78.4	5.9	133.9	35.1
292	75.7	25.7	293.3	71.5	18.4	104.7
293	438	86.4	72.7	37.3	77.1	371
295	244.8	581.6	30.1	979.1	569.4	507.9
296	1349.4	504	1210.8	671.3	716.7	813.5
297	64.9	45.4	49.4	853.9	62	98.3
298	186.2	307.3	416.8	311.1	232.4	211.4
299	306.5	444.4	962	703.8	375.8	401.4
300	420.6	101.7	176.4	125.4	475.3	235.4
301	507.2	2222	808.6	528.9	1281.3	340.3
302	29.2	22.3	23.2	31.4	9.5	10.1
303	457.4	993.6	1360.4	930	836.6	1031.2
304	262.8	452.7	227.3	209.2	208.1	397.9
305	531.2	6335.1	145.3	300	1625.9	5308.7
306	262.8	287.6	155.9	258.3	126	317.5
307	150.7	121.6	150	167.9	118.6	139.3
308	1991.2	756	1163.4	4741.6	1375.7	4290.1
310	950.2	194.6	1093.2	1092.8	219.2	640.7
311	64.6	25.1	144.2	55.8	44.7	73.8
312	797.1	35.8	1289.1	5881.4	362.4	1192
313	542.5	719.4	122	119.1	139.3	161.9
314	938.2	209.6	551.3	68.6	147.2	345
315	123.7	274.1	155.2	218.6	299.1	52.8
316	289.8	413.1	415.9	205.6	84.3	704.2
317	202.4	156.1	133.7	210.8	138.1	206.3
318	126.8	259.1	109.3	26.5	16.2	157.6
319	362	168.9	161.6	713.5	195.9	1566.2
320	503.3	277.3	356.8	1176.5	487.2	297.3
321	218.1	470.4	426.1	337.2	517.9	711.3
322	375.3	251.1	292.4	504	186.1	609.6
323	553	949.4	2829.3	768.9	4431.8	1365.8
324	179.2	52.7	227.9	81.1	81.7	41.1
325	335.3	242.7	242.8	170.7	198.5	313.4
326	1260.9	2604.5	4986.5	584.6	5373.5	643.7
327	29.1	14.2	26.9	21.4	61.9	2.8
328	58.8	218.5	113.1	63.9	223.4	73.3
329	191.7	61.4	40.3	147.8	62.3	144.2
330	134.1	100.9	58.4	36	18.7	37.3
331	445.5	369.7	271.4	981.9	227.2	893.2
333	76.9	473	115.9	230.1	287.1	484.1
334	172.8	136	152.4	100.5	143.3	120.5
335	122.9	126.9	113.2	212.1	846.9	658.3
336	308.8	716	987.8	236.4	665.2	600.4
337	43.9	98.3	1139.9	53.3	129.7	270.9
338	290.4	144.6	420.3	105.8	134.4	220.2
339	338.2	255.3	217.6	483.7	351.7	459.4
340	241.7	256.2	235.6	263.3	247.8	313.8
341	693.6	1174.2	706.5	545.1	590.9	506.5
343	2675.2	997.1	235.2	5179.8	686.5	3885.2
344	1600.8	650.5	866.5	3374.5	937.5	785.9
345	371	324	225.2	332.3	208.4	349.4
347	930.2	70.2	922.3	734.3	7238.6	705.8
348	2298.3	37.7	1946.1	988.1	10651.2	2867.2
349	208.2	402.1	215.3	174.1	296.4	343.8
350	2.9	34.4	518.4	27.6	143.5	191.8
351	188.2	69.4	94.8	40.4	46.1	744.7
352	269.7	230.4	500.5	390.8	298.9	319.5
353	757.9	154.1	248.3	481.8	1304.4	432.8

TABLE 4
4-Gene signature performance in 98 training samples
	Tumor	Benign
	Positive	48	18
	Negative	4	28
	Sensitivity	92% (0.82, 0.97)
	Specificity	61% (0.46, 0.74)

B. Signature Identification using Linear Discrimination Analysis

We used a forward selection process that adds one gene at a time until the posterior error as evaluated by a linear discriminator is less than or equal to 0.1. A four-gene signature was discovered using this approach with the 322 genes. The identities of these 4 genes are listed in Table 5 and 16 and their chip data are shown in Tables 6 and 7.

TABLE 5
4-Gene Signature
SEQ ID NO: Gene Name
354        Chemokine (C—C motif) ligand 18 (pulmonary and
           activation-regulated)
199        Pulmonary surfactant-associated protein B (SP-B)
207        K+ channel beta subunit
255        Putative prostate cancer tumor suppressor

Leave One Out Cross Validation (LOOCV) resulted in 92% sensitivity and 61% specificity, shown in Table 4. The ROC curve gave an AUC of 0.897, as shown in FIG. 1.

TABLE 6
SEQ
ID	Signal
	PC_984TT	PC_986TT	FA_987TT	PC_988TT	PC_989TT	FA_992TT	FA_993TT
12	3399.2	7041.3	5438	6376.7	2734.6	3569.5	4305.9
18	6550.8	5870.6	5815.9	4265.1	8856.4	3454.4	20405.3
29	4578.6	6455.8	2329.4	4259	2666.8	3694	7531.2
	FA_994TT	FA_995TT	FA_996TT	FA_998TT	FA_999TT	FA_1001TT	FA_1002TT
12	2545.7	2451.8	4418	3938.3	3648.5	6834.5	4882
18	12566.4	9889.5	4341.5	5210.1	6639.5	4794.8	3921.9
29	2239.8	1834.5	4607.1	6424.1	3069.6	4301.4	3164
	FA_1004TT	FA_1005TT	FA_1006TT	FA_1010TT	FA_1013TT	FA_1014TT	FA_1017TT
12	2274.9	2644.2	3978.8	2999.7	4012.5	1724	5005.8
18	10402	7376.3	9985.1	1330.3	4618.8	6132	4562.6
29	1688.9	4771.2	3159.1	3082.6	6861.7	1465	3384.7
	FA_1018TT	FA_1020TT	FA_1023TT	FA_1024TT	FA_1026TT	FA_1027TT	FA_1028TT
12	2847.6	7102	7513.5	2086.3	2431.3	1318.2	1231
18	6388.5	2640.8	1967.7	6853.3	5068.5	2006.4	1804.9
29	3829.5	4235	4272.5	924	1702.3	1691.5	1731.3
	FA_1029TT	FA_1030TT	FA_1031TT	FA_1032TT	FA_1034TT	FA_1035TT	FC_1037TT
12	4607.6	2416.1	2203.7	6489.9	2095.3	1547.9	1847.4
18	3507.3	2270.8	8058	11247.5	8258.1	7485.8	8309
29	1530.5	5641.4	3460.1	4802.1	1650.7	854.6	2418.4
	PC_1039TT	PC_1040TT	PC_1041TT	PC_1042TT	PC_1043TT	PC_1044TT	PC_1045TT
12	8204.9	2638.5	4795	2607.8	6725.4	5178.7	2111.1
18	6454.7	10129.3	7964	4952.6	3663.3	1887.7	19840.6
29	8858.5	4136.8	8434	2230.7	3434	2770	2243.1
	PC_1046TT	PC_1047TT	PC_1048TT	PC_1049TT	PC_1050TT	PC_1051TT	PC-FV_1052TT
12	4403.6	9394.7	2262.5	4831.2	2826.9	1288.6	1953.2
18	2417.7	5678.4	6655.2	4325.2	1706	6904.8	4596.1
29	2319.8	20509.6	1176.1	5375.3	2053.1	4027.5	3332.3
	PC_1053TT	PC_1054TT	PC_1055TT	PC_1059TT	PC_1060TT	PC_1061TT	PC_1062TT
12	4150.4	6180.4	1835.7	2447.2	4201.3	4984.3	3399.3
18	5965.7	13847.6	3740.6	4167.7	14516.2	4896.7	8891.6
29	3718.1	4818.3	1728.8	2972.2	4851	3469	3718.6
	PC-	PC-	PC-		PC-	PC-
	FV_1064TT	FV_1065TT	FV_1066TT	PC-FV_1067TT	FV_1068TT	FV_1069TT	PC-FV_1071TT
12	4221	4884.5	7256.6	640	4055	3208.2	6301.3
18	4095	6627.6	1427.1	5405.5	10722	11509.9	10314.3
29	5896.7	5461.2	9437.3	1634.4	1344.2	2186.4	1794.8
	PC-
	FV_1072TT	FA_1073TT	FA_1074TT	FA_1075TT	FA_1076TT	FC_1077TT	FC_1078TT
12	1390.3	3325.5	1430.8	1784.4	1563.9	1999.4	1830.7
18	5629	10010.5	3459.2	11454	10807.8	1384.8	11906.2
29	2974.5	7133.1	3009	4184.9	1673.9	1044.5	4264.1
		PC-	PC-
	FC_1079TT	FV_1080TT	FV_1081TT	FC_1082TT	pb1	pb2	pb3
12	2856.2	2437.9	3541.2	4439.8	11.4	9.1	9.9
18	22738	4344.1	4108.3	3312.3	94.2	50.7	67.6
29	1092.8	3052.8	3302.6	2383	8.7	21.6	30.5
	pb4	pb5′	pb6′	pb7′	pb8′	pd10	pd11
12	33.8	8.3	6.6	18.8	61.4	38.2	10.7
18	74.9	29.7	53.6	37.8	31.8	68.8	117.5
29	66.1	64.6	36.4	51.5	25.1	17.2	17.2
	pd12	pd9
12	4.1	11.6
18	70.8	23.4
29	19.7	11

TABLE 7
SEQ
ID	Signal
	FA_987TT	FA_992TT	FA_993TT	FA_994TT	FA_995TT	FA_996TT	FA_998TT
354	50.9	100.4	63.7	14	699.7	181.7	11.9
199	81.7	18	43.3	130.3	461.9	469.4	135.6
207	3844.9	1325.1	77.9	397.2	518.3	807.5	1084.3
255	1374.4	2332.1	1631	611.1	1616.7	419.2	230.7
	FA_999TT	FA_1001TT	FA_1002TT	FA_1004TT	FA_1005TT	FA_1006TT	FA_1010TT
354	194.7	2397.3	50.6	205.2	9.6	29.1	341.5
199	124.1	574.9	206	158.5	423.6	121	2489.4
207	1861.5	1325.1	846.6	308.8	1765.9	598.9	1067.7
255	266.5	186.7	324.2	94	1071.3	1098.5	1294
	FA_1013TT	FA_1014TT	FA_1017TT	FA_1018TT	FA_1020TT	FA_1023TT	FA_1024TT
354	207.5	69	21.7	20.1	64.7	87.4	372.5
199	440.8	99.8	221.6	226.9	108.2	155.2	112.6
207	535.7	1910.9	1185.2	571.8	1552.7	2739.5	692.6
255	437.2	655.6	165.1	178.4	86.4	436.5	40.7
	FA_1026TT	FA_1027TT	FA_1028TT	FA_1029TT	FA_1030TT	FA_1031TT	FA_1032TT
354	21.5	18.1	3.8	13.3	66	15.1	38.8
199	70.9	46.1	561.3	67.7	35.8	48	107.3
207	1230.4	80.5	732	3216.4	2253.5	1989.9	2115.2
255	479.9	226.5	35.9	1403.4	1144.3	247.9	1989.4
	FA_1034TT	FA_1035TT	FA_1073TT	FA_1074TT	FA_1075TT	FA_1076TT	PC_984TT
354	61.3	25.3	1355.7	188.5	14.7	8.9	97.5
199	216.5	56.1	1980.6	454.1	86.2	173.8	154.2
207	421.8	1493.5	771.6	1291.4	116.5	1169.9	759.2
255	489.2	229.5	205.3	655	152.7	156.3	152
	PC_986TT	PC_988TT	PC_989TT	PC_1039TT	PC_1040TT	PC_1041TT	PC_1042TT
354	966.6	619	12.9	2577	540.4	1229.7	320
199	103.9	142.5	288.5	1006.6	3990.7	17402.7	1023.2
207	400.5	2357.5	1213.8	627.5	62.6	133.6	981.5
255	299.7	2137.5	131.9	500.6	2412.4	2763.1	303.4
	PC_1043TT	PC_1044TT	PC_1045TT	PC_1046TT	PC_1047TT	PC_1048TT	PC_1049TT
354	444.3	170.8	817.6	1095.1	966.8	1263.5	800.7
199	604.3	222.7	22961.4	9488.3	10311.6	1702.7	1366
207	1680.3	594.2	136.5	673.2	755	20.8	254.8
255	407.6	4162.4	872.5	2472.3	1497.3	2944.8	2399.9
	PC_1050TT	PC_1051TT	PC_1053TT	PC_1054TT	PC_1055TT	PC_1059TT	PC_1060TT
354	292.9	614.4	1035.4	1545.3	139.5	500.2	37.1
199	117	29233.8	1435	8550.5	242.8	13914.6	2377.3
207	87.8	113.4	73.3	187.7	491.6	158.4	207.3
255	2331.8	917.2	1505.9	2186.4	3033.2	2191.1	215.4
	PC_1061TT	PC_1062TT	FC_1037TT	FC_1077TT	FC_1078TT	FC_1079TT	FC_1082TT
354	71	23.8	18.4	28.9	87.2	13.5	27.7
199	6933.5	616.2	21.2	226.7	200.8	40.8	144.4
207	1088.5	1133.5	838.8	2012.3	24.9	196.8	1356.4
255	3084.8	1017.8	1355.3	199	1352.4	1578	1294.4
			PC-	PC-	PC-	PC-	PC-
	PC-FV_1052TT	PC-FV_1064TT	FV_1065TT	FV_1066TT	FV_1067TT	FV_1068TT	FV_1069TT
354	394.8	131.4	143.7	281.9	302.1	973.6	44.9
199	4620.7	1931	1613.2	170.8	579.2	20066.3	96.9
207	88.2	1033.1	705	244.1	2559	8.8	12.3
255	2479.7	242.2	1322	641.9	1222.8	1914.8	93.2
			PC-	PC-
	PC-FV_1071TT	PC-FV_1072TT	FV_1080TT	FV_1081TT
354	109.5	127.2	205.7	12.4
199	257.5	2302.7	320	206
207	42.9	72.2	2795.9	145
255	1128.1	2320.8	1705.2	196.8

C. Manual Selection of Markers

Individual genes were selected with an aim to formulate a RT-PCR based assay. Comparison of gene expression profiles between thyroid cancers and non-cancer tissues has identified a five-gene signature from these 322 genes. The identities of these five genes are shown in Tables 8 and 16 and the chip data are shown in Table 9. The performance of this signature was assessed using LDA in the 98 samples, and the signature gives 92% sensitivity and 70% specificity, shown in Table 10. The ROC curve gave an AUC of 0.88, as shown in FIG. 2.

TABLE 8
5-Gene signature
SEQ ID NO: Gene Name
53         Cadherin 3, type 1 (P cadherin)
242        Fibronectin
73         Secretory granule, neuroendocrine protein 1
36         Testican-1
211        Thyroid Peroxidase (TPO)

TABLE 9
SEQ
ID
	BN_800TT	BN_801TT	BN_802TT	BN_804TT	BN_805TT	BN_806TT	BN_807TT
36	908.3	247	118.9	349.7	425.1	229.8	227.7
53	48.6	25	24.1	34	17.8	32.2	16.7
76	252.3	272.9	75.2	260.6	169	587.1	189.8
242	22247.9	1204.2	676.7	2441.5	3900.1	2073.4	2060.1
211	24.2	16983.5	32579.5	20189.3	24480.5	14186.3	6488.1
	BN_871TT	BN_913TT	BN_914TT	BN_915TT	FA_917TT	FA_918TT	FA_919TT
36	897.2	435.1	442.3	508.7	169.6	184.3	213.3
53	192.4	28	76.1	44.2	67.7	135.7	25.7
76	2134.6	252.5	956.3	174.3	62	144	233.8
242	13722.5	10481.9	4172.9	1891.1	1654.2	11791	2788.1
211	6243.3	16339.1	14355	36350.1	29876.5	19395.7	15935.8
	FA_818TT	FA_819TT	FA_820TT	FA_821TT	FA_822TT	FA_842TT	FA_862TT
36	120.4	155.8	210.6	31.7	283.3	122.2	24.1
53	27.2	26.9	34	33.2	34.4	27.8	66.1
76	13	69.8	36.2	171.2	116.2	190.8	15.9
242	1433.3	2211.8	2714.7	325	2278	3959.5	1573.1
211	15976.6	19882.4	10029.6	29411.3	25179.3	12492.5	32721.4
	FA_863TT	FA_864TT	FA_865TT	FA_866TT	FA_867TT	FA_869TT	FA_907TT
36	955.1	173.1	400.5	230.8	233.5	2581.5	207.8
53	333.9	27.9	147.1	155	25	1224.9	52.8
76	2614.7	624.1	614.9	336.7	163.5	1921.3	38.5
242	930.4	1419.2	4708.4	2169.8	1081.9	3241.5	4555.3
211	19631.3	27382.8	29846	25011.6	30599.1	23680.6	35313.3
	FA_908TT	FA_920TT	FA_938TT	FA_940TT	FA_941TT	Fa_EA40374_921TT	Fa_EA40376_923TT
36	329.6	165.4	331.5	298.8	267.4	211.3	188.6
53	35.8	28.5	21.7	291.4	45.3	23.8	62.8
76	253.8	64.7	3312.7	870.1	1038.3	153.3	236.1
242	1630.4	2452.4	6684	765	2229.5	1809.2	3314
211	21639.5	31897.6	26420.3	18786.4	31922.5	36025.3	15065.2
		BN_EA40377_924TT	Fa_EA40378_925TT	Fa_EA40379_926TT	BN_EA40380_927TT
36		1409.1	215.1	228.5	833.3
53		2294.2	40.5	496.1	64.9
76		624.1	149.1	211.3	501.1
242		21699.6	1079.3	21653.5	3263.3
211		664.1	12583.3	13036.6	43191.4
	Fa_EA40387_955TT	Fa_EA40388_956TT	Fa_EA40389_957TT
36	94.7	259.7	786.2
53	197.4	230.4	17.3
76	2225.4	1443.7	223.7
242	2194.8	989.6	2107.8
211	9409.2	19630.9	4160.9
	Fa_EA40390_959TT	Fa_EA40391_960TT	Fa_EA40392_961TT	Fa_EA40393_962TT	PC_829TT	PC_830TT	PC_831TT
36	2496.1	175.3	58.2	1470.7	330.3	210.3	432.7
53	24.4	40.3	52.6	183	73	49.6	1916.2
76	2397	47.6	77.2	1048.1	758.4	576.2	394.3
242	1991.2	1042.5	1474.6	688.1	6760	6785	25733
211	38927.5	31764	34287.3	44314.7	25565	31930.4	138.4
	PC_832TT	PC_834TT	PC_835TT	PC_836TT	PC_837TT	PC_838TT	PC_839TT
36	1376.8	4076.8	1208.3	585	1015.5	1620.2	71
53	1909.1	2701	1178.5	710.7	1469.6	3009.9	41.2
76	433.6	665.5	654.3	2432.3	412.1	1946.7	327.2
242	9423.8	18037.6	23053.8	1044.8	22442.7	27313.9	3641
211	7174.2	1961.7	282.1	24646.9	15840.2	264.2	17049.3
	PC_879TT	PC_881TT	PC_882TT	PC_883TT	PC_884TT	PC_885TT	PC_886TT
36	457.4	1779.4	561.2	722.1	1129.2	552.5	1244.9
53	2036.8	3121.5	2072.4	2753	2221.1	1703.8	1325.9
76	1168	1829.9	1210.6	2663.6	1076	1232.2	1866.8
242	46283.3	32477.3	33142.3	38026.7	42087.5	49249	39172.5
211	86.8	613.5	48.3	126.2	1565.2	120	1553
	PC_890TT	PC_892TT	PC_893TT	PC_894TT	PC_903TT	PC_904TT	PC_928TT
36	813.3	2211.4	1046.2	585.3	3395	767.9	246.6
53	4685.6	3536.8	1363.5	1244.4	3057.5	199.9	41.1
76	3926.2	2787	2359.3	1020.3	1564	203.6	421.5
242	36114.4	31599.6	34700.3	41193.8	18485.8	19181.5	3729.4
211	1569.2	1703.6	234.5	1594	4063.1	5354.1	18199.2
		PC_932TT	PC_933TT	Pc_EA40375_922TT	Pc_EA40381_945TT
36		352.4	920.3	316.8	818.6
53		3447.4	788.3	41.8	803.9
76		850.2	865.6	211.2	237.9
242		21913.7	24536	1758.5	13301.5
211		490.5	13171.6	30959.7	331
	Pc_EA40382_946TT	Pc_EA40383_947TT	Pc_EA40384_948TT
36	3078.8	532.1	311.1
53	2330.1	1337.6	1556.2
76	1830	1279.7	598
242	22076.9	31987.1	27579.2
211	857.8	2007.7	556.5
	FC_823TT	FC_824TT	FC_825TT	FC_827TT	FC_828TT	FC_840TT	FC_896TT
36	282.5	2413	1506.3	821.8	564.4	331.6	857.1
53	23.2	24.1	25.5	348.1	27.8	32.3	245.4
76	460.1	2833.9	1128.9	1421.6	705.3	341.8	358.9
242	12129	22000.8	874.8	2544.9	845.1	3459.7	1998.1
211	30520.5	496.2	7923.9	11508.2	33401.7	10882.8	1625.3
	FC_898TT	FC_899TT	FC_900TT	FC_901TT	FC_902TT	FC_909TT	FC_910TT
36	827.5	1152.4	778.8	11199.3	578.7	713	132.4
53	38.1	1949.7	2221	29.8	185.9	21.5	57.2
76	2517.5	1009.8	3523.8	28603.2	2201.1	195.6	4744.8
242	39786.8	38117	29127.6	4032.5	43673.6	3478.5	1273.2
211	1160.7	132.9	79.4	26.8	251.4	488	8979.7
		Fc_EA40386_954TT	Fc_EA40394_967TT	Fc_EA40395_968TT	Fc_EA40396_969TT
36		619.3	412.7	134	218.6
53		15.8	31	23.8	55.9
76		4136.1	682.5	41.2	18.4
242		969.6	5003.3	13867.1	2129.7
211		20581.7	1509.8	2603.1	15427.4
	Fc_EA40397_970TT	Fc_EA40405_982TT	Fc_EA40406_983TT
36	463	1233.6	234.6
53	65.5	31.6	120.8
76	594.7	931	2232
242	15742.7	4086.9	11985.6
211	369.3	30161.2	19869.7

TABLE 10
5-Gene signature performance in 98 training samples
	Tumor	Benign
	Positive	48	14
	Negative	4	32
	Sensitivity	92% (0.82, 0.97)
	Specificity	70% (0.55, 0.81)

D. Cross Validation with the 74 Independent Thyroid Samples

74 independent thyroid samples were processed and profiled with the U133a chip, and the chip data for these two signatures are shown in the Table 11. The performances of the 4-gene and the 5-gene signatures were assessed with LDA. Both signatures gave equivalent performance in these samples compared to the 98 training samples. The sensitivity and specificity for both signatures are shown in Table 12, and the ROC curves are demonstrated in FIGS. 3a and 3b.

TABLE 11
SEQ
ID	Signal
	FA_987TT	FA_992TT	FA_993TT	FA_994TT	FA_995TT	FA_996TT	FA_998TT
36	92.8	437.8	640.5	4152.5	714.7	254.8	303.4
53	15.8	422.8	25.2	29.5	258.9	45.6	26.8
76	485.1	2536.5	1708.6	288.3	643.3	605.6	341
242	686.5	971.4	24532.8	895.7	6424.8	842.1	905.1
211	28269.8	14689.4	357.5	33711.6	34943.2	16131	22376.1
	FA_999TT	FA_1001TT	FA_1002TT	FA_1004TT	FA_1005TT	FA_1006TT	FA_1010TT
36	63.7	22.3	55.6	408.5	128.3	353	442
53	30.9	31.8	39.6	70.8	37.9	38.9	119.6
76	110.7	90.2	253.5	159.1	1559.6	413.7	1222.5
242	1550.6	1689.3	256.5	1668	3921.5	1013.2	1837.3
211	26779.6	15870.7	24525.5	43040.2	25392.9	32641.9	20140.7
	FA_1013TT	FA_1014TT	FA_1017TT	FA_1018TT	FA_1020TT	FA_1023TT	FA_1024TT
36	453.5	333.7	179.6	146.6	417.3	75.1	129.2
53	39.8	21.4	99.9	23.7	26.8	62.3	22.2
76	333.7	1231.2	241.1	131	1435.3	1491.6	260.8
242	1459.4	415	1696.3	287.1	617.5	1932.6	1689.2
211	7911.3	19359.4	18089	18222.8	30038.8	9053	15611.2
	FA_1026TT	FA_1027TT	FA_1028TT	FA_1029TT	FA_1030TT	FA_1031TT	FA_1032TT
36	281.1	130.5	150.4	629.1	760.4	191.6	1671.5
53	125.5	62.3	118.2	230.7	420.5	27.7	519
76	77.4	111.9	184	2100.9	1741.3	338.1	3643.5
242	1091.6	754.3	705.9	684.7	372.4	1848.8	3094.7
211	21979.1	7890.5	26226	15344.1	10368	30439.9	23943.3
	FA_1034TT	FA_1035TT	FA_1073TT	FA_1074TT	FA_1075TT	FA_1076TT	PC_984TT
36	24.8	119.9	111.7	1010.9	26	224.5	303
53	29.6	30.4	366.7	96.9	94.3	31	37.2
76	289.3	239.7	167.4	326.8	818.9	248.5	198.3
242	1482.1	590.9	4842.5	2815.5	2726.8	754.8	785.1
211	38135.4	30510.6	29406.4	31075.4	20833.9	34960.4	24938.2
	PC_986TT	PC_988TT	PC_989TT	PC_1039TT	PC_1040TT	PC_1041TT	PC_1042TT
36	676.3	391.7	264.9	735.7	524.7	769.9	1125
53	32.5	395.6	305.5	655	1153.9	2194.1	111.5
76	287.9	1384.8	888.3	1048.4	1381.1	412.6	1384.9
242	2450.7	2243.2	698.6	20366.4	32090.9	27480.9	1915.7
211	2689.5	19903.2	32075.9	9197.7	152.2	1862.2	10375.9
	PC_1043TT	PC_1044TT	PC_1045TT	PC_1046TT	PC_1047TT	PC_1048TT	PC_1049TT
36	1013.6	1023.8	809.8	1811.1	1546.2	481.8	2491.9
53	730.7	2965.3	2533.7	2052.8	756.1	988.3	2000.6
76	1977.4	3380.4	422	4343.9	3570.2	1786.8	1619.4
242	3907.5	20074.8	41761.2	33253.5	28124.7	30516	21324.5
211	7015.5	11.5	136.1	59.1	3841.7	31.1	1476
	PC_1050TT	PC_1051TT	PC_1053TT	PC_1054TT	PC_1055TT	PC_1059TT	PC_1060TT
36	443.9	669	477.1	952.8	645.3	660.2	648.5
53	4037.8	1290.7	933.9	1336.9	2123.2	1353.8	66.9
76	856.7	1039	463.2	1399.8	4385	365.8	160.7
242	1261.6	58258.5	26004.9	21219.8	12760.8	26084.4	3277.6
211	1150.2	375.9	73.2	2575.8	400.5	24.2	1637.7
	PC_1061TT	PC_1062TT	FC_1037TT	FC_1077TT	FC_1078TT	FC_1079TT	FC_1082TT
36	3523.2	1912.5	234.2	128.3	825.1	297.5	1447.6
53	2348.3	975.7	97.6	46.2	15.8	38.5	254.6
76	4994.9	3891.7	5559.8	252	1103.5	700	1754.7
242	15397.4	2006.1	1826	2407.5	22661.8	1595.5	713.7
211	3379.4	2201.9	41570	15804.5	3572.1	4377.9	16863.7
	PC-			PC-	PC-	PC-	PC-
	FV_1052TT	PC-FV_1064TT	PC-FV_1065TT	FV_1066TT	FV_1067TT	FV_1068TT	FV_1069TT
36	1993.3	230.6	1128.8	708.4	1348	331.4	33.2
53	2450.3	72.7	610.3	72.5	146.4	1073.7	21.5
76	2075	451.3	1350.2	922.5	1743.7	950.5	332.8
242	21494	7110.9	10228.8	2206.3	3319.2	28034.2	430.1
211	1581.5	29936.9	1594.7	5693.1	11288.8	573.6	12485.5
	PC-			PC-
	FV_1071TT	PC-FV_1072TT	PC-FV_1080TT	FV_1081TT
36	148.9	332.2	1288.7	672
53	1836.9	1450.3	2221	22.9
76	4053	1628.6	2275.9	62.6
242	1810.6	26396.9	683.4	984
211	8.9	24	3416.7	2630.8

TABLE 12
4-Gene and 5-gene signatures performance in 74 validation samples
	Tumor	Benign
4-Gene Signature
	Positive	33	12
	Negative	3	26
	Sensitivity	92% (0.78, 0.97)
	Specificity	68% (0.53, 0.81)
5-Gene Signature
	Positive	33	9
	Negative	3	29
	Sensitivity	92% (0.78, 0.97)
	Specificity	76% (0.61, 0.87)

E. Control Gene Marker Identification

With the 98 thyroid samples and 12 PBL samples we selected two groups of genes as sampling control. One group consists of genes that are expressed in thyroid but not in PBL, the second group includes genes that are expressed in PBL but not in thyroid. The full gene list and corresponding chip data are shown in Tables 13a and 13b. From these genes we selected six genes that are abundant and the differentiation between thyroid and PBL is relatively large. Their expression profile was validated in the 74 independent thyroid samples. The identities of these six genes are listed in Table 14 and their chip data are shown in Tables 15a and 15b.

TABLE 13a
13a1
	SEQ	ThyMixBen_. . ._Signal
	ID	02014_40062_H133A_800TT	02014_40063_H133A_801TT	02014_40064_H133A_802TT
	2	2789.6	2676.2	3009.2
	3	6346.1	794.7	623.9
	5	845.5	3039.1	4452.6
	6	2730.4	1108.5	1155.6
	9	2248.9	12094.5	7529.2
	12	10625.3	3137.2	2382.7
	18	3171	5947.9	13241.7
	22	2715.2	9522.5	6429.7
	25	19159.3	1467.3	550.1
	28	722.7	835.1	727.1
	32	4160.6	8115.2	4061.8
	39	314.3	1243.1	1486.8
	74	323.9	1227.6	1965.1
	78	250.8	677	1029.5
	143	1337.3	1339.1	2607.9
	174	1263.1	4430.7	6041.6
	175	1996.3	1829.5	3632.7
	191	7108.4	848.3	2063
	212	258.2	1405.8	1196.9
	222	20586.8	1371.2	2411.9
	233	1410.6	14126.8	3020.4
	234	5048.1	2183.3	3215.5
	237	905	3397.9	2525.1
	238	198	1937.7	1289.5
	245	143.7	1598.5	1964.2
	250	1300.9	777	1405.9
	252	945.6	1547.3	1210.2
	264	455.1	988.1	932.8
	290	345.6	327.2	533.1
	294	1043	3655.8	4435.4
	296	845.5	1242.5	1068.6
	342	771.4	535.9	998.5
	SEQ	ThyMixBen_. . ._Signal
	ID	02014_40065_H133A_804TT	02014_40066_H133A_805TT	02014_40067_H133A_806TT
	2	2957.5	3644.5
	3	772	2977.3	622.7
	5	2982.5	8283.2	1627.6
	6	2201.2	1954.3	1750
	9	2827.3	7701.7	1548.3
	12	5727.8	6238	4685.1
	18	10294.9	7849.3	4037.4
	22	2590.9	5294.3	6490.4
	25	2838	11294.7	1374.2
	28	568.1	1336.7	740.7
	32	6625.3	7348.9	3964.1
	39	742.5	1027.7	1185.9
	74	1281.5	760.1	505.4
	78	403.7	795.2	355
	143	1758.8	1933.5	1809
	174	3543.2	7346	3920.5
	175	1646.5	2847.5	3054.2
	191	1133.9	1482.4	1149
	212	882.4	1296.8	1790
	222	2573.9	1228.6	1342
	233	2186.1	8439.4	6024.4
	234	4103.9	4096.9	2220.2
	237	2135.4	2822	2492.3
	238	804.5	1538.6	1454.7
	245	897.9	2276.6	1348.2
	250	1466.4	1301.3	1865.3
	252	1357	1437.1	1141.1
	264	631.7	1253.9	845.4
	290	470.2	700.5	231.9
	294	3563.9	4377.4	2734.8
	296	1506.5	2423.4	1527.3
	342	922.5	1108.1	605.4
13a2
	SEQ	Signal
	ID	ThyMixBen_02014_40068_H133A_807TT	02014_40198_H133A_871TT	02014_40321_H133A_913TT
	2	1749.6	1571.1	2634.4
	3	377.2	508	2322.7
	5	2762.9	1795.8	6670.2
	6	1280.1	2033.3	1910.3
	9	3346.8	548.3	11398.5
	12	6927.1	4060.5	6664.4
	18	7418.9	14860.4	3134.7
	22	1797.5	744.5	7334.3
	25	1245.8	815.8	7201.1
	28	301.1	640.8	1325.9
	32	2992.4	3260.2	3588.1
	39	435.8	958.1	1152.1
	74	689.2	1453.7	491.7
	78	160.1	383	151.2
	143	1338.8	1466.6	1069.9
	174	2464.3	1616.3	829.8
	175	1701	1511.5	1101.1
	191	763.6	2383.3	2013.2
	212	481	1131.9	912.5
	222	280.8	1574	4944.1
	233	1289.5	1272.4	6285.6
	234	1645.4	3271.1	2263.3
	237	1732.6	879.6	3780
	238	493.5	893.1	1098.7
	245	661.9	1378.3	1244.1
	250	736.7	1305.6	633
	252	1145.8	1986	1203.2
	264	462.7	891.3	629.4
	290	295.8	697.1	987.8
	294	1909.1	1128.4	924.1
	296	898.4	1232.2	925.1
	342	482.4	712.6	476.1
	SEQ	Signal
	ID	02014_40322_H133A_914TT	02014_40323_H133A_915TT	02014_40324_H133A_917TT
	2	2419.2	2697.4	2901.1
	3	259.8	1123.4	875.2
	5	2094.7	11425.7	4957.2
	6	2543.7	2173.2	1358.7
	9	953.4	2085.2	10684.4
	12	2730.5	4322.8	2616.2
	18	26576.3	9585.4	8588.9
	22	317.9	5120.1	8611.7
	25	253.7	2882.9	1053.4
	28	409.2	762.7	838.8
	32	792.5	5413.2	2581
	39	499.6	556.9	898.6
	74	736.6	986.9	1217
	78	172.9	597.4	745.6
	143	2070.9	2377.2	1976.3
	174	1365.2	4938	4804.3
	175	2325.4	2530.2	2237.6
	191	1274.2	601.2	1100.2
	212	663.2	666.4	1081
	222	342.2	1225.9	449
	233	866.8	1839.3	5797.4
	234	1789.3	6497.4	3416
	237	1345.3	2154.2	2802.8
	238	405.9	592.8	1326.4
	245	645.4	1124.2	1171.1
	250	1409.4	1368.9	1146.7
	252	1323.5	1544.6	757
	264	649.7	872.1	1319.5
	290	819.9	440.6	268.7
	294	1519.2	3225.3	2954.9
	296	1290.3	738.1	1069.6
	342	694.8	801.2	605.7
13a3
	SEQ	Signal
	ID	02014_40325_H133A_918TT	02014_40326_H133A_919TT	ThyFolBen_02014_40079_H133A_818TT
	2	3457.7	2769.1	4234.5
	3	920.5	1289.3	627
	5	1805.2	5184.1	1487.2
	6	1560.8	1519.3	996.2
	9	11354.8	9921.9	3894
	12	7531.7	6887.2	1379.1
	18	8220.1	5452.2	7762.8
	22	4750.8	5739.1	5655.3
	25	1557.9	3017.5	1200.4
	28	886.6	1189.2	731.4
	32	4134.1	10964.4	927.6
	39	1259.2	1022.1	1423.7
	74	741.8	948.9	770
	78	447.9	488.2	790.6
	143	3165.1	1865.5	2330.7
	174	607.5	2151.8	4026.2
	175	5358.5	2402.7	3765.6
	191	2685.9	1183.6	1661.4
	212	1306.3	1072.1	2181.8
	222	2332.8	431.2	1015.6
	233	5181.8	12377	3400.9
	234	3760.2	1988.2	3527.4
	237	2712	3073.8	1930.6
	238	1552.2	1636.1	1333.5
	245	1722.2	1981.5	1978.8
	250	1502.7	1094	1083.3
	252	1609.9	1679.3	1599.4
	264	860.1	835.6	1451.1
	290	773.4	490.4	218.3
	294	555.3	2490.7	1854.9
	296	1240.1	1863	1139.6
	342	738.7	509.3	1018.4
SEQ	Signal
ID	ThyFolBen_02014_40080_H133A_819TT	ThyFolBen_02014_40081_H133A_820TT	ThyFolBen_02014_40082_H133A_821TT
2	5589.2	3035.3	2681.6
3	690.9	585.4	610
5	1942	2663.8	1231.8
6	1140.3	2093.4	841.6
9	2165.4	7467	7685.6
12	1292.4	5085.1	3585.9
18	7277.4	5374.9	2379.1
22	7618.6	6227.9	1551.9
25	881.1	1279.8	406.4
28	681.6	1225.7	473.9
32	3075.2	2775	608.8
39	1632.9	899.5	688.9
74	674.6	1139.7	213
78	602.8	776.3	332.1
143	1160.7	1676	1672.4
174	4702.6	10677.1	3826.8
175	1231.9	2531.9	2307.7
191	1657.1	1377.8	368.2
212	2035.6	954.2	1663.4
222	1651.7	3755.4	1669.9
233	4679.3	2476	1506.6
234	3971.4	4526.5	997.6
237	3521.8	2951.3	2673.5
238	837.6	1069.7	1860.5
245	2170	763.6	1392.9
250	710.8	864.9	1823.2
252	1463.9	1199.9	1019.2
264	1315.6	1221.6	936.8
290	507.2	648.3	294.6
294	2997.4	7108.2	2160.7
296	1245.4	1172.5	1318.3
342	728.8	977.2	710.6
13a4
	SEQ	Signal
	ID	ThyFolBen_02014_40083_H133A_822TT	fa_EA40173_VDX842TT	fa_EA40191_VDX862TT
	2	3403.4	3423.5	2246.6
	3	644.4	950.1	1313.2
	5	3439.5	754.3	2119
	6	1373.7	987.7	834.7
	9	7457.5	2730.9	9307.8
	12	3978.9	9462.8	777.5
	18	6386.9	1591.2	9546.6
	22	2652.5	7124.7	11054.7
	25	1887.7	470.8	703.9
	28	548.5	562.4	596.8
	32	4425.5	2120.3	1084.1
	39	1103.1	1110.2	898.4
	74	285.9	895.8	532.1
	78	643.1	346.6	533.3
	143	1979.9	3302.9	1686.6
	174	5408.1	608.2	5072.8
	175	2650.3	6596.8	2600.8
	191	667.7	2665.7	1382.1
	212	1357.8	2545.2	1590.2
	222	2239.9	471	548.8
	233	7318.7	11617.9	10868.4
	234	2395.9	2832.7	6005.3
	237	2275.3	2639.3	2406.6
	238	1181.8	2124.4	1586.7
	245	2082.5	2302.1	2846.4
	250	1684	1718	862.9
	252	1166.7	1579.6	590.4
	264	654.2	1604.2	3062.9
	290	342	431.8	458.8
	294	2978.3	651.5	3533.7
	296	2132.4	1762.9	815.3
	342	1058.5	488.3	475.4
	SEQ	Signal
	ID	fa_EA40192_VDX863TT	fa_EA40193_VDX864TT	fa_EA40194_VDX865TT
	2	2723.3	4130.4	2828.3
	3	344.4	1731.1	2576.9
	5	3324.7	1663.9	4423
	6	1399.9	1115.4	1872.1
	9	7048.5	3775.7	6931.3
	12	4280.8	4821	2268.2
	18	4979.5	5005.2	4409.5
	22	4669.9	4776.9	5782.5
	25	714.5	445.9	698.2
	28	915.9	1194.1	1041
	32	2638.9	2593.1	1919.9
	39	1375.1	1520.4	1744.1
	74	841.2	1938.6	1109.5
	78	680.5	621.5	385.8
	143	2406.6	2255.4	3419.1
	174	5907.1	2956.1	2670.2
	175	4704.8	3123	5286.8
	191	740.2	1133.3	3678.2
	212	1326.3	1135.1	1079
	222	584.1	899.4	1002.2
	233	6925.9	5416.9	14212.9
	234	2493.8	2128.8	6818.7
	237	2595.1	1857.2	2546.1
	238	2125.3	2039.5	1859.1
	245	2280.8	3973.8	1520.6
	250	2782.6	1973.4	1594.3
	252	1623.2	1735.2	1584.3
	264	1460.8	1510.1	2018.9
	290	602.3	745	977.6
	294	4065.9	2720.4	2292.8
	296	1040.3	1787.6	932.6
	342	759.3	658.3	851.2
13a5
	SEQ	Signal
	ID	fa_EA40195_VDX866TT	fa_EA40196_VDX867TT	fa_EA40197_VDX869TT
	2	3243.6	2969.9	3761.4
	3	728.9	548.2	531.1
	5	2392.7	6268.7	3870.9
	6	1534	965.4	2782.8
	9	8238.3	8829.9	4175.6
	12	3334.6	2752	3382.5
	18	9146.3	8150.5	7796.3
	22	4665.5	8163.5	3812
	25	555.6	524.6	1592.8
	28	1115.3	604	918.9
	32	1089.3	1808.7	1245.6
	39	1606.8	1418.2	1392.4
	74	638.2	2085.2	694.7
	78	480.6	603.6	959.8
	143	3003	2033.2	3441.7
	174	3322	4573.5	4168.2
	175	4747.7	2573.2	5834.5
	191	2724.1	726	831.2
	212	2362.7	1705.9	2344.8
	222	271.7	2039.4	683.4
	233	10892.9	6981.9	10048.5
	234	4015.4	3229.5	4734.4
	237	2159.9	2415.2	2194.8
	238	1451	1111.6	1037.4
	245	2059.1	2548.6	2180.9
	250	3534.3	993.3	2513.3
	252	1589.8	1334.1	2762.4
	264	1335.1	1560.1	1656.9
	290	496.3	626.2	584.9
	294	2869.4	4842.4	2762.9
	296	1414.4	882.4	1284
	342	595.6	660.6	1442.5
	SEQ	Signal
	ID	fa_EA40219_VDX907TT	fa_EA40220_VDX908TT	02014_40327_H133A_920TT
	2	3352.1	2486.7	3109.7
	3	796	1204.6	981.6
	5	10216	3635.2	11319.3
	6	2638.6	1155.7	2100.9
	9	1650.4	7363.2	3172
	12	3589.1	6717.7	3191.1
	18	8021.5	8185	8907.1
	22	4001.7	5539.5	6346.7
	25	2057.7	4103.3	886.1
	28	1190.9	999.1	998.2
	32	4202	7454.6	1100.2
	39	1443.3	949.8	1388.7
	74	1778.1	557.7	1486.9
	78	1000.3	476	721.1
	143	3224.1	2461.3	2701.2
	174	5982	3022.2	5710.7
	175	4666.3	3540.8	3751
	191	1991.3	1556.8	643.4
	212	1259.8	1288.5	1033.6
	222	1370.8	728.8	1675.2
	233	6773.9	15803	3520.9
	234	7233.3	2712.8	8148.3
	237	2990.7	2565.8	2364
	238	914.9	1634.9	1078.9
	245	2093.2	1730	1329.4
	250	878.9	686.3	980.4
	252	1267.3	1857.6	1608.2
	264	942.7	950.4	1076.1
	290	549.5	309.7	613.4
	294	4119.2	2299.8	3497.8
	296	1106.4	1493.4	888.5
	342	1050.3	607.5	1278.6
13a6
	SEQ	Signal
	ID	02014_40332_H133A_938TT	02014_40334_H133A_941TT	02014_40335_H133A_940TT
	2	1963.7	2662.2	2416.5
	3	942.5	342	749.1
	5	2218	3903.1	3011.1
	6	939.5	1239.9	1853.8
	9	5245.3	1988.9	1165.8
	12	2500.4	2100	3597.7
	18	5929.7	7819.7	5335.4
	22	2265.8	6298.2	2112.7
	25	1160.2	916.5	614.7
	28	617.6	408.5	740.7
	32	2918.8	3242.3	3083.9
	39	1356.6	876.8	1855
	74	1102.1	826.7	1384.4
	78	361.5	383.5	482.7
	143	1394.9	2889.2	1838.1
	174	2198.3	1887.5	3921.8
	175	1391.4	3677.8	2169.3
	191	1235.1	364.7	1283.5
	212	1625.4	871.1	1083.8
	222	503.4	638.5	320.1
	233	8499.4	1999.9	4012.1
	234	2067.7	2973.7	2630.4
	237	2763.1	1501.1	2724
	238	1055.6	1055.7	1596.5
	245	751.4	1076.1	915.2
	250	1050.6	1474.3	2517.1
	252	987.8	1382.5	2070.7
	264	1278.3	1261.1	826.2
	290	786.4	936.8	952.1
	294	2197.5	2064.7	2836.2
	296	635.2	572.8	700.9
	342	718.6	866.8	735.7
	SEQ	Signal
	ID	EA02014_40374_H133A_921TT	EA02014_40376_H133A_923TT	EA02014_40377_H133A_924TT
	2	3047.7	2043.6	3322
	3	1300.6	549.3	1182
	5	1669.8	1508.3	1453.3
	6	837.7	1477.8	1129.4
	9	4137	8735.7	4453.3
	12	5716.2	6694.6	3667.8
	18	4017.5	2899.7	5013.3
	22	3386.6	4519.5	4186.6
	25	1055.5	1184.4	828.4
	28	477.3	701.3	550.8
	32	1411.4	4079.5	2063.5
	39	1231.3	982.1	1248
	74	296.9	632.9	787.7
	78	578.5	351.8	389.9
	143	1776	1563	3881.9
	174	3076.4	1858.1	1967.3
	175	2169	2397.2	5896.8
	191	616.4	1037.7	1957
	212	1086.2	1450.7	981.1
	222	1707.8	1089.4	640.8
	233	3345.8	10991.6	11095.5
	234	2027.1	1597	3240
	237	1997.9	2249.3	2941.1
	238	1035.6	1810.9	1257.5
	245	2714.4	2120.1	1553.6
	250	1428.1	1169.4	2857.1
	252	881.9	1589.3	2217.2
	264	865.3	1055.9	1034.7
	290	312.4	385.7	1231.1
	294	2573.5	1835.4	2657.6
	296	1768.2	1426.3	2462.5
	342	770.7	565.3	1695.1
13a7
	SEQ	EA02014_Signal
	ID	40378_H133A_925TT	40379_H133A_926TT	40380_H133A_927TT
	2	3274	3025.4	2424.9
	3	1545.1	1151.1	687.6
	5	3661.8	1323.2	7949.9
	6	1371.5	1220.8	1831
	9	10387.7	11670.1	6402.7
	12	5829.9	6903.8	4783.9
	18	6648	4053.1	7410.2
	22	6859.7	6621.2	3008.1
	25	1035.6	3448.2	1347.1
	28	1087	917.1	747.8
	32	5212.9	6841.6	3282.5
	39	1228.7	1245.7	762.4
	74	823.9	721.6	1460.4
	78	713.8	377.6	621.3
	143	1953.5	2925.7	2861.8
	174	3029	1818.4	5264.1
	175	3229.1	4827.2	3821.1
	191	1112.4	5308.2	841
	212	890.9	915.6	729.1
	222	480.1	2895.3	605.6
	233	6680.7	9190.5	2236.9
	234	1871.2	4194.1	4428.8
	237	2758.4	2108.7	2070.1
	238	1210.7	1289.5	774.3
	245	2369.7	1585.8	785.1
	250	971.8	1387.3	1193.5
	252	1417.1	990.9	1186.9
	264	1089.9	538.3	758.6
	290	565.1	601.8	485.3
	294	2574.6	1541.3	3862.3
	296	1821.8	1115.3	1015.1
	342	621	757.4	791.6
	SEQ	EA02014_Signal
	ID	40387_H133A_955TT	40388_H133A_956TT	40389_H133A_957TT
	2	2302.6	2724.6	2641.3
	3	424.7	420.6	609.2
	5	4860	4059.3	4895.3
	6	2330.9	1642.8	1963.8
	9	3105.3	4256.6	8744.8
	12	2874.5	3494.1	2451
	18	4600.2	3912.9	16235.3
	22	1369.9	2480.5	4685
	25	365.3	1587.2	816.8
	28	1057	1169.8	974.1
	32	2814.2	4083.1	8121.2
	39	904.9	1136.2	1862.7
	74	2781.4	970.2	839
	78	212.8	421.3	891.4
	143	1243.3	2335.1	2564.3
	174	3925.2	4789.1	4553.5
	175	1561.7	4603.8	4098.3
	191	861.6	865.2	1964.9
	212	1264.1	1494.2	1177.2
	222	145.2	425.3	1712.4
	233	441.5	3626.6	11326.8
	234	1260.8	1599	4627.7
	237	1655.9	2140.3	2820.6
	238	1017.9	1645.6	1150.6
	245	1808.4	2014.9	1185.6
	250	2014.8	2033	608.6
	252	1561.4	2006.1	1838
	264	1340.4	1171.9	933.1
	290	597.5	511.7	852.7
	294	2639.9	3968.8	3955.7
	296	1379.4	1444.1	867.3
	342	504.5	671.6	1320.3
13a8
	SEQ	Signal
	ID	EA02014_40390_H133A_959T	EA02014_40391_H133A_960TT	EA02014_40392_H133A_961TT
	2	1817.9	1937.6	2632.3
	3	605.6	546.8	697.5
	5	8452.7	11532.9	5852.5
	6	2508.7	1035.1	1581.2
	9	1557.3	17159.3	4950.2
	12	8423.6	3364.4	3626.3
	18	9560.7	5478.7	8997.6
	22	5745.2	8584.6	5849.4
	25	2003.7	619.6	797.7
	28	1280.7	1023.3	810.5
	32	5819.5	1430	6760.1
	39	844.6	1193.7	2035
	74	1794.4	871.9	1342.7
	78	1290.5	705.2	582.1
	143	3606.5	1206.5	2610
	174	5367.9	3197	2890.4
	175	6112	1232.1	3258.2
	191	628.6	681.7	1024.6
	212	762	850.9	1201
	222	3380.6	2257.2	1397.9
	233	1273.2	3459.2	5807.2
	234	4522.8	4556.7	4306.9
	237	1813.8	2740.9	2387.6
	238	1451	897.7	1411.1
	245	841.7	1542	1434.2
	250	834.9	839.6	1111.7
	252	1612	1068.9	1122.2
	264	1720.7	1090.3	766.9
	290	548.7	268.4	292.1
	294	4894.2	2878.6	1768.4
	296	1074.9	850.9	729.8
	342	1199.4	802.1	874.5
SEQ	Signal
ID	EA02014_40393_H133A_962TT	ThyPapCan_02014_40090_H133A_829TT	ThyPapCan_02014_40091_H133A_830TT@IC
2	2613.7	2167.7	1372.7
3	480.4	1793.5	1236.1
5	5194.8	3735.8	2822.7
6	1561.5	1568.4	1723.3
9	1272.3	3597.7	3243.8
12	1198.7	5938.4	3878.6
18	4601.2	6673.3	6322.9
22	2275.2	4413.3	2539.9
25	887.6	2860.8	3257.2
28	604.5	703.2	592.2
32	736.3	5057.7	6877.1
39	1643.1	906.4	977.6
74	1207.3	873.7	438.1
78	644.6	514.2	463
143	3369.8	2462.6	1861.9
174	2641.3	4481.7	4198.6
175	5085.3	3246.9	2442.8
191	538.5	913.3	723.7
212	690.9	797.9	784
222	127.7	892.4	646.7
233	1846.1	4170.6	4565.3
234	2687.8	3024.6	3006.1
237	1999.7	1879.2	1708
238	1416.3	966.6	803.6
245	1628.4	1415.8	1521.5
250	2545.8	1268.4	993.6
252	1770.9	1379.1	1201.1
264	838.8	728.4	1170.1
290	366.4	284.9	221.6
294	2181.6	2628.2	1888.8
296	975.7	1061.8	946.4
342	1428.7	842.7	661
13a9
	SEQ	ThyPapCan_02014_. . . Signal
	ID	40092_H133A_831TT	40093_H133A_832TT	40095_H133A_834TT
	2	2960.8	3724.8	3502.5
	3	1034.7	1002.2	539.6
	5	1648.6	2929.1	3651.5
	6	1182.8	1644.7	1603.7
	9	1637.6	5720.9	3045.3
	12	4300.1	3654.1	3555.9
	18	6335.8	3922.6	3579.6
	22	3973	4533	5478.5
	25	7110.3	2680	2117.2
	28	550.3	1205.7	660.4
	32	3476.1	8075.3	2580
	39	973.9	1322.9	1283.6
	74	611.8	1044.9	1510.9
	78	179.8	404.5	344.8
	143	2333.5	2803.8	3730.7
	174	2628.9	5254.6	2333.9
	175	3237.9	5586.3	5010.7
	191	3519.9	1826.9	1761.9
	212	957	1085.3	1218.4
	222	3373.3	1016	723.7
	233	11130.3	16096.3	16100.3
	234	2382.4	2253.4	2236.6
	237	2141.4	2712.7	2749.7
	238	719.8	2489.2	1179.1
	245	873.3	1325.6	1693
	250	2074.6	1295	2234.8
	252	1496.7	2444.6	2031.7
	264	931.2	1035.7	1188
	290	499.8	667.3	663.2
	294	2010	4135.1	2098.4
	296	2128.8	2051.6	2507.5
	342	835.3	1453.2	1071.6
	SEQ	ThyPapCan_02014_. . . Signal
	ID	40096_H133A_835TT	40097_H133A_836TT	40098_H133A_837TT@I2
	2	2185.5	2399.1	2900.3
	3	891.3	452.9	1885.7
	5	1611.8	3731.1	3572.5
	6	966.3	2282.6	1818.1
	9	1451	5197.6	7768.2
	12	3946.6	2299	2877.5
	18	3282.2	3591.8	9567
	22	2546.7	2145.4	7779.3
	25	5212.6	869.3	8325.2
	28	730.8	642.1	734.4
	32	2524.9	2454.3	7864.8
	39	847.1	1328.7	1793.3
	74	831.5	519.6	513.4
	78	133.7	582.7	482.5
	143	2073.1	2033.9	3437.3
	174	922.6	5487.5	2544
	175	2460.9	2800.9	4480.6
	191	1360.1	531.4	2426.7
	212	764.9	1307.9	1161.5
	222	3010.1	829.7	1642.5
	233	10534.6	2873.8	13024.1
	234	842.4	1767	3577
	237	2120.8	2269.8	2385.2
	238	806.1	1516.4	1336.1
	245	870.8	1916.1	1869.5
	250	1654.7	2588.9	1104.7
	252	1605.8	1808.1	1897.2
	264	746.7	1074.1	1170.2
	290	626.9	634.4	625.8
	294	1207.1	3722.1	2055.4
	296	2156.5	1001	2034.3
	342	615.5	1084	1209
13a10
	SEQ	Signal
	ID	ThyPapCan_02014_40099_H133A_838TT@I2	02014_40317_H133A_839TT	pc_EA40200_VDX879TT
	2	3540.3	1657	3331
	3	1796.3	750.6	1334.9
	5	4954	2602	3011.2
	6	2558.4	1246.9	1008.5
	9	4538	3328.9	1097.2
	12	2544	6420.6	5055.9
	18	9287.1	5085	6074.5
	22	5415.4	3850	3537
	25	12197.9	1296	3368.6
	28	915.5	631	842.7
	32	4804.9	3883.4	3039.3
	39	1409.2	756	1855
	74	992.8	349.3	597.9
	78	352	259.9	342.4
	143	4199.6	1314.8	2573.1
	174	3924.5	1399.1	5622.6
	175	6697.7	1590	4211.2
	191	3745.9	816.2	4875.5
	212	1219.1	1064.8	1480.3
	222	8593.9	434.6	1994.5
	233	20899.6	4657	37907.7
	234	3763.9	1496.4	3667.8
	237	2711.1	2046.9	1892.2
	238	994.1	1047.3	1092.4
	245	1339.1	1019.4	2826.7
	250	1736	710.8	2570.5
	252	2933.1	1316.3	1849.2
	264	1426.6	987	2826.4
	290	666.3	368.1	487
	294	3175.8	1237.3	4622.7
	296	1837.4	899.1	2639
	342	1355.2	406.1	1662.9
	SEQ	Signal
	ID	pc_EA40201_VDX881TT	pc_EA40202_VDX882TT	pc_EA40203_VDX883TT
	2	3253.1	3349.3	3642
	3	1248.1	477.8	697.9
	5	2106.6	1504.9	2070.9
	6	1708.8	874.6	704.3
	9	1789.6	857.2	1327.3
	12	4641.7	3423.2	2283
	18	5157.6	7305.1	5996.2
	22	3100.8	2588.4	2125.9
	25	4941.8	1669.9	1166.3
	28	869.9	606.5	459.6
	32	5722.3	3401.7	1964.8
	39	1356	1421	1878.4
	74	708.5	741.6	421.6
	78	434.8	172.4	207.2
	143	5070.9	4302.9	3455.3
	174	4217.6	1231.4	1538.6
	175	7931.3	7786.3	5294.6
	191	3853.9	2370.5	1807.8
	212	1571.7	1350.2	874.7
	222	2235.1	980.8	748.4
	233	22959.2	12092.7	30504.2
	234	2431.2	1077.6	1447.8
	237	2919	2374.3	2011.2
	238	929.6	877.7	776.8
	245	1538.1	1379.8	1254.9
	250	1597.7	1899	1923.8
	252	2395.5	2621	1992.7
	264	1272.7	2511.5	1495.4
	290	665.4	692.1	706
	294	3449.7	976.8	1074.7
	296	2217.5	2398.4	2049.3
	342	803.3	1501.3	863
13a11
	SEQ	Signal
	ID	pc_EA40204_VDX884TT	pc_EA40205_VDX885TT	pc_EA40206_VDX886TT
	2	2895.1	2994.7	3397.6
	3	1144	932.3	1277.6
	5	1096.3	1151.4	4943.4
	6	916.1	945	1696.2
	9	2396.9	3699.9	1671.3
	12	3762.2	3308.4	3095.3
	18	9468.3	6669.2	10475.1
	22	3823.4	2813.4	4326.9
	25	1322.8	496	4227.5
	28	563.6	333.7	602.3
	32	4985.4	854.7	1788.8
	39	963	1562	1937.7
	74	417	443.9	383.6
	78	169.9	266.2	346.4
	143	2357.9	2936.4	2961
	174	1096.5	2227.9	1825
	175	3559.1	4964.6	5395
	191	5320.2	8526.6	4668.1
	212	1168.2	1634.1	1396.4
	222	805.9	739.2	2330.2
	233	25920.6	37919.3	33438
	234	1882.8	1513.3	2438.5
	237	2950.6	1089.9	1886.5
	238	1037.6	1240	818.8
	245	1151.5	1872.7	2007.7
	250	3324	2153.4	2363.7
	252	1641	1236.4	1558.6
	264	1120.1	2994.2	1776.5
	290	624.5	516.4	692.1
	294	1273.1	3050.2	1557
	296	2601.3	2023.6	2244.2
	342	723.2	973.5	587
	SEQ	Signal
	ID	pc_EA40207_VDX890TT	pc_EA40208_VDX892TT	pc_EA40209_VDX893TT
	2	4328.1	4435.3	5980.3
	3	3294.1	1361.2	475.7
	5	1741.8	3416.4	653.5
	6	1593.6	1278.6	740.7
	9	1488.6	2591.9	1644.7
	12	2865.4	5996.8	1644.2
	18	18044.8	9220.2	11224.4
	22	7811.1	7837	1650.1
	25	4437.5	1271.9	878.1
	28	782.9	724.2	636.5
	32	2423.6	2099.4	629.4
	39	1973.7	1774.1	1387.6
	74	600.6	814.2	578.6
	78	207.7	507.4	117.7
	143	6472.6	4513.4	3395.7
	174	1268.5	5715	380.6
	175	12711.3	7961.8	5835.7
	191	4129.5	8005	4597.4
	212	1197.9	1161.5	1523.4
	222	3890.4	873.8	1137.4
	233	7762.1	23325.9	20940.7
	234	4528.9	2232.7	1253.9
	237	2930.8	2484.4	2082.4
	238	709.9	1096.2	877.7
	245	1316.8	2042.3	1717.4
	250	1885.4	2787.9	3192.2
	252	2605.7	1944.3	2613.4
	264	1401.3	1517.1	2362.8
	290	520.9	778.6	1209.7
	294	1442.8	3564.9	424.1
	296	2054.1	2777.3	4347
	342	2028.3	679.8	746.2
13a12
	SEQ	Signal
	ID	pc_EA40210_VDX894TT	02014_40319_H133A_903TT	02014_40320_H133A_904TT
	2	4563.8	3729.2	2859.9
	3	475.3	827.4	4626.7
	5	1717.5	3130.1	1505.9
	6	698.9	1153.2	2668.3
	9	3017.4	3184.7	6316.2
	12	1662.3	4850	7880.2
	18	7186	6997.2	14099
	22	1195.2	3583.4	6058.2
	25	587.7	868.9	28372.6
	28	728.8	621.5	1685.2
	32	1503.2	2517.7	19668.7
	39	1609.6	1035.8	1140.8
	74	240.3	718.9	623.5
	78	196.7	180.1	370.1
	143	1838.3	3062.8	1513.2
	174	1548.4	1810.3	1087.6
	175	2462.7	5545.8	1615.4
	191	3292.3	2497.1	3479.2
	212	1289.5	1230.1	645.1
	222	502.2	315.3	8484.1
	233	40786.7	16562	17697.8
	234	1248.4	1443.8	3706.7
	237	1286.1	2852.7	2832.7
	238	1382.7	1243.2	990.6
	245	2174	1000.7	703.1
	250	2738.6	2792.3	1076.8
	252	1078.4	1615.7	2091.1
	264	2550.8	948.7	659.3
	290	518.9	745.9	1057.1
	294	1936.2	1348.3	757.5
	296	2194.3	1614.6	1446.4
	342	612.9	748.4	366.7
	SEQ	Signal
	ID	02014_40328_H133A_928TT	02014_40330_H133A_932TT	02014_40331_H133A_933TT
	2	2475.3	3977.2	3386.3
	3	246.3	2009.2	1481.9
	5	1737.4	1875.4	4763.8
	6	1104	1295.6	1385.4
	9	1911.3	3801.9	2397.6
	12	3035	5874.2	3637.2
	18	11077.7	9724.6	10100.8
	22	4793.7	6322.5	4421.3
	25	667.2	3526	4180.2
	28	927.3	646.4	882.8
	32	3607.7	1986.9	6399.2
	39	1205	1028.3	1359.6
	74	583.2	953	1021.1
	78	543	465.1	373.7
	143	2903.2	3977.3	3056.1
	174	2910.3	3511.6	3939.4
	175	4518.2	7011.2	5184.6
	191	1085	5805.4	2286.3
	212	1795.6	639	1130.8
	222	1685.8	4996.9	611.8
	233	3636.9	19787.1	4648.9
	234	2565.5	2733.9	2463.9
	237	2610.7	2178.6	2681.6
	238	1636.4	1423.2	1469.2
	245	2029.7	1000.1	1302.2
	250	1439.3	3692.8	2113.9
	252	2366.6	1895.9	2343.2
	264	1351	811.7	1104.5
	290	320.1	924.2	1016.3
	294	2287.3	2252.8	2351.2
	296	729.6	2955.6	1690.2
	342	1061	1424.5	894.4
13a13
	SEQ	Signal
	ID	EA02014_40375_H133A_922TT	EA02014_40381_H133A_945TT	EA02014_40382_H133A_946TT
	2	1365.7	2250.1	3658.1
	3	935.6	1124.4	1023.9
	5	7421.5	656.7	3000.3
	6	1026.6	982.6	1628.3
	9	10992.7	1452.2	2478.2
	12	3007	2413.7	5402.5
	18	4106.5	1506.8	9107.3
	22	4766.3	5493.6	3034.7
	25	900.4	10351.1	1252.1
	28	685.8	1022.4	714.8
	32	3099	1984	3215.8
	39	1012.3	480.5	1173
	74	987.5	61.1	894.2
	78	418.8	111.9	529.1
	143	2030.1	1411.5	3847.8
	174	2288.4	269.9	4741.5
	175	2412.3	2138.9	6427.7
	191	617.2	983.6	2182.4
	212	1018.3	208.9	1054.6
	222	725.6	8103.4	443.9
	233	4450.9	1177.3	20110.2
	234	1926	2079.3	2095.5
	237	2547.1	2912.4	3040.2
	238	1822.6	264.6	1023.9
	245	2699.8	113.4	1230.8
	250	1198.1	249	1802.6
	252	1311.3	613.6	2434.6
	264	1364.1	382.4	1206.6
	290	463.8	1223.5	805.1
	294	2024.9	340.9	4085.3
	296	1214	407.7	1761.4
	342	619	828.4	1154.4
	SEQ	Signal
	ID	EA02014_40383_H133A_947TT	EA02014_40384_H133A_948TT	ThyFolCan_02014_40084_H133A_823TT
	2	2299	3252.8	3923.8
	3	2053.6	1187.9	1004.7
	5	4151.2	1730.9	3450.3
	6	1939.7	1023.9	1961.6
	9	4581.5	1567.6	3548.1
	12	7248.9	4382.6	6659.3
	18	6629.5	9741.9	7072.7
	22	4839.3	4984.8	4552
	25	10112.4	3841.3	7385.3
	28	1191.6	656.5	625.4
	32	12202.3	3643.5	4762.1
	39	1094.8	781.3	1099.1
	74	877.1	629	887.2
	78	188.7	371.9	650.2
	143	2492.6	2091.2	2930.6
	174	2231.5	2488.1	7050.3
	175	3285.3	3691.4	4648.5
	191	2820.3	2081	1043.3
	212	964.8	771.1	591.5
	222	4302.9	1433	10512.7
	233	19683.9	4061.3	2305.1
	234	2384.8	2482.7	6283.2
	237	2736.1	3005.4	2681.3
	238	929.2	1088.1	1176.9
	245	1359.8	887	1067.6
	250	1764.8	2220.8	1112.4
	252	2260.9	1332.7	1526.7
	264	1095.1	1210.5	1451.3
	290	865.9	867.2	932.7
	294	1859.8	2226.1	3796.8
	296	1917.2	3476.1	1298.6
	342	639.7	934.8	1110
13a14
SEQ	Signal
ID	ThyFolCan_02014_40085_H133A_824TT	ThyFolCan_02014_40086_H133A_825TT	ThyFolCan_02014_40088_H133A_827TT
2	4103.9	1719.4	2824.5
3	2480.6	144.5	880.5
5	2190.2	1199.7	4743.6
6	678.7	2589.2	2824.2
9	6166.7	326.1	5428.5
12	2872.9	1257.4	4087.8
18	2329.3	4765.3	11522.2
22	4848.8	1224.5	3611.1
25	11319.1	234.5	3308.3
28	772.7	206.8	830.6
32	2272	1393.6	5410.1
39	892.8	541.9	838.5
74	126.8	2071.9	988.3
78	253.6	307.6	635.6
143	2718.2	1570.7	2322.8
174	323	1399.8	2817
175	4437.4	1584	4411.6
191	2214.1	575.3	641
212	1667.2	662.2	577.7
222	13107.5	470.6	1030.1
233	3196	1087.3	2932.3
234	1659.8	875	2243.3
237	4693.9	830.4	3700.2
238	206.3	244.8	1695.9
245	248.7	425	1273.9
250	935.9	379.8	2284.4
252	1005.5	1023.3	1166.6
264	231.5	589	1480.9
290	638.4	233	961.8
294	253.4	1349.8	3087.1
296	1530.8	1570.6	1591.5
342	1457.8	712.8	1052.1
	SEQ	Signal
	ID	ThyFolCan_02014_40089_H133A_828TT	02014_40318_H133A_840TT	fc_EA40212_VDX896TT
	2	3008.4	2542.7	2391.5
	3	497.6	1222.4	1069.4
	5	2936.8	3696.7	776.8
	6	1605.5	1411.7	1403.4
	9	2131.9	9187.9	10000.2
	12	3981.7	7045.4	3506.5
	18	7266.2	3045.4	4683.8
	22	6001.8	8784.3	1719.5
	25	557.1	3685.8	383.8
	28	1057.1	1256.5	1118.8
	32	3330.7	13825	869
	39	941.3	1041	3461.7
	74	1357.4	696.8	1290.4
	78	920.6	422.6	705.5
	143	2621.6	1038.8	4569.2
	174	9345.5	876	8849.8
	175	4784.9	1387.4	7804.9
	191	1208.4	1370.9	4609.8
	212	1864	1229	590.6
	222	3020.4	431.9	641.9
	233	7081	12626.7	4567.8
	234	1839.4	1328	7454.4
	237	2563.5	3040.5	1008.9
	238	2546.2	1614.2	1880.4
	245	1215.4	1333.6	2807.1
	250	894.4	867.2	844.3
	252	1884.3	1524.6	678.4
	264	1740.6	670.9	2459.5
	290	668.6	430.5	996
	294	7034.2	1137.3	7044.6
	296	1110.6	1647.7	1498.9
	342	946.9	436.8	1893.8
13a15
	SEQ	Signal
	ID	fc_EA40214_VDX898TT	fc_EA40215_VDX899TT	fc_EA40216_VDX900TT
	2	2470.7	3328.2	4429.9
	3	226.4	523.3	1216.2
	5	1037.2	3614.5	1440.6
	6	997	685.7	1641.1
	9	384.9	1897.9	973.8
	12	9940.9	1131.5	4352.5
	18	4150.7	7715.2	5736.9
	22	499.6	4466	2120.9
	25	1721.2	1912	10485.2
	28	232.1	706.8	501.4
	32	2728.8	3753	2644.6
	39	1006.6	1103.3	1192.6
	74	2642.5	794.9	374.8
	78	294.6	280.8	131.2
	143	2141.4	2616.6	5902.7
	174	407.1	2263.7	4270
	175	2416.2	3697.7	9897.3
	191	1436.8	2900.8	5153.2
	212	839.5	1241.8	173.4
	222	293.5	1318.1	6645.4
	233	17314.7	18164.1	2971.6
	234	2834.4	1575.6	3547
	237	945.9	3105.6	1268.9
	238	702.9	1189	744.7
	245	914.6	1729.7	1038.5
	250	845.9	2673.5	2175.8
	252	1300.4	2454.3	1377.7
	264	467.6	1277.4	638.7
	290	573.7	617.2	993.4
	294	507.1	1922.1	2827.1
	296	2156.2	2563	1832.8
	342	535.6	937.4	2261.2
	SEQ	Signal
	ID	fc_EA40217_VDX901TT	fc_EA40218_VDX902TT	fc_EA40221_VDX909TT
	2	993.8	2649.9	4427.4
	3	230.6	417	2364.4
	5	3319	1487.4	9590
	6	967.8	2453.4	2537.2
	9	468.7	915.8	3339.3
	12	3202.2	4269.6	15203.8
	18	555.2	9139.4	7575.1
	22	208.2	1563.8	1471.9
	25	826.1	1002	6640.8
	28	122.6	779.4	645.5
	32	1820.8	3404.5	10045.3
	39	880.8	2310.8	346.3
	74	1621.8	1057.9	294
	78	136.4	344.4	391.3
	143	3882.4	3860.3	2140.3
	174	2006.5	2076.1	4365.1
	175	6489.5	5706.6	2832.4
	191	165.9	963.5	512.1
	212	186.6	451.1	539.9
	222	426.3	623.3	2727.5
	233	2885.8	2068.7	15099.5
	234	904.6	3783.5	6440.1
	237	2192.9	893.1	2333.7
	238	554.4	383.3	908.6
	245	839.4	784.2	459.1
	250	702.9	1305.7	723.2
	252	1061.4	1235.8	2869.5
	264	2058	1076.7	569.3
	290	767.4	1281.3	866.1
	294	1753.3	1585.8	2926.6
	296	533.7	2130.3	2647.8
	342	1949.2	975.7	618.5
13a16
	SEQ	Signal
	ID	fc_EA40222_VDX910TT	EA02014_40386_H133A_954TT	EA02014_40394_H133A_967TT
	2	2362.1	1417	1834.4
	3	254.5	263.8	293.1
	5	2789.1	8005.6	1358.8
	6	1096.6	1050.7	1291.7
	9	834.8	1052.4	2701.2
	12	2031.6	4283.7	2805.1
	18	9498.5	18893.2	15454.8
	22	1449.5	1020	888.3
	25	541.3	253.5	572.5
	28	502.3	443	868.6
	32	1205.9	7122.3	811.1
	39	1215.4	1031.1	511
	74	1385.4	1477.5	509.1
	78	367.5	834.2	200.7
	143	1956.7	1083.1	1486.7
	174	4466.4	2823.7	1156.3
	175	1799.1	1264	1758.7
	191	560.2	1494	607.9
	212	1046.1	307.8	548.8
	222	248.3	533.1	1356.4
	233	1183.6	612.7	1063.5
	234	1886.7	3460.3	1207.2
	237	934.6	933.5	2133.3
	238	834.9	291.1	1034.1
	245	1509.7	786.6	657.1
	250	2406.8	1245.7	1247.1
	252	1536.8	1182.4	1035.6
	264	1315.8	582.8	1373.3
	290	732.4	835.3	683.8
	294	2817	2372.1	929.5
	296	1088.4	1541	2014.6
	342	763.6	866.9	722.2
	SEQ	Signal
	ID	EA02014_40395_H133A_968TT	EA02014_40396_H133A_969TT	EA02014_40397_H133A_970TT
	2	2135.5	3006.2	1378.8
	3	346.3	346.5	230.2
	5	637.3	1214.1	1214.7
	6	987.4	1223.8	2564.6
	9	1171.4	6080	440.4
	12	4294.1	4966.4	1686.4
	18	2385.4	3575.2	14192.8
	22	2585.4	3721.5	727.2
	25	3378.9	709.2	372
	28	378.9	964.1	341.9
	32	2553.9	797	1753.4
	39	722	2166.1	527.2
	74	1159.3	1031.4	495.4
	78	235.3	433.7	262.9
	143	2746	2538.4	1943.7
	174	3547.9	1541.5	2214.3
	175	4539.5	3663.3	2264.4
	191	2943.2	2727.4	1474.7
	212	340.4	982.9	647
	222	1194.2	1169.8	228.2
	233	5528.1	6265.3	1076
	234	2384.1	3860.6	3322.7
	237	791	1890.7	1257.5
	238	380.8	946.4	415
	245	384.9	4773.4	447.6
	250	659	1647.1	595
	252	526.7	893	1276.7
	264	958	1622.3	508.6
	290	1744.3	523	850.2
	294	2611.8	1279.4	2097.3
	296	621.4	1368.3	981.8
	342	559	594.3	445.9
13a17
	SEQ	Signal
	ID	EA02014_40405_H133A_982TT	EA02014_40406_H133A_983TT	pb1	pb2	pb3	pb4	pb5′
	2	3615.6	2106	204.1	324.2	178.6	206.6	249.1
	3	765	372.2	171.5	303.8	159.1	61.1	90.2
	5	2446.1	394	107.9	19.9	68.8	74.6	69
	6	1051.6	1176	211.6	214.4	318.6	218.8	355.4
	9	2059.2	1081.4	18	18.8	29.2	9.7	134
	12	3520	391.5	11.4	9.1	9.9	33.8	8.3
	18	4633.4	13339	94.2	50.7	67.6	74.9	29.7
	22	6678.8	403.5	80.1	8.8	58.9	6.8	5
	25	1229.9	601.5	197.1	106.7	65.2	18.7	87.1
	28	778.2	197.6	11.4	9	6.6	11.3	1.7
	32	1302.9	4182.6	8.7	21.6	30.5	66.1	64.6
	39	2104	699	246.6	121.1	42.8	122.8	171.7
	74	1189.7	1142.3	59.9	94.4	70.3	29	5.2
	78	833.6	80.9	48	45.5	66.9	49.5	119.7
	143	2842.2	1778.2	290	291.2	190.4	65.6	203.5
	174	3307.3	329.8	29.8	42.8	25.8	11.5	13.9
	175	3878.9	1966.8	165.7	282.2	158.3	67.2	249.2
	191	3952.2	5278	46.8	181.4	148.2	97.3	152.1
	212	2201.7	1134.3	70.4	55.7	3.5	87	99.8
	222	469	451.7	120.4	148.4	57.7	49.6	58
	233	11069.2	5607	13	9.8	76.9	7.6	5.6
	234	3590	3449.5	186	201.3	165.3	54.8	141.1
	237	2057.6	740.2	135.3	150.7	16.6	14.5	19
	238	1679.4	432.3	22.5	43.8	11.4	6.2	5.1
	245	2301.6	1040.5	7.1	12.7	22.5	5.9	4.6
	250	434.6	1079.4	97.8	138.9	33.7	71.3	46.8
	252	844.6	1446.1	35.6	80.3	29.6	63.3	88.5
	264	1125.7	1084.5	102.8	31.6	147.6	101.5	163.3
	290	347.9	466.9	35.8	7.3	14.4	87.2	71.7
	294	1601.7	575.2	105.1	94.5	41.5	31.9	35.3
	296	872.8	1349.1	217.8	162.6	186.2	171.2	212.5
	342	948.7	482.8	296.5	220.2	308.1	126.3	298.6
13a18
	Signal
	SEQ ID	pb6′	pb7′	pb8′	pd10	pd11	pd12	pd9
	2	167.6	233.9	232.6	116.9	204.5	293.2	79.6
	3	110.3	88	221	90.7	74.9	90.9	129.5
	5	29.7	70.2	182.5	32.6	34.5	130.5	12.9
	6	226.5	440.1	207	219.7	275.2	134.1	193.1
	9	28.9	26.8	30.9	32.4	5.3	25.7	20.3
	12	6.6	18.8	61.4	38.2	10.7	4.1	11.6
	18	53.6	37.8	31.8	68.8	117.5	70.8	23.4
	22	16.9	10.6	32.1	6.4	29.2	21.2	3.1
	25	127	123.7	118.7	9.7	10.6	64.9	6.6
	28	13.2	4.9	43.3	8	8.1	12	26.6
	32	36.4	51.5	25.1	17.2	17.2	19.7	11
	39	326.5	182.6	27.3	126.2	151.9	26	182.7
	74	48.2	29	39.8	55.3	35.3	76.9	6.2
	78	92.1	20	93.1	26.9	11.9	56.6	104.8
	143	176.4	224.5	248.5	126.2	184.6	162.8	249.6
	174	40.8	149.8	24.2	10.6	15.6	81.4	16.8
	175	262.5	355.4	207.8	21.6	213.9	175.8	193.7
	191	151.2	310.7	93.3	65.7	108.4	95.9	79.3
	212	93.6	121.7	141.7	30.8	42.6	108.4	93.2
	222	83.5	82.8	60.7	16.4	50	71.1	66.9
	233	144.7	64.1	16.5	7	6.4	70.8	8.1
	234	40.4	248.1	43.8	45.5	143.3	30.9	77.2
	237	223.8	141.1	129.5	57.6	21.9	11.5	18.7
	238	32.1	27.6	66.5	10.5	33.4	7.7	61.6
	245	19.8	7.2	4.8	2.4	11.2	4.7	6.7
	250	75.3	109.2	65.3	85.7	119.9	118.7	66.4
	252	103.8	91.2	94.8	17	69.3	76.1	22.5
	264	151	224.6	129.9	122.8	99.8	61.5	24.8
	290	21.8	27.6	50.7	49.3	6.2	2.7	3
	294	91.1	58.4	40	24.8	52.6	67.8	31.7
	296	282.4	299.2	143.7	149.7	197.9	205.2	147.7
	342	304.5	437.8	327.4	90.9	247.6	224.4	268.6

TABLE 13b
13b1
SEQ	ThyMixBen_02014_. . ._Signal
ID	40062_H133A_800TT	40063_H133A_801TT	40064_H133A_802TT	40065_H133A_804TT
83	156.7	114.3	73.8	240.3
142	28.3	7.9	15	28.4
136	100.4	23.4	15.3	106.9
137	527.2	47	32.3	177.2
152	237.5	230.4	188.7	465.2
160	291.6	141.9	80.9	323.1
163	15.6	53.1	25.1	70.8
165	190.2	230.7	142.4	483.5
210	436.9	8.6	18.4	343.7
214	269.2	134.4	167.7	141.8
219	217	19.6	7.9	85.6
224	588.2	121.4	119.2	275.2
225	508.1	30.1	42.3	107.3
226	57.3	48.2	80.9	103.9
309	257.7	20.6	20.7	75.5
332	287.1	17	26.1	103.8
346	622.2	18.3	24	17.6
	SEQ	ThyMixBen_02014_. . ._Signal
	ID	40066_H133A_805TT	40067_H133A_806TT	40068_H133A_807TT
	83	173	193.6	291.2
	142	26.9	25.8	14.2
	136	28.3	14.9	56
	137	19.5	53.1	404.6
	152	183	260.9	190.9
	160	98.1	120.3	219.7
	163	20.1	56.1	47.8
	165	179.3	241.7	410.9
	210	31.8	8	148.1
	214	145.7	140.5	349.1
	219	21.8	26.7	115.1
	224	136.6	240.5	392.5
	225	59.4	29.5	147.3
	226	43.5	12.3	88.9
	309	19.2	24	833.9
	332	115.9	68.8	37.9
	346	20.7	13.2	442.1
13b2
SEQ	02014_. . ._Signal
ID	40198_H133A_871TT	40321_H133A_913TT	40322_H133A_914TT	40323_H133A_915TT
83	39.5	90.2	76.4	255.8
142	25.3	22.5	12.9	34.4
136	9.8	31.8	16.8	132
137	227.8	53.6	68.7	60.1
152	184.4	214.3	253.2	294.7
160	267.5	250.7	206.5	328.8
163	44.3	56.4	23.9	98.5
165	174.3	221.8	185.5	266.3
210	25.8	153.6	42	55.5
214	43.2	83.6	110.6	213.7
219	56.6	53.5	45.2	122.1
224	269.7	357.4	260	191.5
225	204.8	322.6	114.2	55.6
226	11.9	57.4	69.9	22
309	37.9	37	28.2	53
332	9.9	59.2	66.7	57.8
346	28.6	263.8	11.1	27.2
	SEQ	02014_. . ._Signal
	ID	40324_H133A_917TT	40325_H133A_918TT	40326_H133A_919TT
	83	150.8	109.7	142.6
	142	8.5	20.6	67.7
	136	115.4	130	7.2
	137	29.6	133.2	29
	152	313.8	251.3	294.2
	160	191.1	220.8	114.4
	163	35.2	68	41.8
	165	104.6	217.1	159.9
	210	8.2	152	49.1
	214	132.6	89.3	138.7
	219	24.4	124	41.3
	224	168.8	330.8	169.8
	225	121.8	317.6	95.8
	226	67.5	33.6	19.3
	309	10.2	32.6	24.2
	332	13	40.5	9
	346	32.5	153.4	61.1
13b3
SEQ	ThyFolBen_02014_. . ._Signal
ID	40079_H133A_818TT	40080_H133A_819TT	40081_H133A_820TT	40082_H133A_821TT	40083_H133A_822TT
83	63.4	151.8	104.1	27.5	138.9
142	15	20.2	18.8	18.4	23
136	17.6	135.4	77.1	31.7	17.7
137	24.7	36.1	18	28.4	42.6
152	62.1	176.7	146.4	273.3	328.2
160	153	138.1	131	192.4	124.1
163	6.9	21.4	35	63.5	13.4
165	28.7	155.3	112.6	135.2	222.6
210	27.5	10.4	8.1	9.9	32.7
214	211.7	210.8	83.9	166.4	160.2
219	18.7	111.8	45.7	10.9	29.6
224	114.7	241.8	100	160.9	242.4
225	69.4	63.8	145.4	110.9	126.1
226	92.1	95.5	36.3	74.5	67.2
309	16.8	17.1	12.1	18.8	27.3
332	40	20.5	21	11	6.6
346	7.2	27.1	18.6	29.3	26.7
13b4
	SEQ	fa_EA40 . . ._Signal
	ID	191_VDX862TT	192_VDX863TT	193_VDX864TT	194_VDX865TT	195_VDX866TT
	83	26.9	24.4	56.7	155.1	22.3
	142	16.1	22.4	14.5	54.8	17.1
	136	23	59	20.4	121.4	12.5
	137	26.7	32.4	19.4	45.2	32.8
	152	75.7	189.4	211.4	320.4	194
	160	239.5	101.4	91.3	292.1	55.8
	163	48.5	47.6	23.1	168.3	35.4
	165	26.5	94.3	81.1	197.9	112.9
	210	32.2	16.2	23.8	81.4	25.3
	214	119.9	130.9	141.7	235.4	263.7
	219	80.6	7.6	15.9	20.9	25
	224	50.9	25.8	50	80	32.6
	225	66.7	41.4	64.4	69.5	18.1
	226	76	2.8	3.5	99.1	88.6
	309	6.7	15.2	9.4	62.6	20.2
	332	9.6	36.9	10.8	91.1	103
	346	25.1	16.5	20.8	89.5	34.2
SEQ	fa_EA40 . . ._Signal
ID	196_VDX867TT	197_VDX869TT	219_VDX907TT	220_VDX908TT
83	94.8	63	41.9	256
142	15.8	15	21.9	23.9
136	88.4	77.1	47.1	36.8
137	30.8	55.2	97	63.4
152	75.5	314	114.8	260
160	86.8	53.7	47.4	145.4
163	13.4	51.5	13.5	60.4
165	164.6	155.9	29.7	250.4
210	22.7	140.5	15.5	200.8
214	30.4	124.9	57	241
219	10	16.5	23.4	20.1
224	99.7	136.4	137.5	167
225	94.7	51.1	51.6	149.8
226	18.3	60.6	6.4	11.6
309	18.4	15.9	10.2	33.3
332	30.1	12.3	19.7	36.5
346	20.9	18.3	11.3	114.6
13b5
SEQ	02014_. . ._Signal
ID	40327_H133A_920TT	40332_H133A_938TT	40334_H133A_941TT	40335_H133A_940TT
83	216.8	145.1	58.1	102.1
142	22.2	7.9	6.6	14.5
136	71.7	30.1	47.9	57.1
137	47	48.1	69.1	57.4
152	252.7	189	184.9	138.7
160	153.6	179.9	121.9	66.6
163	53.3	13	69.1	38.6
165	146.9	146.7	85.1	120
210	24	59.1	21.5	23.8
214	90.5	224.7	178.7	139.3
219	36.4	17.5	14.9	63.3
224	180.2	126.6	154.2	161
225	59.7	197.5	83.8	115.7
226	31.9	58.1	33.7	34.5
309	27.1	7.7	6.2	15.6
332	83.8	7.3	40.7	47.6
346	17	18.8	27.6	24.4
13b6
	SEQ	EA02014_. . ._Signal
	ID	40374_H133A_921TT	40376_H133A_923TT	40377_H133A_924TT
	83	174.4	32.7	69.1
	142	13.7	19.8	16.5
	136	24.2	9.3	12.1
	137	38.3	143.4	28.2
	152	178.2	230.8	155
	160	125.2	133.5	74.9
	163	54.4	4.9	35.5
	165	218.9	155.1	206
	210	36.8	25	20.6
	214	126.7	186.1	167.2
	219	32.3	25.5	15.3
	224	220.8	301.9	129.7
	225	158	221.8	127.9
	226	37.5	33.4	9.6
	309	26.1	16	17.8
	332	26.3	38.5	6.7
	346	20.7	151.4	21.6
	SEQ	EA02014_. . ._Signal
	ID	40378_H133A_925TT	40379_H133A_926TT	40380_H133A_927TT
	83	86.6	67.7	204.9
	142	57.7	22.9	18.9
	136	25.3	190.4	16.3
	137	77.5	156.1	255.2
	152	237.4	235.7	70
	160	197	170.1	234
	163	46.1	65.2	59.9
	165	85.6	158.1	532.5
	210	25.8	19.8	551.3
	214	114.1	191.9	161.4
	219	10.2	95.6	18.5
	224	178.8	308.2	270.9
	225	65.6	269.4	60.6
	226	57.2	80.8	18.1
	309	31.8	32.6	49.2
	332	11.6	73.5	21.6
	346	19.2	179.4	53.6
13b7
SEQ	EA02014_. . ._Signal
ID	40387_H133A_955TT	40388_H133A_956TT	40389_H133A_957TT	40390_H133A_959TT
83	29.1	121.5	70.7	28.8
142	16.7	14.2	10.8	21.4
136	15.7	27.8	67.7	45.9
137	28.5	44.8	34.5	50
152	85.4	163	183.4	127.1
160	121.9	51.9	175	137.4
163	47	27.7	43.6	80.1
165	42.2	122.9	103.8	150.6
210	27.1	5.2	20.4	73.7
214	36.4	68.3	165.9	25.3
219	23.3	51	29.1	25.7
224	143.8	95.1	128.8	78.7
225	140.5	83.1	34.3	54
226	4.3	24.7	84.1	47.7
309	18.7	11.4	26.7	44.2
332	11.1	4	37.9	14.1
346	21.8	22.1	12.8	35.7
	SEQ	EA02014_. . ._Signal
	ID	40391_H133A_960TT	40392_H133A_961TT	40393_H133A_962TT
	83	121.6	120.5	34
	142	18.6	16.5	21.9
	136	15.4	8.2	43
	137	31.3	162.2	18.5
	152	298.3	193	221.2
	160	208.5	125.9	162.9
	163	29.7	33.8	44.4
	165	253.3	106.9	221.6
	210	29.4	38.7	85
	214	129.8	165.9	100.9
	219	67	20.8	21
	224	108.8	152	109
	225	62.8	114.7	94.3
	226	33.3	66.1	13.3
	309	20.6	34.1	35.2
	332	17.8	13.1	11.5
	346	38.7	29.6	10.1
13b8
SEQ	ThyPapCan_02014_. . ._Signal
ID	40090_H133A_829TT	40091_H133A_830TT@IC	40092_H133A_831TT	40093_H133A_832TT	40095_H133A_834TT
83	304.3	199.4	258.5	171.4	112.3
142	26	34.7	22.4	19.1	16.4
136	122.2	116.6	21.7	27.3	30.7
137	40.7	72	23.8	36.8	19.5
152	611.5	682.6	236.2	170.5	200.6
160	218.1	244.7	225.4	68.9	76.4
163	17.8	119.7	38.9	51.8	52.9
165	370.6	263.3	353.8	154.1	165.1
210	223.2	249.8	303	9.7	30.2
214	178.4	246.7	155.4	188.3	138.6
219	36.8	136.4	64.9	24.3	19.1
224	364.7	427.6	180	191.1	163.6
225	333.9	213.5	221	124.6	137.2
226	179.2	142	57	15.4	13.7
309	88.8	136.6	48.8	22.1	23.6
332	92	56.9	42.4	61.1	34.4
346	58.4	61	197.1	38	29.1
SEQ	ThyPapCan_02014_. . ._Signal
ID	40096_H133A_835TT	40097_H133A_836TT	40098_H133A_837TT@I2	40099_H133A_838TT@I2
83	186.5	28.5	137.1	85.9
142	25.8	12.1	22.5	15.4
136	110.2	143.8	14.1	140.7
137	31.5	29.6	29.4	32.5
152	104	136.4	118	155.9
160	137.3	83.2	171.7	66.7
163	42.7	25.5	57.2	23.6
165	233.2	100.4	227.9	213.3
210	94.5	21.9	42.1	23.1
214	133.7	69	298.6	90.8
219	25.9	11.7	13.6	23.8
224	211.5	36.2	303.4	164.5
225	195.1	46.9	145.6	34.3
226	91.8	33.5	132.6	38
309	40.5	16.5	33.9	24.7
332	70.6	14.5	108.1	60.8
346	281.5	37.5	30.8	33
13b9
	SEQ	Signal
	ID	02014_40317_H133A_839TT	pc_EA40200_VDX879TT	pc_EA40201_VDX881TT
	83	288.1	25.7	32.9
	142	16.1	21.2	23.5
	136	62.8	160.5	141.2
	137	45.4	155.5	35.5
	152	383.4	197	90.6
	160	142.9	79.7	181.6
	163	60.7	102.6	138.6
	165	238.4	123.6	227.1
	210	134.1	184.4	28.4
	214	189.2	173	50
	219	26.8	30.4	13.3
	224	215.8	139.5	255.3
	225	167.5	35.2	98.1
	226	49.4	43.4	84.3
	309	340.8	33.7	32
	332	15.9	39.9	67.1
	346	14.3	37.9	36.5
	SEQ	Signal
	ID	pc_EA40202_VDX882TT	pc_EA40203_VDX883TT	pc_EA40204_VDX884TT
	83	29.2	58.6	184.4
	142	7.6	21.5	30.6
	136	8.7	13.2	19.4
	137	63.9	41.5	31.1
	152	123.7	188	240
	160	205.4	157.5	137.8
	163	54.2	51.3	9.1
	165	113.8	224.6	241.9
	210	42.7	12.1	10
	214	164.7	109.2	250.7
	219	78.6	34.3	34.8
	224	96.9	181.3	163.2
	225	32.4	221.4	54.3
	226	16.4	141.3	27.2
	309	22.8	29.8	45.9
	332	14.3	88.5	25.2
	346	33.5	28.7	37.4
13b10
SEQ	pc_EA40 . . . Signal
ID	205_VDX885TT	206_VDX886TT	207_VDX890TT	208_VDX892TT	209_VDX893TT	210_VDX894TT
83	22.9	81.5	34.1	159.2	88.7	43.6
142	26.4	22.6	8.7	10.8	18.5	23.6
136	28.1	18.2	9.6	14.6	17.3	22.5
137	207.7	94.4	68.8	83.7	17.8	140.4
152	77.3	225.5	227.5	95.5	301.1	59.9
160	294.5	164.6	110.3	84.5	105.6	163
163	140.9	34	25.9	9.3	41.9	83.5
165	241.8	101.4	193.6	161.9	112.8	190.6
210	416.8	24.1	45.5	15.1	26.9	15.6
214	323.3	139.5	148.2	174.1	104.5	142.1
219	131.8	12	25.9	48.9	14.4	96.2
224	215.3	136.2	126	193.8	195.4	67.1
225	49.5	105	54.2	97.4	33	38.8
226	181.1	55.2	34.1	4	15	125.1
309	89.7	47.4	58.6	17.8	23.5	72.3
332	73	66.8	48.2	27.5	41.1	25.3
346	13.6	107.7	145.3	12.7	18.3	20
13b11
	SEQ	02014_40 . . ._Signal
	ID	319_H133A_903TT	320_H133A_904TT	328_H133A_928TT	330_H133A_932TT	331_H133A_933TT
	83	58.3	226.6	92.7	79.2	106.8
	142	14.5	118.3	7.4	8	13
	136	18.9	87	29.4	86.9	9.3
	137	24.4	174.5	25.7	135.9	31.8
	152	178.1	137.4	176.6	151.1	166.2
	160	83.2	205	93.5	103.6	73.3
	163	31.5	100.2	19.2	40.5	33.4
	165	223.6	235.9	161.5	132.8	132
	210	35.5	99.9	16.4	124.9	17
	214	118.8	178	25.6	115.6	117
	219	15.1	80.2	27.7	54.2	38.2
	224	174.5	323.7	223.3	203	185.3
	225	170.3	200.3	180.3	157.3	157.2
	226	65.2	26.9	25.2	4.6	35.7
	309	11.1	270.7	15.9	91.5	18.6
	332	12	77.4	15.1	7.2	7.3
	346	30.4	387.2	25.4	204.4	14.7
13b12
	SEQ	EA02014_403 . . ._Signal
	ID	75_H133A_922TT	381_H133A_945TT	382_H133A_946TT	383_H133A_947TT	384_H133A_948TT
	83	88.1	22.1	193.5	166.9	73.7
	142	12	19.6	13.2	21.6	16.9
	136	11.8	12.3	52	46.7	107.9
	137	51.3	182.2	43.4	23.9	14.5
	152	341	139	248.1	299.5	84.2
	160	95.6	102	99.5	184.6	90.4
	163	77.6	41.6	25.9	51.7	4.9
	165	254.8	63.5	172.6	209.2	81.1
	210	8.8	78.8	28.8	44	92.5
	214	79	94.5	148.7	101.7	82.7
	219	22.7	31.8	63.9	23.8	18.1
	224	190.5	194.7	212	278.9	201.1
	225	48.8	135.5	46.8	274.4	97.5
	226	20	24	90.8	45.3	8.8
	309	30.5	195	29.7	53.4	37.9
	332	10.4	4.2	9.2	75	44
	346	19.1	298.1	35.4	251.2	37.2
13b13
	SEQ	ThyFolCan_02014_400 . . ._Signal
	ID	84_H133A_823TT	85_H133A_824TT	86_H133A_825TT	88_H133A_827TT	89_H133A_828TT
	83	242	70.1	71.2	24.8	145.4
	142	19.8	12.5	35.7	17.7	19.6
	136	35.7	21	59.4	20.3	9
	137	86.1	23.7	116.3	18.2	48.6
	152	271.9	199.6	213.1	140.9	202.5
	160	134.5	134.1	415.1	162.4	154
	163	64.5	46.1	82.1	15.5	57.8
	165	189.3	222.6	239	223.8	145.3
	210	8.8	236.3	50	21.8	33.8
	214	33.1	71.3	121.6	157.3	100.8
	219	24.8	64.8	82.1	14.1	60.2
	224	213	96.4	371.4	159.1	92.8
	225	164.9	103.3	224.4	145.2	98.3
	226	10.3	5	24	30.5	21.6
	309	15	33.3	38.4	14.9	19.5
	332	77.6	55.7	124.1	10.6	84.5
	346	39	124.6	31.5	29.5	21.3
13b14
SEQ	Signal
ID	02014_40318_H133A_840TT	fc_EA40212_VDX896TT	fc_EA40214_VDX898TT	fc_EA40215_VDX899TT
83	189.9	110.7	51.4	35.8
142	18.9	20.5	246.2	18.5
136	22.6	105.2	21.3	20.3
137	32.3	40.6	46.3	33.8
152	306	216.1	317.8	169.4
160	99.5	197.5	240.4	68.7
163	52.1	29.7	70.7	75.3
165	236.7	142.2	147	168
210	26.5	108.8	39.9	25.5
214	115.1	63.9	59	129.9
219	16.2	46.2	62.7	39.4
224	203.9	194.6	321.6	225.2
225	198	53.6	82.8	52.5
226	31	57.3	111.5	66.7
309	17.2	40.2	44.3	43
332	51.4	26.5	129.1	7.8
346	11	27.8	21.6	19.4
	SEQ	Signal
	ID	fc_EA40216_VDX900TT	fc_EA40217_VDX901TT	fc_EA40218_VDX902TT
	83	104.6	22.8	44.7
	142	20.7	25.8	28.6
	136	33.6	24.5	24.4
	137	23.9	90.6	48.5
	152	154.6	169.3	374.5
	160	146.7	210.5	196.7
	163	13.6	25.1	59.3
	165	174.2	28.5	89.4
	210	42.2	11	24.4
	214	150.1	194.1	218.2
	219	42.1	92.3	39.4
	224	238	212.5	187.3
	225	250.7	72	53.5
	226	24.8	41	79.9
	309	20.2	21.3	63.8
	332	5.6	37.8	31.6
	346	320.2	24.3	210.6
13b15
SEQ	Signal
ID	fc_EA40221_VDX909TT	fc_EA40222_VDX910TT	EA02014_40386_H133A_954TT	EA02014_40394_H133A_967TT
83	312.2	30.6	105.2	42.2
142	17.8	9.9	41.7	30.5
136	63.1	87.5	38	29.7
137	170.4	111.7	78.6	32.1
152	624.7	121	215.4	212.7
160	257.9	30.5	247.6	161.6
163	21.6	27	43.5	50.7
165	251.9	105	92.7	136.3
210	34	37.1	49	43.9
214	257.9	176.9	168.4	69.9
219	117.7	25.9	43.2	42.1
224	55.1	150	176.9	280.1
225	205.8	42.3	66.7	320.3
226	84.9	14.8	148.6	26
309	745.6	9.7	53.6	42
332	15.9	7.6	69.9	10.3
346	48	25	54.7	142.6
	SEQ	Signal
	ID	EA02014_40395_H133A_968TT	EA02014_40396_H133A_969TT	EA02014_40397_H133A_970TT
	83	47.9	24.4	46.5
	142	11.8	16.7	25.7
	136	206.6	10.1	99.2
	137	20.5	29.4	18.2
	152	160.9	216.7	214.3
	160	192.1	87.9	538.8
	163	56.9	72.4	48.7
	165	166.5	123.8	180.7
	210	21.1	7.4	167.3
	214	113.6	140.1	14
	219	24	12.6	57.9
	224	184.5	194.4	374.4
	225	27	66.2	54.6
	226	47.6	36.9	21.7
	309	23.5	14.6	71
	332	63.6	13.3	26.8
	346	73.6	16.6	79.7
13b16
	SEQ	Signal
	ID	EA02014_40405_H133A_982TT	EA02014_40406_H133A_983TT	pb1	pb2	pb3	pb4	pb5′
	83	58.1	37.8	524.7	768.1	855.6	1163.9	876.3
	142	19.4	37.4	1289.3	1088.9	659.7	732.6	1415
	136	94.2	11	1770.1	1622.7	523	979.3	617.3
	137	17.6	111.2	1871	2554	1313.7	781.1	2087.1
	152	255.8	37.6	9696.4	9404.8	1099.8	9900.7	7060
	160	54.7	347.1	1273.2	1171.6	907	937.4	926.2
	163	32.9	59.7	833	682.5	559.6	358.6	467.8
	165	71.8	232.2	1217.8	986.3	1278.9	2537.1	1464.3
	210	5.2	33.2	3401	2546.6	756.3	4893	1770.8
	214	212.6	165	1384.3	1540	636.7	656.5	1213.9
	219	14.1	43.6	1692.6	1911.7	912	2112.2	1417.9
	224	137	228.2	2481.3	3104.2	1905.4	2292.4	2242.7
	225	109.6	153.4	2367.8	2860.8	1887.6	2052.6	2116.6
	226	41.6	11	797.2	969.9	617.1	626.6	920
	309	20.7	30.6	5357.5	5904	3572.6	6641.9	3580.9
	332	6.8	60.2	258.8	304.2	110.1	255.3	363.3
	346	27	57.3	1584.2	1705.7	1507.5	1626.3	1587.1
13b17
	SEQ	Signal
	ID	pb6′	pb7′	pb8′	pd10	pd11	pd12	pd9
	83	818.3	333.4	692.1	709.8	699.7	926.2	534.7
	142	1287.9	565.2	2004.2	821.9	904.8	1619.6	282.5
	136	1039	962.2	1013.5	1147.9	840.9	599.8	284
	137	1881.4	667.8	2058.1	2182.1	1678.9	1632.9	912.1
	152	3657.7	2025	2993.5	11129.5	11824.2	11963.5	1607
	160	1154.5	301.4	473.2	1849.5	1424.7	660	242
	163	628.5	6534.3	1863.4	148.7	247.4	230.2	4365.5
	165	1485.2	889	1904.7	1404.2	1560.4	1123.6	1919.6
	210	2729.4	595.1	5286.8	7026.5	3861.8	1028.8	1724.8
	214	871.1	442.3	644.5	936.1	939.1	852	347.7
	219	1216.7	411.6	959.7	1085.9	1974.4	1580.2	245.9
	224	2039.1	1488.3	1844.2	2280.1	2823.4	1252.3	1246.6
	225	2214.8	1494.6	2186	1961.1	2628.3	1184.1	1230.7
	226	822.2	437.3	684.5	540.5	839.5	1062.8	273.7
	309	3787.2	1401.5	3537	3522.1	4518.1	5118.1	931.7
	332	218.7	630.6	462.4	168.4	220.4	242.2	322.8
	346	1682.4	909	2317.6	1193.5	1748.9	2159	622.7

TABLE 14
Control Genes
SEQ ID NO: Gene Name
Control Genes for Blood
142        Bone marrow stromal cell antigen 1 (BST1)
219        Leucocyte immunoglobulin-like receptor-6b (LIR-6)
309        Bridging integrator 2 (BIN2)
Control Genes for Thyroid
9          Cysteine-rich, angiogenic inducer, 61 (CYR61)
12         Selenoprotein P, plasma, 1 (SEPP1)
18         Insulin-like growth factor-binding protein 4 (IGFBP4)

TABLE 15a
SEQ ID
	BN_800TT	BN_801TT	BN_802TT	BN_804TT	BN_805TT	BN_806TT	BN_807TT	BN_871TT
142	28.3	7.9	15	28.4	26.9	25.8	14.2	25.3
219	217	19.6	7.9	85.6	21.8	26.7	115.1	56.6
309	257.7	20.6	20.7	75.5	19.2	24	833.9	37.9
	BN_913TT	BN_914TT	BN_915TT	FA_917TT	FA_918TT	FA_919TT	FA_818TT	FA_819TT
142	22.5	12.9	34.4	8.5	20.6	67.7	15	20.2
219	53.5	45.2	122.1	24.4	124	41.3	18.7	111.8
309	37	28.2	53	10.2	32.6	24.2	16.8	17.1
	FA_820TT	FA_821TT	FA_822TT	FA_842TT	FA_862TT	FA_863TT	FA_864TT	FA_865TT
142	18.8	18.4	23	10	16.1	22.4	14.5	54.8
219	45.7	10.9	29.6	28.9	80.6	7.6	15.9	20.9
309	12.1	18.8	27.3	15.2	6.7	15.2	9.4	62.6
	FA_866TT	FA_867TT	FA_869TT	FA_907TT	FA_908TT	FA_920TT	FA_938TT	FA_940TT
142	17.1	15.8	15	21.9	23.9	22.2	7.9	6.6
219	25	10	16.5	23.4	20.1	36.4	17.5	14.9
309	20.2	18.4	15.9	10.2	33.3	27.1	7.7	6.2
	FA_941TT	Fa_EA40374_921TT	Fa_EA40376_923TT	BN_EA40377_924TT	Fa_EA40378_925TT
142	14.5	13.7	19.8	16.5	57.7
219	63.3	32.3	25.5	15.3	10.2
309	15.6	26.1	16	17.8	31.8
	Fa_EA40379_926TT	BN_EA40380_927TT	Fa_EA40387_955TT	Fa_EA40388_956TT	Fa_EA40389_957TT
142	22.9	18.9	16.7	14.2	10.8
219	95.6	18.5	23.3	51	29.1
309	32.6	49.2	18.7	11.4	26.7
	Fa_EA40390_959TT	Fa_EA40391_960TT	Fa_EA40392_961TT	Fa_EA40393_962TT	PC_829TT	PC_830TT
142	21.4	18.6	16.5	21.9	26	34.7
219	25.7	67	20.8	21	36.8	136.4
309	44.2	20.6	34.1	35.2	88.8	136.6
	PC_831TT	PC_832TT	PC_834TT	PC_835TT	PC_836TT	PC_837TT	PC_838TT	PC_839TT
142	22.4	19.1	16.4	25.8	12.1	22.5	15.4	16.1
219	64.9	24.3	19.1	25.9	11.7	13.6	23.8	26.8
309	48.8	22.1	23.6	40.5	16.5	33.9	24.7	340.8
	PC_879TT	PC_881TT	PC_882TT	PC_883TT	PC_884TT	PC_885TT	PC_886TT	PC_890TT
142	21.2	23.5	7.6	21.5	30.6	26.4	22.6	8.7
219	30.4	13.3	78.6	34.3	34.8	131.8	12	25.9
309	33.7	32	22.8	29.8	45.9	89.7	47.4	58.6
	PC_892TT	PC_893TT	PC_894TT	PC_903TT	PC_904TT	PC_928TT	PC_932TT	PC_933TT
142	10.8	18.5	23.6	14.5	118.3	7.4	8	13
219	48.9	14.4	96.2	15.1	80.2	27.7	54.2	38.2
309	17.8	23.5	72.3	11.1	270.7	15.9	91.5	18.6
	Pc_EA40375_922TT	Pc_EA40381_945TT	Pc_EA40382_946TT	Pc_EA40383_947TT	Pc_EA40384_948TT
142	12	19.6	13.2	21.6	16.9
219	22.7	31.8	63.9	23.8	18.1
309	30.5	195	29.7	53.4	37.9
	FC_823TT	FC_824TT	FC_825TT	FC_827TT	FC_828TT	FC_840TT	FC_896TT
142	19.8	12.5	35.7	17.7	19.6	18.9	20.5
219	24.8	64.8	82.1	14.1	60.2	16.2	46.2
309	15	33.3	38.4	14.9	19.5	17.2	40.2
	FC_898TT	FC_899TT	FC_900TT	FC_901TT	FC_902TT	FC_909TT	FC_910TT
142	246.2	18.5	20.7	25.8	28.6	17.8	9.9
219	62.7	39.4	42.1	92.3	39.4	117.7	25.9
309	44.3	43	20.2	21.3	63.8	745.6	9.7
	Fc_EA40386_954TT	Fc_EA40394_967TT	Fc_EA40395_968TT	Fc_EA40396_969TT	Fc_EA40397_970TT
142	41.7	30.5	11.8	19.4	37.4
219	43.2	42.1	24	14.1	43.6
309	53.6	42	23.5	14.6	71
	Fc_EA40405_982TT	Fc_EA40406_983TT	pb1_Signal	pb2_Signal	pb3_Signal	pb4_Signal	pb5′_Signal
142	16.7	25.7	1289.3	1088.9	659.7	732.6	1415
219	12.6	57.9	1692.6	1911.7	912	2112.2	1417.9
309	20.7	30.6	5357.5	5904	3572.6	6641.9	3580.9
	pb6′_Signal	pb7′_Signal	pb8′_Signal	pd10_Signal	pd11_Signal	pd12_Signal	pd9_Signal
142	1287.9	565.2	2004.2	821.9	904.8	1619.6	282.5
219	1216.7	411.6	959.7	1085.9	1974.4	1580.2	245.9
309	3787.2	1401.5	3537	3522.1	4518.1	5118.1	931.7

TABLE 15b
Signal
SEQ ID
	PC_984TT	PC_986TT	FA_987TT	PC_988TT	PC_989TT	FA_992TT	FA_993TT
142	25.1	125.8	18.5	11.4	13.7	11.8	113.6
219	17.5	25.7	22.6	11.3	32.4	61.9	25.2
309	27.6	661.8	15.7	47.4	29.8	33.2	28.4
	FA_994TT	FA_995TT	FA_996TT	FA_998TT	FA_999TT	FA_1001TT	FA_1002TT
142	20.6	25.2	34.1	21.8	31.4	12.7	74.6
219	25.9	36.3	41.5	24.9	16.4	26.5	25.5
309	16.8	26.3	19.4	22.5	14.6	32.3	47.7
	FA_1004TT	FA_1005TT	FA_1006TT	FA_1010TT	FA_1013TT	FA_1014TT	FA_1017TT
142	24.7	20.1	67.7	14.9	48.9	29.8	26.9
219	27.5	11.7	53.3	112.9	35.1	39.5	27.2
309	39.5	10.3	34.6	83.2	46.8	20	25.7
	FA_1018TT	FA_1020TT	FA_1023TT	FA_1024TT	FA_1026TT	FA_1027TT	FA_1028TT
142	25.1	25.5	35.6	26.9	27.9	15.2	24.5
219	66.3	26	6.1	26	59.3	18.8	31.7
309	31	37.4	20.6	46.9	51.4	8.8	33.3
	FA_1029TT	FA_1030TT	FA_1031TT	FA_1032TT	FA_1034TT	FA_1035TT	FC_1037TT
142	10.6	14	20	21.6	31.9	17.1	17.8
219	12.5	33.5	15.1	15	68.5	25.6	63.5
309	20.7	13	21.5	32.2	52.6	24.6	26.2
	PC_1039TT	PC_1040TT	PC_1041TT	PC_1042TT	PC_1043TT	PC_1044TT	PC_1045TT
142	16.1	22.7	99.5	129.8	20.7	79.2	16.4
219	27.9	29.5	23.6	29	21.5	19.8	38.4
309	585.3	37.6	48.7	41	32.8	59.2	112.3
							PC-
	PC_1046TT	PC_1047TT	PC_1048TT	PC_1049TT	PC_1050TT	PC_1051TT	FV_1052TT
142	22.4	81.2	24.7	37.5	25.9	26.6	26.4
219	11.1	97.5	61.8	14.9	14.7	109.1	30.6
309	22.5	207.8	35.4	64	39.5	56.7	28.2
	PC_1053TT	PC_1054TT	PC_1055TT	PC_1059TT	PC_1060TT	PC_1061TT	PC_1062TT
142	12.8	18.5	24.4	22.7	24.6	15.8	25.6
219	12.6	19.6	10.2	24.5	82.6	53.7	20.7
309	20.4	22.1	24	18.9	32.3	54.5	29.1
	PC-	PC-	PC-	PC-	PC-	PC-	PC-
	FV_1064TT	FV_1065TT	FV_1066TT	FV_1067TT	FV_1068TT	FV_1069TT	FV_1071TT
142	16.7	11.3	25.5	17.4	17.5	14	16.7
219	174.4	20.3	132.4	24.8	12.3	14.8	18.8
309	30.4	169.6	49.4	16.9	135.5	18.1	7.6
	PC-
	FV_1072TT	FA_1073TT	FA_1074TT	FA_1075TT	FA_1076TT	FC_1077TT	FC_1078TT
142	14	25.5	22.7	27	16.4	15.8	38.9
219	8.7	73.2	57	54.3	69.9	20	17.1
309	29.9	145.4	21	53	24.3	9.1	32.9
			PC-
	FC_1079TT	PC-FV_1080TT	FV_1081TT	FC_1082TT	pb1	pb2	pb3	pb4
142	31.9	10.2	22	19.5	1289.3	1088.9	659.7	732.6
219	40.1	17.4	38.3	88.1	1692.6	1911.7	912	2112.2
309	27.1	23.4	40.8	12.9	5357.5	5904	3572.6	6641.9
	pb5′	pb6′	pb7′	pb8′	pd10	pd11	pd12	pd9
142	1415	1287.9	565.2	2004.2	821.9	904.8	1619.6	282.5
219	1417.9	1216.7	411.6	959.7	1085.9	1974.4	1580.2	245.9
309	3580.9	3787.2	1401.5	3537	3522.1	4518.1	5118.1	931.7

F. Signature Normalized to Control Genes

We further examined our 5-gene and 4-gene signatures by normalizing these genes to the three selected thyroid control genes as an algorithm for gene chip data normalization. The average fluorescent intensities of the three thyroid control genes were used for signature gene signal normalization. The performance of both signatures improved slightly when these two signatures were normalized. The sensitivity and specificity of the two signatures are listed in Table 16, and the ROC curves are shown in FIGS. 4a and 4b.

TABLE 16
The performances of the 4-gene and 5-gene signatures normalized
to control genes
	Tumor	Benign
4-Gene Signature
	Positive	33	11
	Negative	3	27
	Sensitivity	92% (0.78, 0.97)
	Specificity	71% (0.55, 0.83)
5-Gene Signature
	Positive	33	8
	Negative	3	30
	Sensitivity	92% (0.78, 0.97)
	Specificity	79% (0.64, 0.89)

G. Signature Validation with Two-Round Amplified Probes

To determine if the FNA samples lack sufficient thyroid cells to provide enough probe material for hybridizing to the Affymetrix U133a gene chips after one round of amplification, two-round amplification of the target RNAs we performed two-round amplification with 47 samples that are among the 74 independent validation sample set. The data obtained show that the performances of the 5-gene and 4-gene signatures are identical with either one-round or two-round amplifications. The ROC curves of the two gene signatures with two different target preparations are shown in FIGS. 5a, 5b, 5c, and 5d.

EXAMPLE 4

Cross Validation with Independent Samples

A. Cross Validation with the 83 Independent Fresh Frozen Thyroid Samples

83 independent thyroid samples were processed and profiled with the U133a chip. The number of samples in each category is list in Table 17.

TABLE 17
Fresh Frozen sample collection for signature validation
Sample Type                      Number of Samples
Follicular Adenoma               18
Follicular Thyroid Carcinoma     1
Papillary Carcinoma, Follicular Variant 18
Papillary Thyroid Carcinoma      11
Adenomatoid Nodules              18
Adenomatoid Nodules w/Hashimoto  1
Multinodular Hyperplasia         16

The performance of the 4-gene signature and the 5-gene signature was assessed with LDA using the same cut-off value as in the training set. Both signatures gave equivalent performance in these samples, and they are comparable with the performance in the 98 training set. The sensitivity and specificity for both signatures are shown in Table 18, and the ROC curves are demonstrated in FIGS. 6a and 6b.

TABLE 18
4-Gene and 5-gene signatures performance in 83 validation samples
	Tumor	Benign
4-Gene Signature
	Positive	20	11
	Negative	10	42
	Sensitivity	67% (0.49, 0.81)
	Specificity	79% (0.67, 0.88)
5-Gene Signature
	Positive	24	24
	Negative	6	29
	Sensitivity	80% (0.63, 0.90)
	Specificity	55% (0.41, 0.67)

B. Signature Validation with the 47 Fine Needle Aspirate (FNA) Thyroid Samples

47 thyroid FNA samples were processed and profiled with the UI33a chip. The number of samples in each category is list in Table 19.

TABLE 19
FNA sample collection for signature validation
Sample Type                      Number of Samples
Follicular Adenoma               10
Follicular Thyroid Carcinoma     2
Papillary Carcinoma, Follicular Variant 3
Papillary Thyroid Carcinoma      13
Adenomatoid Nodules              10
Adenomatoid Nodules w/Hashimoto  1
Multinodular Hyperplasia         8

The performance of the 4-gene signature and the 5-gene signature was assessed with LDA model. Both signatures gave equivalent performance in the FNA samples, and they are comparable with the performance in the 98 training set. The sensitivity and specificity for both signatures are shown in Table 20, and the ROC curves are demonstrated in FIGS. 7a and 7b.

TABLE 20
4-Gene and 5-gene signatures performance in 47 FNA samples
	Tumor	Benign
4-Gene Signature
	Positive	15	4
	Negative	3	25
	Sensitivity	94% (0.74, 0.99)
	Specificity	62% (0.44, 0.77)
5-Gene Signature
	Positive	17	10
	Negative	1	19
	Sensitivity	94% (0.74, 0.99
	Specificity	66% (0.47, 0.80)

C. Signature Performance in 28 Paired Fresh Frozen and FNA Thyroid Samples

Within the 83 fresh frozen and the 47 FNA sample collections there are 28 samples that were from the same patient. The direct comparison of our signatures in these paired samples demonstrates how well the signature will translate into the final molecular assay. The performance of the 4-gene signature and the 5-gene signature was assessed with the LDA model. Both signatures gave equivalent performance in the fresh frozen and FNA samples. These results demonstrated that our 4-gene and 5-gene signatures can perform equally well in both sample types, and proved the approach using fresh frozen samples for gene/signature identification is valid. The sensitivity and specificity for both signatures are shown in Table 21, and the ROC curves are demonstrated in FIGS. 8a and 8b.

TABLE 21
4-Gene and 5-gene signatures performance in 28 matched
fresh frozen and FNA samples
	Fresh Frozen		FNA
		Tumor	Benign	Tumor	Benign
4-Gene Signature
	Positive	10	4	12	7
	Negative	3	11	1	8
	Sensitivity	77% (0.50-0.92)		92% (0.67-0.99)
	Specificity	73% (0.48-0.89)		53% (0.30-0.75)
5-Gene Signature
	Positive	11	7	12	7
	Negative	2	8	1	8
	Sensitivity	85% (0.58-0.96)		92% (0.67-0.99)
	Specificity	53% (0.30-0.75)		53% (0.30-0.75)

EXAMPLE 5

Real-Time Quantitative Rt-PCR

Sample Acquisition:

In order to determine whether a subset of the gene profiles and/or controls would give adequate specificity and sensitivity with RT-PCR, the following experiment was performed. The following has the advantage of requiring only one round of RNA amplification.

A total of 107 thyroid biopsies were analyzed in our study: 26 follicular adenoma, 23 follicular carcinoma, 38 papillary carcinoma, 5 normal, 3 papillary carcinoma follicular variant, 3 Hashimoto thyroiditis, 2 microfollicular adenoma, 1 diffuse goiter, 1 goiter with papillary hyperplasia, 1 Hurthle cell adenoma, 1 hyperplasia with papillary structure, 1 multinodular goiter, 1 oncocytic hyperplasia, 1 thyroiditis. Total RNA isolation was extracted by using the Trizol reagent according to the manufacturer's instructions. RNA concentrations were determined by absorbance readings at 260 nm with the Gene-Spec (Hitachi) spectrophotometer. The isolated RNA was stored in RNase-free water at −80° C. until use.

Primer and Probe Design:

The primers and hydrolysis probes were designed using Oligo 6.0 and the Genebank sequences for thyroid cancer status markers (Table 22). These primers and probe sets were designed such that the annealing temperature of the primers was 62° C. and the probes 5-10° C. higher and amplicon size ranges from 100-150 bp. Genomic DNA amplification was excluded by designing our primers around exon-intron splicing sites. Hydrolysis probes were labeled at the 5′ nucleotide with FAM as the reporter dye and at 3′ nucleotide with TAMRA as the quenching dye.

TABLE 22
	Accession				Product
Target	#	Forward Primer (SEQ ID NO:)	Reverse Primer (SEQ ID NO:)	Probe Sequence (SEQ ID NO:)	Length
SGENE	NM_003020	gaaagcggaggagtgtcaatcca (364)	ggttttcgtctagcatcttctcttta (365)	atctacaaggacagagactggataatgttg (366)	130
TESTICAN1	AF231124	gtgagctgtgaagaggagcaggaa (367)	ctttggtcccagctcccgttca (368)	cctcaggggattttggcagtggtgggtccg (369)	102
GABRE	NM_004961	taaactccgccatcctcgtatcaa (370)	cagtggtgacaatctggcacacaa (371)	ccgtgcccatgcccgtacccgtgca (372)	113
CDH3	NM_001793	ctgaagcaggatacatatgacgtgca (373)	agggtccagggcaggtttcgaca (374)	catggcagtcgcacacagtggccctga (375)	124
FN1	NM_002026	tggtgccatgacaatggtgtgaacta (376)	catcatcgtaacacgttgcctcatga (377)	aagattggagagaagtgggaccgtcaggga (378)	148
TPO-1	NM_000547	catctgtgacaacactggcctca (379)	gccacacttgtcgtcttgaggaa (380)	caaattccccgaagactttgagtcttgtgacagc (381)	148
TPO-2	NM_000547	aacctgcgtagactccgggaggc (382)	gccagtgcgtgtccacctgca (383)	ctcgggtgacttggatctccatgtcgctgg (384)	124
KCNAB1-1	NM_003471	tgaaagttccagggcttcactgaa (385)	agctgaggtagtgtgcatcccaga (386)	ctaccagtggttgaaagaaagaattgtaagtgaag (387)	138
KCNAB1-2	NM_003471	tagctgttgcgtggtgcctgagaa (388)	tgatgtcatctttgggagaacctgaa (389)	aaggtgtgagttctgtgctcctgggatcat (390)	119
FABP4-1	NM_001442	gaaagaagtaggagtgggctttgcca (391)	ggcccagtatgaaggaaatctcagta (392)	aaaggtactttcagatttaatggtgatcacatccc (393)	143
FABP4-2	NM_001442	aggaaagtcaagagcaccataacctta (394)	gacgcattccaccaccagtttatca (395)	ttgattttccatcccatttctgcacatgta (396)	123
DOI1-1	NM_000792	gggtaaatctggcccttggaactaca (397)	cccgttggtcacctagaattgaggta (398)	cccagaggaagttcgtgctgttctggaaaa (399)	106
DOI1-2	NM_000792	tgcatcagatggctgggctttta (400)	gctctggttctgcatggtgtcca (401)	catcagaaatcaccagaaccttcaggatcg (402)	142
B-ACTIN	NM_001101	tcacccacactgtgcccatctacga (403)	cagcggaaccgctcattgccaatgg (404)	atgccctcccccatgccatcctgcgt (405)	295
GOLGIN67	NM_015003	gcatggtgatctttgtgaggcga (406)	ctcctggtggtcctgcatctca (407)	ctcaccaacagcgtggagcctgcacaagga (408)	139
PAX8	BC001060	actccagcttgctgagttcccca (409)	actccagcttgctgagttcccca (410)	attattacagttccacatcaaggccgagtgca (411)	125
HERC	NM_003922	gggtgcttttcatgaggtttgtgtca (412)	tgaggtaggcagactgtcgtaaggcc (413)	ccaacactgctgacatttctcagagatttcaaat (414)	219
DDIT3	NM_004083	cctggaaatgaagaggaagaatcaa (415)	agctctgactggaatctggagagtga (416)	aatcttcaccactcttgaccctgcttctctgg (417)	142
ITM1	NM_152713	tggctggtcaggatatacaaggtaaa (418)	tcaacgtcctaaatgtgatgtgctca (419)	cctggataatcgaggcttgtcaaggacataaa (420)	117
C1OF24	NM_052966	tctgaaagtgataaaggaagctgcta (421)	ctttagatctgttaagctggacacac (422)	cttgaagaaacacaacttatttgaagataacatg (423)	103
MOT8	NM_018836	acggcctataacgagaccctgca (424)	gaagaggagggtcggtttccattaa (425)	ttctcacgagtgcgtcagggcatctgtgc (426)	133
ARG2	NM_00172	atttgaccctacactggctccagc (427)	gatccagtgctgatagcaaccctgta (428)	actcctgttgtcgggggactaacctatcgaga (429)	119

Real-Time Quantitative RT-PCR:

Gene specific real-time quantitative RT-PCR amplification of 21 thyroid cancer status genes and a housekeeping gene was performed using the TaqMan One-Step RT-PCR Master Mix (2×) (Applied Biosystems) and the ABI Prism 7900HT sequence detection system (Applied Biosystems). In a 25 μl one-step reaction total RNA (10 ng) was added to a mix that contained: 1×RT-PCR Master Mix, 0.25 U/μl Multiscribe Enzyme, 0.6 μM primers and 0.25 μM probe. Cycling parameters were 48° C. for 30 min and 95° C. 10 min, followed by 40 cycles of 95° C. 15 sec and 62° C. 1 min. Real-time PCR monitoring was achieved by measuring fluorescent signal at the end of the annealing phase for each cycle. The number of cycles to reach the fluorescence threshold was defined as the cycle threshold (Ct value). To minimize the errors arising from the integrity of the RNA in the samples β-actin mRNA was amplified as an internal reference. External standards were prepared by 10-fold serial dilutions of known thyroid cancer positive RNA and used to ensure linearity throughout our assays. Results were expressed in mean Ct value and samples were excluded that had a standard deviation greater then one. The results are provided in Tables 23a, 23b, 23c, 24a and 24b.

The data show that the two gene signature shown in Table 23b is not as sensitive and specific as the four-gene signature from which it was derived. Table 24 shows that use of the PAX8 gene in an RT-PCR reaction as a control for thyroid-specific tissue is effective in an RT-PCR reaction.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention.

TABLE 23A

TABLE 23B

TABLE 23C

TABLE 24A

TABLE 24B

TABLE 25
Sequence identifications
SEQ			Accession
NO:	psid	Name	No.	Description
1	200635_s_at		AU145351	Hs.75216 prot tyrosine phosphatase, rec.
				type, F
2	200771_at		NM_002293	laminin, gamma 1
3	201069_at		NM_004530	matrix metalloproteinase 2
4	201117_s_at	CPE	NM_001873	carboxypeptidase E
5	201150_s_at		NM_000362	tissue inhibitor of metalloproteinase 3
6	201185_at		NM_002775	protease, serine, 11
7	201203_s_at		AI921320	ribosome binding protein 1
8	201212_at		NM_005606	cysteine protease
9	201289_at	CYR61	NM_001554	cysteine-rich, angiogenic inducer, 61
10	201292_at		NM_001067	topoisomerase (DNA) II alpha
11	201418_s_at	SOX4	NM_003107	SRY (sex determining region Y)-box 4
12	201427_s_at	SEPP1	NM_005410	Selenoprotein P, plasma, 1
13	201430_s_at	DPYSL3	NM_001387	dihydropyrimidinase-like 3
14	201431_s_at	DPYSL3	NM_001387	dihydropyrimidinase-like 3
15	201438_at	COL6A3	NM_004369	collagen, type VI, alpha 3
16	201474_s_at	ITGA3	NM_002204	integrin, α 3 transcript variant a
17	201505_at	LAMB1	NM_002291	laminin, beta 1
18	201508_at	IGFBP4	NM_001552	Insulin-like growth factor-binding protein 4
19	201525_at	APOD	NM_001647	apolipoprotein D
20	201645_at	HXB	NM_002160	hexabrachion (tenascin C, cytotactin)
21	201650_at	KRT19	NM_002276	keratin 19
22	201667_at	GJA1	NM_000165	gap junction protein, α 1, 43 kD (connexin 43)
23	201744_s_at	LUM	NM_002345	lumican
24	201792_at	AEBP1	NM_001129	AE-binding protein 1
25	201852_x_at		AI813758	Collagen, type III, alpha 1
26	201893_x_at		AF138300	decorin variant A
27	201983_s_at		AW157070	epidermal growth factor receptor
28	202133_at		AA081084	Transcriptional co-activator w PDZ-binding
				motif
29	202219_at	SLC6A8	NM_005629	solute carrier family 6, member 8
30	202237_at	NNMT	NM_006169	nicotinamide N-methyltransferase
31	202286_s_at		NM_002353	tumor-associated calcium signal transducer 2
32	202291_s_at		NM_000900	matrix Gla protein
33	202310_s_at		NM_000088	proalpha 1 (I) chain of type I procollagen
34	202350_s_at	MATN2	NM_002380	matrilin 2 precursor, transcript variant 1
35	202357_s_at	BF	NM_001710	B-factor, properdin
36	202363_at		AF231124	testican-1
37	202376_at	SERPINA3	NM_001085	Ser (or Cys) proteinase inhib clade A mem 3
38	202404_s_at	COL1A2	NM_000089	collagen, type I, alpha 2
39	202440_s_at		NM_005418	suppression of tumorigenicity 5
40	202504_at	ATDC	NM_012101	ataxia-telangiectasia group D-assoc. protein
41	202575_at	CRABP2	NM_001878	cellular retinoic acid-binding protein 2
42	202588_at	AK1	NM_000476	adenylate kinase 1
43	202712_s_at	CKMT1	NM_020990	creatine kinase, mitochondrial 1
44	202796_at	KIAA1029	NM_007286	synaptopodin
45	202826_at	SPINT1	NM_003710	serine protease inhibitor, Kunitz type 1
46	202834_at	SERPINA8	NM_000029	Ser (or Cys) proteinase inhib, clade A mem 8
47	202898_at	KIAA0468	NM_014654	KIAA0468 gene product
48	202992_at	C7	NM_000587	complement component 7
49	203021_at	SLPI	NM_003064	secretory leukocyte protease inhibitor
50	203083_at	THBS2	NM_003247	thrombospondin 2
51	203180_at	ALDH1A3	NM_000693	aldehyde dehydrogenase 1 family, mem. A3
52	203228_at	PAFAH1B3	NM_002573	platelet-activating factor acetylhydrolase,
				isoform lb, γ sub
53	203256_at	CDH3	NM_001793	cadherin 3, type 1, P-cadherin (placental)
54	203349_s_at	ETV5	NM_004454	ets variant gene 5 (ets-related molecule)
55	203352_at	ORC4L	NM_002552	origin recognition complex, subunit 4-like
56	203354_s_at		NM_015310
57	203381_s_at		NM_000041
58	203382_s_at	APOE	NM_000041	apolipoprotein E
59	203407_at	PPL	NM_002705	periplakin
60	203417_at	MFAP2	NM_017459	microfibrillar-associated protein 2, tran var 1
61	203438_at		NM_003714	stanniocalcin 2
62	203453_at	SCNN1A	NM_001038	sodium channel, nonvoltage-gated 1 α
63	203499_at	EPHA2	NM_004431	EphA2
64	203548_s_at		NM_000237	lipoprotein lipase
65	203570_at	LOXL1	NM_005576	lysyl oxidase-like 1
66	203632_s_at	GPRC5B	NM_016235	G protein-coupled rec, fam C, group 5, mem B
67	203673_at	TG	NM_003235	thyroglobulin
68	203699_s_at		NM_013989	type II iodothyronine deiodinase
69	203700_s_at	DIO2	NM_013989	deiodinase, iodothyronine, type II, tran var 1
70	203786_s_at	TPD52L1	NM_003287	tumor protein D52-like 1
71	203851_at	IGFBP6	NM_002178	insulin-like growth factor binding protein 6
72	203854_at	IF	NM_000204	I factor (complement)
73	203859_s_at	PALM	NM_002579	paralemmin
74	203875_at		NM_003069	SWISNF related, matrix assoc, actin dep
				regulator of chromatin subfam a mem 1
75	203881_s_at		NM_004010	dystrophin, includes DXS142, DXS164,
				DXS206, DXS230, DXS239, DXS268,
				DXS269, DXS270, DXS272 (DMD), transcript
				variant Dp427p2
76	203889_at	SGNE1	NM_003020	secretory granule, neuroendocrine protein 1
77	203911_at	RAP1GA1	NM_002885	RAP1, GTPase activating protein 1
78	203934_at	KDR	NM_002253	kinase insert domain receptor
79	203986_at	GENX-3414	NM_003943	genethonin 1
80	204105_s_at	NRCAM	NM_005010	neuronal cell adhesion molecule
81	204124_at	NaPi-IIb	AF146796	Na dependent phosphate transporter isoform
82	204149_s_at	GSTM4	NM_000850	glutathione S-transferase M4
83	204152_s_at		AI738965	manic fringe (Drosophila) homolog
84	204154_at	CDO1	NM_001801	cysteine dioxygenase, type I
85	204259_at	MMP7	NM_002423	matrix metalloproteinase 7 (matrilysin, uterine)
86	204260_at	CHGB	NM_001819	chromogranin B (secretogranin 1)
87	204268_at	S100A2	NM_005978	S100 calcium-binding protein A2
88	204288_s_at	ARGBP2	NM_021069	ArgAbl-interacting prot ArgBP2, trans var 2
89	204298_s_at	LOX	NM_002317	lysyl oxidase
90	204337_at		NM_005613	regulator of G-protein signalling 4
91	204416_x_at	APOC1	NM_001645	apolipoprotein C-I
92	204424_s_at		NM_018640	neuronal specific transcription factor DAT1
93	204433_s_at		NM_006038	spermatogenesis associated PD1
94	204442_x_at	LTBP4	NM_003573	latent transforming GFβ binding protein 4
95	204452_s_at		NM_003505	frizzled 1
96	204476_s_at	PC	NM_022172	pyruvate carboxylase
97	204503_at	EVPL	NM_001988	envoplakin
98	204591_at	CHL1	NM_006614	cell adhesion molecule w/ homology to
				L1CAM homolog L1
99	204600_at	EPHB3	NM_004443	EphB3
100	204623_at	TFF3	NM_003226	trefoil factor 3 (intestinal)
101	204625_s_at		NM_000212	integrin, β 3 (platelet glycoprotein IIIa, CD61)
102	204697_s_at	CHGA	NM_001275	chromogranin A
103	204741_at	BICD1	NM_001714	Bicaudal D (Drosophila) homolog 1
104	204753_s_at	HLF	NM_002126	hepatic leukemia factor
105	204754_at	HLF	NM_002126	hepatic leukemia factor
106	204755_x_at	HLF	NM_002126	hepatic leukemia factor
107	204787_at	Z39IG	NM_007268	Ig superfamily protein
108	204797_s_at	EMAPL	NM_004434	echinoderm microtubule-associated pro-like
109	204869_at		AL031664	DNA seq RP4-531H16 chrom 20p11.22-12
110	204870_s_at	PCSK2	NM_002594	proprotein convertase subtilisinkexin type 2
111	204933_s_at	TNFRSF11B	NM_002546	TNFR superfamily, member 11b
112	204934_s_at	HPN	NM_002151	hepsin (transmembrane protease, serine 1)
113	204944_at	PTPRG	NM_002841	protein tyrosine phosphatase receptor type G
114	204964_s_at	SSPN	NM_005086	sarcospan (Kras oncogene-associated gene)
115	204975_at	EMP2	NM_001424	epithelial membrane protein 2
116	204990_s_at	ITGB4	NM_000213	integrin, beta 4
117	205051_s_at	KIT	NM_000222	v-kit Hardy-Zuckerman 4 feline sarcoma viral
				oncogene homolog
118	205110_s_at	FGF13	NM_004114	fibroblast growth factor 13
119	205153_s_at	TNFRSF5	NM_001250	TNFR superfamily, mem 5
120	205168_at	DDR2	NM_006182	discoidin domain receptor family, member 2
121	205258_at	INHBB	NM_002193	inhibin, β B (activin AB β polypeptide)
122	205286_at		NM_003222	transcription factor AP-2 gamma
123	205325_at	KIAA0273	NM_014759	KIAA0273 gene product
124	205336_at	PVALB	NM_002854	parvalbumin
125	205402_x_at	PRSS2	NM_002770	protease, serine, 2 (trypsin 2)
126	205413_at	C11ORF8	NM_001584	chromosome 11 open reading frame 8
127	205455_at	MST1R	NM_002447	macrophage stimulating 1 receptor
128	205470_s_at	KLK11	NM_006853	kallikrein 11
129	205479_s_at	PLAU	NM_002658	plasminogen activator, urokinase
130	205481_at	ADORA1	NM_000674	adenosine A1 receptor
131	205485_at	RYR1	NM_000540	ryanodine receptor 1 (skeletal)
132	205490_x_at	connexin 31	NM_024009	gap junction protein, beta 3, 31 kD
133	205531_s_at	GA	NM_013267	breast cell glutaminase
134	205593_s_at	PDE9A	NM_002606	phosphodiesterase 9A
135	205614_x_at	MST1	NM_020998	macrophage stimulating 1
136	205627_at		NM_001785	cytidine deaminase
137	205639_at		NM_001637	acyloxyacyl hydrolase
138	205683_x_at	TPSB1	NM_003294	tryptase beta 1
139	205689_at	KIAA0435	NM_014801	KIAA0435 gene product
140	205700_at	RODH	NM_003725	oxidative 3 α hydroxysteroid dehydrogenase;
				retinol dehydrogenase; 3-hydroxysteroid
				epimerase
141	205710_at	LRP2	NM_004525	low density lipoprotein-related protein 2
142	205715_at	BST1	NM_004334	bone marrow stromal cell antigen 1
143	205717_x_at		NM_002588	protocadherin gamma subfamily C, 3
144	205728_at		AL022718	DNA seq from clone 1052M9 on chrom Xq25
145	205747_at	CBLN1	NM_004352	cerebellin 1 precursor
146	205778_at	KLK7	NM_005046	kallikrein 7 (chymotryptic, stratum corneum)
147	205858_at	NGFR	NM_002507	nerve growth factor receptor
148	205927_s_at	CTSE	NM_001910	cathepsin E
149	205980_s_at	ARHGAP8	NM_015366	Rho GTPase activating protein 8
150	206002_at	GPR64	NM_005756	G protein-coupled receptor 64
151	206114_at	EPHA4	NM_004438	EphA4
152	206390_x_at		NM_002619	platelet factor 4
153	206594_at	KIAA0135	NM_015148	KIAA0135 protein
154	206595_at	CST6	NM_001323	cystatin EM
155	206714_at	ALOX15B	NM_001141	arachidonate 15-lipoxygenase, second type
156	206757_at	PDE5A	NM_001083	phosphodiesterase 5A, cGMP-specific
157	206866_at	CDH4	NM_001794	cadherin 4, type 1, R-cadherin (retinal)
158	206884_s_at	SCEL	NM_003843	sciellin
159	206912_at	FOXE1	NM_004473	forkhead box E1 (thyroid transcription factor2)
160	207111_at		NM_001974	egf-like module cont., mucin-like, hormone
				rec-like seq 1
161	207144_s_at	CITED1	NM_004143	Cbpp300-interacting transactivator, with
				GluAsp-rich carboxy-terminal domain, 1
162	207173_x_at		NM_001797	OB-cadherin-1
163	207674_at	FCAR	NM_002000	Fc fragment of IgA
164	207695_s_at	IGSF1	NM_001555	immunoglobulin superfamily, member 1
165	207795_s_at	CD94	AB009597
166	207826_s_at	ID3	NM_002167	inhibitor of DNA binding 3, dominant negative
				helix-loop-helix protein
167	207923_x_at	PAX8	NM_013953	paired box gene 8
168	208396_s_at	PDE1A	NM_005019	phosphodiesterase 1A, calmodulin-dependent
169	208451_s_at	C4B	NM_000592	complement component 4B
170	208712_at	PRAD1	M73554	cyclinD1
171	208747_s_at		NM_001734	subcomponent C1s, α- and β-chains
172	209021_x_at		BC001331	Similar to KIAA0652 gene product
173	209035_at		NM_002391	midkine
174	209071_s_at		AF159570	regulator of G-protein signalling 5
175	209079_x_at		AF152318	protocadherin gamma A1
176	209173_at		NM_006408	putative secreted protein XAG
177	209208_at		NM_004870	clone 015e11 My008 protein
178	209228_x_at		NM_006765	Putative prostate cancer tumor suppressor
179	209270_at	LAMB3	NM_000228	laminin S B3 chain
180	209280_at		NM_006039	chromosome 17 unknown product mRNA
181	209291_at		NM_001546	inhibitor of DNA binding 4, dominant negative
				helix-loop-helix protein
182	209297_at	ITSN	AF114488	intersectin short isoform
183	209335_at		AI281593
184	209365_s_at	ECM1	NM_004425	extracellular matrix protein 1
185	209386_at		AI346835	transmembrane 4 superfamily member 1
186	209485_s_at	ORP1	AF274714	oxysterol-binding protein-related protein
187	209496_at		BC000069	retinoic acid receptor responder 2
188	209505_at		NM_005654	nuclear receptor subfam 2, group F, mem 1
189	209506_s_at		BC004154	nuclear receptor subfam 2, group F, mem 1
190	209529_at		AF047760	phosphatidic acid phosphohydrolase type-2c
191	209596_at		AF245505	adlican
192	209598_at	KIAA0883	AB020690	KIAA0883 protein
193	209652_s_at		BC001422	Similar to placental growth factor, vascular
				endothelial growth factor-related protein
194	209691_s_at		BC003541	hypothetical protein FLJ10488
195	209739_s_at		AI814551	GS2 gene
196	209772_s_at		X69397	cell surface antigen
197	209781_s_at	T-Star	AF069681	T-Star
198	209792_s_at		BC002710	kallikrein 10
199	209810_at	SP-B	J02761	pulmonary surfactant-associated protein B
200	209897_s_at		AF055585	neurogenic extracellular slit protein Slit2
201	209924_at		AB000221	small inducible cytokine subfamily A (Cys-
				Cys), mem18, pulmonary/activation-reg
202	209946_at		U58111	FLT4 ligand
203	209990_s_at		NM_005458	GABA-B receptor
204	210051_at	cAMP-GEFI	U78168	cAMP-regulated guanine nucleotide exchange
				factor I
205	210055_at		NM_000369	thyroid stimulating hormone receptor
206	210072_at		NM_006274	beta chemokine Exodus-3
207	210078_s_at		L39833	K+ channel beta subunit
208	210096_at		NM_000779	lung cytochrome P450 (IV subfamily) BI
209	210298_x_at	FHL1	AF098518	four and 1/2 LIM domains1 protein isoform B
210	210321_at		M36118	cytotoxin serine protease-C
211	210342_s_at	TPO	NM_000547	thyroid peroxidase
212	210372_s_at	TPD52L2	AF208012	tumor protein D52-like 2
213	210397_at		U73945	beta-defensin-1
214	210401_at		U45448	P2 × 1 receptor
215	210471_s_at		U33428	K+ channel β 1a subunit mRNA, alt spliced
216	210473_s_at	p58GTA	M37712	galactosyltransferase assoc protein kinase
217	210605_s_at		BC003610	Similar to milk fat globule-EGF factor 8
218	210640_s_at	GPCR-Br	U63917	G protein coupled receptor
219	210660_at	LIR-6	AF025529	leucocyte immunoglobulin-like receptor-6b
220	210727_at		NM_001741	Calcitonin, calcitonincalcitonin-rel polypeptide, α
221	210762_s_at	HP	NM_006094	HP protein
222	210809_s_at		D13665	osf-2 mRNA for osteoblast specific factor 2
223	210827_s_at	ESE-1	U73844	epithelial-specific transcription factor ESE-1a
224	211100_x_at		U82278	immunoglobulin-like transcript 1c
225	211101_x_at		U82276	immunoglobulin-like transcript 1a
226	211102_s_at		U82277	immunoglobulin-like transcript 1b
227	211161_s_at		AF130082	collagen, type III, alpha 1
228	211217_s_at		AF051426	slow delayed rectifier channel subunit
229	211538_s_at		U56725	heat shock 70 kD protein 2
230	211564_s_at		BC003096	Similar to LIM domain protein
231	211679_x_at	GABBR2	AF095784	GABA-B receptor R2
232	211813_x_at		AF138303	decorin D
233	211959_at	IGFBP5	AW007532	insulin-like growth factor binding protein 5
234	211964_at		AK025912	type IV collagen alpha (2) chain
235	212067_s_at		AL573058	complement component 1, r subcomponent
236	212253_x_at	KIAA0728	BG253119	KIAA0728 protein
237	212294_at		BG111761	DKFZp586B0918
238	212328_at	KIAA1102	AB029025	KIAA1102 protein
239	212344_at	KIAA1077	AW043713	KIAA1077 protein
240	212353_at	KIAA1077	AI479175	KIAA1077 protein
241	212354_at	KIAA1077	BE500977	KIAA1077 protein
242	212464_s_at	FN	X02761	fibronectin precursor
243	212724_at		NM_005168	ras homolog gene family, member E
244	212738_at		AV717623
245	212775_at		AI978623	KIAA0657 protein
246	212803_at		NM_005967	NGFI-A binding protein 2
247	212806_at	KIAA0367	AL138349	KIAA0367 protein
248	212850_s_at		AA584297	low density lipoprotein receptor-rel protein 4
249	212865_s_at		BF449063	collagen, type XIV, alpha 1 (undulin)
250	212912_at		AI992251	Ribosomal pro S6 kinase, 90 kDa, polypep 2
251	212992_at		AI935123
252	213029_at		AL110126	DKFZp564H1916
253	213306_at		AA917899	multiple PDZ domain protein
254	213381_at		N91149	DKFZp586M2022
255	213423_x_at		AI884858	Putative prostate cancer tumor suppressor
256	213553_x_at		W79394	apolipoprotein C-I
257	213668_s_at		AI989477	SRY (sex determining region Y)-box 4
258	213693_s_at		AI610869	mucin 1, transmembrane
259	213800_at		X04697	complement factor H 38-kDa N-term frag
260	213904_at		AL390170	DKFZp547E184
261	213924_at	FLJ11585	BF476502	hypothetical protein FLJ11585
262	214023_x_at		AL533838	tubulin, beta polypeptide
263	214175_x_at		AI254547	LIM domain protein
264	214239_x_at	Mel-18	AI560455	Zinc finger protein 144
265	214307_at		AI478172	homogentisate 1,2-dioxygenase
266	214434_at	KIAA0417	AB007877	KIAA0417 gene product
267	214632_at		NM_003872	neuropilin 2
268	214680_at		BF674712	neurotrophic tyrosine kinase receptor 2
269	214702_at	MSF-FN70	AJ276395	migration stimulation factor FN70
270	214763_at	FLJ13875	AK023937	FLJ13875
271	214803_at		BF344237	DKFZp564N1116
272	214955_at		AI912086	DNA seq clone 1170K4 chrom 22q12.2-13.1
273	214977_at	FLJ13790	AK023852	FLJ13790
274	215016_x_at	KIAA0728	BC004912	KIAA0728 protein
275	215034_s_at	FLJ13302	AI189753	FLJ13302
276	215076_s_at	FLJ11428	AU144167	FLJ11428
277	215243_s_at	GJB3	AF099730	connexin 31
278	215388_s_at		X56210	complement Factor H-related protein 1
279	215442_s_at		BE740743	thyroid stimulating hormone receptor
280	215443_at		BE740743	thyroid stimulating hormone receptor
281	215506_s_at		AK021882	highly sim to putative tumor sup NOEY2
282	215536_at		X87344	DMA, DMB, HLA-Z1, IPP2, LMP2, TAP1,
				LMP7, TAP2, DOB, DQB2 and RING8, 9, 13,
				14 genes
283	216356_x_at	KIAA0734	AB018277	KIAA0734 protein
284	216470_x_at		AF009664	T cell receptor β locus, 3 trypsinogen repeats
285	216569_at	FABP3-ps	U72237	fatty acid-binding protein pseudogene
286	217546_at		R06655
287	217561_at		BF447272
288	217592_at		AV684859
289	217767_at		NM_000064
290	217820_s_at	FLJ10773	NM_018212	hypothetical protein FLJ10773
291	217875_s_at	TMEPAI	NM_020182	transmem, prostate androgen induced RNA
292	218002_s_at	SCYB14	NM_004887	small inducible cytokine subfam B (Cys-X-
				Cys), mem 14 (BRAK)
293	218182_s_at	CLDN1	NM_021101	claudin 1
294	218353_at		NM_025226	MSTP032 protein
295	218368_s_at	FN14	NM_016639	type I transmembrane protein Fn14
296	218418_s_at		NM_015493	DKFZP434N161
297	218469_at	CKTSF1B1	NM_013372	Cys knot superfamily 1, BMP antagonist 1
298	218537_at	FLJ20568	NM_017885	hypothetical protein FLJ20568
299	218546_at	FLJ14146	NM_024709	hypothetical protein FLJ14146
300	218613_at		NM_018422	hypothetical protein DKFZp761K1423
301	218653_at	SLC25A15	NM_014252	solute carrier family 25 (mitochondrial carrier;
				ornithine transporter) member 15
302	218691_s_at	RIL	NM_003687	reversion-induced LIM protein
303	218844_at	FLJ20920	NM_025149	hypothetical protein FLJ20920
304	218856_at	LOC51323	NM_016629	hypothetical protein LOC51323
305	218952_at	SAAS	NM_013271	granin-like neuroendocrine peptide precursor
306	218960_at	TMPRSS4	NM_016425	transmembrane protease, serine 4
307	219010_at	FLJ10901	NM_018265	hypothetical protein FLJ10901
308	219127_at	MGC11242	NM_024320	hypothetical protein MGC11242
309	219191_s_at	BIN2	NM_016293	bridging integrator 2
310	219195_at	PPARGC1	NM_013261	peroxisome proliferative activated receptor, γ,
				coactivator 1
311	219211_at	USP18	NM_017414	ubiquitin specific protease 18
312	219277_s_at	FLJ10851	NM_018245	hypothetical protein FLJ10851
313	219331_s_at	FLJ10748	NM_018203	hypothetical protein FLJ10748
314	219416_at	CSR1	NM_016240	CSR1 protein
315	219436_s_at	LOC51705	NM_016242	endomucin-2
316	219440_at	RAI2	NM_021785	retinoic acid induced 2
317	219463_at	HS1119D91	NM_012261	sim to S68401 (cattle) glucose induced gene
318	219476_at	MGC4309	NM_024115	hypothetical protein MGC4309
319	219525_at	FLJ10847	NM_018242	hypothetical protein FLJ10847
320	219527_at	FLJ20605	NM_017898	hypothetical protein FLJ20605
321	219561_at	LOC51226	NM_016429	COPZ2 for nonclathrin coat protein zeta-COP
322	219596_at	LOC56906	NM_020147	hyp protein from EUROIMAGE 511235
323	219597_s_at	DUOX1	NM_017434	dual oxidase 1
324	219743_at	HEY2	NM_012259	hairyenhancer-of-split rel with YRPW motif 2
325	219749_at	FLJ20967	NM_022071	hypothetical protein FLJ20967
326	219836_at	MGC10796	NM_024508	hypothetical protein MGC10796
327	219855_at	FLJ10628	NM_018159	hypothetical protein FLJ10628
328	219856_at	MGC2742	NM_023938	hypothetical protein MGC2742
329	219926_at	POP3	NM_022361	popeye protein 3
330	219932_at	VLCS-H1	NM_014031	v long-chain acyl-CoA synthetase homolog 1
331	219958_at	FLJ11190	NM_018354	hypothetical protein FLJ11190
332	220034_at		NM_007199	interleukin-1 receptor-associated kinase M
333	220108_at	GNA14	NM_004297	guanine nucl binding protein (G protein), α 14
334	220332_at	CLDN16	NM_006580	claudin 16
335	220595_at	DKFZp434B0417	NM_013377	hypothetical protein DKFZp434B0417
336	220751_s_at	C5ORF4	NM_016348	chromosome 5 open reading frame 4
337	221009_s_at	PGAR	NM_016109	PPAR(gamma) angiopoietin related protein
338	221073_s_at	NOD1	NM_006092	caspase recruitment domain 4
339	221147_x_at	WWOX	NM_018560	WW domain-containing oxidoreductase
340	221266_s_at	LOC81501	NM_030788	DC-specific transmembrane protein
341	221270_s_at	TGT	NM_031209	tRNA-guanine transglycosylase
342	221489_s_at		AF227517	sprouty (Drosophila) homolog 4
343	221577_x_at		AF003934	prostate differentiation factor
344	221636_s_at		AL136931	DKFZp586G2122
345	221701_s_at		AF352728	STRA6 isoform 1 mRNA, alternatively spliced
346	221724_s_at		AF200738	C-type lectin DDB27 short form
347	221795_at		AI346341	Similar to hypothetical protein FLJ20093
348	221796_at		AA707199	Similar to hypothetical protein FLJ20093
349	221799_at	KIAA1402	AB037823	KIAA1402 protein
350	221870_at		AI417917	FLJ22356 fis
351	221900_at		AI806793	collagen, type VIII, alpha 2
352	221928_at		AI057637	Weakly sim to 2109260A B cell growth factor
353	221959_at		BE672313	highly sim to HSU79298 Human clone 23803
354	32128_at		Y13710	alternative activated macrophage specific CC
				chemokine 1
355	37004_at	SP-B	J02761	pulmonary surfactant-associated protein B
356	37117_at		Z83838	GTPase-activating protein sim to rhoGAP
				protein. ribosomal protein L6 pseudogene
357	37152_at		L07592	peroxisome proliferator activated receptor
358	37408_at	KIAA0709	AB014609	KIAA0709 protein
359	38691_s_at	SP5	J03553	pulmonary surfactant protein
360	45297_at		AI417917
361	63305_at		D81792
362	823_at		HSU84487	CX3C chemokine precursor, alt spliced
363	91920_at		AI205180
364				SGENE forward primer
365				SGENE reverse primer
366				SGENE probe
367				TESTICAN1 forward primer
368				TESTICAN1 reverse primer
369				TESTICAN1 probe
370				GABRE forward primer
371				GABRE reverse primer
372				GABRE probe
373				CDH3 forward primer
374				CDH3 reverse primer
375				CDH3 probe
376				FN1 forward primer
377				FN1 reverse primer
378				FN1 probe
379				TPO-1 forward primer
380				TPO-1 reverse primer
381				TPO-1 probe
382				TPO-2 forward primer
383				TPO-2 reverse primer
384				TPO-2 probe
385				KCNAB1-1 forward primer
386				KCNAB1-1 reverse primer
387				KCNAB1-1 probe
388				KCNAB1-2 forward primer
389				KCNAB1-2 reverse primer
390				KCNAB1-2 probe
391				FABP4-1 forward primer
392				FABP4-1 reverse primer
393				FABP4-1 probe
394				FABP4-2 forward primer
395				FABP4-2 reverse primer
396				FABP4-2 probe
397				DOI1-1 forward primer
398				DOI1-1 reverse primer
399				DOI1-1 probe
400				DOI1-2 forward primer
401				DOI1-2 reverse primer
402				DOI1-2 probe
403				B-ACTIN forward primer
404				B-ACTIN reverse primer
405				B-ACTIN probe
406				GOLGIN67 forward primer
407				GOLGIN67 reverse primer
408				GOLGIN67 probe
409				PAX8 forward primer
410				PAX8 reverse primer
411				PAX8 probe
412				HERC forward primer
413				HERC reverse primer
414				HERC probe
415				DDIT3 forward primer
416				DDIT3 reverse primer
417				DDIT3 probe
418				ITM1 forward primer
419				ITM1 reverse primer
420				ITM1 probe
421				C1OF24 forward primer
422				C1OF24 reverse primer
423				C1OF24 probe
424				MOT8 forward primer
425				MOT8 reverse primer
426				MOT8 probe
427				ARG2 forward primer
428				ARG2 reverse primer
429				ARG2 probe

Claims

1. A method of diagnosing thyroid cancer comprising the steps: a. obtaining a biological sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.

2. A method of differentiating between thyroid carcinoma and benign thyroid diseases comprising the steps: a. obtaining a sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.

3. A method of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples comprising the steps: a. obtaining a sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.

4. A method of determining thyroid cancer patient treatment protocol comprising the steps: a. obtaining a biological sample from a thyroid cancer patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommended to treat the disease.

5. A method of treating a thyroid cancer patient comprising the steps: a. obtaining a biological sample from a thyroid cancer patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and c. treating the patient with thyroidectomy if they are cancer positive.

6. The method of one of claims 1-5 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.

7. The method of one of claims 1-5 wherein the SEQ ID NOs. are 199, 207, 255 and 354.

8. The method of one of claims 1-5 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.

9. The method of one of claims 1-5 wherein the sample is prepared by a method are selected from the group consisting of fine needle aspiration, bulk tissue preparation and laser capture microdissection.

10. The method of claim 9 wherein the bulk tissue preparation is obtained from a biopsy or a surgical specimen.

11. The method of one of claims 1-5 further comprising measuring the expression level of at least one gene encoding mRNA: a. corresponding to SEQ ID NOs: 142, 219 and 309; and/or b. corresponding to SEQ ID NOs: 9, 12 and 18; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 130, 190 and 276 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25.

12. The method of one of claims 1-5 further comprising measuring the expression level of at least one gene constitutively expressed in the sample.

13. The method of one of claims 1-5 wherein the specificity is at least about 40%.

14. The method of one of claims 1-5 wherein the specificity is at least about 50%.

15. The method of one of claims 1-5 wherein the specificity is at least about 60%.

16. The method of one of claims 1-5 wherein the sensitivity is at least at least about 90%.

17. The method of one of claims 1-5 wherein the sensitivity is at least at least about 92%.

18. The method of one of claims 1-5 wherein the comparison of expression patterns is conducted with pattern recognition methods.

19. The method of claim 18 wherein the pattern recognition methods include the use of a Cox proportional hazards analysis.

20. The method of one of claims 1-5 wherein the pre-determined cut-off levels are at least about 1.5-fold over- or under-expression in the sample relative to benign cells or normal tissue.

21. The method of one of claims 1-5 wherein the pre-determined cut-off levels have at least a statistically significant p-value over-expression in the sample having thyroid carcinoma cells relative to benign cells or normal tissue.

22. The method of claim 21 wherein the p-value is less than about 0.05.

23. The method of one of claims 1-5 wherein gene expression is measured on a microarray or gene chip.

24. The method of claim 23 wherein the microarray is a cDNA array or an oligonucleotide array.

25. The method of claim 24 wherein the microarray or gene chip further comprises one or more internal control reagents.

26. The method of one of claims 1-5 wherein gene expression is determined by nucleic acid amplification conducted by polymerase chain reaction (PCR) of RNA extracted from the sample.

27. The method of claim 26 wherein said PCR is reverse transcription polymerase chain reaction (RT-PCR).

28. The method of claim 27, wherein the RT-PCR further comprises one or more internal control reagents.

29. The method of claim 28, wherein the internal control reagent is a method of detecting PAX8 gene expression

30. The method of claim 29, wherein PAX8 gene expression is measured using SEQ ID NOs: 409-411.

31. The method of one of claims 1-5 wherein gene expression is detected by measuring or detecting a protein encoded by the gene.

32. The method of claim 31 wherein the protein is detected by an antibody specific to the protein.

33. The method of one of claims 1-5 wherein gene expression is detected by measuring a characteristic of the gene.

34. The method of claim 33 wherein the characteristic measured is selected from the group consisting of DNA amplification, methylation, mutation and allelic variation.

35. A method of cross validating a gene expression profile for thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance.

36. The method according to claim 35 wherein the gene expression data obtained in step h. is represented by genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or b. recognized specifically by the probe sets selected from the group consisting of psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.

37. A method of independently validating a gene expression profile for thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. normalizing the source variabilities in the gene expression data; c. computing for factor of interest on all variables that were selected previously; and d. testing the prediction model on the sample and record classification performance.

38. The method according to claim 37 wherein the gene expression data obtained in step d. is represented by genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or b. recognized specifically by the probe sets selected from the group consisting of psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.

39. A gene profile obtained by the method according to claim 37 or 38.

40. A method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. applying linear discrimination analysis to the data to obtain selected genes; c. applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score.

41. The method according to claim 40, wherein the linear discriminant analysis is calculated using the equation:

42. A method of generating a thyroid carcinoma prognostic patient report comprising the steps: a. obtaining a biological sample from the patient; b. measuring gene expression of the sample; c. applying a Relapse Hazard Score to the results of step b.; and d. using the results obtained in step c. to generate the report.

43. The method of claim 42 wherein the report contains an assessment of patient outcome and/or probability of risk relative to the patient population.

44. A patient report generated by the method according to claim 42.

45. A composition comprising at least one probe set selected from the group consisting of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

46. A kit for conducting an assay to determine thyroid carcinoma prognosis in a biological sample comprising: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

47. The kit of claim 46 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.

48. The kit of claim 46 wherein the SEQ ID NOs. are 199, 207, 255 and 354.

49. The kit of claim 46 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.

50. The kit of claim 46 further comprising reagents for conducting a microarray analysis.

51. The kit of claim 46 further comprising a medium through which said nucleic acid sequences, their complements, or portions thereof are assayed.

52. Articles for assessing thyroid carcinoma status comprising: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.

53. The articles of claim 52 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.

54. The articles of claim 52 wherein the SEQ ID NOs. are 199, 207, 255 and 354.

55. The articles of claim 52 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.

56. The articles of claim 52 further comprising reagents for conducting a microarray analysis.

57. The articles of claim 52 further comprising a medium through which said nucleic acid sequences, their complements, or portions thereof are assayed.

58. A microarray or gene chip for performing the method of one of claims 1-5.

59. The microarray of claim 58 comprising isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma or risk of relapse in a biological sample.

60. The microarray of claim 59 wherein the measurement or characterization is at least about 1.5-fold over- or under-expression.

61. The microarray of claim 59 wherein the measurement provides a statistically significant p-value over- or under-expression.

62. The microarray of claim 59 wherein the p-value is less than about 0.05.

63. The microarray of claim 59 comprising a cDNA array or an oligonucleotide array.

64. The microarray of claim 59 further comprising or more internal control reagents.

65. A diagnostic/prognostic portfolio comprising isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample.

66. The portfolio of claim 65 wherein the measurement or characterization is at least about 1.5-fold over- or under-expression.

67. The portfolio of claim 65 wherein the measurement provides a statistically significant p-value over- or under-expression.

68. The portfolio of claim 65 wherein the p-value is less than about 0.05.