Thyroid fine needle aspiration molecular assay

Information

  • Patent Application
  • 20070037186
  • Publication Number
    20070037186
  • Date Filed
    May 16, 2006
    19 years ago
  • Date Published
    February 15, 2007
    18 years ago
Abstract
The present invention relates to methods, compositions and articles directed to diagnosing thyroid carcinoma, differentiating between thyroid carcinoma and benign thyroid diseases, testing indeterminate thyroid fine needle aspirate samples of thyroid nodules, and determining patient protocols and outcomes.
Description
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

No government funds were used to make this invention.


REFERENCE TO SEQUENCE LISTING, OR A COMPUTER PROGRAM LISTING COMPACT DISK APPENDIX

Reference to a “Sequence Listing,” a table, or a computer program listing appendix submitted on a compact disc and an incorporation by reference of the material on the compact disc including duplicates and the files on each compact disc are hereby specified.


BACKGROUND OF THE INVENTION

This application claims the benefit of U.S. Provisional Application No. 60/683,173, filed May 20, 2005.


There are approximately 25,600 new cases of thyroid carcinoma diagnosed in the United States each year, and 1,400 patients will die of the disease. About 75% of all thyroid cancers belong to the papillary thyroid carcinoma type. The rest consist of 10% follicular carcinoma, 5% to 9% medullary thyroid cancer, 1% to 2% anaplastic cancer, 1% to 3% lymphoma, and less than 1% sarcoma and other rare tumors. Usually a lump (nodule) in the thyroid is the first sign of thyroid cancer. There are 10 to 18 million people in US with a single thyroid nodule, and approximately 490,000 become clinically apparent each year. Fortunately only about 5% of these nodules are cancerous.


The commonly used method for thyroid cancer diagnosis is fine needle aspiration (FNA) biopsy. FNA samples are examined cytologically to determine whether the nodules are benign or cancerous. The sensitivity and specificity of FNA range from 68% to 98%, and 72% to 100% respectively, depending on institutions and doctors. Unfortunately, in 25% of the cases the specimens are either inadequate for diagnosis or indeterminable by cytology. In current medical practice, patients with indeterminate results are sent to surgery, with consequence that only 25% have cancer and 75% end up with unnecessary surgery. A molecular assay with high sensitivity and a better specificity (higher than 25%) would greatly improve current diagnostic accuracy of thyroid cancer, and omit unnecessary surgery for non-cancerous patients.


Comparative genomic hybridization (CGH), serial analysis of gene expression (SAGE), and DNA microarray have been used to identify genetic events occurring in thyroid cancers such as loss of heterozygosity, up and down gene regulation, and genetic rearrangements. PAX8 and PPARγ genetic rearrangement event has been demonstrated to be associated with follicular thyroid cancer (FTC). Rearrangement of the ret proto-oncogene is related to papillary thyroid cancer (PTC). Down-regulation of thyroid peroxidase (TPO) gene is observed in both FTC and PTC. Galectin-3 was reported to be a candidate marker to differentiate malignant thyroid neoplasms from benign lesions. However, there are other studies demonstrating that Galectin-3 is not a cancer-specific marker. Many genes purported to be useful in thyroid cancer diagnosis lack the sensitivity and specificity required for an accurate molecular assay.


SUMMARY OF THE INVENTION

The present invention encompasses methods of diagnosing thyroid cancer by obtaining a biological sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.


The present invention encompasses methods of differentiating between thyroid carcinoma and benign thyroid diseases by obtaining a sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.


The present invention encompasses methods of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below predetermined cut-off levels are indicative of thyroid cancer.


The present invention encompasses methods of determining thyroid cancer patient treatment protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommend to treat the disease.


The present invention encompasses methods of treating a thyroid cancer patient by obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and treating the patient with a thyroidectomy if they are cancer positive.


The present invention encompasses methods of cross validating a gene expression profile for thyroid carcinoma patients by: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance.


The present invention encompasses methods of independently validating a gene expression profile and gene profiles obtained thereby for thyroid carcinoma patients by obtaining gene expression data from a statistically significant number of patient biological samples; normalizing the source variabilities in the gene expression data; computing for factor of interest on all variables that were selected previously; and testing the prediction model on the sample and record classification performance.


The present invention encompasses a method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients by: obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; and applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score.


The present invention encompasses methods of generating a thyroid carcinoma prognostic patient report and reports obtained thereby, by obtaining a biological sample from the patient; measuring gene expression of the sample; applying a posterior probability thereto; and using the results obtained thereby to generate the report.


The present invention encompasses compositions containing at least one probe set selected from the group consisting of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.


The present invention encompasses kits for conducting an assay to determine thyroid carcinoma diagnosis in a biological sample containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.


The present invention encompasses articles for assessing thyroid carcinoma status containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.


The present invention encompasses microarrays or gene chips for performing the methods provided herein.


The present invention encompasses diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample.




BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 is an ROC curve of the LOOCV of the 4-gene signature in 98 training samples.



FIG. 2 is an ROC curve of the 5-gene signature in 98 training samples.



FIG. 3
a is an ROC curve of the 4-gene signature in 74 independent validation samples; 3b is an ROC curve of the 5-gene signature in 74 independent validation samples.



FIG. 4
a is an ROC curve of the 4-gene signature that is normalized to the three-thyroid control genes; 4b is an ROC curve of the 5-gene signature that is normalized to the three-thyroid control genes.



FIG. 5
a is an ROC curve of the 4-gene signature with one-round amplification in 47 thyroid samples; 5b is an ROC curve of the 4-gene signature with two-round amplification in 47 thyroid samples; 5c is an ROC curve of the 5-gene signature with one-round amplification in 47 thyroid samples; 5d is an ROC curve of the 5-gene signature with two-round amplification in 47 thyroid samples.



FIGS. 6
a and 6b depict the ROC curves for cross validation with the 83 independent fresh frozen thyroid samples.



FIGS. 7
a and 7b depict the ROC curves for signature validation with the 47 fine needle aspirate (FNA) thyroid samples.



FIGS. 8
a and 8b depict the ROC curves for signature performance in 28 paired fresh frozen and FNA thyroid samples.




DETAILED DESCRIPTION

In this study the goal was to identify signatures that can be used in assays such as DNA chip-based assay to differentiate thyroid carcinomas from benign thyroid diseases. 31 primary papillary thyroid tumors, 21 follicular thyroid cancers, 33 follicular adenoma samples, and 13 benign thyroid diseases were analyzed by using the Affymetrix human U133A Gene Chip. Comparison of gene expression profiles between thyroid cancers and benign tissues has enabled us to identify two signatures: a 5-gene signature identified by percentile analysis and manual selection, and a 4-gene signature selected by Linear Discrimination Analysis (LDA) approach. These two signatures have the performance of sensitivity/specificity 92%/70% and 92%/61%, respectively, and have been validated in 74 independent thyroid samples. The results presented herein demonstrate that these candidate signatures facilitate the diagnosis of thyroid cancers with better sensitivity and specificity than currently available diagnostic procedures. These two signatures are suitable for use in testing indeterminate FNA samples.


By performing gene profiling on 98 representative thyroid benign and tumor samples on Affymetrix U133a chips, we have selected two gene signatures, a 5-gene signature and a 4-gene signature, for thyroid FNA molecular assay. Signatures were selected to achieve the best sensitivity of the assay at a close to 95%. Except for fibronectin and thyroid peroxidase, the other seven genes from the two signatures have not been implicated previously in thyroid tumorogenesis. Both signatures have been validated with an independent 74 thyroid samples, and achieved performance that is equivalent to the one in the 98 training samples. The performances of the two gene signatures are 92% sensitivity and 70%/61% specificity, respectively. When these two signatures are normalized to the specific thyroid control genes the performances are improved relative to the ones of the non-normalized signatures. Furthermore, the signatures performed equivalently with two different target preparations, namely one-round amplification and two-round amplifications. This validation is extremely important for thyroid assays that are FNA samples, which usually contain limited numbers of thyroid cells.


The mere presence or absence of particular nucleic acid sequences in a tissue sample has only rarely been found to have diagnostic or prognostic value. Information about the expression of various proteins, peptides or mRNA, on the other hand, is increasingly viewed as important. The mere presence of nucleic acid sequences having the potential to express proteins, peptides, or mRNA (such sequences referred to as “genes”) within the genome by itself is not determinative of whether a protein, peptide, or mRNA is expressed in a given cell. Whether or not a given gene capable of expressing proteins, peptides, or mRNA does so and to what extent such expression occurs, if at all, is determined by a variety of complex factors. Irrespective of difficulties in understanding and assessing these factors, assaying gene expression can provide useful information about the occurrence of important events such as tumorogenesis, metastasis, apoptosis, and other clinically relevant phenomena. Relative indications of the degree to which genes are active or inactive can be found in gene expression profiles. The gene expression profiles of this invention are used to provide a diagnosis and treat patients for thyroid cancer.


Sample preparation requires the collection of patient samples. Patient samples used in the inventive method are those that are suspected of containing diseased cells such as cells taken from a nodule in a fine needle aspirate (FNA) of thyroid tissue. Bulk tissue preparation obtained from a biopsy or a surgical specimen and laser capture microdissection are also suitable for use. Laser Capture Microdissection (LCM) technology is one way to select the cells to be studied, minimizing variability caused by cell type heterogeneity. Consequently, moderate or small changes in gene expression between normal or benign and cancerous cells can be readily detected. Samples can also comprise circulating epithelial cells extracted from peripheral blood. These can be obtained according to a number of methods but the most preferred method is the magnetic separation technique described in U.S. Pat. No. 6,136,182. Once the sample containing the cells of interest has been obtained, RNA is extracted and amplified and a gene expression profile is obtained, preferably via microarray, for genes in the appropriate portfolios.


The present invention encompasses methods of diagnosing thyroid cancer by obtaining a biological sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.


The present invention encompasses methods of differentiating between thyroid carcinoma and benign thyroid diseases by obtaining a sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.


The present invention encompasses methods of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples by: obtaining a sample from a patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or


recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.


The present invention encompasses methods of determining thyroid cancer patient treatment protocol by: obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommend to treat the disease.


The present invention encompasses methods of treating a thyroid cancer patient by obtaining a biological sample from a thyroid cancer patient; and measuring the expression levels in the sample of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25; where the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and treating the patient with thyroidectomy if they are cancer positive.


The SEQ ID NOs in the above methods can be 36, 53, 73, 211 and 242 or 199, 207, 255 and 354, or 45, 215, 65, 29, 190, 199, 207, 255 and 354.


The invention also encompasses the above methods containing the steps of further measuring the expression level of at least one gene encoding mRNA: corresponding to SEQ ID NOs: 142, 219 and 309; and/or corresponding to SEQ ID NOs: 9, 12 and 18; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 130, 190 and 276 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25. The invention also encompasses the above methods containing the steps of further measuring the expression level of at least one gene constitutively expressed in the sample.


Cadherin 3, type 1 (SEQ ID NO: 53) is mentioned in US20030194406; US 20050037439; and US 20040137539. Fibronectin (SEQ ID NO: 242) is mentioned in US6436642 and US20030104419. Secretory granule, neuroendocrine protein 1 (SEQ ID NO: 76) is mentioned in US20030232350; and US20040002067. Testican-1 (SEQ ID NO: 36) is mentioned in US20030108963; and US20050037463. Thyroid peroxidase (SEQ ID NO: 211) is mentioned in US6066449, US20030118553; US20030054571; WO9102061; and WO9856953. Chemokine C (C-C) motif ligand 18 (SEQ ID NO: 354) is mentioned in WO2005005601 and US20020114806. Pulmonary surfactant-associated protein B (SEQ ID NO: 355) is mentioned in US20030219760; and US20030232350. K+ channel beta subunit (SEQ ID NO: 207) is mentioned in US20030096782; and US 20020168638. Putative prostate cancer suppressor (SEQ ID NO: 178) is mentioned in WO2005020784. Bone marrow stromal cell antigen 1 (SEQ ID NO: 142) is mentioned in WO2004040014; and WO2005020784. Leucocyte immunoglobulin-like receptor-6b (SEQ ID NO: 219) is mentioned in US20030060614. Bridging integrator 2 (SEQ ID NO: 309) is mentioned in EP1393776; WO02057414; WO 0116158 and US6831063. Cysteine-rich, angiogenic inducer, 61 (SEQ ID NO: 9) is mentioned in WO2004030615; and WO9733995. Selenoprotein P, Plasma 1 (SEQ ID NO: 12) is mentioned in US20040241653 and WO2005015236. Insulin-like growth factor-binding protein 4 (SEQ ID NO: 18) is mentioned in WO2005015236; WO9203469; WO9203152; and EP0546053.


In this invention, the most preferred method for analyzing the gene expression pattern of a patient in the methods provided herein is through the use of a linear discrimination analysis program. The present invention encompasses a method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients by: obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; and applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score. Other analytical tools can also be used to answer the same question such as, logistic regression and neural network approaches.


For instance, the following can be used for linear discriminant analysis:
p(CP)=d(CP)-d(CN)1+d(CP)-d(CN)p(CN)=11+d(CP)-d(CN)

where,


I(psid)=The log base 2 intensity of the probe set enclosed in parenthesis.


d(CP)=The discriminant function for the cancer positive class


d(CN)=The discriminant function for the cancer negative class


P(CP)=The posterior p-value for the cancer positive class


P(CN)=The posterior p-value for the cancer negative class


Numerous other well-known methods of pattern recognition are available. The following references provide some examples: Weighted Voting: Golub et al. (1999); Support Vector Machines: Su et al. (2001); and Ramaswamy et al. (2001); K-nearest Neighbors: Ramaswamy (2001); and Correlation Coefficients: van 't Veer et al. (2002).


Preferably, portfolios are established such that the combination of genes in the portfolio exhibit improved sensitivity and specificity relative to individual genes or randomly selected combinations of genes. In the context of the instant invention, the sensitivity of the portfolio can be reflected in the fold differences exhibited by a gene's expression in the diseased state relative to the normal state. Specificity can be reflected in statistical measurements of the correlation of the signaling of gene expression with the condition of interest. For example, standard deviation can be a used as such a measurement. In considering a group of genes for inclusion in a portfolio, a small standard deviation in expression measurements correlates with greater specificity. Other measurements of variation such as correlation coefficients can also be used in this capacity. The invention also encompasses the above methods where the specificity is at least about 40%, at least about 50% and at least about 60%. The invention also encompasses the above methods where the sensitivity is at least at least about 90% and at least about 92%.


The invention also encompasses the above methods where the comparison of expression patterns is conducted with pattern recognition methods. One method of the invention involves comparing gene expression profiles for various genes (or portfolios) to ascribe diagnoses. The gene expression profiles of each of the genes comprising the portfolio are fixed in a medium such as a computer readable medium. This can take a number of forms. For example, a table can be established into which the range of signals (e.g., intensity measurements) indicative of disease is input. Actual patient data can then be compared to the values in the table to determine whether the patient samples are normal, benign or diseased. In a more sophisticated embodiment, patterns of the expression signals (e.g., fluorescent intensity) are recorded digitally or graphically. The gene expression patterns from the gene portfolios used in conjunction with patient samples are then compared to the expression patterns.


Pattern comparison software can then be used to determine whether the patient samples have a pattern indicative of the disease. Of course, these comparisons can also be used to determine whether the patient is not likely to experience the disease. The expression profiles of the samples are then compared to the portfolio of a control cell. If the sample expression patterns are consistent with the expression pattern for cancer then (in the absence of countervailing medical considerations) the patient is treated as one would treat a thyroid cancer patient. If the sample expression patterns are consistent with the expression pattern from the normal/control cell then the patient is diagnosed negative for cancer.


Preferably, levels of up and down regulation are distinguished based on fold changes of the intensity measurements of hybridized microarray probes. A 1.5 fold difference is preferred for making such distinctions (or a p-value less than 0.05). That is, before a gene is said to be differentially expressed in diseased versus normal cells, the diseased cell is found to yield at least about 1.5 times more, or 1.5 times less intensity than the normal cells. The greater the fold difference, the more preferred is use of the gene as a diagnostic or prognostic tool. Genes selected for the gene expression profiles of this invention have expression levels that result in the generation of a signal that is distinguishable from those of the normal or non-modulated genes by an amount that exceeds background using clinical laboratory instrumentation.


Statistical values can be used to confidently distinguish modulated from non-modulated genes and noise. Statistical tests find the genes most significantly different between diverse groups of samples. The Student's T-test is an example of a robust statistical test that can be used to find significant differences between two groups. The lower the p-value, the more compelling the evidence that the gene is showing a difference between the different groups. Nevertheless, since microarrays measure more than one gene at a time, tens of thousands of statistical tests may be asked at one time. Because of this, one is unlikely to see small p-values just by chance and adjustments for this using a Sidak correction as well as a randomization/permutation experiment can be made. A p-value less than 0.05 by the T-test is evidence that the gene is significantly different. More compelling evidence is a p-value less then 0.05 after the Sidak correction is factored in. For a large number of samples in each group, a p-value less than 0.05 after the randomization/permutation test is the most compelling evidence of a significant difference.


The present invention encompasses microarrays or gene chips for performing the methods provided herein. The microarrays can contain isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma or risk of relapse in a biological sample. The microarray preferably measures or characterizes at least about 1.5-fold over- or under-expression, provides a statistically significant p-value over- or under-expression, or a p-value is less than 0.05. Preferably, the microarray contains a cDNA array or an oligonucleotide array and may contain one or more internal control reagents. One preferred internal control reagent is a method of detecting PAX8 gene expression which can be measured using SEQ ID NOs: 409-411.


Preferably, an oligonucleotide in the array corresponds to the 3′ non-coding region of the gene the expression of which is being measured.


Another parameter that can be used to select genes that generate a signal that is greater than that of the non-modulated gene or noise is the use of a measurement of absolute signal difference. Preferably, the signal generated by the modulated gene expression is at least 20% different than those of the normal or non-modulated gene (on an absolute basis). It is even more preferred that such genes produce expression patterns that are at least 30% different than those of normal or non-modulated genes.


Preferred methods for establishing gene expression profiles include determining the amount of RNA that is produced by a gene that can code for a protein or peptide. This is accomplished by reverse transcriptase PCR (RT-PCR), competitive RT-PCR, real time RT-PCR, differential display RT-PCR, Northern Blot analysis and other related tests. While it is possible to conduct these techniques using individual PCR reactions, it is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) produced from mRNA and analyze it via microarray.


A number of different array configurations and methods for their production are known to those of skill in the art and are described in U.S. patents such as: U.S. Pat. Nos. 5,445,934; 5,532,128; 5,556,752; 5,242,974; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,436,327; 5,472,672; 5,527,681; 5,529,756; 5,545,531; 5,554,501; 5,561,071; 5,571,639; 5,593,839; 5,599,695; 5,624,711; 5,658,734; and 5,700,637.


Microarray technology allows for the measurement of the steady-state mRNA level of thousands of genes simultaneously thereby presenting a powerful tool for identifying effects such as the onset, arrest, or modulation of uncontrolled cell proliferation. Two microarray technologies are currently in wide use. The first are cDNA arrays and the second are oligonucleotide arrays. Although differences exist in the construction of these chips, essentially all downstream data analysis and output are the same. The product of these analyses are typically measurements of the intensity of the signal received from a labeled probe used to detect a cDNA sequence from the sample that hybridizes to a nucleic acid sequence at a known location on the microarray. Typically, the intensity of the signal is proportional to the quantity of cDNA, and thus mRNA, expressed in the sample cells. A large number of such techniques are available and useful. Preferred methods for determining gene expression can be found in U.S. Pat. Nos. 6,271,002; 6,218,122; 6,218,114; and 6,004,755.


Analysis of the expression levels is conducted by comparing such signal intensities. This is best done by generating a ratio matrix of the expression intensities of genes in a test sample versus those in a control sample. For instance, the gene expression intensities from a diseased tissue can be compared with the expression intensities generated from benign or normal tissue of the same type. A ratio of these expression intensities indicates the fold-change in gene expression between the test and control samples.


Gene expression profiles can also be displayed in a number of ways. The most common method is to arrange raw fluorescence intensities or ratio matrix into a graphical dendogram where columns indicate test samples and rows indicate genes. The data are arranged so genes that have similar expression profiles are proximal to each other. The expression ratio for each gene is visualized as a color. For example, a ratio less than one (indicating down-regulation) may appear in the blue portion of the spectrum while a ratio greater than one (indicating up-regulation) may appear as a color in the red portion of the spectrum. Commercially available computer software programs are available to display such data including “GENESPRING” from Silicon Genetics, Inc. and “DISCOVERY” and “INFER” software from Partek, Inc.


Modulated genes used in the methods of the invention are described in the Examples. The genes that are differentially expressed are either up regulated or down regulated in patients with thyroid cancer relative to those with benign thyroid diseases. Up regulation and down regulation are relative terms meaning that a detectable difference (beyond the contribution of noise in the system used to measure it) is found in the amount of expression of the genes relative to some baseline. In this case, the baseline is the measured gene expression of a benign disease patient. The genes of interest in the diseased cells are then either up regulated or down regulated relative to the baseline level using the same measurement method. Diseased, in this context, refers to an alteration of the state of a body that interrupts or disturbs, or has the potential to disturb, proper performance of bodily functions as occurs with the uncontrolled proliferation of cells. Someone is diagnosed with a disease when some aspect of that person's genotype or phenotype is consistent with the presence of the disease. However, the act of conducting a diagnosis or prognosis includes the determination of disease/status issues such as determining the likelihood of relapse, type of therapy and therapy monitoring. In therapy monitoring, clinical judgments are made regarding the effect of a given course of therapy by comparing the expression of genes over time to determine whether the gene expression profiles have changed or are changing to patterns more consistent with normal tissue.


Genes can be grouped so that information obtained about the set of genes in the group provides a sound basis for making a clinically relevant judgment such as a diagnosis, prognosis, or treatment choice. These sets of genes make up the portfolios of the invention. As with most diagnostic markers, it is often desirable to use the fewest number of markers sufficient to make a correct medical judgment. This prevents a delay in treatment pending further analysis as well unproductive use of time and resources.


One method of establishing gene expression portfolios is through the use of optimization algorithms such as the mean variance algorithm widely used in establishing stock portfolios. This method is described in detail in US patent publication number 20030194734. Essentially, the method calls for the establishment of a set of inputs (stocks in financial applications, expression as measured by intensity here) that will optimize the return (e.g., signal that is generated) one receives for using it while minimizing the variability of the return. Many commercial software programs are available to conduct such operations. “Wagner Associates Mean-Variance Optimization Application,” referred to as “Wagner Software” throughout this specification, is preferred. This software uses functions from the “Wagner Associates Mean-Variance Optimization Library” to determine an efficient frontier and optimal portfolios in the Markowitz sense is preferred. Use of this type of software requires that microarray data be transformed so that it can be treated as an input in the way stock return and risk measurements are used when the software is used for its intended financial analysis purposes.


The process of selecting a portfolio can also include the application of heuristic rules. Preferably, such rules are formulated based on biology and an understanding of the technology used to produce clinical results. More preferably, they are applied to output from the optimization method. For example, the mean variance method of portfolio selection can be applied to microarray data for a number of genes differentially expressed in subjects with cancer. Output from the method would be an optimized set of genes that could include some genes that are expressed in peripheral blood as well as in diseased tissue. If samples used in the testing method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in peripheral blood, then a heuristic rule can be applied in which a portfolio is selected from the efficient frontier excluding those that are differentially expressed in peripheral blood. Of course, the rule can be applied prior to the formation of the efficient frontier by, for example, applying the rule during data pre-selection.


Other heuristic rules can be applied that are not necessarily related to the biology in question. For example, one can apply a rule that only a prescribed percentage of the portfolio can be represented by a particular gene or group of genes. Commercially available software such as the Wagner Software readily accommodates these types of heuristics. This can be useful, for example, when factors other than accuracy and precision (e.g., anticipated licensing fees) have an impact on the desirability of including one or more genes.


The gene expression profiles of this invention can also be used in conjunction with other non-genetic diagnostic methods useful in cancer diagnosis, prognosis, or treatment monitoring. For example, in some circumstances it is beneficial to combine the diagnostic power of the gene expression based methods described above with data from conventional markers such as serum protein markers (e.g., Cancer Antigen 27.29 (“CA 27.29”)). A range of such markers exists including such analytes as CA 27.29. In one such method, blood is periodically taken from a treated patient and then subjected to an enzyme immunoassay for one of the serum markers described above. When the concentration of the marker suggests the return of tumors or failure of therapy, a sample source amenable to gene expression analysis is taken. Where a suspicious mass exists, a fine needle aspirate (FNA) is taken and gene expression profiles of cells taken from the mass are then analyzed as described above. Alternatively, tissue samples may be taken from areas adjacent to the tissue from which a tumor was previously removed. This approach can be particularly useful when other testing produces ambiguous results.


The present invention encompasses methods of cross validating a gene expression profile and the profiles thus obtained, for thyroid carcinoma patients by: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance. In this method, preferably, the gene expression data obtained in step h. is represented by genes from those encoding mRNA: corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or recognized specifically by the probe sets from psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.


The present invention encompasses methods of independently validating a gene expression profile and the profiles thus obtained, for thyroid cancer patients by obtaining gene expression data from a statistically significant number of patient biological samples; normalizing the source variabilities in the gene expression data; computing for factor of interest on all variables that were selected previously; and testing the prediction model on the sample and record classification performance. In this method, preferably, the gene expression data obtained in step d. is represented by genes from those encoding mRNA: corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or recognized specifically by the probe sets from psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.


The present invention encompasses methods of generating a posterior probability to enable diagnosis of thyroid carcinoma patients by obtaining gene expression data from a statistically significant number of patient biological samples; applying linear discrimination analysis to the data to obtain selected genes; applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score. For instance, the following can be used for Linear Discriminant Analysis:
p(CP)=d(CP)-d(CN)1+d(CP)-d(CN)p(CN)=11+d(CP)-d(CN)

where,


I(psid)=The log base 2 intensity of the probe set enclosed in parenthesis.


d(CP)=The discriminant function for the cancer positive class


d(CN)=The discriminant function for the cancer negative class


P(CP)=The posterior p-value for the cancer positive class


P(CN)=The posterior p-value for the cancer negative class


The present invention encompasses methods of generating a thyroid carcinoma diagnostic patient report and reports obtained thereby, by obtaining a biological sample from the patient; measuring gene expression of the sample; applying a posterior probability score thereto; and using the results obtained thereby to generate the report. The report can also contain an assessment of patient outcome and/or probability of risk relative to the patient population.


The present invention encompasses compositions containing at least one probe set from: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.


The present invention encompasses kits for conducting an assay to determine thyroid carcinoma diagnosis in a biological sample containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25. The SEQ ID NOs. can be 36, 53, 73, 211 and 242, 199, 207, 255 and 354 and 45, 215, 65, 29, 190, 199, 207, 255 and 354.


Kits made according to the invention include formatted assays for determining the gene expression profiles. These can include all or some of the materials needed to conduct the assays such as reagents and instructions and a medium through which nucleic acid sequences, their complements, or portions thereof are assayed.


Articles of this invention include representations of the gene expression profiles useful for treating, diagnosing, prognosticating, and otherwise assessing diseases. These profile representations are reduced to a medium that can be automatically read by a machine such as computer readable media (magnetic, optical, and the like). The articles can also include instructions for assessing the gene expression profiles in such media. For example, the articles may comprise a CD ROM having computer instructions for comparing gene expression profiles of the portfolios of genes described above. The articles may also have gene expression profiles digitally recorded therein so that they may be compared with gene expression data from patient samples. Alternatively, the profiles can be recorded in different representational format. A graphical recordation is one such format. Clustering algorithms such as those incorporated in “DISCOVERY” and “INFER” software from Partek, Inc. mentioned above can best assist in the visualization of such data.


Different types of articles of manufacture according to the invention are media or formatted assays used to reveal gene expression profiles. These can comprise, for example, microarrays in which sequence complements or probes are affixed to a matrix to which the sequences indicative of the genes of interest combine creating a readable determinant of their presence. Alternatively, articles according to the invention can be fashioned into reagent kits for conducting hybridization, amplification, and signal generation indicative of the level of expression of the genes of interest for detecting cancer.


The present invention encompasses articles for assessing thyroid carcinoma status containing: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25. The SEQ ID NOs. can be 36, 53, 73, 211 and 242; 199, 207, 255 and 354; or 45, 215, 65, 29, 190, 199, 207, 255 and 354.


The present invention encompasses diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes from those encoding mRNA: corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or corresponding to SEQ ID NOs: 199, 207, 255 and 354; or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or recognized specifically by the probe sets from psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample. Preferably, the portfolio measures or characterizes at least about 1.5-fold over- or under-expression or provides a statistically significant p-value over- or under-expression. Preferably, the p-value is less than 0.05.


The following examples are provided to illustrate but not limit the claimed invention. All references cited herein are hereby incorporated by reference herein.


EXAMPLE 1
Materials and Methods

Tissue samples


Fresh frozen thyroid benign diseases, follicular adenoma, follicular carcinoma, and papillary carcinoma samples were obtained from different commercial vendors including Genomics Collaborative, Inc. (Cambridge, Mass.), Asterand (Detroit, Mich.), and Proteogenex (Los Angeles, Calif.). All samples were collected according to an Institutional Review Board approval protocol. Patients demographic and pathology information were also collected. The histopathological features of each sample were reviewed to confirm diagnosis, estimate sample preservation and tumor content.


RNA isolation


Standard TriZol protocol was used for all the RNA isolations. Tissue was homogenized in TriZol reagent (Invitrogen, Carlsbad, Calif.). Total RNA was isolated from TriZol and precipitated at −20° C. with isopropyl alcohol. RNA pellets were washed with 75% ethanol, dissolved in water and stored at −80° C. until use. RNA integrity was examined with Agilent 2100 Bioanalyzer RNA 6000 NanoAssay (Agilent Technologies, Palo Alto, Calif.).


Linear Discrimination Analysis


Linear Discriminant Analysis was performed using these steps: calculation of a common (pooled) covariance matrix and within-group means; calculation of the set of linear discriminant functions from the common covariance and the within-group means; and classification using the linear discriminant functions.


Plugging the chip intensity readings for each probe into the following equation can be used to derive the posterior probability of an unknown thyroid sample as either cancer positive or negative. For example, if a thyroid sample is tested with the assay and gives a p(CP)>0.5 this sample will be classified as thyroid cancer.


For the 4 gene signature:

d(CP)=−50.9964+0.220424(I(32128at))+1.520185(I(209810at))+3.09431(I(210078sat))+6.11283(I(213423xat))
d(CN)=−46.7445+0.374751(I(32128at))+1.010852(I(209810at))+3.645515(I(210078sat))+5.337296(I(213423xat))

For the 5 gene signature:

d(CP)=−135.931+4.737838(I(202363at))−1.23763(I(203256at))+1984148(I(203889at))+6.638082(l(210342sat)+10.7704(I(212464sat))
d(CN)=−128.978+4.610498(I(202363at))−1.28685(I(203256at))+1.656772 (I(203889at))+6.859133(l(210342sat)+10.24482 (I(212464sat)) p(CP)=d(CP)-d(CN)1+d(CP)-d(CN)p(CN)=11+d(CP)-d(CN)

where,


I(psid)=The log base 2 intensity of the probe set enclosed in parenthesis.


d(CP)=The discriminant function for the cancer positive class


d(CN)=The discriminant function for the cancer negative class


P(CP)=The posterior p-value for the cancer positive class


P(CN)=The posterior p-value for the cancer negative class


Two-Round aRNA Amplification


aRNA was amplified from 10 ng total RNA using the RiboBeast 2-Round Aminoallyl-aRNA Amplification kit (Epicentre, WI), a T7 based RNA linear amplification protocol, with some modifications. Total RNA was reverse transcribed using an oligo(dT) primer containing a T7 RNA polymerase promoter sequence and Superscript III RT. The second-strand synthesis was carried out using Bst DNA polymerase. An extra step of incubation with an exonuclease mix of Exo I and Exo VII was performed to reduce background. The double-stranded cDNA served as the template for T7-mediated linear amplification by in vitro transcription. For the second round of amplification, instead of using the RiboBeast reagents, the ENZO BioArray HighYield RNA Transcript Labeling kit (Affymetrix, CA) was used in place of the in vitro transcription step of Aminoallyl-aRNA. The aRNA was quantified by Agilent Nano Chip technology.


EXAMPLE 2
Microarray Analysis

Labeled cRNA was prepared and hybridized with the high-density oligonucleotide array Hu133A Gene Chip (Affymetrix, Santa Clara, Calif.) containing a total of 22,000 probe sets. Hybridization was performed according to a standard protocol provided by the manufacturer. Arrays were scanned using Affymetrix protocols and scanners. For subsequent analysis, each probe set was considered as an independent gene. Expression values for each gene were calculated by using Affymetrix Gene Chip analysis software MAS 5.0. All chips met the following quality control standards: the percentage of “presence” call, the scaling factor, the background level, and the noise level have to be within the range of mean plus or minus 3 standard deviation. All chips used for subsequent analysis have passed these quality control criteria. Sample collection for signature selection and independent validation is summarized in Table 1.

TABLE 1Sample collection for signature training and validationCategoryNumber of SamplesTraining Sample SetFollicular Adenoma (FA)33Follicular Carcinoma (FC)21Benign Diseases (BN)13Papillary Carcinoma (PC)31Validation Sample SetFollicular Adenoma (FA)38Follicular Carcinoma (FC)5Follicular Variant of Papillary11Carcinoma (FVPTC)Papillary Carcinoma (PC)20


EXAMPLE 3
Results Signature Identification

A. Gene Selection


A total of 98 samples including 31 primary papillary thyroid tumors, 21 follicular thyroid cancers, 33 follicular adenoma, and 13 benign thyroid tissues were analyzed by using Affymetrix human U133A gene chips. Five gene selection criteria were applied to the entire data set to obtain a limited number of genes for subsequent gene marker or signature identification:


1. Genes with at least one “Present Call” in this sample set were considered.


2. Genes with more than one “Present Call” in 12 PBL samples were excluded.


3. Only genes with chip intensity larger than 200 in all samples were selected.


4. Using genes that passed the above three criteria, we performed a variety of analyses, as listed in Table 2, to identify genes that are either up-regulated or down-regulated in thyroid tumors.


5. Finally, genes with expression change greater than 1.4-fold were selected.

TABLE 2Summary of different types of percentile analysesType of Percentile Analysis120% FC vs 100% Benign230% FC vs 90% Benign330% PC vs 90% Benign470% FC vs 50% Benign570% PC vs 50% Benign690% Benign vs 30% FC790% Benign vs 30% PC


The final number of selected genes for signature identification is 322, described in Table 25, SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 335-363. The data obtained from the 322 selected genes are provided in Table 3 and summarized in Table 4.

TABLE 33aSEQ ID NO:800TT801TT802TT804TT805TT806TT807TT818TT819TT35410235.3163.812.299.1111.62506.31780.729.34.1355508.5150.831.583.863.1457.5189.948.245.335682.7754707.3477.31120.7827.5246.31068.3960.1357834758.9718249.4883.6554.5377.5616.1706.93582490.4593.3565.5540.31132.7750.4803.7377.4534.6359533.5342412409.4413.3396.5309.5352.8317.7362136.4550399.6653.8573.4322.4539.5317.5324.9360476.2324.5352.5348.2473.3342.9170.3190.1279.4361196.4995.8839.3382.6926.9480.8305.3913.91123.4363642.7392.9410.2742.3447.2504.9457.6397490.3157.5694.1410.9413.8950.3946.6351.2317.7346.428543127.22912.3675.344843866950.52514.32438.176.65841380.1315.4543393.6303.9713.9821.686606.3941.21104.5736.7749.71740.51083.6423.7583.391852.910149.76856.22912.16808.71233.43010.63890.52225.410213.956.566.870.8121.8102.5426.158.3149.911463.3163.4131.5187.4350.7210.3129.1340.2336.313286.2180.9111.8233.1197.5335.1173.870.7108.3141590.2437.8323.5558.1897.51161.3642.8105.9170.6159293.6467.4332.9823.33718.3204959.7506.8670.5161801093.1911.1674.5960.21600.84671244.5995.617850.81221.72320.1687.91614.91605.7404.61911.4211419411.11415.6184.1723.51035.5370.5548.9147192.620733.91.11.174.5256.41.1326.71.11.22172.3200.712.981.588.3242.56711.537.4223094.89706.37329.53225.36075.36859.52406.56706.88884.7234749.1837.41.1835.62674.6364.31127.51.131.724965.622139.2361.9738.2167.3169.571.9121.6267416.97158.3127.46838.882382252.35033.665.1119.92758.1722.5759815.4651.8689.9359.8573381.929215.3111.155.4103.790.270.565.9199.3105.7305508.4259.411.7410.1853.5143.9596.320.745.831141.5311.166.8198.7183.8290.6464.150.5108.63320935.4341.8144.8828.37608.5425359.189.7315.93482.54387.64002.62634.34784.647982420.63104.2355835289.7142.432.9436.5220.8143.9838.924.427.436760.5205.8124156.6338.1167.8148.642.9140.837339.4237.6117.2340.6200.9294.7332.7183.3276.33815634.5361.2546.7505.14617.1382.4256.9914.7676.540622.8479.8437.7682.8423.9523.7477.9481.4742.741217.2359.7234.4221.2757.4528.7139.2226.1164.442219.8238.2203.5163.5270.5212.1176.6169.7210.443234.7301366.1430.4277390.7298.8366.6431.1441194.4428.6352.7678.61038.4590.6502.4312.5412.64593.2348.4537.2498.2362.4526.8286.3593.7721.846353.4362.7228.1486.3390348.8264.3223.9308.2471440122.7195.5267.7384.4279.8279.8186120.148199.4203.416.71371.4795.6261.92274.736.62149195.9337.7268285.8341.3420.2392.8175.7207.1508413277.972.94811790.1240.3276.319.6144.451548.44229436.166.935.2265.438.835.452189.3199.3189.3144.9217.9179.8189.7265.6263.15390.279.346.25136.381.2109.483.533.954879.23831133.4796.7378.8853508.41350.7462.25569.1130.481.7126.965.7123.796.686.1118.95629.953.283.682.1125.580.45764.559.6575589.3468.9208.8519338.32738.12814.695.31205825483492.1294.6702.4495.22804.23544.895.7164.75957.61695.31278.9884.11841.62339.6560.21800.2220460308154.2148.1188151.4261115.3120.2177.261193.7168.2134.2228153.6138.7132.183.1176.162119.4478.9203.51627.21442.21810.1903.6752303.96398.7380.9470197.8346.6224.8242.2297.519264143.1133.4210.8393.3197.5194.5165.5154.4209.965328.512464.1172.8348.1151.2192.8101.1127.966249.17321332.3450.2923.7721.7524.11163.3105667293.131554.331050.534557.435093.933778.121708.933200.237492686324052694.92196.15092.23821972.52314.22245.969756.55955.87077.65234.26301.11133.558706218.48519.470424.62064.62173.14141.41212.71829.624181388.81591.471499.3545.4159.2507.52187.3258.8298.2106.573.572431.6355.2472.7512.9768.2712.7665.71451.141073272.6264.5266.7235473.2341218433.5361.975120.4364.8176279491.9225.9244.3377.5440.776153.3176.546143.895.5498182.1234.877102.13322.23704.43549.37422.73279.72337.52786.8681178297.4973.11410.84871074.9411.43151025.7834.179126.7120.4132.9181.3166.487.6155.4114.9113.980153.8328.9160.6571.7267307.1430.9345.1451.181179.7181.8101.5996.9161.1619.21156.473105.58254.9362.8385.4367264.5251.3241.3414.222084101.2291.6129.7162.2330.9286.7196.375.377.585558.7171.1121.8116.1116.9188.5368.6191161.486100.590.567.6100.471.378.5104.680.5101.487144.9375.2299.1190267227.394.170.7488.188136.14022.94905.42121.44345.44155.71621.65239.47618.289361.1158.9159.8335218.5244.6224.8136.2163901105.6113.492.7212.6301.1131.7229.681.775.79141283.8405.283.4373.4101.53129.92037.310.973.892125.54171.43562.52666.82820.27133.6192911013.36783.593102.9336.1636.6108.4214.1218.9125.8330.1222.894173.3927600.9384.51060.6985.2285.3819.37599543.6796225.2699.2229.71129264.2589.6347.596166.4173.4234108.8198.5171.690.4154.2139.99728.3196.3256.1110.4302.3307.3112.4520.9415.1983347.344.56.133.234.462.99.73499315.9219.6221.2281.5254.6306.8218.9200240.610040.312275.17465.84158.85537.219961.11057.91835.428160.9101169.6185264.2312.3225.5277.8165.2258.7276.2102208.7160.9193308.2155.3201.8154.2171.3189.5103402302.9300.1382.9342.4374.1315.3292.4280.210425.2569354.3402.2554.51086.3407.5469.3840.910546.4550.9418437.1724.91141481.65961001.310615.2622.8398.8419.8577.51074.2377.8444.5794.41076337.1255.7210448.7353.8639.631591.3155.9108167.9316.2436.9315429.5269.2221.7417.346710964.81110.3875.6160.6318.4942.9215.81481.153.81101.11261.51589.1263.4923.84084.941544176.311133.11767.81964.91872.4427.31690.71292.2749.51008.91121.3407.2104.1401.9271.4454.9209.1219.930.211313951.3189.9275.6197.3169.2225.7104.1185.9114268.1679853.3378.5772.9883.3311353.1443.1115357.8569.5376383.7574.8380.6337.8221.5323.5116291.2223163.2334.1242.5288.6199.1177.2195.2117289.85414.44654.41394.23310.62815.7721.73557.65696.611892533.690.4527.7275.1665.7306.860.399.6119114.7226.3336.7194.9102.7168.3397.781.76512078.6116.4118.2137338.5139164.351.873.3121161.2788.8997.1260.6745.81450.3199.5403.7483.312290.3263.589.9186.6106.4226.4124.751.1205123172.4136.9175193.8162.9133.6111.592.3143.1124182.9130.4129.2229.5137.2159182.4106.9127125771.9885.8846.91521.7915.3963.4856.9836.5775.412625.41583.41549.97282100.41526.4558.81490.21266127101.3121.897.6163.599.6101.1101.174.1160.2128346234238.5469239.1325198.4245.9311.81294494.1248.8234274.6301.2383.927072.7148.1130117.9100.2138.4121.998.910497.733120.613195.667.871.9133.783.381.392127.2160.1132232188.4200.5251174266.8171.5186.5257.713331.991.961.8130.656.7175.598.696.9108.113468.7109.8181.9126.1162.2149.1117.5169.9162.7135342.4599423.7336.6593.1454.2196.2246.7390.2138376.2149.897.5172.2167.1141.1170.9102.7126.1139109.4107.8120.5114.4131110134.247.678.614050.44099.62561.41129.92225.84646.8179.335873225.414128.71684.32067.91954.81743.82519.7838.92235.91940.3144530.5489.8450.9680.6482.9521.4406.93706.9433.4145237.2196.3199.6376.6227.5244164175.5217.2146240207.7196.5287216.2221.3171.1170.3240.114734.859.132.671.1106.83876.966.744.2148677.5348.2249.8461.1251.5501.4616.9292.6327.214935.2397.1361.6203.1742.4464.8110.1706.6571150205.4160.9229.9251200.4189.2332.7156.6501.8151173.8466.2220285.9235.8499.7139.8284.8258.515396.7149.4109.5120139.6106.3110.4101.594.3154353.7288.862.8174.6358.1579.2122.345.3359.9155497.4136.2109.5189.4118.5147.5131.9115.5137.51567397.784.6132.7100.1118.98764.673157153149.2105143.1123.7160.2159151.6147.21581.38.9102.499.51.123.174.87.993.2159332887.33372.92710.73432.13979.21070.53809.94336.81611.3134.2113.3263.6128.2276.1557.1118.42.91621735.617024.1264.5702.3122.336531.185.116494.6209.12869.2348.2520.82102.633.21670.7436.5166700.46433.59921.64090.97108.33609.53473.47815.75478.41671.22320.413181994.53064.92291.7729.23184.32565.5168190593.2775.5598.1769.2610.1414.81931.61123.8169512.24400.22669.82975.62812.96215.73878.61890.1829.917073.51014.42146.7775.81454.91033.1409.32535.1867.21715104.51332.2272.62234.54145.4565.73636.71.31.2172697.5650.4797.2721.1621.5792.4573.5666.6657173117169.1136.9226.4229245.8226.4407.6310.51761.21.23906.6275.774.8809.23.42700.362.8177101617.1461.8602.7515.7623.3414876.6749.6178167.1612.81577.1197.3112.9554.5318.8310.264.7179153.458.690.99066.893.5114.442.393.2180501.770.972.4141.5208.385.6126.391.4102.8181624.812366.29356.28736.710384.99225.76284958910736.6182416.7513.2472.4300.9658.9537.7246.8533.1527.21832674.81193.31.1989.72589.1336.1836.31.110.3184424.7204.6210.9228.6394.8275.7205.5185.6179.618515351703.81133.32133.82209.6911.31201.81162.91148.4186489.1547.1422.7473508.7434.6349.5507.53151871394260.657.1168.9226.784.542434.560.7188257.6162.3197.5380.9488.7103.9313.1102.5160.718966.486.3121.9244.8239.778.6190.375.4112.219078.183.5429.5280.5102.5357.691.997.684.81915186883.91804.8892.91302.6986.6662.91537.41728.1192183.6117.1105.4207.3160.4130.7133.386.8109.419375.21034.11775.64731246.2728.5400.42163.81704.819435.4141109.3203.6162.4216.681.4282.5166.3195166.4286.5375.7319.3152.4274.8209.4184.4172.61963.16834.94672.95030.22309.26216.84103.76137.96356.519799.910474.8123.9144.874.678.742.676.119864.163.153.4170.681.1107.753.758.8105199831.824058.3107.991.4602.123256.873.6200526.8384.3120.9388.4798.8293.1355.9148.21532018960.416522.2144.780.928182028.740.367.220381.3472.4610.991.8451.2472.3101.5229.9173.5204111.5557.7815343.5524.4484.1188.1623.8532.3205110.16177.94916.23074.24380.75662.92513.56031.44413.3206327.4232221.42279.41294.7242.323853.3182.8201.2207140.61170.8430.34781596.21348.5347.22523.22245.3208102.4611.420894.9323317.4205.475371.120919.63466.74058.336211656.73787.31837.33395.92777.221168.513748.33015619158.620412.611472.55548.413311.618245.421297.3492.1523.31191.7274.3490.1563.4430.6523.7213118.298.7138131.379.472.3107.556.187.521574.51676.2558.9803.51642.32856.5476.44663.23720.121675.1912.51082.46028741309.1366.31248.61513.4217253.9338.8345.6232.8478.1255.5260.8183.8153.8218217.6281.1360.1283.7411.2483.8185.6541.5461.7220116.2103.966.997.583.399.769.588.487.1221587961.9558.8297.6954.6365.8346.2594456.9223239.4255135.7374.9272.4283.3188.8205.6338.922716526.9687.5402.1801.28633.7549.7683662.9533.2228109.5590.7434.3616.8410.6745.3291.4596.4397.3229238.4255.8193.3117.2266.5145.6228.4102.2491.9230226.6172.787.5128.9178.7109152.981.697.2231164.7239.9241177.8240.8204.382.9126.8110.2232726.26011.469.44687.84109.51565.93685.255.1121.42331921.310660.630282711.77662.77862.618293283.35519.52351985.5721.4238.4931.82117.4492.214377796.1236111.5389.5124.3281.9194.3199.7268.587132.1237678.22297.41864.112031986.117431173.91963.82872.9238100.71551.21160.8572.21309.91228.54511210.1642.7239332.1763.7202225.7393.5575.5339267.473.62402452.6853.2251.5167.9951.3599.5378.3208.9113.22413976.21815.3487.33201245.61299.5844.5423.8113.224222247.91204.2676.72441.53900.12073.42060.11433.32211.8243500.8602.3147.7417.4460.7206.9420.7210.1264.1244408.8194.7250139.3215163.3362.3191.9185.1246346.4311.5153.6129.5426.7193.8297.6237.1115.3247228128.5128.2180.1149.8122.11199582.624884.9198.9142.5115.1171.7266.576.9113.4199.32491035.7288.92257.9857.311641466.9537.1513.5696.225126488.878.2123232.613874.6121.3124.6253108.7314.2326.6251.4350.9226.2192.2227.9226.6254141.8397.1285.791.7668.4932.2144.2644.2128.5255158.7631.91918.6177.794.3560.5328.5275.47425628050525.2120.3424.5151.71961.11539.7156.2137.1257114.599.883100.6201.5126.486.7157.4157.6258158.649.91.2230.787162.9312.29.5188.62591056.7678.874.6435975.6278.5381.278.819.9260181.2203.6112.1206.3156.5223.4178.5122.7146.6261102.9308.1236.7105398.6247.2179878.1456.3263715.4341.5448.7152.3586.5224.7469.7458.1389263497.6226.9137.3149.6251166.4214.585.4135.226594.8312.7829.9450.4436.1369.5258.6592.9638.8266265.8327344.5288.3382.4344.9252.4143.5246256250.1118.495.6163.6115.3138.5119.791.9107.12689.8979.7661.1894.3411.91696.9366.1409.71018.82695449.940.567.334.639.137.92741.9270250173.8181.8187.3170224.5142.3228.7279.3271480.9213.9276.2361316273.2153.9288.4298272848.6504.7506.3704.7547.1495.8552.5478.3596.92731.22102.34434.2854.444322983.714042522.82416.92741684.71062218.2668.5812.7391.8925.2159.9290.7275287.7447.3282.7622.1481245.2328.9276.9234.727624704.91039.35651641.611368.8805.31068.9882.8583277242197.4155.1247.2180.4234.4184.7192.8192.52781231.4973145.3901.41474.2594.6925.8126131.627917.32232.42050.112681303.22923.4900.42377.31977.228059.42645.52730.21625.92545.43355.11233.42801.53378.528111.1384.86538.771.4100.9103.714.117.9282608.4296.3256.6463.7205.6325.1415.2194.5210.3283332.9264.5234.2544.1264.3374.3400.4291.5271.428478.367.869.478.9689271.159.988.3285128.176.9110.6115.5106.6107.883.189.295.8286136.9882.81547.8797.26981112.3458.4673.7251.9287133.4121.2112.9117.491.9158.28770.494.5288171.7149.6158.2178.1157.8201117123.4124.42892065.2477.9207.9783.61036.1420.32425.518.41.3291133.564.497.572.7132.773.587.358.949.4292584.563.225154.11191.9660.3757.527.540.929385.6186.6107288.987.8189235.3128.155.829599.7791.3242.3325.4327.2175.4230.6133.1144.9296676.2918.1709.4934.21877.11141.7589.6753.4857.2297208.161.945125.178.167128.833.556.2298486.9293.3320.6257.4410.5356.9211.9196.2400.4299238.1923.6448.91006.61054.5910660.9696.1686.7300215.4203.8395.4255.6312.3188.4202.2244.5347.9301212.9290820.4372.3708.3367.5860.11368.31185.730229.525.810.51934.545.738.4911.2303244.8782.2902.3349.1907.8713.9323.7823.8976.63041861.6166.7207.3308.3367.6378.4394.1160.5243.8305175.3159.51205.8156.7144.6223.3176.9191.7180306257.6154.3146.1240.3149206.8136.3126182.9307140.9142.6126.5207130.3179.3122.6127.1144.630851.21843.11030.91212.91456.72208.3994.91319.83640.631056.1389.3310.4316.3466.8385.1278.8726.7401.631195.8109.3154.990107.1120.196.340.5202.13121.1193.8599390.5611.6728.7365.51657.6289.8313114.1119.7208.9142.2124.9120.7102.2171.4137.5314228.4414.8146.7189.2419.3985268.1164.1805.7315106.4758.2540.2634.9351.4466.9317.2369.3322.431687.3363.4151353425.1312.8284.4214.7159.2317349.5178.8142.4246187.7213.8173.4172.5170.83184116547.188.362.8174.658.929.936.8319434.9249.185.8420.7189.3189.1249.896.7149.6320107.4586.7418.3403.8488.4523.9404.2689.4494.1321543.8319.1469.7514.1488.3438.7255599.8413.8322143.6271.4269.5298.2237237.4211.8133.223932370.73285.63624.31105.34318.52487.45692285.53132.632483.1109.6285.4143.7116.7132.585.8120.877.4325110.9251.9316.5290236.5383.2230.7313.5303.7326135.53242.58125.64127.55469.64502.91608.53693.92895.832758.5451.22559.93517.537.71.132865.8655.8464.1320.5288.4542.9197.8325.2508.23298064.269112.35694.879.645.759.533040.580.160.75825.8201.852.315.235331432.9313.6325.8596282.5296.4296.4323.7289.3333130.6705.5966.7555.7561.6839.7421.8765.6867.7334249.3142.3160.4202.9176.2182.3124.3206.3169.133582.580.483109.4123.6101.9119.473.9145.7336190.4460647.9449.1599.6811.8357.9794.4514337325.2155.4169.187.4565.9331.4139.4121218.6338456.9208.6167.7232253.9347.6196.9230.3166.2339286.9555.1405.8559379.8628.6310.9351.5538.6340512.3229.9206.7351.4259.7284.5241.8186.5258.4341149.5767.9579.4500.3838.9598.2472.1804.7865.1343152.940.55791479.852.4120.2411.9326.785344233.71144.2879.21306.41034.512671054.11516.91049.3345371.6243.5219304.9271.1232.5238.5219.9295.334798.23633.12744.62838.43198.44569.81600.11448.83315.834878.56124.86613.54006.54485.37289.43180.72561.55272.3349582.7260240.8164.6205.7203.8225.1195.3203.1350355.9281.6330.4285.5454.2255105.2161.7183.4351732.9348.347.4261.9443.7347.8457.373.6169.9352162.3297339.9197.7488.4390.6178.5201.7300.5353186.4405.1211.5354.7282.6265.3148.4203378.93bSEQ ID NO:820TT821TT822TT823TT824TT825TT827TT828TT829TT354101.832.1469263.81085.822126.1351609.835550.145.1504.278.32521.57117379.81017.3356697.4939.21065.9788.9148.7218.1645.8867.3539.6357470.4512.9724.1516.5395.9181909.4596552.3358572.8424.1483.2901.7829.4659.81454.2582.71006.9359347.5382.6400.4351.2192.3373.5325.1300.2434.7362518.5320.1492.7704.3136.5151.1355.4543.3388.6360319.8228.6329.3403.7774.2179.6366.3240.3358.5361480.91229.9857.7620.4288.12561180.4566.6668.1363418.7427.1382.75453591019.2338.9487.86951693.8684807.9656.3335.6360.3549.1242.6662.721188.24262.82973.52345.3485.6836.82548.251552907.27285570.3706.5933.7231.3398465.3243.7598.58772941.1585.41410767.6899.7976.4715.31364.296790.16640.57386.33225.85435.7126.34807.51611.93114.710127.873.688.9165.81940.4149.4211.5105.7161.711219.2282.4325.1111.455878.5557.8260.1213.21397.3102.3156.9158.8964.8160.6157.6106.2231.814280.4281.5511.4335.91351.5111.1708.2213543.415407.6174.9613.52405.85398.842.51013.9261.5818.716996867.41065.21313.3639.8600.3893.2655.31176.4179051286.81004.51341.43130.7458.2571.61357.1567.719176.2160.52137215.5362.5258.31756.9171.6407.1202.81.15.655.23077.91.1341.31.2120.321198.48.387.453.332.837.41005.137.987.5226631.11931.63566.856325189.51534.94150.77366.15102.623182.821.2532.3340.71711.81.11721.440.1764.82477.833.2358.6267.6422.374.6370.737.1206.726295.9149.35582.18222610.573.96672.8337.82827.227919.8264.6443.1611.7683.8209.21842.7221356.42970.770.774.8144.2604.4984.4261138.9191.130121.925.4650.1375.74468.946.5561.645.4242.8315697.5123.5224.1147.91115.183.1610.3182319.633468.4153716.113385.76334.6140.71847224.81175.1341720.22051.33037.51584.2336.13724.721195586.2261135244.141.784.262.7824.152.2178.217.41328.536119.6118169.3230.61819.9929.8683492.9214.837155.7184.2228.5240.8319.5467.7184.9199.9387.738585.2232.7573.66068.74340.674.31214.6360.9671.840591.8535.9446.1487.3508.4640.3459382.6707.641125.3451.1286.6226.1178.8297.4551.6110.9268.142208.6409.7329.7258.1211.2288.8404.4466.9264.3431026.6218.9326.6574.3230.1671.1309239.338544615.3369.3535.2505392.7412.7711.3532.763745520.7482.1383.7299.978.6389.4649.9316.5478.746320.2300.6305.2401.7263.7512.6527.8382.7432.747139.1150.5229.5149.7531.9197.1197.3127210.4481.321.1476.792.9168.212.9551.239.1389.549166.1218.5298.7280.5457.8255.1900.8192.7389.950347.999.6314.6484.21930.45073280.5471.851242.81.541.167.7580.8328.7355.425.4109.352192.8248.6243.7205.8370.9381.6276.2205.6177.25396.287.970.947.343.373.7337.695.3151.954407.41349.6375.9248.1781299.71508.8490.7389.255121.8106.297.687.586144.3103.2108.1117.55645.3148.566.56789.349.749.342.586.457676281.8885.5948.4804.4353.9504.682.93332.658778.6312.31214.51060.81872293.1691.484.73886.7591030.82434.12195.81055.8320324.21155.11409.3875.360135.3164.3164.2188.6621.3165.8256106.3154.461162.8141.6158.3159.3275.5228.7281.2168.6177.2624949.924.36071227.9429.71067.9763.2300.62120.463484.5316.4328.9307.7341.148.2473.5163.4154.364204.6186.8246.6401.870.3580.21442.7100.3242.16565.5179.7174.9187.7722.150248.472.4115.266773.71116.3780.2512.2301358.5869.5898.9607.46728999.829358.232402.237818.63337.425748.422954.23664137486.168416.73006.93943.73062.41532880.91180.91284.82957.1691079.47132.78048.44826.8649.28495.45023.18078.47915.3706077.81872.9984682.7249.33261.44520.31401.4911.771132.3112.4422.9210.12216.882.9814.197.5287.672490.81451.81261.7235.1471.174.1306.4974.81198.673348.5369.6410.2281.9216.9255.6357.1221.4359.575419.582.9224.3363.6248.7233.6379.3555287.77611.9119.6100.8434.72481.211851252.2685.6485.4774580.13450.45301.76090.7261.83157.921464545.63500.3781117.1545.1716.9909.9254.8255.98681420.7711.979530164.2183.5180.9240.5155.8185.8142.8115.980603.51468.6828.2186.8153.51495.3273.8761.5324.2811295.1100.2158.7133.6628.6130314.3106.5383.782337330.3245.9228.361.7460.2141303.9207.584106.4568.8287.1105.9114.1486.2497.7114.6176.985172.3125.3120175.2169193.1218.4131.9194868787.253.686.389.1131.685639.613787214.5168.9252.9285.81403.4202.4230.4184.8289.6881660.923326323.65821275.21272.14080.37866.95791.589206177.6198327.11314.5479.1253.4182.8368.190115.4102.5134.4235.22070.3140.2141111.9226.291502.7105.11042284.81947.8244.5511.118.4487292642558484350.42893.7766.311438256.44985.12390.793205.6230.3307.5325218.5186.3253.4252154.894357.11091.11411.5311.1158.346.1509.8632.4557.795241.3283.6505576.362.8172.8115.5216.153296280.5181.9147142.4142.7170.7216.5116.6156.597466.6344322221.470.5218.7225.5294.9178.29823.332.529.322.131.8317.235.82226.899200.6212.8216.1258.2243.6366.3323184.2327.91001421.1302.23029.15780.9673.21623.52932.33304.811319.8101272218267.6467.255.2386.1265.8234.8421.9102152.6160.8134.1185.4141.5525.58297.9131.6193.5103330.3366.8262.3438.6370.5687.6328.6308.6379.9104678.2302.2864.8623.862.2907.1333.91068.4672.3105495.9329.5905.2487.577.9996.44251136.1616.5106612.3277.5775557.334.6814.9280957.1583.4107308.9188.7250.9591.61517.4241.8305161.81102.6108388.5475.8557.1574.6533.2365.7509.2634321.610947.9211.4334.1275.6373.3113.21573359.41203.11101.1367.7820.1614750.82.32128.4450.72481.1111105.4111.51115.11085.431.91134.1919.72507.51720.311262.4132.4118.7104.6124.988.91090.712.5512.4113149.166.5145.6225.31395.8112.7316.5230.1145.4114929.6594672804.4155.5238.7339.5618.6378.6115473.6276.3355.8431779.1286.2826.4464.8562.1116228.8183.6205.8214.2113.4286233.8157.3281.61171259.3645.92714.71854.7284.3889.6776.55906.81981.411816599.4148.2154104.5952.7926.263.2218.811974.155.595.2192.8129.2122.6138.969252.5120154.788.6159.7229.353378.8126.8101.7185.5121470.8523.41077.7284.1270.279.91935.6440.9773.2122139.13251.8203.5559116.7160.998.4167.8123127.6127.8146.622386.8290.5147161152.7124323.6121.6123147.7138.1317.32203.4125.6200.2125909.9886.8770.61100653.61873.2823.8980.31308.7126865.41870.31455.2950.6132.1353.6443.81299.3756.7127146.889.1116.4108.3102.8176.389.7112.1164.4128199.2243.1243.5292.8184.9435.5169371.4255.3380.5129201129.2160.1346.8964143.6229.7180.9349.9130436.5199.9143.8114.361.5134.4300.873.2120.4131133.992.374.488.583.4229.7410.560.2101.7132170.5183.6217.5279177.9291.2172.6176.3285.913376.5158.571.8115.244.6280.4133.976.658.9134177.7117.692.687.147.4135.3194.3131.1125.4135668.9332.2491.2604177.1258426.2374.2376.313889.5107.6139.2104.1252.7204.2408.1146.3173.813994.561.7100.115466.7109.2217.669.769.7140488.15040.75478884.219.9864.2414.12686.32320.61411820.22069.91896.41208195.66661637.71312.81389.1144389.92941519.1509.5290.3566.43501.12333.5594.6145176.7233.5205.8273.5163.7364.5169239.5307.6146180.4184.7182241.3165.7371.9208.9218.9287.114760.667.536.535.9453348.839.784.2148218311.7680.6305.9613.6301.8333.6170.7855.4149389.2615.3612.9411.246.938.6377.1483.8290.4150292.4123.3170.9249.3169.9382.61326246.2272.1151172.2109.5207.1176.5173197.7201.353.4217.8153100.2143.8139113.197.6119115.697.7102.5154965.5130.7240.3422.3239.6103.1344.9332536.6155150.4145.1158.1122114.6231.1116.7136.3190.315672.357.376.997.860.5106.585.449.191.715792.1101.4129.597.6197.6183.4266.9102.3169158105.718.195.3311.11.512410.317.71593118.92438.522544357.3169.72658.71376.23763.92939.41615.610274.943.713.3206.35.919.54316286.452.8243.7212.12021.652.643059.9191.716475.9635.3125.446.662.790.54939.7520.4106.51668478.48844.47517.89251.3668.65048253211114.95155.6167944.42088.22168.93078.335.42685.3569.9438.52149.5168981.2741.9536.9381.5101.8263.91589.110901157.8169998.2828.41558.63346.84596.6373.22769.4732.918910.11701690.42036.11458.21172.61929.3472.11536.61074.1748.217135.61.21357.1179.92986.61.21399.739.73790.7172660.5696.5574.5822549.6679.2517.6539873.1173172.3120.5182.9172.3441.691875.5186.4445.71761.132.122.81.11.1269.93233.21.1160.9177675.5641.9541.61175.8196.51163.3437.1345.5599.4178144.2121.872.4360.41481.810252178.688.7313.717952.187.193.5143.381.8124.175.443.4153.818095.766.1137.1160.5253.7190.5496.269.1199.31818377.69185.510162.211258.51081.711429.65621.912118.410006.8182458.5488.6593.1336.2742.2148.2383.4287.6393.918341.78.1711.7110.5624.41.2150741.7551.1184241.8165.4281.2458.9346.3189.5244.1175.4339.31851648.2527.414631633.23854.7591.41805.11354.3962186852.3370.9554.5405.8293.7714.5452.3164.8319.518781.476.3149.6122.4192.983.5478375.8136.5188325.564.9281153.1548.572.7239.9148.5260.2189179.136.6199.499.5226.774.1111.4100151.719065.256.757.5206147170.8473.9107.2158.51911282.4180.6706.5991.91859.6193.4671.81181.2884.9192133.159.797.6101117.7186.91346.880.1111.3193281715511158.41627.3211677.6728.52190.6745.3194224.1133.7191.1211.394.657.1198.579.7112.4195210.1378.3415.7457.791.8391.3167.4250.9161.21962059.16068.98250.36100.2260.49272.94421.52709.17446.4197116.374.972.569.91094.792.5126.697.4137.719869.154.579.390.464.8142.2658.474.2125.919973.163674.4113.73555.687.8295.6125.91666.8200152.4193.6440136.71166.9233.9450.3193.7343.6201101.231560.4302.81214.517.79030.41612.8203703.7907.41270.851492.1126.91145.21552.7207.62041285.1377.7403705.288.6338.5595.2922.9476.32052463.43054.53730.84980.4361.5572.33463.46141.23833.2206187.4167.3168.6267.31097.9453.7228.3296.23177.1207288.43037.32123.7206.161.4218.8485.62438.31258.7208190.397.4336.5323109.99.2306.2227.8548.32093259.23551.65575.62237.4150.64727.51832.2732.23005.42118683.622986.220317.733405.45657384.79662.329932.520413.12121572515.7339.7208.580.11016.31086.1339.2299.921394.59092.1102.561.4224.980.966.5121.6215366.75578.54327285.678.2266478.13071.21903.3216633.5670697.1660.4547267.5566.7785.5412.5217235.7147.3281.6384479.998.7277.7221.7271.5218191.6481.1295.1384112.2335.8274687.3319.72207479.4131.986.9109.2139.974.378.798.2221739.77751236738.21516.5159.5796.8459.3439.4223226.1262.3230.6220.4235.4419.6210.6191.4360.2227784.7236.7712.838644971.950.22112.1483.21731228427.4369.6410.7756.3119453308.8321.2777.9229121.4178.2180.7386.6270.9497.6489353.6172.92308563.3105.6210.31243.740.9331.4106.7325.5231337.9417.5650305129.2163.1486.4499193.8232213116.63960.5604.61673.454.44508.4185.82113.523325641822.66196.92781.43667.31118.930846379.74116.8235137.663.4580.8361.21679.592.883386.22441.7236160.2120182.2264.3417.6254.8288.4125.5310.62372392.51737.21778.81851.23102.3638.82558.12048.71204.1238934.81575.11087.91078.8215.5179.11369.62083.3807.8239256.359.9259.2442208.4101.6275.958.6485240316.927.3330.2381.268352.8381.641.4575.1241602.736.7562.8985.9886.183.4734.2126.712142422714.732522781212922000.8874.82544.9845.16760243477.1168.4373453.47356.1182.8441.2223259.3244137.2198.3172.5137.8308.4111.1215.7213.9147.9246262306.4301.9426.2407.7346.6609.8874.2145.9247117.5142.677156.9119.1289.1120.2120.9213.4248216.4124.174.2115.892.4107.5317.2126.7106.4249180341.2320.1176.7185.5885.1399.6131.7791.825163.8107.9106.384.5742.744.5117.594.5111.7253190.7244.8204.4375.3374.5218.4376.5486.5269.6254145.41957.11159.5243.2123.7228.21365142.3312.9255170.982.951.9379.11787.51107.52481.491.2318.4256517.8132.4995.4353.11340.6331.8499.8141.83605.8257124.3174.8165.997.2172.354209.3115.4173.8258241.2253.453.4345.6104.4131.73.9456.5259692.265.2512.5236.2422.21.2669.179.7638.4260153.5168.4123.3295.4151.6561.5224.9163.9266.2261197.8221.1313.1301.577.8119.5496.81094.7301.6263698.9553.8407.2370.61231.9141.3387.3692.4333.4263135.578.4109.7225.91211201.2434.596.2404.4265362.9618.8519.4342.3102258.8178.2477.2588.4266246.8201.9307.4607.3257.6820.3300.7537.1367256115.8100.6138.3134.8325.1134.2161.275.9165.2268209.2366.9653.7922.510480.6333.1299.5775.926940.748.542.372.212690.53060.591.4270466.8148.2169.3215.5180.7290.2237153.1262.6271340.4250.6292363.1191.9147.4231.1338.8278.4272419.7600.7550.3549.6590.7925.3506506.9675.12731329.64064.85723.54200.853.9141.92361.52682.84782.9274572.9159.6459.6777.22112.55901292.6264.9670.4275400.8151.3339.13981769221.5415.8329.2264.82761260.73041311.25788.99405.7142.23231.8599.62504.9277175.4164.3192.2231.9150.5254.7152.2197.2281.6278110387.3544.7209.6729.138.2801.462.2875.427918533010.31676.63236.4131.7425.72072.32745.719872802108.74444.52655.33526338.9391.32886.54540.82685.828118.42553.6118.367.5103.2129.13649.1282208.4189.9229.3225.9218274.6281.5269.8574.2283226.2239236.5269.1179.9647.8210.9202.5338.128476.58385.584.861.1154.183.451.987.928583.481.898.2109.970.2153.387104.4126.62862043.9638.51891.2121.4602.8343.8417.5688.5824.4287102.2122.8119.2106.4113.9133.595.5144.2149.6288142147.4138.8152.9154.3269139.9140.5203.7289673.81.2569.8199.41260.8269.4831.465.92672.1291209.644112.8181.3341.74478.999.5126.629262.940.3181.849.2103.447.8786.436.9412.2293489.3121.195.172.652.199.7409.750.8113295527.5128.5168466.6768.9354.3354.7222.9256.1296773.6924.11329.9843.81063956.81070.2873.2688.92975251.985.260.12284.195.470.852.296.9298295.2198.2300.3295.1502.3161.6292.8372.62902991170.61365.1561.9926.9160.3431.41139.9604851.130079.1638.7458158.4272.1104.6617.9383.6205.33011366.1435.21418.5798.3317.5423.3664.2750.62119.830214.821.621.113.6121.539.524.79.534.93031272.61149.6761.8834.5159.9477.7449.71072.6432.13041151.3128.6230.5335.2454.3186.61221.7235379.7305151.1238.9140.3950.2110.910771043.9166.7211.5306136.4144.5117.6155.2192.6291.2118.6150.5228.4307132.8177.7207.1196.3120249.1112.4122.8281.53082569.41758.72241.22859.3230.62770.2677.22894.91090.1310980334456.4390114.5278.1997.8654.8472.6311142.673.184.3121.478.4146.9148.3200.6115.73122560.457.2426.889.218.4574.8506.6402.8956.5313209.5119.1121.2222.791.7201.4478.692.9117.2314158.8162.7249.8188.5309.489.2547.1122.9576.3315702.8557.9900546.6104247.6529.5657.3404.1316250.6332.6259.8311.969.6518.6460.2314.7248.1317150.5169.2177177.5133.8233171.7173.6261.631840.7117.2213.844.547.318.657.859.89.1319309.7173162.421797.81038.4828.1117.5167.2320822.5511664.1815.9185371.3845592.1437.2321629.1258.6321.1511.8309.4452.1355573.3321.3322195.9274200.6228.2502.2565.2318241250.53235483.13828.63464.51733.4233.8941.91329.523762289.1324224.96144.885.43256.6246103.970.2325342.8379339.3282.9230.2339.8313.3331.33313262895.36732.36959.5716.8385.8689.61354.33462.4810.23271426.89107.3745.331.892.330.540.5328281.4393463538.544.8160.9160.6240510.832983.38072.151.7315.4197.3209.565.597.533051.440.962.538.864.68649.845.375.4331310.9265.9292.9290.5301.21151377.7262.6363.2333770.8635.61012.3910.6190.7762.8346908.1711.7334207.8219.4166215.4137.5112.8565.2135.4170335155.680.9114.5131.990.7718.1215.7922.8155.9336340.7427.2563.8689.196.3436.7487.1782.5499337284976.8200.7463932.4112.2638.2474.2194.5338177.2183.9190.4175.1273.459.6256.4142.1229.6339395.4525.8437.1581225445.4326.7362.3485.5340223.5251.1290.8318.2197.1253.7187.5285.3397.33414738741273.4721.4508.71207.3566.8660.8584.1343469.4161.578.2124.93661807.9128153.8117.83441783.51064.11156.41751.4281.3986.51814.71291.31259.5345244.8232.7258.2265.4279383.5225.4192.1278.1347939.31308.920122968.2324.41367.92442.71031.32634.634816192746.338364352.3628.42022.45951.24142.13535.5349208.6294.7249.4334.4413.9154.9222.4262.8343350265151.9221.4354.31016.41.2367.5179283.6351121.2184512.266.7230.2220.7229.769.7320.1352468.7405.1432.1461.6124.7253.5262.2439377.6353422.8154.1375.8272.6206.3272.5306.9342275.33cSEQ IDNO:830TT831TT832TT834TT835TT836TT837TT838TT839TT3541607.71269.469.2410.92189.223.1352.6432.9560.63551226.29155.4818.23259.74192.960.26955.82712.6387356589.5420.2584481.7485.2628.1781.8356.3432.6357639.1496.4606.3873.1453.3762.3556.9747.8483.83581141.11537.22093.31332.41450.67851727.41490.9867.6359410.8324.8302.5275.6347.4372401.6274.5352.8362433.71188.9809.4714.8722536.81286.6790.9408.6360355.3785.8548.6473.7527.2237.8648589.2258.9361669.1117.2502.4332.7153.1491.8673.8155.9634.6363624.8516.7452.9386.1575.4348.2555.6423.3578.61681.61339.4926.71627.51378.3825.91180.51556.848322308.22517.82273.153471263.42813.71449.62931.32339.67760.1396.2691.31209.2602.6682.5797.8924.6504.681540.3559.2932.1520.1496.71011.1563.4319.8942.692980.91665.35198.92703.91212.74689.77367.24021.72722.510122.4197.565.2110.5139.559.499.3137.7236.611376.8703.1345.6651.8578.7208.4539.6862.817413181.2792.6515259.6570.1291.6711.6596.7310.514618.32196.318021423.91281.31502.72410.12087.7533.515807.11589.61001.5828.31241.5307.42913.44498.6625.1161484.539321622.52238.63413.61419.62274.42625.1831.617699.7876.31400.31300.9988.912811049.52078.4694.119482.6465.62749.2461.1810290.31716.71582.71076.22084450.8263.1290.53601.1182.4324.9165.72191.33467.2514.91814.13225.9499.22094.71840.3181.3223156.14671.95203.46611.634352468.19279.36745.64447.323495.31234.61083.4798.11519.6356.21191.82950.2871.624274.4317.3405.7185.5432.2235.1795.2871.3137.7262752.24302.18189.51864.33917.42490.769745535.2470627424.6749.91258.81611.9871.35051476.71146.7506.129165.7162.775.490.5104.294.3114.4146.210130312.4592.5409.5348418.1136.71284.61307.6408.131331.712536.518349042.716967303.85146.56843.3352.9331256.24507.91474.32328.64981.8451.74542.511875.5544.7342831.94923213.2870569.71873.22278.6454.62785.13512171751.1260.4933.61418.4120.2423.2768.6680.336145.6258.1974.83626.3913.3524.5893.81391.4185.237286.6268.9312.8203.1264.8203424.3264.8270.438709.73086.61199.9882.21931.9384.41810.37524348.440603.3849.4466.7631.9695.6357.4654.4633.1633.241285.5513.6628.4721.924821004.7621.22126360.342229.9548.9402.2516.1450.5519.8332.6612.9222.943390.1489.1363.3192.2399.6388.1369222.3314.144652.8952.5925.31044.2930.7784.2962.51223.446845691.21619.8791.51433.21616.2618.51030.51531.9335.246351.6412.4339330.5453.3276.5345.7346.9376.647256.3423.2349.8448.9546.2138.6305.9635.7188.248297.1112.1708.1397.5367.9134.41885.5680.11204.749497.22981.61179.97125248.7553.91047.2640.1381.850350.3659.2627.4427.2665.1230.31754.62654228.25180.21018.5175.1392.4669.4374.5326.8448.477.752219.7261.6189.5266.9275.7214.6245.4224.4208.55397.51385.31668.82690.61207.650910962281.1132.554401.91101.61148.71527.2880.31550.3682.61648.3318.85587.279.5120.68164126101.5117.8130.85641.5356.3290.8220321.6255.3116.9178.9114.6574709.88263670.513995.12735.51208.72495.38987.21600.1585493.8942.8382413347.23431.81473.62604.69793.31896.959990.84570.92467.22820.83584.11578.82600.22511.91043.96086.6409328.3697.7313.2195.4394769.5205.861148.6102.4113.5119.196.3180.5151.5144.590.7622552.434192087.81947.43982.4632.74686.31552893.863138.1500.7504.9621.5477.8416.2765.6623.8200.964194.3430.21152334.21238.6157.1225.5301.4184.865119.3275.4393.9220.9330.6146.6362.6472.9192.666644.51716.5799.82089.91882.3860.9884.91790.8494.16733664.71869825385.329495.122746.132326.635830.425673.330440.8684863.4757.4639.2500.3628.51067877.5537.22729.1697538.61746.32633.52161.41446.63285.43619.92224.23873.7701167.74005.527754480.95935.22888.42408.73524.21112.271331.37296.23308.34722.76620.9641.733237752.1521.972867.22722587.71727.12480.6715.11071.12441.2729.373248.7702.4513.9998.3674.5351.8560.2646.8291.375191.9299.81021.22627.9481184.1684.53040.4241.476602.9419.6424.1687.6576.51929.4374.11713.5249.7773969.71046.928031502.31123.73525.23967.9610.4302878461260.7681.4434.3255.4719658.2440.9425.579112.1359.7118.8269.2354.3241.7238391.9129.780211.4800.8565.51265877.2479.3445.81163.2181.681381.48963.91038.97150.58082.3289.12966.65268.9339.882204.4189.8246.1203.2216.8260.9253.2152.4345.884167297.3276.3381.1417.7274.7303.1497.5238.985186.41174.1201.51066.11674.8143.6434.1306203.88675.7748.2119174.2654.484.9219.2164.9102.987252.72338.9668.24451007.4249.11199.6589.5215886167.9470.34262.61023.8548.15577.94604.6683.83916.789267506.7193233.1541.1192.3266.6262.9321.890190.7110.5214.3244.9280124.7260290113.5917102.81126.21543.86389.72050.8529.2760.67087.21108.2921861.99980.697447280.95486.57913.27006.754122498.893163.2108.9245.5157.5112.4254.2250.411919394839.45771488.51006.1405.51082.51126.2964.8634.995515.41234.6807.9454959.8864.4770.5494.4662.296144.9212.1199351.5306.3223.8227.7302.517597130.8471.3333.4484448.6329.5480.1568.4147.19815.832.437.634.451.33938.465.938.299318.3435.4289.7489.3399.5198.2351.7473.12981001291651.713251.41990.7423.34429.813164.22305552.1101532.8290.8329.4342.8316.8363.7300.1234.7333.5102229.2186.8199.6138.3206.2149.6226.5175.3202.1103342.5406.4434355.9371.1306.7526.4435.6362.1104596.190.6698.7267.865.4947.3366148.9436.1105533.986.9770.1333.9108.7831.3274.7239.4443.9106573.670.7537.2270.6112.2911.2341.9194.3486.51071027.4294.7183.4222.5716.1250.8263.1280.6335.9108241.6145283.6211.1169.4333276.2235.5308.91091066.52807.42388.41135.51428.22931.41315.42683.795.31102960.771996101.12633.53373.856145706.16310.8130.71112125.4189.5742.5359.12531180.3925.2140.91262.1112523.32050.61308.31693.41084.81386.3718.31809.1394.911374.8326591.7308.2365.7404.6253437.5190.6114494.6580.3510.6830.3436.6489.3361.3460.5588.4115501.5966.3740.21215.51149363.512251118.5466.4116279621.8666.9515.9520.1199.11091891.9310.31171708.9122.31731.3467162.6817.71395.5183.91888.5118136.1129.6287.9133.897154.8231.6230.9391.1119250.9375.2298.4289.2272.3298.3279.5171.8367.912013598.5266117.9142.2119.8265.8210.2170.8121925.31636.723415981.423051239.63217.74469.4424.6122146.6403.5321.9294.5387.4169.6475.8415.899.5123185.4288.7188.9285.9269.3240.8291.1457.9164124178.1141152.797.1156.7104.4167.4144.7176.41251161.11141.82587.85502.61399.36891600.72696.81040.4126656.838.1771.3130.617.21187.147764905127102.9244.7132189183113.8209.9130.613312838769514.5255.768429281269317.9214941338.31293571983.42117559.51969.4382.48991412221.413080.2488.5349.7368.2469.6255.7169.9378.510913197.6577.1413.3535.1592.4154308.1504.5115.2132259267.5225.2362.6285.3231.6294.2316.4233.113362284.1126.4152.8224.7170.9160.7281.170.9134129.3363.2256.8186.3308.2228.3147.2117.2137.1135398.3284.6523.7620.2375.8623.2554.6638.2372.3138150.3205.6166.6165.6244.7180.3238.1192.4141.713987.282.8324.7238168198.4204.8178.3147.61402117.8107.311571151.668.32112.41062.3199.72021.81411371.76772205.3517.1203.11460.21313.51101344.6144487.86712.69651.113878.13393.49082.55985.522188.6513.2145262429.3287.6252.2268.9217336.2203.2226.4146194.8463.3178.9314.7540.9163.7240.6520.1224.114759.756.9119.9366.315250.5148.4263.9103.4148821.7868.3548.5469.31125.9334.81013.8676.8741149242.9174.5271.1252.6219.5363.8434.4169218.3150183.1227.8233.6259.9424.1141.2359.8423249.3151211.41131.6570576.6580.9369.8475.6262.8327.615381.4122.6274.3196.9115.5453.6156.4725.7123.9154687.54823.41405.35742.34211.6942.82873.59112.2480.4155139.21013.1289.7320.7766.9289.3405.9264.7116.915677.8638.3346.5465.6740.7128.6262.3511.3127.6157210.4137.4176.314419897.2246151.5150.215814.71191.6243.3631.9852.7303.1733.1924.112.11593335.31313.52648.71400.31293.62577.52106.81174.13077.416158.469722447.55870.85806.53314.6521.94390.498.3162145582315.4818.2813.391.8982.12165.6316.316475.41096.75139.71786.4674.5836.83086.4577.7211.61665882.41758.73139.91274662.73213.14469.71150.43810.81672593.91006.12947.19871134.42040.22587.31035.825691681092.3472.4620.1812.6879.6719.1508.4613801.116916935.611084.67798.311788.66525.44941.21021913134.44408.7170640.42234.22081.12242.82170.820861389.52450684.41714002.88601755.1540.21265.9373.53814.41969.22887.5172871.6562.5496.9524.4536.8741.7618.8487.5795.1173575.8843.7419.71448.7916.9512.91159.72172.2361176217.51069.11369.41083.4461.52385.1823271.771.1177712.3592497.4495.9559.8651.8489.3372.457417833317221370.524001863.31852.31112.42050.7135.6179148.91165.29141121.11438.784.3739.11727.8116.9180178394.9592.7482.6468.6261.9679.3584.8124.91818559.63563.79515.25496.63150.66350.885355034.99024.4182303.1363.2607437.8284.5355547.5405.8347.6183463.4743.11416.6409.4692.8313.61066.31567.7752.9184321.8771.517054.71022.13464736.3714.2527.3221.3185858.57670.73976.33238.86074.4967.86474.35307.21275.6186422.8223.9502187.1245.8411.1334.5155.1496.2187130.6301.4247.9382.4430.998251.4429.4499.9188231.3443.1490.2209.5672.4207.6460.1490.2230.3189186.2290.4253.1112418.8162.1356.5338.2129.7190115.7719.2278442.3529.6419.8501.5634110.1191762.22944.31482.914911153.8593.32253.32972.3855.819290.9135.5169.182.5159.1122.1164.695.6111.4193830.6156.9650.733273.51566.3778.2246.1749.5194116.9307.8210.6367243.7248.1220.6242.1121.1195167.1213.3230.493.7205.8349.5194.4147.8226.81968492.84271.54837.942454837.65613.65166.82741.27143.4197126137.688126163.162.4170153.799.719877.91237.6107.31714.12069.7160.7379.33850.142.81991975.915850.11067.13670.66331.392.910936.94209.3574.9200442.4367.6806.6641.4731.8272.8852.3608.7378.92011717.31466.362.74092205.681.5409.1388.1531.5203185.51325.51994.82659.61146.7553426.71650.6294.4204640.5373.89901221.5639.1971.7716.9673.8413.22053638.53132.45021.14836.22548.84867.65773.15664.64500.12064305.4266.2226.9194.42367.5186.11565.61933.113603.8207991.424.6637.6252.975.41349.4407.4119.4589.5208589.91696384.82423.4990.6458.54652841.2361.92093044.41250.13110.3684.4220.23097.84613.7225.9281021121702.91636106.71726.7272.320338.214214.4218.113108.3212363.11146.1984.21161.81648.51165.9720.91062.1324.3213117.585.693.180.5140.7104160.1103.1133.22151547.871895.2308.853.32847.9790201.2863.8216466.2184743.2255.8157.4648.4522.1231.6528.4217253.91156.6956.51388.7916.7655.7993.91488283.6218273.9156.2297.3168.4134.5253.5206.7182.5309220111.8108178.487.687.478.9114.573.195221401.7980.8956.61765.31118.9944.12190.12120.8463.1223313.8693.9257526.7856.5230.4725.6679.9230.52271309.42741.4829.91455.72656.4513.52644.77955811.4228788.4341.7662.1341400605.3554.8321.3480.1229165.7231.4242.7245.2169.4132.9206.6199.8256.2230378.33159.3602.92495.62807.6427.91760.92607.2253.5231179.7503.81002.1932.9465.2263.4286.4683.6168.82322120.52917.66467.51163.83285.81825.25213.44175.93969.42333812.28994.910159.2166878022.53071.410101.614509.85294.22352787.4609.31195.2414.8721.3253.42159.89211447.2236205.5420.9541.4310.6425.8168.2568.3431.3257.52371075.91872.52343.12170.919471599.717141850.91457.9238595.7686.41928.81067.3636.71278.61084.7907.4839.5239408.99101240.6343.7979.2698.31207.41043.8297.9240439.8896.6923.9386.11012.3671.21029.81706.7346.52411039.922072261786.11746.5143122862914.4614.42426785257339423.818037.623053.81044.822442.727313.93641243172.2719.2374.5427.7727.7198.8793.6730.7379244117.1158.2359.41692.5225.5224.6205.9781.3255.6246205.21124.9754.61864.11124.1998.2993.12067192.7247158.1122.898.990.5167.380.1192119.8170.224893.39642395.24780.41534.51401.21160.43767.9132.8249628.3275.9966.5609.4278.51711.81017717.3746.225186.71115.8467.4572.21064.5196697.9947.778.7253180.8267.8313.8390.7438.7298.7304.7693.5229.6254323.1411.81816.51559.8527.520751017.11776.1350.4255307.71612.21295.22395.71944.51881.31003.52216.6117.32564984885.51242.85330.61414.4583.9717.62463.5988.4257229.6347.5146.2392.4283.4105.2231.5331.893.6258467.51932.3306.9580.91669.950.71440.1419.2185.1259656.1739.81239.2816.5649.5213.61710.4612.8550.2260211.1149.6119.9165.1155.4190.5169.4142.4201.5261304.892.6456.1380.7123.1205.9183.4133.3296.1263416.5696.6508.2595.2545.5479.7789.5725.8408.1263565.62856535.62244.52669.9321.71544.82324280265470.569.8209.8116.197.9338.5324.8100.9325.4266256195.2345.7246.5313.5349.5292.8235.5347.8256173.1291.4341.1568.6490.5185.1300.4785.2162.7268527.3595.72023.3935.85451146.6808.3526.4721.426932.6266.571.6170.1494.552.6298.3240.865.9270279.9197.9274.9183205.6244.4305.9202.5162.7271242.71141.1567357.71086274.5625.41269.3250.7272700.4967.8477.4599.8826.1428.3698698.64802734697.92112811.9916.2234.73500.54802.815501104.3274603.81411.81737.5867.41091321.91389.71216664.2275225.93619.51297.8806.92484.1321.72165.11639.8396.927627324767.82036.42069.35010.28446695.512351.91238.7277255.2264.7225.8355.7325.1200.6250.2259206.6278765.81291.51132.11008.71492.3255.41550.71198.8598.72792233.918371527.82169.71934.22261.91828.42407.22843.72803349.32489.91693.73130.82269.83147.523373287.72513.828137.7385.1326.7815.7570.2488.3255.1762.474282523447277.81273.6749.8235.4421.23058.5317.7283447.5340.8310351.6440.4246.8393386.9348.128474.483130.8103.8100.871.2141.1145.889.2285116109.8107.896.2136.895105.2105.693.82861056.763.5148.968.854.6307.6176.760.5344.1287126.981.8136.5115.2128.5110153.795.599.4288172.6145.5166.4146.9195.1144.4165.3173.21842892816.84208.51023.72660.24312.6404.13191.635391715.5291120338.3132.7186.1234.4129.8203425.5113292473.6820.14181.16680.4826.4110.48212.216919.5977.52931201421.41229.9592.81834.6509674.6986.7171.8295341.61948.41254.92043.12299.81064.41671.92245.9229.1296552.71443.51644.11603.51908.8822.21505.81432.6753.829745.390.894.650.313953.588.5154.3116.4298440.1517.5501.4487.3470.9471.4489.6506.6219.8299725.6819.41275.94386.63103.31663.7910.54069.91147.8300177.41033.2826.41230.71114.8748.3543.41306.1250.13012124.1211.2358.6194.9158913.5300.7228.4485.730237.22676.5240.6211.926.1121.2193.646.4303324.2270.8472.7273.6263997.6487248.9581.6304344.9585.6322.9461.8884.2214.1543356.5364.9305175.5190.4287.7598.2791.2551.1859.42550.8158.7306189.2803.1191.1557.8620.8163.1322.9218.6195.4307302238.1145.1553.9295.1159.8280.9449.1226.33081190.6794.81165.2705.2515.11800.1914.4520.91641.8310362.3134.8505.7103.4125.4229.5318.362.5326.131162.7499.8263.8932.2246.8162.7224.51036.4115.8312902.250.7593.6151.654.4843.6810.119.4523.1313132.9517.9687.5313.3244.1457.1385.1576.9131.9314522.6650.8980.11264.11058586.81856.21354.1372315391.8154.3554.7155.4153.4591.4395.7235.9458316210.3558.3491565.6525.6484.4470.4509234317314.7271195.4240.9303.1168.8387.81026.2214.731845.9383.2425.9527.9428.597264.8364.3127.7319174.9528.4259454.7535.4302.5225.5319.9223.3320572.9159.3518.2278.5211.4569.8518.8239.3464.9321307.2232.7332.4169.5222.3311.8367.9203.1354.6322164.7350.9214.6345.1354.5264.7257.5318.3243.33232580.91349.53402.62592.21137.53939.82125.91848.51426.632469597.2475.4645.4435.8233.3224688.172.4325317.1681.6505.4818.9491.5395.8558.8605.8254.63267901838.62873.236072251.94068.761443552.431363276.7409.378.4615.9402.11018.7342.630.3328751.2151376.6307255.2542.9560.4300.2662.832985.3109.991746394.777.945.980.633054.9951436.11119408.855.7678877.4141.4331403.9382.1215302.1371.7380.3325.4324.5332333571.4156462.8160.5140.11058.8443.4150.5603.1334195.4500.91027.6250.9655196.6332.8432.2161.6335155.1109.1732.5572.2165.562194.8923.7127.6336668210.4480.1280.3175.5389.2344.2252.7445.1337197.1220.6207.5266.7387.8309.2374240.3256.6338217.2890.9464.61427.6896.6189.410391728.1231.7339377346.8345.1332.7324.7435.1457.4277.5454.9340330.695874.2237.5123339.892245.2222.4696.674884.9304.2341657.2434.5521.8461442.6785.8552.9485.6713.7343109.44793.6207.9601.92590773.611381171.957.13441167249.7893.9545.2581.2963.41019.3554.71114.2345252.6620.5437.9408.2509.3204.8544.8404.8294.13472279.31845.76453.334901999.53041.526441859.92280.83482856.12533.87636.16329.83556.35813.95133.14694.95037.6349353.3256.7290.3316.7301.8407.4319.1485.8258.4350386804.7473.6475.2611.1257.1657.4638.3199.2351308.42206.41213.12566.31996.9246.91150.32079.9292.1352355.683.4314.2140.3111.5364265.6231294.5353232.6402.1295294.2423.7229.4384.5414.6243.73dSEQ ID NO:840TT842TT862TT863TT864TT865TT866TT867TT869TT354413.4103.128.589.150.8119.4632.29.248.7355518.163.61683.329114.555.849.544356617.81163.11507.8789.41313.21067.31224.9824.3740.8357750.6663.31662.6876.7839.2166012431043.5843.5358647.8509.5567.71088.71049.57951349.45351699.5359330.5214.7472.1313.5373.5481.3371.9361.8235.3362288.4245.9172.7589.6377.5866.5666.6454.5954360434.1305.6182.5297.3370.2347.1290.1218.1444.6361682.3740.4589.9765.7495.7894.5527.51472.7327.2363435.5328.8483.4387360.5673502.1431.23671532.1658.9827.5640.1768.3484.6619.1510.9964.524059.83830.74516.53770.52512.93756.62448.43524.23003.67483.8209.7470.6825.4484.2153.7393.7965873.781199.11312934.61643.21176.8871.71342.3768.573298223.92596.37524.86220.93456.360277023.57427.53975.61051.296.267.9101.6111.8139.375.746.4157.411171.2198.5495.5218.3206597.6634.9288.5318.813537.426536.3777.1442.195.7614.965.2238.9141233.61157.9134.427311781.1837.62365195.6747.915699.2133.5191.7417.5408.8260185.5349.2539.416662.41257.31518.21301966.81066.21385714.31347.5171194.51224.22909.61355.91395.51413.21584.11543.71301.1191305.5169.4164.2167.4153.8335.4192.4217.81592011.11.1551.11.269.636.11.72.721240.887.245.6290.614.9100.6193.61.2665.2229947.17799.811063.45454.85808.55943.25158.28719.74509.223956.71.148.1157.61.14.328.877.362.72421830.6818.7223.955.222583.6138.2313.6269557.176.6228.7772.158.3169.6349.8241.6342.127776.7416.1446.1321.7837194.8624.3214.8248.92959.3307.6113.8111.9151.893.7155.294.7165.930116261.136.17437.733895.9132.181.431656.370.713.126424.8107.5243.863.61804.133863622.5646.3338.4225.91364.6528.1298.3824.13448014062.87041.92172.22709.97154.648743483.41898.935349.548.62169.1220.8140.3127.842.429.636247.6112.170.6952.1127.4437.9132.7244.92851.637359.5154.3129.5201163.4356.6166.6166.1147.538818.9343.8681579.21066.9635.4454.1452.9944.340584.7371.3337.3437.1313.3551.1403.2378412.841247.9211.828324.9206.9141.2142.1246.91045.242201.277.8271.3370.1220.5370.8243.3311.3477.743319.5237319.5348.9367.9367.4376.6359.5514.544340.2338.9375.8466.7295.21064.8611.2385.6862.445387.6484.6587.1607.2566.7339.3634461.7686.846312.8273211.3310.6243.5430.8275.4232.3243.147267.1166.995.5209.9200.1356306.7200468.148586.432.736.885.415.6170.444.6128.752.449559.1182.887.8323.1320.3292.7479.7171.12445018351.5313.7151.254.7307.2159.4147.7107.55150.257.325.153.527.6365.3326.7129.5249.352195.7196.6173.8234.1186.2225.4159.6208.9221.85382.534.1142.8294.373168.9158.450.31001.954497.51164.8197.81471.81002.7709.61166.2163.11728.255119.7111.7100104.890.9118.711694.592.25650.478.915.7207.8125.469.186.591.815557913.7120.139.3348.796112.4648.363.71449.658937.3144.433.7395.5111.4501.81139.162.21741.7591524.72456.92314.61572.71908.71437.11816.2851.3158160239.9177.8101.9208.9122.9164.2115.8114.4341.661138.8102.4167.6195.1161.4602.8171.7220.1121.5623218.41230.893.3144.41893.7776.31111.11116.3275.763476.2251.9390.8305.5390.5446.7360.3186.241664260108.572.5133186.3125.9184.1121.4174.165130.1114.1115.9113.8100.757.684103.6167.366736.81620528.81200.91060.8922.41062.5613.31936.46736967.432327.935416.133262.733086.450663.133055.833098.233842.1683604.6765.627112612.81433.63309.41090.53575.32217.7694370.22244.88123.84669.22913.39134.72674.39458.64732.4702223.51376.4751.723781890.82166.22162.91456.93220.2711018.790.71561072.2120.596.6145.6125.6898.572552.91523.3537.5355.6575.3229.2397.7248.8869.373447.7234.9263.5297.8293.7265.4305231.6465.475260.1159459.2194.5212.8460245.4508.2472.176273.6135.41.12171.1611.1559.9220.4108.31748.8774806.24952.77485.32585.44993.99359.96144.55753.5242278623.9418.4269898.4765.7441601.47031341.879121.6161.5129.6160.7133.3143.3133.6130.7177.480132.5767.81091.7413.8130.3423489.5238.5763.781512.5282.4123.8218.8242.42971287.381.3806.982309.9198.2168.6248.4267111.1195.8299.2260.384387.2136.773.1108.868.4133.596.7102.1324.185248.9142.390.9119.5146.4305.5231.4148.7109.486128.281.232873.654.4101.398.795.610187389.7249.9208.9161233.2395.2213.6276.9167.9883944.82735.38374.95614.35926.17145.86096.29499.14340.889354171.2148.1205.8141.7276.5145.7180.3128.590115.991.9105.1103.993163.4108.3110.669.3911164.3208.61.2284.296.6444.21453.867464.29240856778.22708.19676.95168.63758.86575.22375.710249.793301.2226.8421.5194.9232.2375.5171.1428.1163.794995.1541.1897.8657.7595.7381.98093351275.8951045.2582.5118.6543.6452.1179.3209.1188.8345.696151.5196167.6244181.7245.6205.7171.9230.897166.6276.5308289.5386.8228.9347249.1374.69860.431.52723.19.231.12038.221.799253.6187.7194.3246183.1311.2227.1164.5250.110019287.66400.48181.32605.310229.374039672.311255.4738.2101266.7227.3183.5187210.8246.9215.4175.2303.8102171.5108.4168.3145.6139.2216.4161.6192.6129.1103278.8262.5300.2251.6305.7614.4341.7296.7354.3104443.1801.2207.5609.2639.4662.8235.7480.5507.8105463.11053.8415.1584.5740.7772.3384.2617387.3106518.9705.8207.9540.7585.7524.4227513.5481.3107364.910541.3163.264.4139.2185.1113.3132.5108330.2330.9645.2275.1408425.5324.6567.1309.210967.36034.51177025.23555.9130.14629.256.54997.511028.911743.396.511643.76913.61.264691.112381.41111421.11571367.81848.83058.4428.31123.41923.11485.6112527115.6213921.9582.150.6951.8441.71495.5113455.9246.953.3182.6309119257158.9473.4114507.9943.61193488.7600.7470.7525.8646.51445.6115579.2287238.3468.6331.5339.6406.9347.8648.7116323237.9245203.6210.8323.5238.4227.4251.71172477.520495384.61932.82356.6215117244147.6916.2118442.91260.5217.3146.6481247.5132.8138.7375.2119196.2294.259.3102.7207.422.6112.9103.5412.3120173.763.576.211685.451.583.388.465.8121572.41198.8854.2827.21024.86711242.7359.71485.9122290.1202.3237.7134.1153.2200.7314.399.7125.712349.5102.7113.5109.8125.4167.4124.8161127.5124122156.7104.5141126.9183.5129.5127.187.6125901.7798.3548.8603.5613.71170.8823708576.31261558.52022.31906.61073.11537.31698.31203.71574734.612767.594.2121.1129.3177.1229.6142.1113.2149.3128270.3227.2174236.1175.5523.6265.8219.6215.4129252.6119.855.2205.4120.9238.2283.6118.6158.21307174.981.3173.464.2151.7101.272.2206.813199.756.156.9101.971.171.485.639.6410132179.1167.2163.5226.3168.3291.1198.8168.5289.613365.3135.6129.8134.1108.690.5155.990.6247.7134141.867.6374.3220.5242.9331.8297.9192.8232135323.6502.2986.3429.9398.9720.6576.6551856.1138179.585.7141.7111.390.4263.4150100.795.9139106.9129.9131.6116.9120.4167.8111.3119.2214.61401721.83036.32185.52508.84344.2551489.13284.424921412410.63225.51665.61916.72935.31825.52844.61474.71924.7144467.52221378.913755448595.38268.8333.624504.7145184.9199.7201.3201.7182.6355.7205.2181.5193.7146199.9232.9156.3218.2193.1318.3215.5183.7234.11473923.23523.839.48129.48.243.7148623.9168.1255.4231.2256.6443311.3211.5208.8149298.4748.7946.9488781.4682.8843.3449.2418150271.8256.3118.7145.6239.5283.8224.4131.5178.9151386739.9194.8394.3448.1199.1376.1165.6142153101.182.9117.5170.794.7158.393.798.7124.8154696.5806.1188.7316.489.7503.2343.3153.6615.8155126.391.9134.1121.487.9243.6235.9104.596.7156119.240.668.794.777.367131.662.7173.315777.5165.7132.1100.788103.8133.9113.1166.415830.39.61.4158.397.241.9159.91.21019.81593785.939174901.33467.13669.53653.43209.23643.53005.316190.573.4502779.2176170.63362.61.24114.9162165.648.850.34923.675.152.883.863.7164274.71048.7159.52491.43031446.52413.5213.42997.71665679.858946666.64629.28306.159723859.75542.74096.61672803.8865.7583.61447.21517.1468.11020.9895.31756168664.51070.8946.41307.61154.7804.8787.31131.51135.41694025.89912.97833510.54082.61690.63122.83606.33273.9170630.21665.51244.323081487.7895.51906.2884.12192.61711597.918.21.352.3123.43174103.750.6172648.7336.4566.3568.5546.7747570.3569.6634.3173301.5351.8502.4419.8242.782.9106.8377.31153.3176205103.637.42372.31244.74312046.71.16658.9177657.2340.2225.5561.7411195319.8255.7474.3178133.2340.844588.777.1236.215690.12026.1179114.748.765.586.756.789.459.695.553.818085.188.571.9296.6369.5193.3269.471.570018113466.711481.61449210957.29935.2218971018412851.67312.1182654.9653.9427.9406.4491.3347.1403.3562.8449.51831741.81.272216.61.513.4127.374.760.8184210.8167156.24707.4163.4275.2340.4183.2408.71852742.8559.8331.21091.6875.42220.61051563.71819.8186540.1408.4119.6379511.7293.6378.6390.8334.818746178.376.673.656.432475.8168671.7188583.157.1288.4239128.3224113.7356.9137.6189194.829.285.5119.562.4143.867.8131.368190123.9206.8248.585.4260.670.6194.8276275.51911270.22209.51240.3741.81132.93308.22393.3694.6828.7192119.58114779.863.3171.5100.589245.3193572747.22493.91776.21406.72749.4771.42411.61560.3194156.3196.374.6184.9231.772.8155.2181247.3195308.3259.1115.5265.8182.4266.7269.9321.4172.61968888.91967.31862.44252.64150.71524.32417.528384062.6197123.156.464.355.963.46192.788.567.419872.746.759.1128.186.2134.77689.21231.8199715.5149.977.4200.999.1117.193.783.258.1200436.8119110279144.7161.1188.8132.1183.8201420.4136.734.57682.5105.4714.746.948.3203216.9328.6478.51783339.6318.5429.8215.3696.8204424.2534.92224.1826.21409.91071.21167.6730.81179.72055342.36991.46610.97662.46557.24601.16434.75994.95922.6206196.9136.2256226167.3461.3381.3255.3194207856.92195.1498.133742428.9655.513111015.21559.2208394.5627.5228.8462.5481.5375.3249.2214.1366.32094454.31325.44002326.12927.3297.92136.12044.24109.12119691.910693.823350.114624.222270.23088817057.724224.720568.5212572.3271.2156.5584.8425.7440.5458.5393.6829.42136711461.573.571.3151.987.18182.8215822.12240.32843771.23251.7364.91154.1891.61823.72161084.81208.4774.3825.1931.310191459.9886.9394.2217263.5128.1178388.9253.4229.3192.2287.8619.7218247369430.6309.9285.4378.5371.4431.1300.2220192.165.172.882.964.6195.18297.9152.1221874.9273.4348.7610.2398.6589.1442576.1781.3223203.5216.6257.1227.9193239.1307.3269.5181.62271491.4508.8973.3663611.51289.2657.2715.41113.4228479.7346.7305.5399.5432.4168.3334.5406.8398229344.9179.3263.5202.7135.8258.4146.7307178.3230408173.853.423072.6146.689.472.61044.423160.9169.5179.7565.7166.8279.1189.2170.4295.42327655.569.6144.4522.16.3156.1223.7143.5237.323310823.98532.573806335.2465314890.46151.66357.98900.2235964.3116.899.5118.8232172.3135.3109.668.6236284.7110.185.2190113.2251.9125160.61092372149.22342.61981.719101532.61925.61630.121872001.92381376.81774.91294.31639.91873.913311069.91075.9920.9239677.1102.355.759888.8415.3790.4144.5446.3240910202.5215.31413.1146.1590.91856.1149.8658.92411746.2288.3229.31845.3213.41394.42581292.11300.32423459.73959.51573.1930.41419.24708.42169.81081.93241.5243789.8205.4201.9189.4191.5359.6385.6187.1231.5244166.8289.4346.4297.2266.9336.1253.7298.8291.7246735.5339.5415.4754.5305.6434.1389.1182.41612.5247152.591.8114.1105.7117.4162.4111.110977.5248113.4311.4156.1827.2163.8295.1550.657.7969249546.32609.677.31171.42406.91453.12505.91690.12558.1251114.675.4190.3144.567.4139.8164.586.3272.4253343.5454621.6336.8375.4294.5353308370.8254634.2878.2135.81836.51289.6195.3904.4151.21561.8255104.9294.141.8691.587372.2205.6116.51995.4256859.7310.398.5401.3162.4559.41488.4155514.5257100.386.9144.3100.1101.5226.9206.1125.7172.8258150.3110.9556.93196.4364.7435.11.356.52591252.622.514.571.4242.153.8318.252.772.5260153.5162.6101.6142.8117.7170.7162.1100.8140.1261284.9426473.6367.3285.2584.1539.9954.5991.9263387.1519.81024.7612.1575.4914.8292.9533.1500.2263443.5164.6135.3170.4102.9275.3155114.2855265418.7323.5784.91333.6878.4655510.2758222266365.9238.9328.9335.6303.6404.8506.9500.5362.225623248.368.8144.586.516174.181263.7268789.4359.6223.2619.4600188.7380.9385.6616.226929.523.745.237.742.9141.673.556.727.4270318.9330.1251.6249.2249.1310.4140.9168.8208.5271239.6226.6272.6240.3278.2416.5239.5262.2282.4272529.2443502.9351.9421.7790.6423.8540.7390.32732412.25385359.426772738.32513.72568.73343.16538274860.6187.6415.1523.9197.7408.9297.8848.1225.6275810.8120.9107.2223.4149.2360.4213.5132.2481.22763000.6430.1824.6833608.9992.7603.1628.91368.2277143.4150.6195.4175.5161.1288.2217.2177.8321.72781181.413.474.4130.2391.9174.1641.2103.4104.32793167.23036.43286.53373.92195.215421783.51888.52287.82802799.64372.98233.14783.53720.75792.33596.62627.63750.3281198.345.421.1878.5124.3131.5432.726.2503.4282262.4214.2212.7210.6257.2367.2315.7214.2206283200.9307.7203.2180205.1205.9289.5199.1361.328486.17944.862.958.368.854.764.267.528587.396.6120.599.390.3149.5127.69082.7286786.21509.21245.6480.51419.11355.41398.3986.2463.7287130.988.7115.7133.4101206.6124.4129.495.2288121.5110.5133.2130.9129.7239.3147.4130.898.928981797.81.2264.2130.1209209.493.1162291128.384.3184.7105.8127.5140.4106.4110.2175.4292325.5712.8127.1172.1269.8126.41240.75879293169.470.344.4339.3157.814.6329.257289.72951114.874.691388.6176.3215.7303129.7708.92961100.31475.6747.1869.31179.1893.31093.56641046.429780.1103.760.551.826.98654.951.960.9298262.5378262.4322.1347.3553.8442.5361.5482.82991244.6880.6660.41666.71114.4999.21190.8835.11409.5300221.5287.878.81021.2396.7142.9552.3600.21201.1301345.6176.4916.7791.8996.12261.6747.61879.6867.330230.111.59.61.29.552.18.231.120.4303659.7792.41951.7791.91024.81077.61052.71025.2591.6304338.3113.8145.9218.3159.1368.5315.3213.9279.5305126.3179.5829.3410.1205.7213328.4168.92353306137.6129.3119.7111.1136.2360.3171.7145.8121.9307116.198.9137.8143.6128.3221.3155.3111.8121.63081839.81691.43877.11787.21771.69901269.41210.91188.7310746.5649365.2639.4842.4331.6428.2770.7283.9311148.4156.4215.3228.8178.694.4194.5255.6341312960.41273.3387.3768.11668504.5546.2772.8843.7313116.8110.3118.2691.9301.6156.3349.8120.81297314813.7765104454.5738.3343480.5177.9358315511.2104.279.8249.6127.6186.6134.3235.8364316333.7362.7292.4420274.7331.6438.9346.4445.6317135.8140147.1152.2131.7314.3145.4127.2161.3318177.480.7163.7110.3146.954.5212.438.748.6319137.7159.9208.9347.1302.7212.6492.3225299.2320786.7569.4419.9576.6664261.9358.7564.8362.1321430.1418.3554.5345.7495.1766.8520.2522.1417.8322313.5258.9206327.9350.1237.1317.3284.4302.23231640.13893.266234933.34083.64146.34123.62877.78765.3324191.652.689.7451.6184.5161.8224.994.8485.6325252.3394.8205336.6342.2306382.9200472.43266503.54515.15659.13116.94025.84887.65753.45207.43124.332732.7114.347.644.234.928.145.132.7122328572.1311.6141.9444207.970.7242.6305.2432.532955.756.698.487.954.4253.99587.862.1330248.921.418.433.371.670.850.426.141.6331262.5211258.2272.6238.9488.3289.6242.5276.5333527469.3712.6701.7769.3702.2868.3980.31069.6334178.8178143.4202.5157.4217.1144129.4147.4335109.780.46559.971237.869.369.9140.5336478.11866439.4413717.7515.6725.6440.9491.5337250.586.1605.5216112.1769301201.7436.9338207.4381.7182.5222.8212.2291.2398.5122.7422.9339491.6370.5242.7371.6357.1291.6301329.6333.1340262.2228.9221.7277.5209.8433.8234.6244238.8341553.7859.2680.7749.1833.5945.2877.81040.5836.334382.4129.6166.7112.2227121.6417.599.3261.13441494.71234.192311741290.7695.21049.81243.6776.1345229.2243.3208263.4197.6424253.1228.21903472522.720021475.13154.42419.43643.73353.422132257.13485357.38676.54846.971516595.29416.28225.18754.77625.2349199234.6342.6366.5251342.4222.3330.6366.8350425.9228.7186194.8307.5295.9344.4186.6478.3351639.7438.8120.8247.4113.3139.6323154.5311.5352383.1438.1904.1394.6424.3618.5412.3428.9250.7353440.7413.1270.3281.2203315.4237.6265.9206.93eSEQ ID NO:871TT879TT881TT882TT883TT884TT885TT886TT354116.3981.8502.2324.4156.7786.8376.6642.735566.18420.72645.1615213553.82564.73412.812344.6356338.51495.5623.7501.4743.6903.31811.4741.6357443.41347.3566608.2679.7484.61559983.6358700.61921.22381.52373.21674.32027.63756.91590.4359376185.1264.6206.9308.2331.9281.8247.9362655.51294.9729.91088.1864.41725.11214.91246.6360266.2611.8464.8543.6452.1537.3693.4474.9361152.3149.9338.7186.5167.3256.5235.5312.1363570.7493.8575.1513.3517.2615.3759.7454.41130.2622.41944.71584.51981.61283.3420.91894.32411.71993.43797.12512.74511.42897.712543862.97372.9193.8680.5596.1614.8129.52.7504.282363.3511.5342.5363.9358497.4221.6355.69381.61198.71487.5781.6985.42024.63933.71448.210171.5160.4133.2137.6129.1154.3182.410711324858.2937906.4953.31879.714812251.213126.1303.3531.1319.9664.9496223.2472.714295.2932.11713.81521.72129.62134.51840.12225.41595.62064.61333.1540.9265.7569.7709.81795.916511.23919.72909.73131.83773.63125.23619.33331.517214.6800.51475.11075.31483.611621482.81281.819198274.5768.1268.8208509.4276.1570.1201988.3739.3319.5316.5192142.3242.8575.42134.624921542.82495.11851.52668.61631.92770.3221078.14211.341163543.73242.14723.43467.84881.8231.1825.21432.3370.9163.91192.4221.915172474.6391.1433388.2211.7258.7300.5572.72648.4921.94466.3587.5349.21513.7644.91870.327495.1654.31266.210761461.5696.9334.71531.429381.5152.891.835.9162.7135.1152238.53031.3686.6444223.3222321.8356.5825.631635.618297.714048.68744.115394.717798.216472.512208.233439.97923.94124.53804.63932.52361.73149.17173.6343213.6825.91104.9697285.8603.4436.71025.53522.62143.61770.31187.91220.41620.31651.352936492.1322.51635.1387.3554.6818.8268.41021.437429.6140.1245.5191.1224.1241.8207.1178.538237.91844.22220.8794.4644.7984292.13477.440451.5617.3495.81186.4725.4800.6880.81036.141252.11258.89434956.12394.2566.6987.63025.442579.4532.8258.11104396.5335.9491.3504431029384.9273.6344416.5403.9517.2325.744565.31802.41501.61596.11100.91275.91583.21199451500.81346.91175.41573.62053.9971.83321783.946307.7539343380.7553.4414.6398.2340.84767.81213521.9742.8498.15071389.1810.8486.2645.9561.5325.692.6189.4537.5190.649192.11573.12319.61719.21210.46469.11691.61799.35021030.9954.7379.1309.7799.1597.42116.351772.5259.7304170.3108.11357.1408.8394.952193.2298.8343.6347.9276289.4348.2335.953153.51632.62144.72293.92026.51732.8446.51982.954809.71147.31387.62014.61631.71524.61231.92093.855147.786.2101.7108.385.2103.3116.662.55613094.8277.7121.8341.898.5180.9241.457777.31976.614161.43909.23643.6667.81053.75922.8581225.75418.714855.86952.44309.63516.66571.6924259271.63644.33754.44801.43817.36657.44444.23360.860159.2218.9601.1529.4311.4171.9231.9506.761138.9159.4118.473.6104.8116.1164.581.1623244.158181646.12645.73666.233582535.74029.763157.2628.9667.9804.6516.3778703.2578.364994.5119.1251.9202.5258.2236.6151.1722.16535.2209.3234.7217.1113.7118.8146.7305.466437.52105.51849.42646.82322.71754.71801.81830.26713299.526691.329363.421948.430861.227520.33279127456.3681527.1379.2840.8286.8238.8383.753.62104.6695084.11418.51727.3964.1782.12036.14783532.1709067.85289.85151.55378.24923.77248.85765.76685.771356.73218.26059.44739.27588311425184665.572126.92024.93174.22185.22596.32512.42145.91991.373163.4917.4942.3785.8642.51021.71109.21059.275234.3480.21234.82124.71532.8329.3830.52611.1761819.91037.314731162.82498.4959.8921.61764.57752593101.81035.91814.1885.51999.13528.71319.678568.7520.5454.4245.9225.2250.6256.7390.879402.6303.3288.4416.4496.9377.6309.8241.780141.11486.21527.91160.9747.91195.71756.4792.881189.9133717841.39074.616493.481215097.911272.182435.3141.8224.9197.1249.7316.8170.98471.2138.6259.2151.7138.9415.1303326.885187.81315612.4336.4240.8318.3399.81550.28693.590.2120.7294.3724.1302.789.1261.787539.51122.1581.51395.114761619.41043.72328.9883161.6561.11162.2632.3466750.6597.31050.689317.9237.2318.3196.3337.5343.7255.7239.790111.8266.6953.6334.9123.2226325.2129.6911023.43728.14506.64033.42043.220952191.93082.3922374.94865.16296.68454.911642.611587.79943.61056893103.8133.1109.8121.641.769.917.11669459.2296.8784.9944.1600.5776.8481.11257.89569126.3450.5453.8310.8189.3165.4142.496147.8682.4387.8387.3404.3357.9565.3420.497204.3883.1454.1708.8421.4468686.4732.898728.410.542.672.243.529.75336.499210.6821.1369.4814.2595.6485.9696.6541.1100995.9102.83585.789.534.32798.51123456101133.4146.6270.3174.9310.3198.2121.7192.7102190.6110.7244152.9172.3180.7158123.8103379.6430.7535.3399.6560.3572.8586.9406.810425269.693.2189.428.667.416.292.3105363.6168.9116.4217.870.2146.4118.2171.8106442.395.1136.615456.379.812.9109.4107301538.7356.6408.6301.5322.4420.8596.8108255.8236.3168137.3106.8179.7237170.7109169.91482.1544.71597294.11205.61691683.9110322.71903.71404.24278.2691.92791.82817.92504.6111252.725.4233.324.463.4101.247.1118.3112633.21314.21405.62124.51859.31085.3587.61601.9113164.4330.6333.5268.5218.6285.2237.3350.611488.6309.31164.6333.2513.7630.7664.7778.3115326.51299.51101.11198.81051.2817.41102.21084.6116252.3360.5666.11347.3817.6327.9554.6825.911742.1101.1493.9114.674399.7133.8234.51181176.7116.7300.6130.5200.8470.8207.3112.511998.3184.2281.1245.5317.6213191.233612099.598.8155.8124.795.698.9123.978.9121234.82992.44320.24055.830205336.53158.45803.1122645.9446.7248.2356.4312.1428.7329.5346.1123300.8313.4352.6504.1413.5386.8444417.51244390.296.1118.6125.8161.7134.4182.694.91251484.8805.427732982.27375.5984.21310.9807.1126278.656.9192.924.931.877.8104.966.8127114.5332.1225.5171.6237.5193.8339.3225.1128318.6181.2386.421369850.3108521.8356.193954.5129176.11916.31120.72375.92049.11464.31602.61660130114.6735.8381595.7599.3446.9434.4456.6131236.1156.9297.1426.8385.2268.2149.3279.8132169.8303.3464.3423.7368.6256428.6304.5133102.5245.3224.6394186.7265.2300269.3134175.1516.6316.3534.3524626.6679.7687.4135170964.7971.6756.7562.2683.11544.5931138145.9173.1201.3127.5189.1187.4173.916613966.8286.4170167270.8159281340.11402616.5135.6163.61.2183.898.21064.1141407.3178380.3594.82751127.7586.1346.3144370.223200.87070.420031.220055.75695.12100816416.4145203197.5215.6241.1234295.8284.7197.3146299.6606.7853.81054.9249.3683.3966.5411.514734.5138.1361.4219.1120.169110.251.6148200.31072.9641.5371.8309.31298734.4563.6149147.1811.8330.1243.5389.9584.1960.6374.5150243.6194.2614.8339.8227.4390.5510.2508.8151103.4200.9536659.61097.9831.2572.51463153102.7134.4117.8319.9659.8147158.2276.815464.75340.97684.34496.668193595.61313.47444155155.1604.1224.8527.6443.5980.8352708.4156117.9162.1382.4213.5503.7174219.3257.1157134.1215.4212.5227.7257.4258.4309.6331.4158857.5149.9598.8544.5850.2506.6301.4728.31591385.813661517.31101.71387.11799.82020.51476161950.16758.67657.210885169844705.27562.36065.716212.5256.2584.1235.7456.1369.3231.2451.516447.5347.71040.54140.21526.92205.51430.77468.91664175.21086.41301.1700.5641.41360.7585.81191.3167545.5254.91335.1355.91787.4118.5231.5771.1168140.61535.51213549.9594.11616.82190.3639.2169582.912292.613216.515240.114867.17648.89941.313159.9170857.82119.52344.73361.92260.92642.519203323.21711.11063.9967.879.8105514339.5801172489.3575.3552.3483.9608.6582.7664.1514.2173168.3410.31713.9878.7690.81123.5254.32373.917650.7173.8993.1155.41107.21814.1400.91423.1177610.5234350.8201.7455.2147.8113.6315.4178670.2457.319241409.81033.81365.3281.5700.6179188.9540.811361826.7836.8964.6165.71383.2180208.1750.5880.8997.3460.6628.8717.2618.11819102.84805.76228.94111.83157.65112.85426.84235.7182244.4524.8434.5395.3395.9340.8570.44551831.1286.3920.215669.6540.1211.4691184202.5365.3361.12170.53042.7341.2479.3909.8185707.42338.25269.75295.831166542.93238.56677.11861338.698.2262.6165.5183.3170.6131.9218.6187301.2421.4792.2247.6123.3291.1366.9720.218854.4507.9399.8687.8469.2348.4605.1684.618968.7209287.2379.3305.1161.4160.7404.9190199.8242.2483.5455.5631.924171.1375.71911726.740393532.72210.11524.246096889.43737.319289.689.6157.2211.492.6233.7145.8105.419385216.9219.4119.469.2392.2176.5239.519449.9282251.7297.8199.9135172.5243.3195712.1117.7174.3152.985.3174.373.7152.11962873.3845.81650.61499.51608.9962584.51404197483.3253.5190.9146112.4139144.8141.2198126.642311176.91159.91263.89999252035.119987.29967.34014.38315.919492.14175.44540.217229.4200344.7460.31008.1823.2437.1394.5655.2945.4201122.71085.1434.8378.2229.8766.3506.3515.7203678.51088.31322.91133.73167.7436.25633185.7204634.23003.41397.71339.91300.31299.22900.21073205946.35589.73415.43931.94602.25034.54943.86059.1206278.8299.7268.4293.8350.2398.3635.4241.1207125.779.6212.346.6106.658.157.3679.72085.43861.8679.23099.7462.3711799604.6209648.226.6610.871.6104.377.372161.42115817.8134.3575.984.6135.11200.4233.21507.12121458.6689.411351092.6988.6986.3460.61341.52137576.6117.6121.9100.696.3151.6183.1136.221571.873.2323.271.1161.2100.530.8676.7216415.9276.5268.1173.7199.3277.1434.2282.321778.7959.52746.71024.92616.6671.5359.6850.8218268.3172.1161.1189.2123.2160.7128.5186.8220134.572.8184.996.184.3650.4100.481.9221207.514381268.52111.3963.71155.31048.41581.4223308.1673.6497.3535.5748.5534.7710.2869.92274743740.63123.81451.8740.11207.81221.43703.7228553.9202.8342.4247.9322.9245.3315.9260.5229978.6365204.1229.3104.9176.7197.5149.42301574381.34364.634694117.22984.94092.32935.6231299.2338.1519.6436.91304.6261.4183.11209.92321.2479.72967.9397.7283.81161.6447.91442.72331408.317920.313126.57241.819318.813487.218348.915152.523522.6659.3624.9172.2155.8342.8152.7485.3236244.8153.5397.3304.6449.7331.3200.6282.5237841.816752348.21931.51633.12253.2749.11687.1238606.8847.7670.6582.6625.6723.4726.5667.2239455.9304.41179.8492.8201.3464.9311.9376.9240756.3795.31590.4747.3330.31193.3846709.62411604.8957.32984.81412.5619.32269.1981.8132124213722.546283.332477.333142.338026.742087.54924939172.5243322.6586.6483.3483.6499.4723.7534603.124480.81208.5771.31636.91032.2928.2507.9553.8246167.72506.31683.72500.31675.8557.31133.61677.5247116.8115.5128.4104.8125.8135.7147.396.5248309.31728.91916.33434.33874.71004.62401.75089.3249432681.6804.8479.8417.31208.21265.1742.5251134671368.82493.8784.31646.7587.91794.9253375.8544.2623.3589.2333.1383.4859.9310.8254716.8989.81029.31067.7790.5817991.71396.7255777.97062286.61766.11100.51765.9286948.3256645.431363129.73456.41905.41995.53000.32611257107.8348.2360.1289.9300.9240.840375025883.13074.5844.52046.81476.73628.73511.22536.12591.2668.51027.2351524.21117.3356.7500260185.4108.7158.6251.8168.6182256.7116.226173.8130.7187.361.6210.2242.6130.1258.1263919.61233.9819.41299.4572.7912.11233872.7263199.84626.13402.33087.93813.235826403.53036.9265310125156135.2128.1234.796.8155.8266381.6899.6433.3530.4242.9358.6641.2241.1256130.8141.8211.4344.3408.2195.6211388.4268155.9135.7783.8251.7990.9145.677.9262.526970.4137.9127.487.5920.7144.7106.4123.1270906197.1177.3148.3194.1214.8161.2198.9271197.7411.2613.2278.31153.32568.1824.51254.6272530.2865.4861.9814.5776.6929.71402.410122732.1207.7884.3165.72070.8969.7200.61967.32741050.2932.11127.61151.31481.12100.51603.41010.4275277.86741507.81511.2956.41603.8960.92338.9276496.54907.850711824.8921.91584.410436199.7277159.6251.2318.9445.6355.2318.1503.6277.727815.31224.61434.2602.71133.318981401.1984.1279678.51074.41101.71030.5187814251541.12160.32801096.53203.92152.52126.23768.54309.67516.94768.728138.3590.9605.4938.5832.1257.9315.3385.4282407.5416.5704.21079.11604.5485.4482.31146.7283603.1605593.6521.9638.2488.6789.7516.5284131.459.7136.249.9188.8106.8101.585285154.1117110.9109.1135.7131.9163116286530.443.859.527.722.9109.866.734.6287102.4116.9133.699.1113.6295171.379.7288160.1126.6179.5153.3164.7202.8216.9139.72891536.24488.84944.91532.83646.85911.34344.58246.5291102.7248.4286.1208.5228.9130.1253.237429242.7732.88793.118089.33318.53787.110588.98088.8293271.4344.8740.3493462.9499.8453.7383.2295727.5890.42593.213143115.5310.9729.51143.9296887.92346.41719.11863.51576.82166.62085.11930.429796.559.7110.183.171.160.111282.2298546.1730.6785.4968.7730.85631034.8859.8299691.23305.32824.95439.51735.11756.82682.44873.4300323.51392.4991.41256.61607.81164.41068.31558.2301728.3209.7186.7221.8162.3294.8281.5306.33027.7347.9205.9264.9249.4213.4340.1128.4303488.4309.5299.3350256.8366.4288.4319.4304190.4376.7480.7406.4314.91106.8764.9973.2305478.8246.1628.72896.4633.1802.4305.6892.8306159.1618.4450.3475.8439.91419.5763.8450.3307132.8254.7425.8462.3354.6254.6307.12373085822.9744.5524.5787589.2606.8354.7424.93101068.6151.4133.4116.477.7177.368124.331136.2641.7499622.8349.4351.8356454.73124778.5245143.2236.84.3250.7224.5335313136.4173383.6419537.8354.8230.1549.2314485.9926.31589956.61048.31458.6629.4877.4315125.982.4187.28858.77793.243.3316367.6574.4633.7462.8337.8583763.4450.7317145.22021956.5215.8199.9250.1242.6647.431822.4277.6212450.5289.2439.1285.9458.33191838.4512.3276.4733268.8487.6670354.9320477181.1267.8128.4160.8244142.2214.4321718.7163.3292.4134.5159.2263227.2257.6322440.4379.6285.7360.6238.3342.7305208.43231582.33954.13885.83447.23490.53121.33460.93724.3324112.2445.5257.9704.3519.5235.2528.1737.5325190.1374.9430.9503.9541.5326.1367.3610.4326422.94053.96121.74456.61364.35707.53498.24848.93275.6292.7203.1609.7707.7133.8263.6273.532872.252299.894.6299.987.127.6114.9329216.165.549.196.460.5118.7102.776.433074.1438.11060824632896708.8558.4331783.2297.5466.2372.3422.4374.2562297.2333216.1167.4206.9194.6174.538.1190.6149.2334107.8126.8470.1153.1513.7220141.5193.3335570.7191.9697.3783.9505.5208243.3414.7336491.6342.6210.4272.6218256.8428.3243337127.4619.5632.8711.3511.9972.3606.6804.8338180.6155918381292.52158.9837.91460.81632.3339303.9217.3347.8220329.4258.1219.3184.2340185.5137573.8177311.954500.9184533.659673.9314613.686723.1341412.2585708530.7576.4437.9557.3684.63437951.12880.91575.61520.53477.924252379.21087.23441755.5649.1436.9434.5285.2463.7452.7599.1345236.2296.5511.3662580.8429.8424.2488.6347821.310633642.71447.84119.21163.91210.21782.634816794474.77575.34999.76225.73803.13979.14537.5349256.8526.7376.5477.4483.9423.5503.2641.4350210.5768.8682.2677.9628.8579671.7500.6351119.8929.515532794.51558.81728.2788.71446.6352435.7264.1190.3177.4180.3233.4304.2190.7353385500.7566.6574.8346.1382.1487.34733fSEQ IDNO:892TT893TT894TT896TT898TT899TT900TT901TT354838.5571.4438.331.678.4438.1332.3995.73555801.61326.34267.6187.61212990.33907.93595.2356672.9416.11076.32648.9200.3682.2309.3200.9357815.8844.68691303.9212719.3729.3131.33581742.61693.22440.31481.7366.42077.82415.2704.2359186222.6304.4405.5466.7343.4245.5236.63622087.51335.31239.7326.8171.4870.6879.2101.1360472.7502.8559.41042.8290.1549.2506174.5361390.480162.4329.8212.1162.1138.5149.9363335.6549.7748.6666.9742.2461356.5506.811364864.12300.11111.5725.51891.2735.81211.828223.22863.61612.13492.1669.611163477.710076.17621.368.983.528.3339.5548.2237.7108.68434.3297.2236.7314.41057.9469735.81382.292209.51428.72874.59019.8219.41483.2931.82991087.4318.6123113.9359.9132.2797.4116.1112437.41234.9867.71328.7332.7722898.4645.513397162.2347.3290.4118.5313.37181070.4142294.4977.81525.31055.3256.21105.92608.54093.215828.3416.9482.6728.216.4502.23166.5179.11632342475.747101027.1239.93055.64422.5721.2172718.1742.6607.2522240.9762.61568.9129.7191086.6248.6333.5226.7290.8444.87182.81716.220192.8641.712.5391.2792.4372.336.3211826.14120.61923.8941.2238.42518.72236.894.6228192.12215.61368.71592.1753.15336.92477.2299.223687.5415.7227.31.11.1709.62476.1179.724326.7113.9163.5127.1110.4165803.4105261128.9408.7398.263.7106.11433.65983.21234.8271213865.2488.6772.5725.71107.3619.858.329134.285.5245.2242.8215.1196.6356.2198.730362.2248.6151.7102.916.7261.51169.1236319692.52015418540.61550.9250.215669.53557.55.2331841.12277.71079.8442.8137.23329.214318.3588.834826.4839.3441.46244011.4566.1579.82078.9351512.11217.11163.2194.2132.81055.61451.826.9362188735.7379.8646.9507.51041.8675.28116.137133.7152.8191.6188737.6240.4318.6263.738776.1895.4248.4519.499.41003.56688.2339.440910.9789.8648.8518.5810.2652.7553.1417.341922.530531250.6119.4254.6779.13979.3333.242343.8889400.7444.1260.1318.1535.4200.643219.44224171244.11305.2310.9593.51335.24413881454.81175.71009.9401.4945.21312.6316.6451335.61007.6839.8405.9730.71723.41554740.146281.1267.6425376.4402.6326.41021.786347739.5340.9354.1543.9308.4485.9555.91064.548570.52323040.327.6142.156.8273.5492690.87059.82365.9162.5247.73550.1610.3195.850582.4319.5412.6124.580377.81255230515301015.7325.9138.52289.9333.2623.965.352333.7327.9286.2281.6329.4221.1347.5493.3533598.91864.61743.5365.889.11567.9167073.15419881754.51175.5286.191.41181.11478.92364.45585.996.895.9124.314585.680140.656213.9163.6156.63962.8229.7214.457.5576568.182.1618.1951.4256.71930764.78145810305.1843.31639.63341.1274.32514.513981879.6594632.78361.84125.61656.3319.14755.62037.81675.360510.1221.7136.9117.4148.1354.9336.7187.16198.3111.4123.3179.6275.5108.572.974.6625423.23854.12373.98567.72395.33812.32208.6148163830.41299.6461.4605.269.5803.8256.137.764479.7114.8188.8126.9488.9197.6329.8245.965389.5110.387.850.150.1176383.4101.2661831.23206.92835.9601634.92474.71318.9103.36726156.424869.83131434527.110176.925736.91905.1173.468821.840.72360.3789.42432.7943.968.91.1692579.5781.61976.31894.35728.22305.4397.5111.3705688.98491.78887.22267.95973.985714098.7128.4713496.65511.62751.2100.665.63748.210193.5626.27232962026.71766.1530.8106.19222699.199.973763.6839.9660.7520.4264.6888.6359.2419.4754452.71125.7275.2310.3145804.4156.6359.9762427.62043.5940.2329.22388.1841.43184.422133.777563.42247.63062.36825.92972.11722.2280.82325.778623.5124.1227.5554.4340.2302.3207.6170.979297.9552.3257.1484.8185.7287.4938.8230.9802294.31015.3932.1949.4267.8937.21004.62105.3818681.46802.813448.3318.1159.416138.89121168.382128.299.7135270.9561.7187.3146.752.584308.9120.8130.3138.1893.7256.5336131.785410.72865.5317.4179.7186.4225.11173198.28671.5641.8296.9391.1257.7123.22621.823448.8876893701.32676.7616.52618572313.932488712.7622.28401105.61000.6639.5272.41569.489295186158.6179.6961.8277.3453.9155.990215.568.7167.8107.4122.9164.71000.2289917519.7924.81647.3799.8217.9817.92001.92046.39211830.913031.113383.87238.6302.13811.15046.1174.393115.587.83489.4211.978.4109.275.894767.11362.1410.1191.297.7553.9380.239.995299.5345.9216.655.5193.551270862.496353.2438.1419.9460.6210.2326144.2304.297808.2693.9524.22786.4252.2405.5344.9189.99820.138.944.121.622.745.414.9853991151.91198.4389.3273.9337.4383.1950.5207.7100152.990.9122.7552.861.1313.341.736022.7101260.8135.8150.6140.2234.4326.1275.4121.1102117.3164.9193.6214.6452.9190.4161.915084.6103359.7366.5553.1618.6458.1556.4352.4349.310472.385.795.184.2660.1174.149.8301.710576.8146192.9201.7396.4190.855576.110680.9148.199.697.2589.1212.879.7301107207.3184.2599.8177.7156.9201.1710.6224.5108163.3204.4177.6565.4277.2123.7285.73961091770.9611.22356.178.165.3737.6812.41225.91103284.91445.75145.61.21.32012.12144.53019.9111125.14662.729.8254.8274.1161.339.91126161456.31415289.856.81850.32408.594.2113484.5533.3277.498.1241.5317.7339.866.4114600.1371.3562.4290103.7987.5502.2156.91151041.71742.31015.41023384.61053.1733.8268.3116932296381243.7236.9432.41273.7147.7117339.7124.5167.1263.6190.4177.4107.755.511869.7220.3177.8130.53113.8104.8101.3865.7119298.6219.6301.294.880.9379.1460.65312098.353.499.6177.4150.198.11050.9126.1121586619003972.7505.492.266302072844.8122322.1911.3404.3385.8240.5366.3568.363.3123404.9634.2345.1149392340.4234.3311.6124131.4129.1160.1787.82835.4130.4121.4150.7125723.6926.11036939.92182.9947.812974.8522.7126141.130.5891591503.235.63.1355.9127191.9184.3258.1319.5139.6201.4155.4104.9128179235943.8208.7264359.9236127.390211.9230929.71291267.53432.61214.7246.9149.31110.65445.8153.6130540.5632.3587.9375.8113.6347.21074.482.4131856.8607.9246.290.3123.935748054.8132387.6420.8334.4228.4227.3360.2314.6225.9133237.3363.1302.2130.6230.6311.5218603.9134594.41140498.1384104345.6401.6224.81351075.3533.8887.31588.4220677.5175.4301.4138231.7110.1175.8232.6169.6171141.3203.3139298.9162.7156.5459.8119.7182.1162227.8140762.9725.5154.531.81.292.135.41.1141621.6930.7688.4687.823420.136.5666.8144378039899.922316.3645.5490.7130849054.7316.7145177368.3269.9232.7310.9289.2250219.2146243250.9892.8185.83291096513.5231147120.464.379.778.134.2140.29423.6148677.9631.3630.4298.9225.4335.1307.8192.7149398.6217.3602.81656.931.3377.513454.5150374.1454.4196.3972.4157.6149.2283.35740.815110521195656.8163.7191.8924.2636.7216.6153139.4146.7146.2319.5194.788.4724.199.21548645.216591.35176.3424.8109.135774066.175.6155246.6937.6813.8187.8175.2624.4381.4146.7156295.3187.621276.153.7543.4250.452.4157223.9203.1318.4199.3184.1199.3122.6224.2158537.6821.6265.21.427713.1498.59.41591344.71973.31599.73234904.21579.4405.51.31613301.27782.714054.563.266.78990.64295.2228.4162701.6131.2171.765.832330.51161.770.71648016.93022.21600.5253.889.7771.6851.688.21661326.91067.9409.936043611.91114.71254.5258.6167457.995.7482.21592.11309.9959.281.51.21681090.3935.11205.2793.690.855289.134.216913698.98961.44979.81588.3221.915295.76424.9919.21702889.32125.11875.62018.5382738.12166.41941.3171575.686.9234.31.31.2326.81162.6272.5172480.7479.3537.5625.7696.9476.9451.9506.71731793.3647.9338.5142.8256.61057.8862.7492.41761468.41365.5272.91.275.3744.9117.310085.2177275.198.7141183.5592.4278.4235.9131.11781912.61129.2203.686.27281472.4238912289179485.61376.2243.460153.31065.33098.753.91801011.7464.5526.5263.1154.4957.81085118.11815130.43292.8372413102.111246.25277.82419.3389.1182530.4324.9404767.8204.4388.4384.7169.2183447.6199135.71.11.1259.91258.2281.4184620357.8340.4291.6192428.814293.9682.81853627.910011.62963.4729355.610614.73033.4880186173.9184.8258.31106716.2173.4287.82619187333.3525.2136.5200.2239.2314.3689.4176.4188435.3350.4378.3132.3145.2161.91419.6133.9189181.3130.5201.391.3144.292.7674.179.5190359.9238.5312108.8110.1485.5163.758.419157073740.13029.63256.5886.22447.83778.597.4192150.495.8139.2130.9129.3109.1506.32753.6193361.7114.388.96063.3105.9289.6160.146.2194261.5249.3203.6200.9134.1251.6372.2471.3195132110.9158.396.7440.4150189.2297.31961327.61039.51104311.87746.93084.91670.6448.2197132.298.3139.2194218.3141.3868.5520.5198532.61476.51624.783.894.62377.6755.470.41997184.62171.37934.6482.352.54537.35623.94564.9200975.6370.7300.2182.2210.4482.6427.51652.6201957604.8467.335.111.1420.73341094.32033711.31570.81229.65308.7248.9965.61358.947.12041750.81898.92112.94011.7204.11174.1290.927.120560394435.43880.56493.92337.34612.61166.93.2206163.8374.4608.3472.7308.5390.5250327.8207480.647.774.7206.634.9103.458.159.8208585.41688.41780.1191.958.9866.4278.11.6209197.54.460.6353.25030.7400.566.4207.92111550.5219.11271.81356.7942.5164.7120.187.421214261312.8870.1225.41412.12035.31106.752.1213104191.1118.8124.53087.3123.3121.977.7215475.155.984.6159131.477.793216397.6259.8310.5423.2377.9179.3226.1222.22171130.5517.6725187.5173.52109.11336.7189.2218159.4224.9205.2353.5294.1236.6199.58922079.670204.61293.4119128.5270.968484.32212459.41795.5739.3429.3254.41453.4860.5219.7223981.9680.4687.3439.1267.8500.2459.3290.42271489.91104.5879.41033.7822.71224.75386.3435.5228186.1178.2271.2198.1433.9318.4220.6177.1229180.5334201.9302.5172.6189.2253.5582.62303245.42835.93394.8163.399.63274.14388147.12311258.8702.6436985.6204.9418.8591.975.2232704.3266.5271.659.531.810004104.978223315997.89251.8218295239.61502218292.934903738.3235405.2135205.3218.877.9242.7688.4216.2236345.4176.8244.351.8289.1251.1569.9355.32372087.12074.2977.3667.1647.62376.1125221052381029.7709.6957.51263.7456.51002.9733.2417.9239398.5111.4252.1162.397.3806.1929.51253.4240590.8219.9517.4355.874.6973.11561.112352411224.2353.4781.2558.862.32210.82833.82772.124231599.634700.341193.81998.139786.83811729127.64032.52434961167.3574.5293.2363.2674.9937.7478.8244619.3993.1600.4303.263.1271.1782.3352.72461856.61243.21238.1641.8111.22226.51235.4797.624790.889.3158.9200.2539.1130.588.42091.62483748.426171198.3214.580.71744935.6108.12492042.6468.9513.550.4326.4336.8254.7971.72515951004.559256.1351047.92445.571.5253465.8497.1469.6410220.1449.3295.9531.12542043.5910.3939.7363.4861038.8861.81072552304.81354.8344.7122.3762.21679.92631.114516.52567209.51050.31841.6927.6282.3701.31193.81494.3257856.2248.4216.9662.9150341.6378.8234.12581862.62711.52864.4273.423.21388.33786.638.9259690.81255315.58.98.9666.1567.435.6260171.5136.4233.1141.7251.1174130.8576.4261647.4192.870.8118.287.710872.591.1263797.91445.4889.112653327572.61048.44844.52632900.533884354382258.72740.83471.4176.526589.2115.6179.2394.1219100.9131.685.6266213.6237.5772.5877652.8477.8159.6124256293.8159.8170.396.7137.6266.6612.1111.9268427.247.3133.164.4531.8497.380.318.9269144.1171.618464.4137.5256.6159.247.1270149.1221.6249.7540.1727.4204.9126.7413271928.91477.3659.3228.8157361939.9257.92722065.5769.5961.5709.2889.7644.3583.31336.4273460254.41932.6197255.71557.31.21.127412721303.2959.1381.8692.6817.73288.61936.22751067.23809.3819189.789.63279.9984.3183.62761560.51665.4856.1437.3864.31770.98639.5830.5277420.2373.4347.1255.6230.4352.6225.8197.82781479.62479.2413.938.116.11327.71485.31104.22794418.51252.41647.91229.2826.21907.3690.51.22806980.63103.25603.59202.3973.73117.310541.4281893.5469.5390.850.976.1645.628.32949.8282436.5866.2712.4604.9432.1429.34533.3239.2283378.5494.1618.3438.7610.6397.3345.72247.928486.578.484.759.9151.4121.610490285100.1125140.6171.6130.3107.295.4109.528621.94734.4361.5622.217.45114.128785103.5147.3266.3140.8110.490.852593.6288106.7108.9226255.8302141.1141.3161.528916536.41225.134541845.6187.61317.11594.5336.7291197.9131.8167.2170.527.6264.2372222.729210808.4363.8202.4174.866172015444.1227.7293409.1361.7288.2206.382.6711.2306.955.7295812283.81193.9554.6477.92370701.1344.92962134.13003.71806.51160.211211902.21362.4253.229738.559.7102.375.62740.870.7113.339.2298610.2990998952469.4525.7390.2600.92992108.94536.43222.22152.4419.342581379.777.23001679.81409.51107.290.1244.21361.8952.6239.4301221.2271284.8845.7261211.4223.5162.3302216.8246.1174.834.540.3171.5310.621.7303266.3414.9259.11838.2984.5263.8215.752.13041007.4636.1791.11190.1791396.5803.92631.23052780.81913203.5627.5451.4213.24287.828703.6306600.91369.7510.6266.5278.1451.2469.4196.1307427.2183.4239.2150194.3189.6485.2145.3308296.6711.6941.5559.63583.4734515.21057.131071.1164.33071005.91091.892.5194.1204.9311819.5309.6177.4119.948.5805.6148.5343.431235.7488.7553.35485.31957.5229.2282.31084.7313624.7219.7192.2247.3117.1393.7632.5548.73141060.4958.7775.5190.2164.31171521.3302.7315208.452.172131.8117.4149.473.178.3316967.1497.3525.1285.3123.4509.3313.11093.33171983.8165184.2186.9201.3230.5235.8160.7318535.81159.4335.757.834.2275.6327.6202.1319303615.9648.6565.7660.6420.7486.282.1320250.3171.3229.3898.4581.8283.3182.891.2321153.9170.4222.1487.3395.4195.2275.7152.1322272.1366269.8234.9505.1327291.7323.832341492529.24790.211767.2291.72101.21031.536.9324597.91026.6425.6216.666.4520.2374.438.3325600.8475.6489.7427.7333.3614.4461.4102.33266135.24645.82435.94623.7489.73385.8361.854.932713739.2140.211.618.17721166.847328139.541.94235.3115.4264.682.528.132945.169.152.6106.4190.459.353.4158.63301850.5187.5197.457.563.1611.992.748.8331306.7290.7381.2458.9680.9301.1355.5305.4333168.8202.7113.7654.4440.199.6101.7733.2334157.4151.2147.9185.5154.5491.6227.7175.6335355141.1215.2128.2621.4273.8122.195.7336199.6235357392.5544.7194.9201.4419.4337529.5776.2670.25029.212.6247.41259.737.23382393.6467.51714.9222.693.81228.2573.680.8339268.9201224.4249562.8317.5248.1316.4340108216.2107282.5151414.7284.8351.6104374125245.9415.7341557.6400640.4937.5796.5538.1314.8530.63434739.2440726701153.23880.93677.6847.9199.5344535.4284.2615.62191.31660.9465.9413.9155.3345437.9418.5469.5233.5318503.8379.4297.93472204.6607.22427.6366.11391.91925.4461.576.13487719.824945392.3378.62314.65267.11183.1125.8349570.2609636458.1172.2320.7665.1493.5350497.3566.4585.7901.1105.7491.3539.637.93511925.21358.61065.7133.796.11962.8717.332.9352177.5197.1290.51585.5569.8165.4101.5302.3353734.5602399.5357.6924415.5202.7175.33gSEQ ID NO:902TT903TT904TT907TT908TT909TT910TT913TT3541260.93539.83818.19.2180.3221.364.7837.935583.55857.18246.948.424760.353.8151.4356105.3500.4419.6781.6797.8102.4278.5575.7357249.4689.9517.8798.6569.9361.7600.7655.3358975.32387.61281.2823.5857.31419.9874.2849.4359419.6370.8337.1471.8328.4383.9347.2356.6362373.21448.2359.4401473.1781.6303.4262.5360268446.7558.4242366.41651.7276.5241.5361172.3318.3567.61196.1670.7316.5236.7426.23631097.1422.7450.5468.3468.2570.7425.1561.61242.71509.1565.31975.2843.7742.5644.2516.12425.64753.12426.52640.232421866.51738.32465.6796.71020.9322.71442.2913.42.1688.8390.181309.411771828.8572.91092.81041.79041781.99496.72818.24872.615666508.72940.7542867810150.781.421897.490.5118.513957.611623.6578.7535.7283.7341.2219.9168.831013173.4526.71528.195.2286227.31018.432214424.51784.72754255.4584.81148.72517.6721.515192.6231.16970.4559.7866.82354.9135.82247.916814.42337.11020.35711207.1216.61179.9947174171095.81202.61279.31125.91162.1297.91237.419320.6619.62250.9274.24651.616678.5159.1586.32041.5263.61643.594.170.435.51.342.3211282017.2451.4191.3326.952.297.2172.4222089.54271.96617.24571.36361.42003.91809.47708.1231.1427.65067.6455.9966.72190.6113.72551.224140.7218.4963.7245.9328.3456.7114.4572.726110.4193814240.410247609.617839.9409.35874.4277361194.6387.1374.1866.3660.5336.8622.3291746.3207.1150.796.2129.5375.287.3132.63060.4204.17348.8247268.91830.251.2900.431250.54640.91272.454.2361.6246.2125.611511.933726.11138.222827.917631784.52090.6172.68499.2341224.51241.41284.72615.84040.915892170.13921.135265.217401410.3169.9408.1178.349.7274.536306.62846753.6141.1241.3516.5112.2307.437441.8182.5666.4164.8262.4355.8217.6253.338390.4378.813610.51317946.6761.7296.85444.740678819.1540.93014.7512.9629.2400556.241644.1499.6729.1155425.8379.6508.2453.142291418.9301279.7205.7234453.1140.6432139.6206.7327.3675.6397893.4362.6369.24473711151144.4735.2636.81352.5377.3421.9451766.41105.2390.4587.3440.935.51234.1598.646871.9344.7382.8237.1318362.4260.5359.747157.7796425.9228.6277.4458.4103.4356.248100.3309.22616.3124.4634.61634.565.7281.849270.16992.32626.6317.7377.3697.2177.2387.650165.6199.93637.3652.6305.4478.171.21362.651678.9706.6252.1581.355.1329.7103.897.252336238.2225.3231.8202.9192.7152.9196.953318.61664.1277119.1102.473.8168.1127.654230.91387467.5296.1274.5242.31255.6479.955100.582.482.191.1106121.499.699.45618.8321.883.3126.25149.726779.7572055.16894.71056.41811040.6898.5320.96449.55836117181.81246192.6956.81419.1257.58484.959652.52674.11061813.91612.9824.9505.6837.760153.4426.9592.3113.9288.1186.2123.5328.961248.3108110.1157.8116.186.1104.3147.462892.64240.62145.845321616.2180.2167.41671.56343.1696.1228.6152.7248203.2222.51249.764754.3484.896.8136.8172.48787.999.3336.86583.2218.3730.9106.4207.9403.275.9215.466493.51210670.5495.6581.91176.5951.4686.86710133.833324.82424234583.333362.63068.33135037066.4682389.51201.415689401.92614.546.94918.31993.1696293.32834.33650.813600.446711986730.82110.2707326.85218.41465.62301.916981562.63047.71292.171109.35006.61167.7193.9743.93907.9456.8458.472207.72313.91722.7291.3396.6781109349.673194.2657.8526.2409.4339.5863203.3363.57576.61227.8331.8313290.4824.986.8175.5762053.91453.3198.21.416690.44285.2181.1771780158614276365.75262.6227.62010.23182.578481.4317.2437.6789.5715.2564.6535.8202.479461.6214.6214.296.5110.51271235.9128.680121.1746.1294272.1130.480.8247.6349.581125.164732165.1112.4380.6161.3327.9257.782704.3216.5171431.3318.7149.5340308.584221.9611.2399.9105.1228.82138.2106204.785269.2233.61982.8169149.9211.7137.7320.886135.5108.9106.995.7105.493.873.7117.787127.6465.3323.295.3403.962.8157.61429.6881283.62522.41743.711815.23616.8446.23870.73025.489256.7275.1477.6154.3289.3541.1134.8307.190116.5131.5622.1230.7165.3129.692.9171.2911291.46737.968175.2942526142.58893.292127.78921.73533.82067.54220.73041.69733.81770.293120.4181.9160.9277.6309.897.6147.2189.7941.3950.7333.4626.41123.6927.6636725.29563.1671.5509.63091194.287.61502.348696163.4343.5183.1221134.2332.6215.1172.797174.6412.9129.6240.3192.1109.1232131.99826946.923.65.940.3461.4247.829.499317.3330.4345.2231.4230327.3224.5258.3100278.95487.54658.32977.617708.1533.6704.614117.2101148.9470.7172.2240.4366.1137.6433.1297.3102267.2130.3143.5163138256.5184.4174.4103345.9454.6332.2322.3296331.9319.9317.1104620.8254.8155.1500.3426.6538.2415.4490.4105676.6264.2231.1551.9371.6831.1467.2475.1106832.7268.5316.9494.6516.3767.4474.1471.9107214.1396.61610.7203.7296.7656.5164.1329.5108430.9225.7420.7408.9306.7300.6149.3296.7109144.55293.33445.649.399.863.94951.688.8110156.213367.44936.41.2133.166.610420.480.611131.1449319.1972.41746.372.4634.61582.31121208.7915.8358.6513445.279.81002.1451.1113257526.1411.1260302.4165.9228.3166.5114219.5492.8315.8675.8574.1743.9193.5408.5115266.91153.1535357.9489.51534.5313.6476.9116239.1559.7345285.6292.6498.3203270.4117451.4852.51167.13758.52636.4220694.61851.1118691.9236.5502.498.3512.6440.9312.8488.6119125.2496.5189.866278.8218.877.4289.7120643.2122264.2153.9186.9624.7139.7154121749.52913.7860.2336.87641394.6129.9463.5122460.8265.7184.8120.824658.986.9235.1123207.9251.7204.8140.6122.2149.6111.5124.41245670.9155.5148368.2165.8183.3107.3167.11251479.53998.5753.1813.4967.41104.9793.81004.9126762.9199.8558.9519.51369.1191.1682.8864.4127111.6161.471.8154.2116.4116.196.1113.7128270.9268.1265.5253.8194.8249.5193.3261.6129178.9974.61280192.4245.5216.2155.5148513093.9415135.96498.984.4187.378.113179.964999.156.7110.5120.982.581.5132246.1248.4231.5176.3238.7261172.1211133132.419655.978.866.967.3116.783.113480.7357.4130244.7105.4224.6226.157.7135206.7527.6330.5525.9476.5254.4334.4358.2138146.5176.3495.1127.6180.238783.2571.2139125.6176.993.3107.1113.116190.5991401.12124.9375.13699.3699.458.6710.11623.814139.21376.8980.81472.71866.895.612651674.3144438.19635.2440.9420.6469.1364.921511.5484.8145295.9239.9182.7181.3218.7151.5152.5257.7146298.9424.8178.8181250.5196.8180.3248.814748.8115.316038.686.534.727.452.8148301.51046.21135.9223.2407.2165.1181.9387.114947.3241.2214.2458.8455.629.3104.5303.3150170537.9266.4204.9218.7213.6102.9241.915189.2551.3254.9165.8534.6208.7145347.215386.5128.6144.8102.4114131.9482.5102.515489.94360.8958.8781.1686.3354.299.81301.7155231.3491.3148.5113.4129.9135.7457.7250.3156106.4562.9116.763.7114.594.8103.6100.3157215.1148.4161134.5165.7219111.3154.415832.91321.340.51.217.360.4325.49.7159599.72783.11317.42648.24295.6543352.41844.516146.42664.3142.6105.43779.312174.84916270.2205.92154.4120.2230.1302.526.7575.316497.24519.6284.180.3241.1136.14278.6145.21661463.3193726896646.86511.92436.24573.33272.4167213.41628.1728.32340.54783.139.724191862.816846.21573.6390.51142.4452.1470.9298.3741.51695537.113680.414101.224184999.2901.31483.34751.3170246.12210.5661.21664.4916.3216.42618.5589.3171163.7592.26989.4403.52812.85944.71.22024.1172503.1636.3612.7637.8678.8382.4649.1592.8173438.71492.9435.8581.6451.6406.1375.7321.61761.24078.3151.3721.441.721.5659.5126.2177504.8573.3573.5497.6548.9188.7524.1641178763.22581.3274.3130.1130.5395.31441.3106179143.71098.5182.383.971.189.762.5528.9180146.2930.7373.3106151.6300.6164186.41819206.56564.96165.713167.311548.71304.87115.79061182263.8376.5668.2414.65071400.6232.9393.91831.2395.23392.4216.2953.93944.8144.71249.2184228.53067.2599.8207334.4400.410162.8380.118593141083749.71981.61615.93634.4834.26945.4186493.3324.2396.2656.7709.11183.3453.346218796.3258.31535.7409.2314.32757.267.4650.918866.9405.5832.9151.3247.2306.989.3144.418970.6239.2289.3112199.7237.65978.61901.31113.6243.53852103.1101.1159.9191898.622282806.61788.21533.1466498.61912.7192103.737726765.3134.7128.966.1119.5193140.5752.9580.62185.8876.867.5271.5561.819460.2320.3198.5159.6173.596126.9140.9195308.8210.3178.6401.4266.1175.7367.5230.81965889.26514.44504.54416.37685183.76854.27068.9197374.581.9129.2108.8122174.968.1178.119895.330073.242.555.886.539.277.119987.17825.910594.651.3344.674.963274.1200130.8511514170.4544.7475.6154.9259.72011208.73427.43404.438.8160.1168.642.3918.42036000.1982.6359.196.8204.846.1331.8188.3204206700.4262.9650.9591.3846.3674.6437.22051762.15866.23715.32132.75805.3149.55381.12955.4206597.2208.113097.8301.21950.72675.5252.6329.820777.6602.1745.6352.7484.2308.41182.9575208283.8306.2451.2156.5329.61044.1156.9149.8209254.31864.3892.24970.45671.955342026.32662.4211262.33358.1461529093.415999.8393.67278.512689.22121608.11431.5332.2551.6514.2482.4786.4353.92133281.697.3108.3107.5105.416099.5104.521589.6862.3617432.2796.7441.31738.3806.2216333.1284385.1651910.8264.4588601.9217224.31692513.5290.3372.2448.4238.7272.8218271.4191194.3230.9353.1288.6279.7263.722026824.213273.9124.1470.8129.2103.4350.52212151009.5780.2674.9632.31487406.7578.3223352.8388.2438286.9203.4160.1124.31200.6227565.2503.9164061473.61813.52226.4314.35151.9228624.4455.2331.2808.6799.2205.8683.16042291426.6209.6275.1972.8180.9357.1249.2538.6230281.71542.1611.5209207.8215.8975742312885.2380.620067.8164.295.5166.1101.5232581351.913448.1771.86104.819484.1294.74379.32332461.314608.911362.45629.111330.58712.71500.95870.1235317.4465.15668.6250.51690.52382.371.8932.8236179.8493.3282.1229.7368.1466.598.5194.22377341979.92226.623471794.91757.77902552.2238269.21084.1803.1718.31198.8688.1706.9861.9239101.2896.81025.8156.81210.1429.8176647.7240117.51116.11919.1210.21169.1420.8189.31162.5241173.92109.53105.64442419956.7341200124243673.618485.819181.54555.31630.43478.51273.210481.9243157.3341.91232.7219.9483699.282.11003.1244115746.8224.6148.2196.6321261166.4246153.21046.6224.3103.9143.7173.81360.9276.9247446126.1129.3102.9139134.877.7138.1248202.43011.8309.9182.5128.8133.91016.4127.7249196.32527.31726.51395.5337.1271.3233.7469.7251386.51104.2346.8127.590.8190.6175.2116.5253173.5286.7365.9263403.6544.3306.8269.12541211348.6394.873434.2259.8554.3264.1255953.82792.9253.9137.5120.4451.31497.298.42561230.95411.2704.585.2918.6465.8224.17960.4257196284.4209154.9200.857.775.2165.8258596.31068.81617.224.7209.433.645.7129.92593.3934.82120.9131.2687.3806.346531.9260248.3182.9167.4127.1173.3209.8128.2198.626119401.9345.11066.3184.5629.866.6326.52633859.5516.2662.8577.5720.7535.7488.6407263418.61350.1772.4214.4221.7353.8173.2599.8265369.8167.3372.9453.3248.693.4268.9414.82661779.8263318.1407491.3511.1236.7401.1256117.2391.4130.192.5181.8142.5146152268120.11119310.7819.21655.3121.7645.81264.1269333.7121.582.34846.955.727.463.7270521.6206.4175.2475.9301.9165.7234.5239.6271251.72043.7362.9255.5197.7227225.6192.4272620.4563.5600.9411.3451639.9426.2524.5273136.72008783.29402.23170.737.52967.51970.3274436.61279.41048.7803.4803.21605278.3616.8275267.11400.8971.4450.3462.31341.1238.22631.7276711.3764259302051.73808.85060.2400.37898.3277188.1213.8210151.7217.1196.7161.8199.427865.713413512.1262.61386.1710.464.3510.5279577.532552105.61256.33760.949.63058.32014.5280876.14218.82673.71739.23129.6176.53883.12142.328133.4653.2169.748.5118.739363.8289282387.6472.5331.7252.3284.5371.6219.7694.4283584.8297.3224322.6357.9395.3382.4244284124.9130.189.253.174.768.261.3104.6285154100.9114.990.598.7114.798.4113.928614.591.5472.11032.527719681525.5442.2287744.2114.2131.494.7147.1127.565.1206.5288245.8103.9143.6161.5162.8177.7112.5161.4289231.35107.24629.493.71685.94764.5141.92073.729167.2135.6201.2185.4144.5245.673.8128.429243.61910.52535.872.3371.64192.750.7206.729363.91213.8284.154.5117102.3188.85612953291994.3668.6211.8267.397.1684.534542961451.11263.31341.5761.31067.51967.3758.9687.729759373.8109.149.4123.58842.9364.8298360444.6275.9300.9273.2358.5306.54362991094.32223.7794.81242.11051.71871.61233.7605.23001861200.8322.3408.7137.5150.81157.7233.1301250.2525.4365.94246.8594.8155.1545.6329.530228.282.444.322.736.125.76.327.73031397.3375.7390.8921836.9531.6689.2589304485.21102.9799.5659.6239.71106.9120.6501.13051523.9661.1201.8144.2192.3247.8195.8173306222.8363.6184.3150.2197.8184.8128.9208.3307180.1571.1188169.2150.6127.7165.31983083026.7857.81219.51191.41726.264.11855.41201.9310932.8136.9271.11036.8498.799290.2343.231148.536099.1180.9152.476.1167.7104.531246285236.72257.71039.866643.8643313126.7420.1135.612178.1101622.3132.7314119.11765872.1133.6629.1211.4112.9473315141.7212.9441.6286.4519.91377.8271.7192.2316119.8562.5354.9220.7270.5441.8189.1436.3317178.4694.3216.3177.3204.7218.1156.9178.731828.3646.1105.330.6143.443.888.5101.13191682.7339.1154339.5190.3129.4447.1293.2320816.1326.7425.5913.6680.7459.9482.1501.5321360.2245.2811.4486.9413.3931.3260.1454.2322604.1279.1205.3203203.2198.1215.6180.1323620.64592.11478.513669.8188329734641551324106.1478.7118.1131.877.674.8294.856.2325255.2515.4238.4250.8279.1142.4597.5247.7326318.53462.42655.22527.13852.6220.7891.62803.732764.144.386.61.35225.311.5100.132858.8534.2264.2543.1719.495.4544.4515.6329122.466.860.162.859.591.345.474.1330491131.8126.441.557.5131.531.964331632.1258263307.2275.1480248.3284.1333147285.7369.3854.9519285.3603413.2334129302.9300.5121170.3145.9129.4211.5335215.5628.5174.5108107.2135.951.5116.8336358.7245.7230.7382.1500.4819.1394.5415.4337105.81112.71023.2358235.61517.697.2364338134.6567.8499.9131.2238.2332.7132278.1339335.4352.2311385625.4323.2314.7428.2340303.2343.2263.9231263.3223.5177.2315.9341408.4464.7438.11146.6803.2349.7511.1757.83431287814.6228123.559.875.2658.497.93442683.4670.4822.41937.21561.21319.51187.91110.2345270.8356.3270.7213.6219.2281.7199.4223.6347321.33161.81516.82286.93928.3682.11998.63960.1348592.86727.13096.64465.57652.33345.74616.86087.1349213.8458.9441.6165.6239.7177.8310.8270.7350139.5477.9625.9282.7381.81996.1328.4149.735145.62277.1515.7158453.8105.4294.7668.6352470.6167.1213.9516.8305.72359246.1210.6353792.6308.9297.2170.8260.9153.9208.2337.53hSEQ ID NO:914TT915TT917TT918TT919TT920TT921TT922TT35471.952.3102.46332.8339.528.3586.41.135577.990.759.8865.8218.875.4827.677.1356309.5389.3791.7762.2694.7578.21581.5949.2357238.7565.6645.2593.2611.7800.3666.9768.9358812.3933.3620.4729.2758.3710.1556.9571.9359399.3508376.9330320.8353.6299.6506362527.8508.3517.31171.8669.6758.3407.4431.6360287.6262.1276.8458.5477.6256.8248.9297.3361153.4816.8853.1453.3532.51170.91300542.2363631.4726.4557.1448.6429.4599.4429.9590.71770.6362.7797.9661.6799.3756.1848.9856.224813910.31810.91338.33134.1394747192783.87299.12389.1790.1343.4419.81494.7829.3845.98614.3810.2763.61902.71081.7629.1831.6938.29524.51890.19055.39890.78192.72264.63685.810424.810169.8317.64279.258.4136.212040.511146141.2351.8282.6234.9269.5274.6155.713104.496.3115.4412.7501.891136.4182.414150.5149.2276.71839.81222149.8335.3427.41583.6639.9331.3203.11168.9304.5277.5582.716834740.51080.21040.9977.47611018.51197.71795.8775.81324.91290.51245.31170.31306.3917.319261.4404.1541.1316.84263.1155.9150.63899.9201.344.215.683.683311.41.121383.416.8145.6554.643235.542.5144.622483.47044.69872.25621.26671.87593.94117.56209.5231.2758271.8277.72394.81.1325.3627.92429304.7103.5271.5469.349.8178.9196.826161.32148.72238.7435.115713.760.3774.47022.3272027.3253.6510.6701703.8324.3324728.429167.674.468.6190.8125.673.184.8170.1301.1246188525.7759.974.5129.7286.631256.3146449.71402.9328.4110.8218.2222.73369.41248.9534.41635.51154322.1691.6434.8342249.52411.84154.53039.84215.74564.82908.5397935118.8296.655.51050.9413100.2126.59536230.8313.4160.9183.5250.9153.4140.4242.637313.2317.7214.6190.8269.8183.3173.6197.93861.3851.9351.31044.4981.7465.1612.9276.640719.3813.3549.5535.4513829.2442.3543.741172.6171190284.7581.1145.2362.8549.842343.9273.7144130.6210.4229.7202.5160431155.5721.6513.5373.6260617.8269.7355.844467.8606.3633.6727.9790.8640420.7335.6451102.5638.1519.3594.7368.8478.2608.5404.846443.3467.6402.9285.6318.8295.6260.9360.447246.9143.9102.7241.9285.2145.3226182.54848.2197.7222.249.71024.92323465.849234.5355.6207.31446.9736.1344.1252.2364.35042399.9174.3301.5536.571.4207.3223.151444.259.2128.9228.873.765.919.452.152203.3187.7224202.7200.7180.8198.3190.453186.91.2213.7202.169.275.4108.4128.154684.7417.1501.3720.5410.5294509.8366.455129.496.5115.698.9115.5100.794.972.256247.293.8506265.7100.57462.357713.4745.5417.14396.2674.3127.11311.922658679.3672.7334.55289.1905113.71260.3158.8591114.3488.51847.41440.11675.2906.223481103.160160.5166.8216.5231.6179.7142.2165.1203.461293.8239.7136.1128145.9155.4122.5116.86229752562.61652.41873.2152752660.43206.263144.6161.3490.3578.9239.3242239.6251.9641905.1179138290.9184.1124138.2156.26554106187.6155.7243.675166.3146.966676.3527.1840.51026.2765.5627.51284.4290.3673308252249.53796630570.832361.942996.52928639242.9684579.17275.82857.31137.24016.27822.92361.23436.9697472.615249.75078.72335.45252.610446.37213.96679.9709607.714583227.31337.81473.11664.64441375.971234129.9307.4332.12083.387105.8493.572117.7616.5195.61937.6446.3359.7707166.573299.5310.6290.6264.1473267.6370.2457.775167.6215.7252.1193312.540677.3143.276987.133.318.974.9191.49.9122.1134.1773486.89405.25866.23917.23054.210710.93845.4744578322.9806.61125.4721.3791.71090.1887.2548.779156.375.484.6199.2122.310576.6133.880577.4115.1104.4407.6226.3186.6758.9124.981120.4121.1187.81222.5315.8185177.335882480.2436.7398.1285.9256.1480.6350.3306.784122.6108.4185.4180.2503.7117.889.6217.385172.1158.7146.61050.6166.4134.4197.3142.68699.387.780.978.193.65677.298.487346.4214.6478.3693.6282.7172329.4231.5882119.712099.46271.83285.94646.78968.21915.39385.789308.6290.4303232.4299.7233.4163.8190.99098.7279.4108.489113.481.7100.6149.591582.6482.32756847.8528.161.11397.971.5922641.51419.62112.834323134.21442.44677.325479388.7211.3338.9402.7236.9286.5297.3310.69489.71072.4937.7516.71228974.114271237.695510.2756.1652.5461.5647.6779.5500.1747.896142.3129.6170.2169.9161.5179.1155.6168.297169.9186.3239.2240.4173.7176.8317.9243.4983725.239.987.152.825.528.439.999287.4268.3235.3210.6248.3226.3210.8292.3100289.98016.13817.95438.16332.16494.4114613390101271.7593.1444.8210.9231.5571.7327.5268.8102244.7270.9155.8164.2185.3197.2148.5149103359.8424.3368.8345.3325.6402.3249.8390.8104582.6395.2757373.7448.9715.7422.81046.9105605.4439.1711.2498.5563713.5478.7844.5106573.3421.3707.9394.3496.4727.1411.81158.6107342.9313.4232.5633.3349.997.4256.3159.1108374.4509.1404.5447.5424395.3507313.710970.148.4100.41071.321652.3605.8112.21101.31.156.42298.1314.911.21496.5175111618.41832.71179.51928929.62094.9301.92011.4112925.8306.9118.6634.8404.2186.5159.1438113222.3166.6157.8240.9191.7283.559.8260.2114192.2388.8475452.6701.1833.9536.1428.3115744.1403.4380.9477.3722354.5316403.111674256.2288.5251.7354.9244.7200.7290.2117124.23117.33370.91392.12479.33139.43082.91506.611845.9127.9220.2543.8654.1106.676302.511973.6109.679.5187.2253.712989.7180.112063151.9118.983.3329.6139.596.519612149.1198.11209.51344.6731.2553.5930.81026.3122325.574.7168.8279.7220128.373.4226.7123191.5158.6161.6149.7200.5180.6123.1147.8124208.1325.2147.4136144.3215.6157.8152.91251661.51623.31124.6933.3856.11323.7974.71239.4126336.6998.615181111.41195.1749.31734.31307.5127114.1160.9127108.199.9108.894.3121.3128377.5502304.4273.4240.5360.7256.7248.3129152156.1228.4614.3248.8187.1182.1174.4130201.8125.2123.191.186.5146.4126102.5131171.696.492.7100.474.181.264.762132194.7290.5224204.2202.2246.9198.3213.9133185.328.590.595.699.853.6115.167.8134108.7105.8146.2129.8136.1152.6101.4104.9135329.3300.4422.9350.2459.4315.2405.3583.7138141.3138.1148138261.5129.3112.3140.113964.772.791.711389.472.378.570.314012.83594.2546.117311815.62735.67476.31203.114176521652264.21694.92113.32212.91964.92552.8144557.3658.9531.9445.9506.1576448.1498.5145293.6414.8253.6213.1181.7238.7218282.1146346.7292.7269.6217.1213.1208.1211.4258.414762.779.546.153.881.958.549.863.7148269.9289.4334.4865.9508.3260.4407.4281.314997.4236.4437.2418.5394.6307.1973.7534.2150137.6243.5188.6496186.8175.5160154.5151127.6135.7166.9264342.2154.3155.1238.1153123.6100.3115.7116.3102.489.5160.7101.315485197.41113.2453.2438.4272.868.6476.9155278.9193.9179.6197.2142.9121155.5125.7156223.267.312573.3134.887.962.794.5157191.414180.7108126.5132.4139.9153.4158120.427.918.722.213.58.348.31.11592173.333514458.52838.93155.54574.934365276.1161321.74.948.538.351.173.232.3115.516257.7109.590.4127451.253.597.4109.916418.3107.3133.5945.5294.7100.8471.31451661789.684388113.294644481.510514.26218.78586.91671221.41687.42694.8870.22235.23402.429673999.61681134.11571.9233.8389.6470.21162.3676.1517.91691299.13874.82937.320149.34579.73975.55507.13449.1170496.61040.8993.11421.71194.617471725.6975.71711.7726.5381.81172.23538.71.7311.2923.1172787.9831.5671.7556.8576.2725.4702.2758.7173325.2174.5231.2453.8404104.2388.1164.71761.161.71.1901.445.4116.125.713.11771168.1892.5744.8380424.7794561663.61781040.7147.4125.3225.611865.1137.1105.3179175.2142.580.7229.886.5162.995.482.1180219.9159.169.7168.4130.9108.4102102.91817935.313498.813730.611985.510419.512804.411323.812979.3182150.3447.5499.1465.6614.8394.1697.3535.61831.2302315.655.73038.81.1111.6870.4184164.6304.5220.8214.1342.7208.6235.9282.7185339.51227.313162812.42324.11291.1801.3951.81861007.5586.1520.9357.3592.2596427.6531187105.8150.7121.4138.6346.7114.571.7179.718890.9117.6131.9111.7401.8185.495.3186.518944.789.189.175.5222.576.862.8140190387.4103.3160.9193.8110.4132.317.1290.61911052.5301.21095.52271.61145.2677.5637486.6192630.699.9111.6214209.170.985.5102.319374.32980.51451.81464.1967.93258.61246.71115.3194103.995.6148.6197.7173.4182.1182.9151.6195232517.9233.4227.6231.8371.1311.1252.319614368.79559.46515.44725.26534.56168.53594.510426.2197174.7101.274.154.7170.5108.482.8122.419891135.656.660.389.459.645.659.419961139.776.31103.8315.193.41137.5145200174.8227.8166143.6811.9124150.7494.820197.840.6125.16018.8363.416.6745.354203248.851.5202.6274233114.9678.6137.4204355.2445.7563594.4551.8780.5259.1741.32053081.73669.54544.74530.258214180.62864.16443.9206635.1335.2212.1203.22002.9327.3212.8296.9207108.8465.211541017.8856.5253.42406.9982.7208376.187.8163.3235.1433.7162209.8341.420940986563.65001.82151.63441.15849.75350.85424.321113293.256352.52754316362.212402.530128.425478.326582.62123366.9504.5937.3451.1493.9512.1182356.521355772.1102.272.787.2125.668.684.721569.6611.11358.51255.11026.12885253.81589.5216307.44181035.4885.1913.2784.3771.5663.5217122.9221.4276.8282.9382.1276250.6310.7218405.2348.1325389.5308.3374.2366.4279.9220133.1120.1104.490.87487.260.6104.9221202.1462707.8738.8744.5462.6507.6536.4223401.3290.1265373.6219.2205.5250.1279.222796.81403.6588.9742.91379767.3484.7435.2228744.11944.7680.2365.74181097.5375675.9229192.8268148.6179.1300.2245.5147234.8230587.1143.8108519.8327.3137.290.6168.9231159.4112.3101.9123.3147.395.5310.1105.2232861502.81501.4235.415668.238.8605.24886.3233813.81781.76349.75834.78518.54215.23924.84770.723519.1393.8248.5975.61843.272.6302.8584.4236135.6172.6172178.6303.1218.4107.7240.42371106.117892038.41890.32100.81798.91370.41717.2238366.2375.61127.21261.71343.5899.58591414.423961.2182.2230.2474.9731.798.3176.9251.224091.7193.4362.9596.3923.8202.3144.4289.624126.6324.2559.91218.51761.7170.8321.8584.82424172.91891.11654.2117912788.12452.41809.21758.5243248.1152.6323.5711.2510.7217.7135.2244.724468.898.9183.4204.9179.5139.4209.7132.7246385.380.7187.9227.3218.7122.1230.3250.4247115.2187.8109.8134.8162.4139.5154.3176.4248175.8124.7211.6157.6122.1213.7119.315124978.81316.11303.21406.5646.5109489.7316.725141.962.5102.3171.412987.17344.9253297.4222.6147.6339.3377.1276.6218.4296.8254170132351.7258.6501.345.2529.9460.225511404785.6207.210889.8121.151.6256509.5559.2396.46461.4596.9143.81128.172.8257111.3113208.1145.8103.3155.1204.9122258373.920.971.2831.4206.87.319.2134.72591.2346.7153.9329.11431.2189.151.2376.3260269.3188.5157.8133.8179.4168.2152.1211.1261363.1886.3408.2266.3337.5580.5238.9222.6263350.7311.2391.8381.3340.2408301.8534.9263560.3220122.6491.3334.4187.2129.9227265305.3771.9487.2449.1359.5453.8572.3448.6266587.1510.1304.8271.5354.2346.8203.3606.6256110.1118.2141.4183.8193.4156.1104.6141.6268829.5440.5993.8821.41312.7938.4407.21476.726958.443.632.752.348.947.735.431.4270414.3315208162.5188.1275.9132.5378.4271184.7216.5242.4350268.7323.9246.1211.3272673.6752.9549.8450534.1526.4507.2463.9273667.94430.82398.62278.92835.25763.43170.910524274309.4563.1382416.71158.9634.4198.9501.8275150.9343.1349.7862.7617.9370.3217.2282.6276144.22577.7914.91262.72706.1873.2822.4731.1277221264.6204.6186.4182199.3212.4205.92785.1445.5286.4951.32040.1322.797.9556.92791964.21929.51874.11425.72873.12411.127534215.22801725.81807.217902026.63105.83426.93401.64521.1281299.610.661.7159.3165.822.710.956.8282253.1287.7240.7553.9252245.3295.4310.6283451.8310.2223.6224.6261.3262.4300.3265.8284107.26579.394.477.195.288.368.2285126.9108.289.290.895.783.3101.156.8286207.5742.2937.41260.1840.3441.71221.8518287147.3167.1130.2109.190112.1102.3113288171.6203.3136.7135.2166.9154.6140.7158289371.3670.583.51902.32036.548228264.629180.2126.472.578.8132.2210.163.6112.729238.1110.746.9472.61250.227.4126.266.3293222.584110.2187.112459.9126.588.82951213.6281.8785.8379.3174.4535.7147292.6296898.3582827.5972.11280.1738.61194.8908.929758.468.579.3128150.255.443.358.5298389.2195.7352.2318292.9275.4295.4345.42991008.9952.4435.5935.91207.21276.81004.8874.4300616.3416.193.2235.8253285.2321.8218.3301787.47692.9760.9597.65824161.5866.61551.43028.220.220.526.438.311.548.219.3303667.1584.1822.2624674.3794.9891.8698304184.1237.5283.8497280.3200.5163.9170.7305158.6187.4179.4240.3128.9137.5171.4144306177.6272.7152.9164.2148.6151.8118.4196.2307232.6294179.7177.7166.7143.1269.6156.13083916.91024.81901.6978.12018.213671084.72030.4310840.81027434.4345.5351.7775.7403.96043111.4100.4111.4207.4110.6112.785.548.23123441.62815.6597.5664496.51479.8176.11442.5313100.5123.2112.4128.1112.7146.283.4132.5314271.3291.9302.3543.9514181.8157.4408.4315194.3265553.7442.1676.9352.4338.1580.4316190.3130.5393.5448.9461.5184.7184326.6317187.8207.7143.51020.4167.2168.1180.4189.731841.318.463.6115.2161.234.415117.9319860151.7173.4206.1185.7184.2193172.4320509.6854.4499.3516.6643.1697.6512842.6321856.4633.2596.3403.9477.8545.6282.5377.9322433.2202.4278.6249.3234227.3234.3199.3323841.52787.92937.21793.41324.14240.924862525.832434.620.838.8166.5195.2110.185.575.9325493.2226.8266.8301.9256.4292.2312.9251.6326107.715004118.25094.14992.31863.83521.728503278.41.26.158.153.110.11.119.4328448.41313.7690.6383.9558.3678.1451.7643.7329242.567.967.95261.753.971.250.233017.847.239.7282.170.442.8119.647.7331733.3495.8278.9232273.6280.6257242.5333302.31043.41067536.5739.2789589.6857.9334135171185.4142.8175.4125.4150.7191.2335114.3112135.6198.2140.265.382.4146.1336273.5427.6549929.9527.7486.6685.7484.4337127.6450.5304.7308.8228.9259.2192337.1338122131.1153.1314.9206.1109.7203.8162.9339589.7576.7629.8367.4474.8496.3533.8528.2340345.7362289.7277.4243.4291.8246.1272.23416011030.1896.3495.4536.51091.41222.41064.83434100.7199.44311240.18330.475.2123.13441624.52249.21044.51143.81222.61571.51112.91923.9345238.1412.6253.9217.5231.2189.6247.2211.33472041.81350.13062.92896.23974.12601.71109.23899.93482985.83296.87137.17441.29015.94507.62225.56141.5349242.2171.3270.3274.6214.3206.7232284.3350145.3165.3253.4465.2473.9247260.1349.3351221.571.2134484.9440.992.2237.3182.5352302.8377.2355.1306.4343.9332.8471.2707.4353485.1155.6246.1298.4282.3160.5283245.43iSEQ ID NO:923TT924TT925TT926TT927TT928TT932TT933TT3544999.2948.98.58107.3357.6741.12903.8582.13551542.9255.1105.54694.498.391.61287.2466356955.2717.810551279.5479.1524.8624.3654.8357742.1866.6793.6981.1533.1757.7765.3734.4358619.21731.9778.3770.2675559.42309.31072.7359393.4300.3283.4311.1437.6326298.3314.7362382.2940.4368.8968.1747.1473.33226.3666.7360305.2656.7364.5362.7233.2217.2638.3448361455.4543660.9437.4376.41699.9116.7462.7363425.6414.8478.3461574.2432.5334.7437.11730.21032.9682844.1393.9674.51344.91001.2234491961.43686.92642.71807.9344964642719.47354463.2545364.5928.7902.8291.21104.382391.2881.8994.12512.81239.11078.91105.41030.397066.73621.18955.91021661461554.63073.12224.41076.1133.748.5112.370.940.5125.884.211423.1502.3256.7620.1215.5224.51442.7450.713208.3631.4132.2270.3127.5202.1244.8524.11417723284.9595.11382.8378.2703.91281.91396.615273.3253.1691.6629.7624.5137.91375.3988.3161155.71826.61298.21503.2766.7976.82803.31587.517981152510841110.8713.81879.12006.1958.619295.3325.42332.9154.5766.21435450.61516205.6231.81.1406.2937.7717.228521216.91426.9466.21058.3233.189.32805.3820.1225541.15019.97633.37736.74422.44997.76683.95281.223418.4128.7924.7522.4263.195.81540.61482.224124.7262.2466.7332.9277.9112.7502.5370262003.6326.49052447.21915.3199.61793.95637.427903.71325.6731.2620.3523.4499.51436.81142.62977.9153.4131.3265.8339.291278.2113.330244.5111.3342.61082.1219.4136880.6493.231717.25693.4185.82809.1627.1214.113720.9411533942.91061.8704.63949.8244.3466.45262.72453.2343136.1702.34502.93384.32498.91817.4204.41637.335823.2709.61791649.8528.8173.22586.2722.3361961335.4173.1183.3431.8189.1339.1986.237190.3178.3281.4264.8256.3166142.8210.338764.61248.7543.52191.9232.8763.62898.91375.140454.8644.3481.5529.5897.3467541618.641324.4539.9467.9199.6143.92803.9331.2668.842245.1482.5178170.4246.6572.5528.4345.243312.4237363359522.3337.5229305.944485.51587.5666.9778.7788.5427.71308.41173.245523.41739.2564.2954.7723.9426.51423.91045.946219.6289.5291.3270.7363.6297.2236.2308.847358.31203.3261.6420.8219.8231.9811565.748132.232.9529.417.2481.915768.81447.349502.33238.8380.65448761.8211.713066374350203.5179.7458.7481.9247130.41359.3491.35136.1495.536.6477.9354.1190.1860.5367.952217.6305.8203.1178.1145.5199.2266.4254.353135.21943.2130.6584.498144.22628.1714.354980.61795433.4795.1591.61643.81486.91394.955106.385.498.876.597.290.886.481.55672.3168.254.577.870.1175.9120.4338.8574530.25218.3281.24508.11636.41547.54191.44170.2588556.86205.1264.95634.21765.72033.78482.44433.9591700.34628.32056.31693.4800.81336.95450.12540.660185.2235.6229.2272.6145.4296.3224.931961115.298.8149130.4193.6134.390.8139.6623145.74454.62756.328555821142.25129.22442.263379.2744.4325.8938.2356.15021395.4539.964238.63544.9113.1512.4242.4124.5661.9573.565113.4390.1172.8433.795.5201.5506.6282.366712.91199.2529.5816.9392.71636.51229.21158.86729201.124240.435951.330300.539570.834590.312924.333523.768369.9258.43692.3955.13718.52125.313.82527.3691786.81413.75838.92685.99047.24524.2193.45503.7701299.14941.41670.81399.34204.22761.21891.33217.771319.83969.91361.7304214.9196.27882.82439.772858.12076.74241838.1291.2256.64680.61518.673330.7633.1342.2295.9422.6202.3561.1512.875160.91925.8332.6236.1224.7510.62680.71504.476186.2576.1105.9163.7609.8358.6809.9826.1773237.71390.95841.23756.28578.93419.8278.93072.778390.6630.41085.3608.2792.8957.2640.8631.779149230.2167.8234.3145.3153.8436.8205.9803351124.8139.3306338751.91832.2582.181756.31099.93142079.91185.6169.35642.31783.282204.4219.8346.6218.1417.4382.997.4242.284161.4305.1329.2121.2177.5155.6567.227685268.5148.9131.59338.9157.7130.4841209.58663.760.190.794.777.363.7128.2210.387336.8563.4358.3784227.4345.86260.3351.1882065.91415.15272.527634806.26097.4444.13528.889170217.9167.4265.8193.2219.7218.7301.190125.6103.3107.3195.6166.8106.5188.5236.29114152.64927.966.96763.61057.91430.57192.32761924155.79975.43017.42430.31461.85499.510750.26764.793253.7200.3376.1458.2173.2390.5123.5213.3942143.217231215.41528.1389.5566.51579.91152.995493.2509.2582.1343.1199.5575.4147.5827.496154286.2193.1193.6157.8242.7283.8221.597289.41005.4259.4282.6167.4291674.7490.29816.818.839.836.226.932.420.3129.599254.8406.1225.7255.7266219.6745306.110012961.3633.223136.513157.84258.21845792.19157.9101199.2366.4205.1247.6410.2348.6240.2460.8102169.7159.1125.6126.2215.3150.291.5222103283.5423.8297.5295.3439.2325.4387.5411.3104480.4470.1825.8374.7462.5333.1196.7465.7105619.1605.5855.3445.7366.9360.7367.7428.9106431505.5776.2415.5433341.7213.9403.2107543.7258.5162.41100.5444.6341846.1327.4108369.2171.8356.8273.4382.3416.2184.3269.61092753.8628.9228.34738.3100.41962.4446.61981.71104958.71350.1414.37933.5114.92744.51064.53917.51111702404.91150.91477.81041.7814.8162.5988.11121008.41893534.7114706.3402.21536.41239.5113151.5782135.7174.6265.6218.31021.9721.6114530.5317.9811.7453.1335.8512.2419.4481.1115303.3874.1578.9468.1458.5324.91401.9823.6116268457.4242.4317.8206.9239.41630.2331.41172483.3467.53516.81446.41615.14189.5228.41398118165.1112513.5378.2458.6641.7191.7241.8119231.3494.5171.7189.4195.2333.6346.5301.312087.499.3267.372.498.975.752227.3121967.43533.9789.31797301.9588.64329.51463.8122139.2473.8265.9361.231576.3341.7238.2123119.5215.8183.1128.8119.8265.2182.7263.7124109.4166.6139.1148.2604.8130.2108.7169.3125722.7763.11037.41010.31402.8848.6637.5908.81261296.7159.81627.8874.6884.3818.1110.9767.8127104.8194.810595.2146.298.1305.7145.8128224.9308285.9277.2363.9241.5136.6243.7129545.42482.1213.22357.2237.71139.45618.81929.513076.7408.175.290.5165.7222.2490.8419.513185.81368.953.3125.2103.883.8726.3483.3132172.5245.6197.9213230.3179.6212.1210.3133146.7108.366.257.7106.666.4177.979.6134143.3290.6125.887.5146152.7489.7203.5135483571.2802.1590.4416.8293.2388.6465.7138139.2119.6184.4178169.675.2370.9179.5139121.1452.7115.4122.7113.3162.62391941404146.118761951.61338.3211.91.2179.7833.91411804.41208.1168815672363.31017699.31291.8144380.19550.3459.6472.65617295.89513.310388.7145194.42091162.4172259.9188.3229274.5146205.4202199.5239.1259184.3149.4241.414752107.575.755.966.346.253.6102.4148718.7437450.11743.3388408.31716259.8149513.6418556.5723.8170.1284.3345.2370.6150340.8469.1189.2647.8337.7133.8357.6199.7151378.3501.3350.8284.8186.5295.11725566.4153135.8159.4124.9120.8128.2109.1403.41078.5154315.73650.2708.61687.8203.3594.77527.93225.5155173.6320.6127.8180.3169.7101.4200.9264.61564525461.880.7117.5103.3127.8570.5157136.9129.1120.6168.2166.4137.2114.9166.31581.2666.76.771.942.671.21801.9533.31591953.42285.33885.52682.23034.83946.61345.52577.3161319.4130272.93.429.5683.5715.72665.9162110.341257370123.669.8481.8259.516416719328.7183.5423.7105.25095.92963.93993.31664942.95074.87381.46040.86386.63311.82123.62331.2167749.2988.43046.31523.62291.61961.5174.82118.3168751.11098.9495.4268.2581.5558495.71402.71697503.72997.61624.47311.54532.98835.68236.48878.21701092.73984.7914.41353.11072.73583.16780.12356.31711091.9103.22345.51683.71336.167.41413.41527172647.2545.2686.6676.8882.2643.6381.4537.6173310.1807.9316.1454.7125570.22254.5686.8176352.83659.5161.768266.9511.81820.11938.3177266.4422.7627.2464.7698.3660182.2629.917878.12301.7104.6251.2360.21258.12294.61651.5179128.91233.166.2511.4130.958.81647.21137.8180105.8710.8107181.6146.878.71093420.81819757762013164.39078.611540.27914.94064.38345.1182496.8473.5600.9574.6265.4353.5605.3428.7183392.639.91783.880.3243.423.2486.11115.1184259.122002.2275.3392.4236.8191.23061.92469.91851311.73109.91695.22606.41042.9801.21663.76383.1186309.2248.2731.9456.2752.1448.3238.7330.6187360.280.5282.7112.1108.252.7216.2310.5188146.5209366.396.4142.6103.3898.6358.818984.1133.6168.173.613348.1304.3209.31906637079.899.890.5387.4665.7640.71911054.31687.11089.64008.9457.11051.34042.41869.4192101.978.1134.8200.9179.165.7775.6145.6193815.2514.51367.91552.31059.72629.4354.5944.3194138.2264.9193.5255.5125.4157.6270.8185.4195269.8168.4314.1235.5344.1291109.8242.7196183518913022.52154.730255691.112246848.21977867146.689.4111.894.472.199.419859.7349.1117.372.477.765.989.4217.41992202.9301.5120.66209.3190.5911705.6642.7200369.9467.8572.4164.5285358.3533694.82014783.41093.342.17327.6380.1865.72830.3670.3203229.2565.9244.9314.3126.5350.84025.71159.82041028.91353.2742.4630.8467.1794.81093.2723.22054521.13738.96165.25757.62714.1369644795109.5206286.5137.7822.1155.9838.5245.41616.9203.72071415.9489.1680.7771.5469.4789.493.7464.52081235.8212.4285.9104.7204.8139.6283.2359.2209833.21350.43254.11747.45771.71318.986.52452.821111370.8683.410746.511683.636602.314294.3496.211150.1212417.31679.4495.3397.91235.8814.5486.7989.521380.368.584.3144.480.35974.4100.72151765.1754.51147.41032.5842.1953108565.1216976.1385.31162.1844.6488.1945.3574.9513.2217246.71309.8268.5563.9267.11014.6687.1752.5218309.8166.4348.5328.9276.7314111.9166.422075.389.181.168.8102.464.658.566.7221711.2968.6587.7780.3463.3617.21979.71046.5223360.9409.7327.9542.2323.6203.4535.9305.2227720681.3761.12095.7501.1532.72050.62295.1228319.6300.8802.4439.9916.7403.2157.7507229228.5277.6251.1185.2164.1200.4180.1258.6230277.51169.1166.3609.9138.4112.41313.41176.2231146.9281.7111166120.6124.91309.9513.52321325.81986317350.31427140.71196.83680.12336765.27965.76520.57610.72523.63946.515970.85207.9235798.9137.61126.62196.9740.673.9877866.4236109495.7368.7241.9407.9187.5496.94262371643.32222.918461647.11467.41755.21820.32097.62381432.81140.61085.21024.6592.91468.41314.41287.123983.3421.5345.8665.5279.4372.4776.5766.3240140.9406.6453953.8285.9481.11780.9951.5241234.7932.4931.71944457.3892.72797.12091.7242331421699.61079.321653.53263.33729.421913.724536243354246.6412.21107.5269.7217.5691.3311.1244222388.3205223.8105.6325.5474.4399.6246472.31406305.7434.6199.4177.41088.7901.824792.898.8151126.2202.2107.483.4102.1248212.23753.3158.2227.2186.1449.424803964.52491409.41281.8405.11043649.51270.819581894.725199.7776.596.3222.977.6219.81995.8859.5253275293.5302.1128.1252.8311316.4291.9254695.91525.8629.1370.5121.725701228.61090.425560.92489.789.7245.42891251.32613.61698.625612009.8382376.16109998.61154.16963.61470.4257181.8218.1208382.8124.9107369.9216.5258864.1663.9212.21288.313047.22891.5350.9259235.3658.41209.1373.2212.5143.51662.81191.8260151.4161.7168.5138.6240.5128.7127.1189.1261200.6567.6409.5332.1282.3256.2194303.8263524.9637.2549.3697.3354.8473.9797.2691.2263262.81110.6213541.8164.6154.51268.5980.9265278.9105.6510.8504.8664337.359.8364266414.8163.6326.2220.7601.9433.1158.4283.7256126.6169.2102.6129.7138.6131.2232.7376.52684551366.41736.7757.1890.51003.2289.5131826929.7103.93784.968.84687.8154.9270198.8186.3209.5175.8440234.1176.8287.7271239.31388167.32027.5279.7256.33061.5829.7272368514.5501.9443.2535.3513.2464.6370.62733575.11142.14935.82965.14032.35489.5628.95515.92743691242.3929638.7910.6393.13068.91428275331.81186.4419.7790.1385.7210.6387.12099.42761037.3821.9994.32971.4802.9655.63409.53911.4277154235.3180.6192.9222146.1209.9210.9278393.72185.41095.91106.9475.5287.12762.21290.32791931.91574.62162.61696.414821484.12472.123302802954.92033.62673.92531.21688.41936.33691.52628.728176.5295.7134.981.787.5993.9793372.3282295.3214.12953209.3379.2245.1981.6261.1283249.5269.5265.3232.1431.8208.7205.3271.728473.5112.261.975.776.497.757.192.728511199.475.2101.194.768.693.998286629.852.2799.81994.7465.5828.953.1264.8287115.511387.7122.5134.4100.981.595.9288109.4141.8130.1140.7149.8126.1108.4112.528916661269.4941.65416.8893.2209.95258.52320.129179.6122.196292.2114.697.9167.1160.9292226.55489.8317.3841.696.181.24786.42366.7293173.9986.892624.7212.3203.9667.1929.4295312.61375.5229.51024.5598569.3688.517552961129.71734.41277.5815.2602.9561.52271.71202.629781.653.953.8152.291.562.5118.645.6298394.3619.7407.5404.3288.6242.2506.9419.7299869.81276.71226.2959.5865.11714.92366.21985.2300273.31444.8240.7364.3206.46601568.7998301354.5293.6797439.25202.8496.9215.5810.23024369.422.953.424.28.5116.561.8303635.73901008.6773.9568.9855.4413.7576.5304565.4436.2225.3950.6633.7252.3868425.2305213.5194586.7250.1230.8450.4693.3661.4306150.6895.3136.6156.5236.5135.11745.4158.5307127.6203.9134.7192.6264.9138.8211.5228.63081248.1607.61715.7815.51207.61667526.51140.3310323.3105.3561.9412.8554.5441.295.6355.5311187.1409134.4246.266.9232.4864.3176.7312215.635.7964.5512.91442.3743.11.2712.1313102.1614.877.9187.7226.5400.1210.6454.43146811706.8671.1751.7185.6303.4684.7792.1315211.5216.7421.9234416.7500.7245.9280316435.5619.5376.2536.9395.4330.2704.9460.6317168.8203.4167.52721.9212.3142.8142.3295.9318129.1300.4132.8150.654.139.71463.9297.9319438.9357.5187.5180.3354.2257.4855.9322.5320533.7201.6562465.6667.1655.6266.9475.1321320.6174.3471.9402.1561.7371.6180.9319.4322257.1275.3249193.6264.7232267.4249.93232838.337402267.72105.42020.17965.72455.66172.4324139.6720.8116.187.966.3225.9269421.6325325.1538.7346.6353241.9342.5547.1466.23266936.934063724.5617629493655.61280.42870.432729.328.440.534.81.143.150.585.2328323.8284.6596.2451.7857.7576.772.6488.63297683.569.971.38178.765.141.9330148.3861.937.4251.519.553.51666.2255.1331232.2284.6291.4279.4449.1243.7257.3263.5333420491.9777.5589.6728.3591.1250.1419.1334179.2509.5135.4165.9136.1152.8170.2551.5335109243.2144.4104.1452.172.9710.8914.6336765.5230.7670.7465499.8294.9129.3318.8337312.91159419.7497.2178165.9990.91049.7338577.4617.7185.9401.6177.5251.9956.2491.5339392.3332.8470.3340.9615.4377.2170.7322.8340246.7275.9213.8279.9271.3234.8170.6251.1341539.3411.3601608.3542.6515.2389.8567.6343244.138583562.51435.6259.12195.3417.33441212.4452.61195.1997.31945.31246.2594.8932345264.5585.5216.6239.2204.1247.3398.5204.534717383503.55107.22563.12564.32751.214844149.23483976.77721.46875.54637.63708.36099.25834.67036.6349273.4377.5176.5381.9233.3415.6597.8380.1350321.2741.3399.7390.9121.3191.6653.8456.2351524.92215.5274.7977.6159.5507.22220.4809.3352503.6131.4464399.1339.9347.1171.6202.5353362.5223.7256.6221.7248.9379.2318.9224.13jSEQ ID NO:938TT940TT941TT945TT946TT947TT948TT954TT354124.7131.568.51831.32991.11970.34151.3697.935560.558.518.76512959.83221.33037.991.9356930.6668.1621.51481.2524619.9852.9343.7357668.51037.6614.1992.7744.6692.6698.9500.3358534.12157.9778.4766.22015.31757.91431.4322.3359630.5285.6377.6284.2331.2319.5309.2503.3362416.8682.5687883.51080.8836.2746476.8360275.7208.2221.9220.7571.6596.9804.3159.4361583.8838.6283.7134.5371.1271.3137.7156.1363425358.8438.2340.4460.3536.2369.7849.51912.1505.2651.71316.81552.61201.31465.6256.122300.42928.61830.4985.53226.819701555.6876.47656.3686.71076.647.51068.9536365.41299.181044.12152.8933.8991820.3808.2739.81547.894509.21083.61954.21300.12078.339081283.1685.210140.188.1122.41873.292.1150.4164.5113.41170.2163.3140.5707443.9558.3863.682.913151.7615.2230.4207349.6491.1268.6107.814292.71519.9379.4942.71077.91723.41237119.815287.3218.1204.73524.8341.42287.5744.4147.9161093.91353.61394.3376.62242.42345.14508.1532.5171167.21155.99335171588.4984.51068.3312.319241.1159.7215.2431.13112812648.8285.5201.213.81.1238.8388.1452.5759.11.22113.1453.2114.212979.21497.12096.8450398.9223034.32692.97458.47149.43919.75688.15625.71444.423240.250.11.12306.1246.92461.4936.21.124167.459.167383.4283.5552.3205.859.9261363.13331553026.11238.791642694.566.127664.2691.5441.3957.51357954.31589.7352.82989.7109.7122.73754.740.3136.4202.8163.630132.243.3144.71236.6203.11185.3426.373.83170.5216.285.516661.78943.313168.116458.770.633754.7291.749610017.82060.87990.63081.283.8343799.41463.12114.5557.9529.31398.3512.34496.73549.6245.8449.4283.11235.6706.1239.47136319.6311.9235.6621.12677.9398273.3356.837165.2175.1219.1198.1231.1292.9220.8375.838588.7850.6583.85243.71146.539901615.279.340474.3418.3456.15232.8561592.8854.7557.241145.4200.595.4209.9739.61408.3703.3263.342259.7422.1296.8134.4388.8299.2320346.443312.7469.7413.4844.8254.3342.2278.61487.444513.5424.1470.75541223.31138.7885.5455.545890.2736.7547.2940.61426.21512.11930.91179.946245310.6350.6275.4289.5350292.2348.247282.9220.4144.2180.6703.3454.3694.6183.64865.925.341.1147.2354.71468.641315.749257.11250.1224.512537.45118.72265.34031294.450174.590.2118.51385.9212.4962.9427.932.65195.1552.756.4170.8478419.9827.7730.252197196.4147.1401.4251.1232.6352.8240.35348.5381.996.11013.62192.5931.31091.51.754826.41710.8514.81477.31185.6797.41536.4340.455115.1111.994.4164.79480.689.7130.45664268.479.290.4219.3188.7175.563.757617.91038.1375.9868.212415.339831493.6579.158584.4972.6292.82931.711316.35093.92162.2939.4591552.81358.21824.43299.33044.83483.94854.3122.260123.4154130.4239.2412.9378.4248.4139.661193106.498402.3130.979142.9155.7621365.11782305.22981.43752.12025.73563.24345.763145.2365.5174.3650.2742.9588.7744.3153.864143.1168.7146.9198.1479.3303.3288.31482.765149.380.854.7446.7254.3265.4155.356.966834.1822.9752.9332.71793.61625.82019.9272.46735954.428315.736691.22509.329331.428689.219265.724099.5682348.512253289.623.4760.41000260.11110.3693844.91911.74757.3675.42667.43541.21114.37548.2702817.254742510.66068.14627.558534221.9861071194.3578.8125.9216.59508.53820.81470.284.372588.11284.2401.1327.22278.51343.5141813173258239.7218.8232.7766.7694.8726.4198.675252.1212.9239.3123.91227.9463.3938.9272.6762962.6845.5915.9198.81587.91178574.936117716342.32666.515026.8503.112351954.22093.64483.278729.3762.4748.4157.2758.2290.5576.41050.679174.2122.2114.9257.1232.1270.7344.5138801248787.51009.5282.2770.1649.91098.8266.381115.6272.3127.3229.25071.111031.37637.743.782610.7314.6210.5232257.3258.9135.41823.38494.294.692.683304.7340208.787.385140.2169.4138.12066.11108.11254441.8428.88639.971.999.782.284.5383.5141293.587298.4166.5180.311204.71172.7669.11630.9199.4885196.83340.85827.4127.51059.31704.6635.31431.589235.6196.8215.8267.6325.5267.5617.523790115.485.796.9368.5152.8292.9344.875.491522538.6254.83408.36047.22646.81460.51153.4923787.57863.12264316.17435.15854.55932.4213.693338.7224230.8159.4208.2159.2161.6162.194635.6617.5996.8254.1860.97681265.529.895699.71108.4462.481.3719569.5312.276.196333207.6214.4289.7323.1290.3295.4231.997416.2279.5425.1563.7405.6387496.6170.19827.337.637.736.218.737.239.6211.199301.5228.7224.2752.5370.7398.9427.92101002314.73267.416920.7300.1254.34199.9860.32812.9101330.3321.7727.274.4500.6272225.2171.9102169.4127.4144.6162.3150.2178.5170.9171.9103381.1314.1488277.5491.6397.1366.3377.4104692.9415.8921.4315.6185.7234.958.6310.2105372.6381.6637159.3149.3300.479.5455.3106646.1411.71024.2213.3167.6292.169.4362107267257.5123.5748.7451.6527.6584.4230.2108573.6195.9332.9184.1209.2219.8263536.810961.91019.956.4186.23392.91439.41742.727.811025.12062.422.9215.17704.231774011.81.1111143.5479.32111.441.4269.7337.1266.3190.6112551.8742.95591551022.11281.41187.51294.411399.7563.8103.4189.8444.1262.8316.1223.5114503.8603.2350.4104.9714.7677361.5212.4115401.8436616.11714.8863.7903.2724.2444.3116209.7203.7150.52167.8763.4502.8591.3201.21173806.61057.13146.1179.1561.9533.2197.2320118138.949.585.3477.1265.1194.4119.2509.111981.2371.2135.5216567.1144.4163.5165.4120160.6114.371.992.6176.6216.8101.484.2121164.4411.2437.2213.33724.51512.33717.567.312298.880.1243.21399.7264.3428.5386304.3123228.3146.3183.886273.3303.5160.2337.2124151.3149.7152.5120.2120.6139.9109.11219.8125909.1689.8819.3575.933514.11041.2939.81157.91261425.91166.4900.7103.3147.1234.7109.9694.212799.186.5106.2122.9202.2163.7251.1114.5128231.7208253.1214261.371697.2219.5291.6129202.2353.5133.81125.32440.81025.81063.6165.3130345.4395.112169388.5391.7446.8121.4131168.1194.181.9126.4965.8403.9495.8134.7132181188.5164.5532.9286.9263.7252.1213.2133101.3107.4143.6234.5193.6164.6236.4134.6134208.4308.8149144300.6320.7552.5107.9135238.9233.2326.6225.1687.6468.7352.5301.713896.3108.4108222.7408.8249.3192.4170.3139165.699.976.6136.8269.3296.315995.61402802.52059.91086.636.8599.5750.1666.11.31412290.92263.42358.9108.9934.1627.7325.8732.51447698.28602.5444.5323.912464.511467.67038368145193.7146.1183.3157.9225.5228.7268.8245.8146240.8175.6204.2249.1261358.4743.9242.214747.828.434.355200.2100.25164.4148229.4308.8238.2263.9480.4561.5358.6145.1149551.3349.3339.3928.4251.7301.5518.5137150164.4207.3163.4141.1291.4208.5289.6323.1151126.6323.1102.9132599.9423.7877.989.4153115.7114.691123.5136.1115.3108.6154.415496.3720.7304.7130.91984.85390.16547.479.715597.9124.5101.4112.9272.1587.2922.9167.615687.790.595.849682.8491.1331.159.2157111.6117.5128.1151.8208161.9186.4149.315865.61732.586.6324.9473.6737.61773.815.31593116.834525239.7900.32646.81464.21902.598016114481.91741.52880.91.14831.78199.73949.650.716289.755.328.4589.7490589.7221.535.9164177.58435.5104.776.75265.1293.64062.988.11664359.32839.161631137.71081.22208.22366.93751.11671749.11818.83470.51.21723.11291.3832.1565.3168710.21123.1423.859.31688.4894.71924122.31691524.82200.32148.91401.811518.512728.96382.11374.41701062.42335.77581597.82005.82041.33494.1467.31713638.6581497.11638.65452916.5723.71.4172663.9679.9727.5420.9685.3596.1496.1610.3173416.9738.3140.5328.51336.6772.41320.3267.71761.16520.4150.599.23722.2368.31845.429.3177545.8562.41099.7185.2574488384.25981781775.41955376.9512.62127.51048.91852.41565.3179180.3138.6117.42012.31196.7828.91163106.118074.4892.7105.8237.5803.4419.6473.4114.31819404.26484.310300.3941.74892.76450.64354.99168.5182372308.8208.5248.4424.6399.7405287.118326449.627.6849.9182.82050.1619.51.1184340.23360.4202.11220.71934.2441.7306.9181.9185955.1847.9908.68586.159906583.44156.5642.7186377.1397.9305.4331.6290.1282.2230.3953.81876383.554.1487.3334.1525.2118.2375.2188135.2163.593.8278.1334.8593.656540.818997.479.773.5170.6247.6288.5313.763.819071.9271.7441.9766.9331.8397.9570.870.819111841205.3431.31127.32057.12357.61735.31441.4192637.681.190.998.597.8124.5152.4136.21931083.71465.12071.9376.7704.1341.3284.4528.8194105.9174.3134.6104.3225.4234.8239.867.9195513.2534.1382172.8221202.4154.9532.61966150.66442.810030.2655.34512.82383.71783.63777.8197119.970.866.6405.3140.1126.5270.4248.419886.467.156.7167.2622.11324.81830.665.719963.749.536.5946.43952.845573993.970200141.2131.193.9326.4480.8559.4384.1118.820199.9125.164.31769.63178.72044.93554.3746.9203205.72333.5101.7551633.6575.7143.968.5204536.9539.6677.133.91308734.6891.1781.52052519.65145.45497.1266.33930.636991755.23034.5206161.9155.6164.4948.81321.7387.6243.4466.4207632.93069.3716.582.8354.731582.299.4208414.1294.169.8102.5523.42129.8361.4692092353.23015.83230.6167.61434.91049.6343.53631.821125849.914301.831677367.5805.91538.7536.817099.2212806.21682.7669.31766.71465.31682.11111.32465.121395.814290.397.793.571.11273700.6215908.34183.71058.154.1546.4345.5127.3143.3216474.8805.2456.5290.5173.7292.6242.1234.8217310.4448.51982532353.61241.61337.2128.5218356.8253.7304.9121189.9218303.7349.522088.75960.1118.189.587.693.5429221480.5659.6319.4233.31004.21199.6880.1240.6223244.2220.3254.22169.6392.2560.5572.7233.1227757501.6622.86541.8749.45527.92138.893.6228608.75511481.7131.1431.4377.7265587.1229493.1133.9211.8452.4129.8269.4179.7599230161.6103.2123.81187.92084.82370.14149.475.2231118.2789.1176.380752.2257.9129.9148.9232941.1198.3129.71787.8868.56851.21950.15.62337265.54514.52133.71354.413569.213328.54088.9897.7235824100.3178.61170.4445.61811569.975.9236205.3143.9239.7348.8434.4422.2446.1266.42371942.71890.51088.62229.92092.31996.62088.9774.4238939.71507.6905.5237.4920814.4934.8213.8239155.31246.4106.29901304.2963.5415.2125.6240105.31516.5105.52154.11232.91172.8394.5111.2241298.23242161.33194.22781.82574.496215624266847652229.513301.522076.931987.127579.2969.6243154.1116133.62751287.9733.2891.1152.3244177177.5176.5466.1826.4342.9309.468.7246291.6200.2283.7627.113221294.21779143.824798.889.9132.588.7163133.773.4283.9248126.41414.5201.14043465.61012.61020178.9249782.431621403.376.11097.8767.3537.1537.9251161.5155.163.51785.1627.71481.51000.682.3253264.5218442.9168.6424.5446.9362.6279.9254105.62093.181.782.51493.7652.8622.8398.92551747.22263.9395659.62271.91148.51978.81845.7256435.9539.6279.62547.33827.21885.71217.91110.225756110.780.2207.2269.3316390.98.12589.31.3118.2870206.61331.33545.538.6259108.729.163254.6602.21965.41032.41.2260164.7153.3244.8156.4212.5156.2106.4401.2261991.9382.7312.575.3207.2161.7238.671.9263714.7331.8539.21150469.9540.1765.1394.2263186.913897.61287.21762.62495.83807.6183.3265788.6425.8473.176.487.4170.156.1398266353.2233.3346.6277.1270.4331.4210.9954.625672.3174.2105.6365383.6281.3202.2129.4268281.11707.5870.9706.92068.2688.8318283.326939.144.64054.8173.2430.9328.858.9270215.2272.7184.8275.7242.6247.3201.7957.5271235.7337.1250.4160.2871.9511.6907.5198.1272413.3461.6314.7697411.8753.7501.7539.42731403.72489.35667.824.31615.92911.31683814.1274614.7410.3702.22259.7916.51540.81573.5855275249.7229.2228.58716.52253.72452.51476.9255.52761102.2729.48238564.611808452.93389.578.2277166.3154.9175.4443.3274.9287.7236.4171278409.157.7133.6461.11337.11922.61313.921.42793251.53522.33542.382.41789.52134.11300.81253.52803966.43899.23833.5208.11888.53042.71982.81794.828119.5547.7210.928.9707.3438.3349.4158282204.3211.2288.1298.4427.8422.4236.1272.7283238.5204.2254221.9351.9341.6284.8456.328474.460.695.458.42258.384.182.593.7285116.893.3101.595.593.998.8108.7120.7286151.8621.9136.97331112.764.6214.1287106.573.4112.1121113.488.992.4149.7288165.7147.9139.4188.3157.7159.2153.4210.6289361.8386.8175.91115.34422.64190.91131.9143.329148.4122.179.780.2146.2305.5248.857.2292105.8222.915.82034.22474.91817.6494.716.929379.2522.459729.51441.8926922.776.1295337.6458.1827.4131.123692332.11528.5122.4296383.8625.7393.8207.21441.21567.122341401.5297535928.1437.457.3124.958.872.5298391.9287.2290.1297.6584.3544.1371.3310.6299923.91489.6612.9234.91909.52964.32109.9599.9300418.5788.5191.33361170.1795.11388351.3301991481.91125.5359.4219.4308.6234.684930223.510.420.2207135.3153.1376.59.23031127.8805.71035.876.4260.7316336830.1304168.9328.4141.92398458.16651628.3347.3305615.6310.91835.6139.91686.4577.1314.2187.1306157151.3142.31385.7410.9361.9901.3131.6307130.6104.8192.11073.9343.2232.4160.4141.23082650.81762.23182.2208.5559.7737.4291.12599.7310283.4464.8253.685.6100.7156.8136.21022.4311179.3173.457.1111.3657.6321.6401.652.1312292.8760.1295.936.934.2289.2131.12976.1313430.31430.724992.5552.3277.7267157.2314226.3371.8186.9342.82406.41007.7840.8106.5315309.4351.9325.930.1395.5278.5274.6535.1316209.5432.1259.5113.1414.1508.4795.4296.6317144.3130.5141.8227.4261.4240204160.6318107.5220.662.4340.5222.2300.4303.533.3319498.2410.5297.8132.9340.8346.8430.1820.9320581.2637.7414.9113.7262.1263.9280.4504.6321733.9546.4690.4441.5201.4365.2236.3491.1322217.9299263.9192.8327.7307.9337.2518.83233187.24533.52223.17584003.92801.51477.21113.132469.4506.868.6123.4493.6420.7324.747.1325450.9358.4218.3215.6509.5446.4622185.73262420.82944.2761.2377.62798.72211.23775.5127.932767.41.13.5294.923.8104.148.91.1328488.9519.1682.628.9478.5335.1132.2219.632922.86267.7356.26551.264.3179.233040.211.338.350722.3567.2650.145.5331273.9221.2263.6301.3394.4336.3281.2667.1333901.4799.41778.771.1251.5317.3197.7472.4334142.6391.3161.2132.6683.2297.3816.3123.433592.183.6139.7122.3635.2109.493650.1336415.5361.2472.655.1215.3220144.3242.6337248.11107.3362.9456.2546.9381.82046.3137338116.6210.198.7249.2759.21019.7678.9129.6339410.3355.2381.9207.7358.5303.8255.2422.3340222.1232.5256.4303.1602.995894.7123847.4268.6341340.4368.3779229.7428.7419.5322798.8343351.3283.267.9210.7808.42720.67228.23446.23441130.71272.9909.5155.6531.7706.2595.71725.9345214.4187.9216.5326.2289.7349.2223.2308.63477804322.61880.33519.14904.62435.81042.810573482033.18452.13722.68444.38098.73669.42324.62993.4349414.1298.8450384.7420.6314.2331.6323.1350193.6155.1166.7164.9603.4717.31008.9102.4351149.887.751.7177.81787.4975.6863.9113352305.1222.3426.3134.8158.9214.2127.41132353228.2245.9178.8150.1197.2301.1428.1413SEQ ID NO:955TT956TT957TT959TT960TT961TT962TT35487.9200.98.755.227.742768.135594.690.349.7131.543.1452.487.9356581.7511.3566.1708.3716.31212.4709.2357586.61247.1595.1664.9783891.1787.2358714.81339.8621733.9978.3526.41369.9359451.3315.7386.8424.9420.5309.2381.1362290512.7459.8835.1394.4252.8419.6360221.5346.6132.9201.9228.2220.9348.6361182.44121902403.3846.8964.31117.4363416.2327.3406.2502.2548.9506.15221675.4869.8676.6267.5452.3717.4496.321844.73591.13028.13641.63980.33803.63593.47309.8581.3550.1630.41040.21288.91720.881337.31229.51489.8865.2743.21080.81023.592938.335227292.51627.813667.84833.1816.21058.557.9102.297.477.990.89111237.4291.8198.6338.4478.9402.412713245.4217.883.997110.5141.1325.41413901022.1201.2221.1188.4343.31201.71592.3394.2192.7775.3322.5337.5375.91611902000.9686.21137.7815.91366.21403.617298.5665.49891727.816441382.7773.219176.4249.5161.8245.1209.8154.9170.7201.158.31.4133.81.12.21.1213541554.7106.91.3129.694.688.3221772.43116.75851.76314.110192.97077.52802.82344.4809.834.3489.733.21631.12486.3453.2147.635390.7121.5117.526645.42180.547.81478.1169.6380.574.727278.11212.1159.1236.2335.3339.4261.42978.481.923.582.153.568.759.63071.2234.9129.8239.551.611415.531294.9587.248.2138.986174.543.633162.4998.1428.51117.4279.9251.3313.63430532498.13095.72119.53047.92373.91094.735181.9491.274441.422.7965.81736127.6209.5637.32400.3139.2157.61485.137166.9139.5190.8131.7237.7198.7233.938130.1678413.51057.4365.3316.8662.740257450.66557.8482.9628.5522.6591.241134.2455.4123.4163.6368.6605.8254.342257.3576.9200.4398.3154.3212244.143446239.2748.7367323.5371.3664.844546.1682.4841.1846.6457.9413.3620.1451085.8897.1601.8484.8436.6816.9845.346294.3214.6267376.1303.22833204796.5206140.7192.8168.4247213.34818313.821.5378.31541.11.549303.8472.1236.5221.8366.2411.7363.75078.2293.2108497.3147.7127.266.951342.3124.4234.445.554.436.3156.352194.3158.4311.6182.3216.4212.3171.653153.6347.31983.6112.1196.9251.85412551165.2316.5359.8277.1598.1124855116.8117.3120.389.7118.2109.388.756219.8182.988.165.649.553.3172.857257.9611.8345831.21681240.7159.258242.6710490.12548.4205.51436.582.1591047.22248.51125813.5918.119991120.96097300.215485.5160.5117.3185.66190.4103.2161.9145.1203.2134.9108.262300.71868.2953.7574.1642.81633.813963297536.7193.6228.4311.9261.2255.964109.8100.1170.4227.4176.6190.7115.16587.5158.6150.981.871.667.2102661355.7951.2564.5797.6309.4509.51530.76734223.43183824742.436682.236457.832604.143684.2683348.21692.51286.839465683.42624.11368.7697947.54162397011781.210279.870555076.1704104.32568.649642477.4881.6933.22792.271619.9681.8113.5372.3137.172319.972229.3609.41269.4639.7229.4694.7159.473260.4365.9207.3238.1275.9264.9416.775149.7302.2171.8538.4453.7249.2115.4762162.31321.71892328.112.254.41010.4775244.72705.94944.64760.44771.93213.43514.878310.5589.31329.21771866.2805.1952.579231.8135.6383134.3114.6119.6116.480667.1355.6404.3450.585239.4268.7811253.31566.684.2100.9194.3384.9263.582333.1228.4350.7215.3247.9520.6252.584147325.5277141.8114.9106153.285163.8102.1111.6119.6149.3210.2180.586193.855.995.3298.1298.370.271.187156.9158.6353.7164.2293.6482.8160.98833254358.24541.76014.17677.110815.9500689140.5120.8185.6259178.4199.4228.69068.4170.591.9205.987.5144.711491249.8383.1110.81269.170.91429.673.4924953.46959.31774.32917.72117.87949.37560.693201209.6400.5170.5283.1293.5163.494260.43158.752.2867.5660.8606.6836.795593.4622.7577.7104.7388.1646.71203.296165.4233.3200.5123.7184.717137297273.3336.6287.9296.3132.3317370.19870.841.825.416.525.632.73099164.8189.4116167.2280.8245.9257.1100610.812721.116769.49378.24271.415550.11798.6101232.4238.6434.5383.4434.1504.6729.3102147.5132.7112.2180.7209.4215.6169.1103309.3255.1195.4418.3293.4404.3381.3104631.5573.5522.3415.2370.9830.3589105655.3488.2398.8564421.8540.9516.4106562.5491440.4361470.2736.1469107170.3157.5207.8405.5147.6558.5118.6108260.5430.5385.5555.3419273.4323.91096189.12697.142.665.578.8577.26878.311010703.63965.41.228.119.71384.5130391111743.41684.3944.41390.42754.71147.93105.8112823.1805.841.7109.8237.759.8620.111324644547824690.9253.2214.1114239.9397.1452.5688.81076.1566830.3115441.3600.8435.6627.2408348.9523.2116223.5218.9200.8251.8236.2182.6216.1117413582.64938.95309.22714.33839.8902.6118203.1268.2141148.8118.434.2105.311945.1322.8110.9119.575.9246.323312063.4106.6118.6184.1122.382.1114.7121461.913241289.4211.1422.1737.7749.7122243.1213.952.5140.884.5274.4144.3123189.9195.8480.9135.7146.6163.4216.1124130.1117258.6193.4182.9170.1178125984.3573.5539.91065.4967.51025.711721261322.2965.11360738.2631.31011.4682.8127131.796.4132117.3113.4116.7127.7128194.1182.2236.4276.3285.9310.1367.6129130.1229.7252.6224.8171.9522.6200.2130185.4150.7162.79993.789.6207.813195.8152.7148.347.374.796.594.2132163.2168.1192.6193.3258.1217.7272.4133204.5249.284.8160.370.865.275.8134287.4159.698.4197.6118.4129.9184.5135373.8551.6416.6392.1459.3328.2406.9138137.1115.6126.5195133.1149.9117.4139116.4142.379.771.680.287.777.614074.53607.62148.21275.73106.62235.31653.31411566.12429.4761.511822077.21681.81605.614412425.97539.3395.2417450.5512.87238.7145160.5137.2206.9220255.1198.3239.2146182.1147.4169.7202.3262.8225.5211.914728.643.99166.426.559.820148205.3553.1180.2198270.3668.6306.4149325326.5236.6362.1407.1765.1342.1150197.1234.6172.3171.9270.8246.9159.2151123.1264.295.7127.8158.8148.1257.2153103.8118.2112.8119.6110.6115.4113.9154304.41676.62431.9408.8152.52641.1142.4155498.7158.7136.4138136.6144.9139.315695.489.863.651.874.1120.865.3157178115.2155.5132.3138.2159.9181.3158283.41174.219.816.21.213.6578.51591776.82641.61398.31601.93134.93315.733961619817.82623.3177.1129.76.7152.91887.416245.7101.627.6150.840.376.246.916478.1707463.5110.3193.8333.73770.916663842992.44919.55671.46028.16429.23769.11671191.31999.31864686.41834.72207.62362.61681167.3843.32714.31862.41004922.51487.61693437.74365.51880.13159.81921.458361307.91701488.12441.61019.61307.11150.42496.91953.81711.2722.21.2760.41.2725.91.2172590.7573.3719.5631.6816.5666.4904.9173408.8355.1171213.4406.9481.6564.21761175.51461.1175.78.4704.9850.32537.2177536.9672.1597.5376.7544817.5635.8178385.8730.591.3209.5184.72331073.817974.184.760.370.371.4127.1145.7180156.8498.8119.5132.172.9109.4609.918186827928.210784.91044214140.412487.912014.6182323.1400.6375.2349.8535.4405.4334.3183128.7461.71.2388.515.553.11.3184279.4565.1227.8327.3211.1272.92642.91851142.8848.21463.71098.510431044.1911.4186444.5436.7360.3324.6419403314.3187214.8123.4366.1170.779.590.476.618894.7141.3105.2357.2157110170.518949.274.380146.660.966.588190267.842271.295.985.5102.1152.5191825.2845.31874.8739.8734.81020.6520.619267.8308.777.494.480.777.479.81936951573.52485.31849.32885.43460.81615.5194173.6299.7106.6134.3150.7122.6175.9195248.2343.9371.7347.9320.2194.4297.71967207.47285.35142.42474.26626.68775.311352.419750.693.6113.8142.396.486.55819856.844.636.951.166.847.9128.9199135.2104.657.8204.735.2599.8103.1200110.8310.7104.4327.5121.9121.6147.5201125.9200.146.969.225.3505.354.7203163.6319130.285252312.1621.1204826.2879.7567.6726.8704.1434980.12054963.176952785.76249.96069.16172.26469.82063841284196.81397.4323.3282.2224.92071180.71623.7402.12190.2453.51652.91647208495.8653.7150.2227.7257340.5253.62091608.42981.52844.2445.85286.94175.66653.12117731.415392.63699.233617.123929.628201.937299.8212911.56921485440.7207.7396.6971.421358.377.2150.291.5119.683.284.42151364.91835.2477.21858.8394.42522.12910.2216540.7636.6665441.7610.8635.7494.3217196.1494.8258300.826097.9424.1218359.4357308.6572.5327.9346.3318.622087.666.571.489.910686.788.5221195.8787.9397518.1651.9372.5497.7223248.3279.5456247.2226.7308.9202.1227326.21074.9579.81616.2517.9516.4447.3228377.5502.7583.4486.6764.6521.7871.2229311.2113.41212.9377.4152.793.4149230417.2297.5120.9131.8135.8242.5285.4231108.5189.888.267.4140.1160.7309.4232465.51573.341.4973.5118.3273.378.3233728.93634.17030.21396.13819.15175.12235.423537.3474.788.2526120.4662.142.3236199.7143.3108.3196.9220171.3142.52371614.81725.32189.41342.62031.31672.91475238823.614241041.51173.3691.21142.21169.523956.1641.7183140.59588683.124098.3853.8155.4330.5155.1106.4574.824184.41914.8289.8519.5207.19513672422194.8989.62107.81991.21042.51474.6688.124389.9263.3247.9268.6679.7287.289244209.3288.389.9209.1146.51311312461348810.8270.7434.585.9160.3487.6247113.492.868145.3125.8139.4150.2248503.9571.2120.3199.5153.6226.1529.72496501958.3945.4442.8746.9674.21861.5251149.3159.298.76754.598.7133.7253458.5369.7392.2512.7189.7171.8255.1254759.11048.256.3201.5144.1322.51876.1255395847.192.8241.2190.6204937.8256497.3504.3202.91243.9138.21112.8153.225796.8170.361.6110.7240.3224.183.225880.1318.21.141.2194.61.325931.3422.435.1291.4170194.96.1260144.2118.9152.1196.1181.1162.3192.926172118.5599.4788.2759.5233.2707.9263414.9536.2500.4605.6316.7492.7460.5263550.2391.2170.3206.7218261.4299265334.6245.7405.7534.5619.51119574.8266546.7433.1317.8513.8421.9266.6397.725669.3168.9137.294.2115.110197.3268570.4855.7334.9287.8801.21200.21032.626917.825.551.232.633.837.956.8270313.9169.7378.4245.5183.8220.5267271197.8175.4205.9317.3297.9247.6263.9272537.8303.4368416.8596.6461.6589.22732896.52422.42113.94788.32936.52726.76835.9274736340.7226.1863.7465215.6180.7275312220.3428292.8254301.5300276290.21528.1727.22093.9539.5692.9622.8277171.5177.3190.4200.2228.4201.6245.627857615.190.6495.4201.9350.420.52792553.93673.61781.13550.43051.63161.93164.52804112.44496.72693.56671.44029.93715.13402.8281420.9478.9381.799.324.776.5829.5282284.1237.5220.4467.3243.1183.4280.3283320.7247.3262.2267.1257.1287.9255.528486.160.666.982.56891102.628574.584.578.898.8132.497.789.8286140.3125.8856.5479.212531123.8337.328782.768.3104.9131118.4100.2124.1288112.6131.8109.3132.3203.1166.3157.2289329.152374.61912.151194.879.229172.9135.9147.6116.3111.710691.229261.3181.249.9155.843.9982.977.4293210.2267.7100.570.687.491.2418.7295880.3560.6520.9266.4534.9307.3261.42961067.21234.6688.7782.9718.7604.5724.829747.964.851.587.238.669.158.3298551.5344.5386.7324.7241.8269394.72991468.81771.8787.51048935.5572.9948.9300817.3680.9461.3248.2137.3294.2748.4301608.41624.71490.73382.644441930.7176930210.426.630.433.226.335.724.2303710.1705.11706.6859.3577.5788.3425.130495.7466.8190.4187.2124.8202.8143.5305157.1529.4493.4795.6163.169.8249306131.8108.5180.6143.8154.4173206307191.4207.284.5181.7133.4205.1178.93082703.41485.813022184.2756.31330.11074.7310549.2417.5612811.3723.1576409.8311145132126159.1101.9148.1113.93121216.9574.9992.1892.8612.7695.21340.7313307.7190.1158.9201.8115.6112.71437.5314416.9725.7134.8157168.8428.1448.6315192.5412.2496467.2366.2506.8341.4316444470.195.3286281.8131.4291.2317157.9142150.3197.9191.9177.2201.1318140.5334.756.929.173.18778.1319706.9280.3127.7267.670.7164.5199.4320535.8590.3887.9568592.8742.2577.9321340.3326.5372793.8460.1414.9375.2322352.2258.3185.4237.2248.6152.6280.93232455.74246.43485.22786.24469.12754.24942.2324348.9411169.2707387.9460325449.5519.2168216.7282.5299.4469.43261603.631673571.4404.94260.93099.91692.632726.84410.312.225.720.68.2328277.9499.5114.4194624.6445.4617.532963.151.96454.156.367.281.933026.8398.351.138.353.444.128.4331353.6211.8246.9326.3313.7256.2346.2333628.2817.1534.6764.7963.21039.8993.5334129131.6121.3127.9171.5135.9210.233561.583.3276.3550.9108.1127.9116.4336877.3835262.7397.8457.2330598.7337119244.5349.6426.7114.8364.1225.7338213.7307.5152.1190160264.1213.2339337.9298.3253.4278.6421.1490.3476.5340161.4161248.4316.2277.8273.6290.1341575.9645.8726.6782.51057.6767.6465.13431203450.3740.9103.8137.117810534412751111.41819.21393.51260.31521.11289.7345164.6211.9210.1208.7288.4221.3290.734726033049.51135.91212.82982.63471.62440.334846364968.12088.32517.84998.76143.95642.9349231.2321.5329.2238.9199275.7273.9350306.8357165.3139.9214.3201.7315.7351661.6248.970.275.764.214076.9352228.8337.7313.8812.7340.3238.1322353268118.5158.9211.1171284.3124.53kSEQ ID NO:967TT968TT969TT970TT982TT983TT35423.255.9169.322.61.2136.235528.550.21052.481.625.996.4356625.8410.22722.4190.1528.5449.5357301.6385.5990299.7781321.6358855.6468.3570.2419.9530.5768359336.5327.4464.6420.5326.9556.2362247.8386.1248.5248355.4570.5360219.2183.9501.1198.9170.3376.9361248.2544730.9108.3746.6231.5363716.9541.2438.23964.4373.4824.21469.7405.71234.4133.8970527.92135.12759.13994.4239.33662.3264.171.3402.812994.81127.5460.281162.1811.3967.4854.4644.1915.392702.91018.84839.3217.31823.6997.210190.7504.6237.6195.3126.1271.3111104.81435.32566.4297.7275.4422.713198.313654.373.168.5266.914545.3572.6232.173.269.46761582.9465.9409.7155.7537.1134.516981.5987.61149.6167.1888.71443.117178.56391677.1125.22064.5437.919289.1542.1212.7359106.4291.4201.1118.773.81.219.56.121928.11108.31144.37710.6499.2221063.23119.64358872.98269.8577.8231.2379.935.21.21.161.42473.759226.757.2297.565.526117.4453.2143.858.489440271699.9830.8811.4403.5511.2509.329594.6288325.3378112.4982.93086.982.7124.510.94597311573.738.8497.9471.534.372.633441.8872.91130.875.9411.7352341018.82164.12701.32309.92634.94374.33599.670.4393.280.213.2133.736167.8137.3152.5203.81201.5111.337329.9181.7190.5777.4172.2464.838240.21359.21110.589.71069.551.140666.4451.5462.6593.8349.6703.841180.91696.6333.6178.9730231.942176.5403.8214306.2308.2287.743821.9483.93211489232.81352.944467.5380471.5555.7360.345545770.8434.4558.1181710711373.846411.4330.8255409.7273.6401.247166.6296.7247.1277.4321.6130.9481.2116.91.26928.911149627.1965.5130.2225.8251.8772.350142.5216.3192.315.177.1161.55157.4149.438.22101.51490.91190.652308.7413.6298.7307.9217.7234.65384.9100.2159.993.3102217.654870.3607.4345.8269.3669.652955161.694.898.6115.2110.3144.356106.736.55442.1150.133.657343.81228.1103770.3171.3966.758392.81366.3238.31256263.51149.659605.21677.62094285.710881273.860202.7198164.7124.8168.1155.561542.2245.6124.9288103.9201.2621650.57509.13612.11170.1318.89459.863259.6202.4365.9187.3388.3316.864540.3166.5122.81276.6123.716116588.478.466.190.166.498.466351.3424.5843.2182.51223.8103.2678409.726223.634005.19041.432601.53094.7682810.93260.12929.34961.64818.8513.16911767.36789.11095711079.310388.23855.9702845.616031889.88120.71927.81628.771268.692.8207.574.892.7322.272139.6120.7919.8113.4282.2275.273237.7278.3786.2192.5388.7263.97591.9141.7446.157.6157.7455.976554.224.114.5498.3903.92000.7772410.21463.149484569.62755.15975.378315.7431.5516.1324.31188.78179162.4146171.7204.3106.5265.280100.7790.8491.395.1372.8933.3812776.278.6226.549.7116.4232.7821230.5231.41201479.5468.63720.284308.9961.710178.7204.4653.185350.3125.3159.1154.7129484.4869185.773.9126.352.9189.687296.2320.31151.2607.3338598.188190913505707.21415.810923.2860.889206.8203.5145.5160.9154.6303.99095.993.995.899.7108.7108.291362346.8219.6491.878.8550.5923647.7833.57305.983.43870.63178.493158.2341.1321.394.2217.345994199.5488854.371.2251.2114.49590.199154.9131686.8242.996152.2124.4172.1130.6192.9111.297251.1342.4429.895.2143.5354.998240.937.130.667.914.8257.999321.4281.7244.4316192.3311.7100288.5356.213918.1777.17145.11884.5101158.2192.6116.4133.6117.1224.1102353.9153.6142.8363.4159275.5103351.3300.2333.9367.9291.8152.5104274.145.1405.3200.11282.8873.3105449.351.2538259.7701.61037.6106297.632.8390.4273.1945.8933.9107169.5176.1188.6213.6121.6426.3108160.8676.4409.7356.4505.9328.91093423.549.24125.3130.229.4301.61105966.710.74569.2200.425.8956.3111253.1609.471.4158.5134.5223.51121062.894.2773.31195.8507.31.2113221.5123.767.4210.1274.17.7114123.6108.3382.3250.2272.6105.3115397.9320.1369.8242.8282.1292116279.4395237.5165.5184.5311.1117200.41406.93545.8607.82324.7349.8118336.5116.386.45808.964.92556.4119365.676.750.2122.983.380.812048.134449.899.63044.7110.5121259.6336.7403.187.61213.5143.5122292.8185.3455.1158.534.9507.8123139.7152.881.1352.1126366.5124172.2143.6148.25160.71241721251555.3978.9878.31620.9867.11453.512687.559.31558.6257.71842.3258.4127140.383.5117.6156105192128320249.4167.1365.5265.9418.6129189.6189.4161.786198.2224.2130122.984.171.2115.687.472131140.139.7182.4236.871.2535132243.2184208.8237.5218.6256.7133174.8338.7113.282.867.1321.5134182.1160.9497.987.7278.3109.1135286.8205.4723.3307241.7336.9138146.4136.3144.8124114.4176.2139202.8189.915272.1169.5132.414018.21010.62927.923.61469.11.5141178.6283.52257.93.41606.23101446356.1261.5311.4419.2349.3527.5145298.7186.1180.4255.9190279.2146272229.4195.1295.7196343.114742.544.635.858.644.529.3148357.4192.1831.9156.5464.41068.9149272.61841807.933284.7171150182.2502.5356148.7526.3948.6151265.1174.8181.4138.7143.7162.4153132.4185.7157.8103.5113.3218.6154145.646.6390.9121.868.4160.8155226.6139.4130.3224.696.3238.715681.550.520.5169.1107.588.7157226.7170.6136.4131.5112.2189.1158236.4237.11.1202.439.1650.61591520.94126.23171.7755.44600.43258.916131.6790.13.512.12.51.316262.171.545.640.821.657.1164391.7235.71236.891.4215.840.91664422.14880.37064.92557.63776.68467.5167544.21623684.21035.638752178.21682410.782.3985.819.1523.643169485.11840.57446.21266.91301.42686.1170971.76431478.2166.92916.1760.717138.2233.97331.21.2503.5172492.3472656483.1510.4757.2173542.8375.8794.6114.4595647.817610.632.11.269.1991.61.2177224.21237.4236.61044.6789.8993.81781934.6409470.7650.51387941.3179145.3412.960.7161.285.7245.718016192.467.4128.294.3131.71819117.68152.511035.813798.515093.48202.9182189.4445.2574.2128.1524.1227.51831.164.711.71.21.172.1184215541.8290167.9286.9190185973.9711.71014679.8914.91030.3186377560.6395.41755.4302.8732.218753.867.341.881.433.1104.618843.633.7103.261.31218.594.918986.437.969.284.5695.6108.4190407.6372.7283.5135.690.2162.9191359.826052070.6919.32961.24325.2192856.8383.6183.3146.269.3827.119375.81538.42686.5638.62367.333.3194121.6135.523028.4238.5127.6195159.5372.6180614.6333.1355.61967404.94791.5952.57933.67823.28113.2197133.644.6130.5218.571.7113.9198129.4323.2103.3138.956.8123.9199105.7361584.12.742.7162200251.1102.9160.6270.3374.1170.520170.349.7172.958.11.6125.6203155.284.1172.2202.8393.4343.4204258.9711.51093.8268.3710.3515.62051215.11501.87081.6570.25009.61308.5206328173298.2310.4185.1597.2207172.968.61428.146.52541.6144.32081492.3724.810.1783.845.3209667.11776.2311.61203.927451499.42111193.22651.612245343.12545817479.9212837.54332452353.6512.9728.8213203.38771.43629.993.5468.621517671.1554.757.53381.9202216611.8308.3915.4490.4896.8690.5217118.5146.7191.2121293.9120.7218252.2466.5274.1124.9335.3428.6220125.275.4108.21056177.9131.8221139.2264.1452146.5699.3143.9223415.6845.6362.8477.7165.6689.8227314.82480.31008.1182.61091.2223.2228432.9294.9213.2461.6568.4517.8229143.7774171.71810.6305446.623017963.379.4202.463.637.6231136.2113.7127180.7207.420523245.3272.386.58.963.8337.423314834545.56134.31579.17762.73649.323585.7443.4423.866.6211.8323.6236110.2202.4106.8196.1123.9257.52371495.9564.816411057.21533.6704.4238744.2349.2899.4244.11354349.4239186.3100.4196.393124153.1240195.971.5727.265.8131.3148241237.2205.21034.394.1300.5145.62425003.313867.12129.715742.74086.911985.6243803.1288.9174.5134.2226.2143.124497.8194.6282.98.3256.1109.7246359276.8388.3169.2115.4448.4247170.8140.7109.7303.9118.1139.1248245.6109.7217.3113.2196.9135.724996.3216.6223.8135.948.3585.6251187.961.1115.559.8112.593.9253260.8275.7327.1165.6468.1240.625463.264.3465.31212267.515.92551923352.4648.8811.11499.81126.3256563.4448.2228.9490.482.7573.9257378.8648.4475.3161.3185.7145.8258582.1257.25241.416840.210242593073.9532.428.944.513.3260209.5228.1128.5237.3114618.7261135.7834.3320.6115.8259.6134.1263320.6673.5537470.6473.92280.3263316.2103.4161.5369.4123.6137.2265106.3287.4601.3317.4934.8119.6266216.8145.8179.8955181.8470.8256147.489.797.781.8124.2119.5268304.819.760.1175.62929.8220.926961.384.93557.538158.7270276.1144.9183.11394.4176.9726.2271139.7191.4249.6243.4292.71902721068.5485.1605.5722403558.4273145.8421.94104.11.31705.734.7274178.2517.1426.4468.2206.6681.6275271.4219.3164299.8209.9428.2276396.33030.8977.31881246.2307.4277228.6153.3181.7212.1199244.327850.31164.110195288.6105.7279985.714072129.1232.52794.610022801510.72192.56373286.63920.21434.528124.51.232.820.666.140.32824703.6248.3312.9291241.6404.4283413.8290.4220660.8232552.8284106.484.778.8140.965.199.7285148.492.7162.5143.5104.421928612910.11134.436.11.3510.6287127.8111.967.9468.286.5147.5288267.1129.5153.3256.4171.7231.228991.1390.9271465.5214.21306.3291133.272.578.45.9133.935.129275.725.7293.371.518.4104.729343886.472.737.377.1371295244.8581.630.1979.1569.4507.92961349.45041210.8671.3716.7813.529764.945.449.4853.96298.3298186.2307.3416.8311.1232.4211.4299306.5444.4962703.8375.8401.4300420.6101.7176.4125.4475.3235.4301507.22222808.6528.91281.3340.330229.222.323.231.49.510.1303457.4993.61360.4930836.61031.2304262.8452.7227.3209.2208.1397.9305531.26335.1145.33001625.95308.7306262.8287.6155.9258.3126317.5307150.7121.6150167.9118.6139.33081991.27561163.44741.61375.74290.1310950.2194.61093.21092.8219.2640.731164.625.1144.255.844.773.8312797.135.81289.15881.4362.41192313542.5719.4122119.1139.3161.9314938.2209.6551.368.6147.2345315123.7274.1155.2218.6299.152.8316289.8413.1415.9205.684.3704.2317202.4156.1133.7210.8138.1206.3318126.8259.1109.326.516.2157.6319362168.9161.6713.5195.91566.2320503.3277.3356.81176.5487.2297.3321218.1470.4426.1337.2517.9711.3322375.3251.1292.4504186.1609.6323553949.42829.3768.94431.81365.8324179.252.7227.981.181.741.1325335.3242.7242.8170.7198.5313.43261260.92604.54986.5584.65373.5643.732729.114.226.921.461.92.832858.8218.5113.163.9223.473.3329191.761.440.3147.862.3144.2330134.1100.958.43618.737.3331445.5369.7271.4981.9227.2893.233376.9473115.9230.1287.1484.1334172.8136152.4100.5143.3120.5335122.9126.9113.2212.1846.9658.3336308.8716987.8236.4665.2600.433743.998.31139.953.3129.7270.9338290.4144.6420.3105.8134.4220.2339338.2255.3217.6483.7351.7459.4340241.7256.2235.6263.3247.8313.8341693.61174.2706.5545.1590.9506.53432675.2997.1235.25179.8686.53885.23441600.8650.5866.53374.5937.5785.9345371324225.2332.3208.4349.4347930.270.2922.3734.37238.6705.83482298.337.71946.1988.110651.22867.2349208.2402.1215.3174.1296.4343.83502.934.4518.427.6143.5191.8351188.269.494.840.446.1744.7352269.7230.4500.5390.8298.9319.5353757.9154.1248.3481.81304.4432.8









TABLE 4










4-Gene signature performance in 98 training samples










Tumor
Benign















Positive
48
18



Negative
 4
28











Sensitivity
92% (0.82, 0.97)




Specificity
61% (0.46, 0.74)











B. Signature Identification using Linear Discrimination Analysis


We used a forward selection process that adds one gene at a time until the posterior error as evaluated by a linear discriminator is less than or equal to 0.1. A four-gene signature was discovered using this approach with the 322 genes. The identities of these 4 genes are listed in Table 5 and 16 and their chip data are shown in Tables 6 and 7.

TABLE 54-Gene SignatureSEQ ID NO:Gene Name354Chemokine (C—C motif) ligand 18 (pulmonary andactivation-regulated)199Pulmonary surfactant-associated protein B (SP-B)207K+ channel beta subunit255Putative prostate cancer tumor suppressor


Leave One Out Cross Validation (LOOCV) resulted in 92% sensitivity and 61% specificity, shown in Table 4. The ROC curve gave an AUC of 0.897, as shown in FIG. 1.

TABLE 6SEQIDSignalPC_984TTPC_986TTFA_987TTPC_988TTPC_989TTFA_992TTFA_993TT123399.27041.354386376.72734.63569.54305.9186550.85870.65815.94265.18856.43454.420405.3294578.66455.82329.442592666.836947531.2FA_994TTFA_995TTFA_996TTFA_998TTFA_999TTFA_1001TTFA_1002TT122545.72451.844183938.33648.56834.548821812566.49889.54341.55210.16639.54794.83921.9292239.81834.54607.16424.13069.64301.43164FA_1004TTFA_1005TTFA_1006TTFA_1010TTFA_1013TTFA_1014TTFA_1017TT122274.92644.23978.82999.74012.517245005.818104027376.39985.11330.34618.861324562.6291688.94771.23159.13082.66861.714653384.7FA_1018TTFA_1020TTFA_1023TTFA_1024TTFA_1026TTFA_1027TTFA_1028TT122847.671027513.52086.32431.31318.21231186388.52640.81967.76853.35068.52006.41804.9293829.542354272.59241702.31691.51731.3FA_1029TTFA_1030TTFA_1031TTFA_1032TTFA_1034TTFA_1035TTFC_1037TT124607.62416.12203.76489.92095.31547.91847.4183507.32270.8805811247.58258.17485.88309291530.55641.43460.14802.11650.7854.62418.4PC_1039TTPC_1040TTPC_1041TTPC_1042TTPC_1043TTPC_1044TTPC_1045TT128204.92638.547952607.86725.45178.72111.1186454.710129.379644952.63663.31887.719840.6298858.54136.884342230.7343427702243.1PC_1046TTPC_1047TTPC_1048TTPC_1049TTPC_1050TTPC_1051TTPC-FV_1052TT124403.69394.72262.54831.22826.91288.61953.2182417.75678.46655.24325.217066904.84596.1292319.820509.61176.15375.32053.14027.53332.3PC_1053TTPC_1054TTPC_1055TTPC_1059TTPC_1060TTPC_1061TTPC_1062TT124150.46180.41835.72447.24201.34984.33399.3185965.713847.63740.64167.714516.24896.78891.6293718.14818.31728.82972.2485134693718.6PC-PC-PC-PC-PC-FV_1064TTFV_1065TTFV_1066TTPC-FV_1067TTFV_1068TTFV_1069TTPC-FV_1071TT1242214884.57256.664040553208.26301.31840956627.61427.15405.51072211509.910314.3295896.75461.29437.31634.41344.22186.41794.8PC-FV_1072TTFA_1073TTFA_1074TTFA_1075TTFA_1076TTFC_1077TTFC_1078TT121390.33325.51430.81784.41563.91999.41830.718562910010.53459.21145410807.81384.811906.2292974.57133.130094184.91673.91044.54264.1PC-PC-FC_1079TTFV_1080TTFV_1081TTFC_1082TTpb1pb2pb3122856.22437.93541.24439.811.49.19.918227384344.14108.33312.394.250.767.6291092.83052.83302.623838.721.630.5pb4pb5′pb6′pb7′pb8′pd10pd111233.88.36.618.861.438.210.71874.929.753.637.831.868.8117.52966.164.636.451.525.117.217.2pd12pd9124.111.61870.823.42919.711










TABLE 7








SEQ



ID
Signal























FA_987TT
FA_992TT
FA_993TT
FA_994TT
FA_995TT
FA_996TT
FA_998TT





354
50.9
100.4
63.7
14
699.7
181.7
11.9


199
81.7
18
43.3
130.3
461.9
469.4
135.6


207
3844.9
1325.1
77.9
397.2
518.3
807.5
1084.3


255
1374.4
2332.1
1631
611.1
1616.7
419.2
230.7






FA_999TT
FA_1001TT
FA_1002TT
FA_1004TT
FA_1005TT
FA_1006TT
FA_1010TT





354
194.7
2397.3
50.6
205.2
9.6
29.1
341.5


199
124.1
574.9
206
158.5
423.6
121
2489.4


207
1861.5
1325.1
846.6
308.8
1765.9
598.9
1067.7


255
266.5
186.7
324.2
94
1071.3
1098.5
1294






FA_1013TT
FA_1014TT
FA_1017TT
FA_1018TT
FA_1020TT
FA_1023TT
FA_1024TT





354
207.5
69
21.7
20.1
64.7
87.4
372.5


199
440.8
99.8
221.6
226.9
108.2
155.2
112.6


207
535.7
1910.9
1185.2
571.8
1552.7
2739.5
692.6


255
437.2
655.6
165.1
178.4
86.4
436.5
40.7






FA_1026TT
FA_1027TT
FA_1028TT
FA_1029TT
FA_1030TT
FA_1031TT
FA_1032TT





354
21.5
18.1
3.8
13.3
66
15.1
38.8


199
70.9
46.1
561.3
67.7
35.8
48
107.3


207
1230.4
80.5
732
3216.4
2253.5
1989.9
2115.2


255
479.9
226.5
35.9
1403.4
1144.3
247.9
1989.4






FA_1034TT
FA_1035TT
FA_1073TT
FA_1074TT
FA_1075TT
FA_1076TT
PC_984TT





354
61.3
25.3
1355.7
188.5
14.7
8.9
97.5


199
216.5
56.1
1980.6
454.1
86.2
173.8
154.2


207
421.8
1493.5
771.6
1291.4
116.5
1169.9
759.2


255
489.2
229.5
205.3
655
152.7
156.3
152






PC_986TT
PC_988TT
PC_989TT
PC_1039TT
PC_1040TT
PC_1041TT
PC_1042TT





354
966.6
619
12.9
2577
540.4
1229.7
320


199
103.9
142.5
288.5
1006.6
3990.7
17402.7
1023.2


207
400.5
2357.5
1213.8
627.5
62.6
133.6
981.5


255
299.7
2137.5
131.9
500.6
2412.4
2763.1
303.4






PC_1043TT
PC_1044TT
PC_1045TT
PC_1046TT
PC_1047TT
PC_1048TT
PC_1049TT





354
444.3
170.8
817.6
1095.1
966.8
1263.5
800.7


199
604.3
222.7
22961.4
9488.3
10311.6
1702.7
1366


207
1680.3
594.2
136.5
673.2
755
20.8
254.8


255
407.6
4162.4
872.5
2472.3
1497.3
2944.8
2399.9






PC_1050TT
PC_1051TT
PC_1053TT
PC_1054TT
PC_1055TT
PC_1059TT
PC_1060TT





354
292.9
614.4
1035.4
1545.3
139.5
500.2
37.1


199
117
29233.8
1435
8550.5
242.8
13914.6
2377.3


207
87.8
113.4
73.3
187.7
491.6
158.4
207.3


255
2331.8
917.2
1505.9
2186.4
3033.2
2191.1
215.4






PC_1061TT
PC_1062TT
FC_1037TT
FC_1077TT
FC_1078TT
FC_1079TT
FC_1082TT





354
71
23.8
18.4
28.9
87.2
13.5
27.7


199
6933.5
616.2
21.2
226.7
200.8
40.8
144.4


207
1088.5
1133.5
838.8
2012.3
24.9
196.8
1356.4


255
3084.8
1017.8
1355.3
199
1352.4
1578
1294.4








PC-
PC-
PC-
PC-
PC-



PC-FV_1052TT
PC-FV_1064TT
FV_1065TT
FV_1066TT
FV_1067TT
FV_1068TT
FV_1069TT





354
394.8
131.4
143.7
281.9
302.1
973.6
44.9


199
4620.7
1931
1613.2
170.8
579.2
20066.3
96.9


207
88.2
1033.1
705
244.1
2559
8.8
12.3


255
2479.7
242.2
1322
641.9
1222.8
1914.8
93.2








PC-
PC-



PC-FV_1071TT
PC-FV_1072TT
FV_1080TT
FV_1081TT





354
109.5
127.2
205.7
12.4


199
257.5
2302.7
320
206


207
42.9
72.2
2795.9
145


255
1128.1
2320.8
1705.2
196.8










C. Manual Selection of Markers


Individual genes were selected with an aim to formulate a RT-PCR based assay. Comparison of gene expression profiles between thyroid cancers and non-cancer tissues has identified a five-gene signature from these 322 genes. The identities of these five genes are shown in Tables 8 and 16 and the chip data are shown in Table 9. The performance of this signature was assessed using LDA in the 98 samples, and the signature gives 92% sensitivity and 70% specificity, shown in Table 10. The ROC curve gave an AUC of 0.88, as shown in FIG. 2.

TABLE 85-Gene signatureSEQ ID NO:Gene Name53Cadherin 3, type 1 (P cadherin)242Fibronectin73Secretory granule, neuroendocrine protein 136Testican-1211Thyroid Peroxidase (TPO)










TABLE 9








SEQ



ID























BN_800TT
BN_801TT
BN_802TT
BN_804TT
BN_805TT
BN_806TT
BN_807TT





36
908.3
247
118.9
349.7
425.1
229.8
227.7


53
48.6
25
24.1
34
17.8
32.2
16.7


76
252.3
272.9
75.2
260.6
169
587.1
189.8


242
22247.9
1204.2
676.7
2441.5
3900.1
2073.4
2060.1


211
24.2
16983.5
32579.5
20189.3
24480.5
14186.3
6488.1






BN_871TT
BN_913TT
BN_914TT
BN_915TT
FA_917TT
FA_918TT
FA_919TT





36
897.2
435.1
442.3
508.7
169.6
184.3
213.3


53
192.4
28
76.1
44.2
67.7
135.7
25.7


76
2134.6
252.5
956.3
174.3
62
144
233.8


242
13722.5
10481.9
4172.9
1891.1
1654.2
11791
2788.1


211
6243.3
16339.1
14355
36350.1
29876.5
19395.7
15935.8






FA_818TT
FA_819TT
FA_820TT
FA_821TT
FA_822TT
FA_842TT
FA_862TT





36
120.4
155.8
210.6
31.7
283.3
122.2
24.1


53
27.2
26.9
34
33.2
34.4
27.8
66.1


76
13
69.8
36.2
171.2
116.2
190.8
15.9


242
1433.3
2211.8
2714.7
325
2278
3959.5
1573.1


211
15976.6
19882.4
10029.6
29411.3
25179.3
12492.5
32721.4






FA_863TT
FA_864TT
FA_865TT
FA_866TT
FA_867TT
FA_869TT
FA_907TT





36
955.1
173.1
400.5
230.8
233.5
2581.5
207.8


53
333.9
27.9
147.1
155
25
1224.9
52.8


76
2614.7
624.1
614.9
336.7
163.5
1921.3
38.5


242
930.4
1419.2
4708.4
2169.8
1081.9
3241.5
4555.3


211
19631.3
27382.8
29846
25011.6
30599.1
23680.6
35313.3


















FA_908TT
FA_920TT
FA_938TT
FA_940TT
FA_941TT
Fa_EA40374_921TT
Fa_EA40376_923TT





36
329.6
165.4
331.5
298.8
267.4
211.3
188.6


53
35.8
28.5
21.7
291.4
45.3
23.8
62.8


76
253.8
64.7
3312.7
870.1
1038.3
153.3
236.1


242
1630.4
2452.4
6684
765
2229.5
1809.2
3314


211
21639.5
31897.6
26420.3
18786.4
31922.5
36025.3
15065.2

















BN_EA40377_924TT
Fa_EA40378_925TT
Fa_EA40379_926TT
BN_EA40380_927TT





36

1409.1
215.1
228.5
833.3


53

2294.2
40.5
496.1
64.9


76

624.1
149.1
211.3
501.1


242

21699.6
1079.3
21653.5
3263.3


211

664.1
12583.3
13036.6
43191.4














Fa_EA40387_955TT
Fa_EA40388_956TT
Fa_EA40389_957TT





36
94.7
259.7
786.2


53
197.4
230.4
17.3


76
2225.4
1443.7
223.7


242
2194.8
989.6
2107.8


211
9409.2
19630.9
4160.9


















Fa_EA40390_959TT
Fa_EA40391_960TT
Fa_EA40392_961TT
Fa_EA40393_962TT
PC_829TT
PC_830TT
PC_831TT





36
2496.1
175.3
58.2
1470.7
330.3
210.3
432.7


53
24.4
40.3
52.6
183
73
49.6
1916.2


76
2397
47.6
77.2
1048.1
758.4
576.2
394.3


242
1991.2
1042.5
1474.6
688.1
6760
6785
25733


211
38927.5
31764
34287.3
44314.7
25565
31930.4
138.4


















PC_832TT
PC_834TT
PC_835TT
PC_836TT
PC_837TT
PC_838TT
PC_839TT





36
1376.8
4076.8
1208.3
585
1015.5
1620.2
71


53
1909.1
2701
1178.5
710.7
1469.6
3009.9
41.2


76
433.6
665.5
654.3
2432.3
412.1
1946.7
327.2


242
9423.8
18037.6
23053.8
1044.8
22442.7
27313.9
3641


211
7174.2
1961.7
282.1
24646.9
15840.2
264.2
17049.3






PC_879TT
PC_881TT
PC_882TT
PC_883TT
PC_884TT
PC_885TT
PC_886TT





36
457.4
1779.4
561.2
722.1
1129.2
552.5
1244.9


53
2036.8
3121.5
2072.4
2753
2221.1
1703.8
1325.9


76
1168
1829.9
1210.6
2663.6
1076
1232.2
1866.8


242
46283.3
32477.3
33142.3
38026.7
42087.5
49249
39172.5


211
86.8
613.5
48.3
126.2
1565.2
120
1553






PC_890TT
PC_892TT
PC_893TT
PC_894TT
PC_903TT
PC_904TT
PC_928TT





36
813.3
2211.4
1046.2
585.3
3395
767.9
246.6


53
4685.6
3536.8
1363.5
1244.4
3057.5
199.9
41.1


76
3926.2
2787
2359.3
1020.3
1564
203.6
421.5


242
36114.4
31599.6
34700.3
41193.8
18485.8
19181.5
3729.4


211
1569.2
1703.6
234.5
1594
4063.1
5354.1
18199.2

















PC_932TT
PC_933TT
Pc_EA40375_922TT
Pc_EA40381_945TT





36

352.4
920.3
316.8
818.6


53

3447.4
788.3
41.8
803.9


76

850.2
865.6
211.2
237.9


242

21913.7
24536
1758.5
13301.5


211

490.5
13171.6
30959.7
331














Pc_EA40382_946TT
Pc_EA40383_947TT
Pc_EA40384_948TT





36
3078.8
532.1
311.1


53
2330.1
1337.6
1556.2


76
1830
1279.7
598


242
22076.9
31987.1
27579.2


211
857.8
2007.7
556.5


















FC_823TT
FC_824TT
FC_825TT
FC_827TT
FC_828TT
FC_840TT
FC_896TT





36
282.5
2413
1506.3
821.8
564.4
331.6
857.1


53
23.2
24.1
25.5
348.1
27.8
32.3
245.4


76
460.1
2833.9
1128.9
1421.6
705.3
341.8
358.9


242
12129
22000.8
874.8
2544.9
845.1
3459.7
1998.1


211
30520.5
496.2
7923.9
11508.2
33401.7
10882.8
1625.3






FC_898TT
FC_899TT
FC_900TT
FC_901TT
FC_902TT
FC_909TT
FC_910TT





36
827.5
1152.4
778.8
11199.3
578.7
713
132.4


53
38.1
1949.7
2221
29.8
185.9
21.5
57.2


76
2517.5
1009.8
3523.8
28603.2
2201.1
195.6
4744.8


242
39786.8
38117
29127.6
4032.5
43673.6
3478.5
1273.2


211
1160.7
132.9
79.4
26.8
251.4
488
8979.7

















Fc_EA40386_954TT
Fc_EA40394_967TT
Fc_EA40395_968TT
Fc_EA40396_969TT





36

619.3
412.7
134
218.6


53

15.8
31
23.8
55.9


76

4136.1
682.5
41.2
18.4


242

969.6
5003.3
13867.1
2129.7


211

20581.7
1509.8
2603.1
15427.4














Fc_EA40397_970TT
Fc_EA40405_982TT
Fc_EA40406_983TT





36
463
1233.6
234.6


53
65.5
31.6
120.8


76
594.7
931
2232


242
15742.7
4086.9
11985.6


211
369.3
30161.2
19869.7
















TABLE 10










5-Gene signature performance in 98 training samples










Tumor
Benign















Positive
48
14



Negative
 4
32











Sensitivity
92% (0.82, 0.97)




Specificity
70% (0.55, 0.81)











D. Cross Validation with the 74 Independent Thyroid Samples


74 independent thyroid samples were processed and profiled with the U133a chip, and the chip data for these two signatures are shown in the Table 11. The performances of the 4-gene and the 5-gene signatures were assessed with LDA. Both signatures gave equivalent performance in these samples compared to the 98 training samples. The sensitivity and specificity for both signatures are shown in Table 12, and the ROC curves are demonstrated in FIGS. 3a and 3b.

TABLE 11SEQIDSignalFA_987TTFA_992TTFA_993TTFA_994TTFA_995TTFA_996TTFA_998TT3692.8437.8640.54152.5714.7254.8303.45315.8422.825.229.5258.945.626.876485.12536.51708.6288.3643.3605.6341242686.5971.424532.8895.76424.8842.1905.121128269.814689.4357.533711.634943.21613122376.1FA_999TTFA_1001TTFA_1002TTFA_1004TTFA_1005TTFA_1006TTFA_1010TT3663.722.355.6408.5128.33534425330.931.839.670.837.938.9119.676110.790.2253.5159.11559.6413.71222.52421550.61689.3256.516683921.51013.21837.321126779.615870.724525.543040.225392.932641.920140.7FA_1013TTFA_1014TTFA_1017TTFA_1018TTFA_1020TTFA_1023TTFA_1024TT36453.5333.7179.6146.6417.375.1129.25339.821.499.923.726.862.322.276333.71231.2241.11311435.31491.6260.82421459.44151696.3287.1617.51932.61689.22117911.319359.41808918222.830038.8905315611.2FA_1026TTFA_1027TTFA_1028TTFA_1029TTFA_1030TTFA_1031TTFA_1032TT36281.1130.5150.4629.1760.4191.61671.553125.562.3118.2230.7420.527.75197677.4111.91842100.91741.3338.13643.52421091.6754.3705.9684.7372.41848.83094.721121979.17890.52622615344.11036830439.923943.3FA_1034TTFA_1035TTFA_1073TTFA_1074TTFA_1075TTFA_1076TTPC_984TT3624.8119.9111.71010.926224.53035329.630.4366.796.994.33137.276289.3239.7167.4326.8818.9248.5198.32421482.1590.94842.52815.52726.8754.8785.121138135.430510.629406.431075.420833.934960.424938.2PC_986TTPC_988TTPC_989TTPC_1039TTPC_1040TTPC_1041TTPC_1042TT36676.3391.7264.9735.7524.7769.911255332.5395.6305.56551153.92194.1111.576287.91384.8888.31048.41381.1412.61384.92422450.72243.2698.620366.432090.927480.91915.72112689.519903.232075.99197.7152.21862.210375.9PC_1043TTPC_1044TTPC_1045TTPC_1046TTPC_1047TTPC_1048TTPC_1049TT361013.61023.8809.81811.11546.2481.82491.953730.72965.32533.72052.8756.1988.32000.6761977.43380.44224343.93570.21786.81619.42423907.520074.841761.233253.528124.73051621324.52117015.511.5136.159.13841.731.11476PC_1050TTPC_1051TTPC_1053TTPC_1054TTPC_1055TTPC_1059TTPC_1060TT36443.9669477.1952.8645.3660.2648.5534037.81290.7933.91336.92123.21353.866.976856.71039463.21399.84385365.8160.72421261.658258.526004.921219.812760.826084.43277.62111150.2375.973.22575.8400.524.21637.7PC_1061TTPC_1062TTFC_1037TTFC_1077TTFC_1078TTFC_1079TTFC_1082TT363523.21912.5234.2128.3825.1297.51447.6532348.3975.797.646.215.838.5254.6764994.93891.75559.82521103.57001754.724215397.42006.118262407.522661.81595.5713.72113379.42201.94157015804.53572.14377.916863.7PC-PC-PC-PC-PC-FV_1052TTPC-FV_1064TTPC-FV_1065TTFV_1066TTFV_1067TTFV_1068TTFV_1069TT361993.3230.61128.8708.41348331.433.2532450.372.7610.372.5146.41073.721.5762075451.31350.2922.51743.7950.5332.8242214947110.910228.82206.33319.228034.2430.12111581.529936.91594.75693.111288.8573.612485.5PC-PC-FV_1071TTPC-FV_1072TTPC-FV_1080TTFV_1081TT36148.9332.21288.7672531836.91450.3222122.97640531628.62275.962.62421810.626396.9683.49842118.9243416.72630.8









TABLE 12










4-Gene and 5-gene signatures performance in 74 validation samples










Tumor
Benign











4-Gene Signature











Positive
33
12



Negative
3
26











Sensitivity
92% (0.78, 0.97)




Specificity
68% (0.53, 0.81)







5-Gene Signature











Positive
33
9



Negative
3
29











Sensitivity
92% (0.78, 0.97)




Specificity
76% (0.61, 0.87)











E. Control Gene Marker Identification


With the 98 thyroid samples and 12 PBL samples we selected two groups of genes as sampling control. One group consists of genes that are expressed in thyroid but not in PBL, the second group includes genes that are expressed in PBL but not in thyroid. The full gene list and corresponding chip data are shown in Tables 13a and 13b. From these genes we selected six genes that are abundant and the differentiation between thyroid and PBL is relatively large. Their expression profile was validated in the 74 independent thyroid samples. The identities of these six genes are listed in Table 14 and their chip data are shown in Tables 15a and 15b.

TABLE 13a13a1SEQThyMixBen_. . ._SignalID02014_40062_H133A_800TT02014_40063_H133A_801TT02014_40064_H133A_802TT 22789.62676.23009.2 36346.1794.7623.9 5845.53039.14452.6 62730.41108.51155.6 92248.912094.57529.2 1210625.33137.22382.7 1831715947.913241.7 222715.29522.56429.7 2519159.31467.3550.1 28722.7835.1727.1 324160.68115.24061.8 39314.31243.11486.8 74323.91227.61965.1 78250.86771029.51431337.31339.12607.91741263.14430.76041.61751996.31829.53632.71917108.4848.32063212258.21405.81196.922220586.81371.22411.92331410.614126.83020.42345048.12183.33215.52379053397.92525.12381981937.71289.5245143.71598.51964.22501300.97771405.9252945.61547.31210.2264455.1988.1932.8290345.6327.2533.129410433655.84435.4296845.51242.51068.6342771.4535.9998.5SEQThyMixBen_. . ._SignalID02014_40065_H133A_804TT02014_40066_H133A_805TT02014_40067_H133A_806TT 22957.53644.5 37722977.3622.7 52982.58283.21627.6 62201.21954.31750 92827.37701.71548.3 125727.862384685.1 1810294.97849.34037.4 222590.95294.36490.4 25283811294.71374.2 28568.11336.7740.7 326625.37348.93964.1 39742.51027.71185.9 741281.5760.1505.4 78403.7795.23551431758.81933.518091743543.273463920.51751646.52847.53054.21911133.91482.41149212882.41296.817902222573.91228.613422332186.18439.46024.42344103.94096.92220.22372135.428222492.3238804.51538.61454.7245897.92276.61348.22501466.41301.31865.325213571437.11141.1264631.71253.9845.4290470.2700.5231.92943563.94377.42734.82961506.52423.41527.3342922.51108.1605.413a2SEQSignalIDThyMixBen_02014_40068_H133A_807TT02014_40198_H133A_871TT02014_40321_H133A_913TT 21749.61571.12634.4 3377.25082322.7 52762.91795.86670.2 61280.12033.31910.3 93346.8548.311398.5 126927.14060.56664.4 187418.914860.43134.7 221797.5744.57334.3 251245.8815.87201.1 28301.1640.81325.9 322992.43260.23588.1 39435.8958.11152.1 74689.21453.7491.7 78160.1383151.21431338.81466.61069.91742464.31616.3829.817517011511.51101.1191763.62383.32013.22124811131.9912.5222280.815744944.12331289.51272.46285.62341645.43271.12263.32371732.6879.63780238493.5893.11098.7245661.91378.31244.1250736.71305.66332521145.819861203.2264462.7891.3629.4290295.8697.1987.82941909.11128.4924.1296898.41232.2925.1342482.4712.6476.1SEQSignalID02014_40322_H133A_914TT02014_40323_H133A_915TT02014_40324_H133A_917TT 22419.22697.42901.1 3259.81123.4875.2 52094.711425.74957.2 62543.72173.21358.7 9953.42085.210684.4 122730.54322.82616.2 1826576.39585.48588.9 22317.95120.18611.7 25253.72882.91053.4 28409.2762.7838.8 32792.55413.22581 39499.6556.9898.6 74736.6986.91217 78172.9597.4745.61432070.92377.21976.31741365.249384804.31752325.42530.22237.61911274.2601.21100.2212663.2666.41081222342.21225.9449233866.81839.35797.42341789.36497.434162371345.32154.22802.8238405.9592.81326.4245645.41124.21171.12501409.41368.91146.72521323.51544.6757264649.7872.11319.5290819.9440.6268.72941519.23225.32954.92961290.3738.11069.6342694.8801.2605.713a3SEQSignalID02014_40325_H133A_918TT02014_40326_H133A_919TTThyFolBen_02014_40079_H133A_818TT 23457.72769.14234.5 3920.51289.3627 51805.25184.11487.2 61560.81519.3996.2 911354.89921.93894 127531.76887.21379.1 188220.15452.27762.8 224750.85739.15655.3 251557.93017.51200.4 28886.61189.2731.4 324134.110964.4927.6 391259.21022.11423.7 74741.8948.9770 78447.9488.2790.61433165.11865.52330.7174607.52151.84026.21755358.52402.73765.61912685.91183.61661.42121306.31072.12181.82222332.8431.21015.62335181.8123773400.92343760.21988.23527.423727123073.81930.62381552.21636.11333.52451722.21981.51978.82501502.710941083.32521609.91679.31599.4264860.1835.61451.1290773.4490.4218.3294555.32490.71854.92961240.118631139.6342738.7509.31018.4SEQSignalIDThyFolBen_02014_40080_H133A_819TTThyFolBen_02014_40081_H133A_820TTThyFolBen_02014_40082_H133A_821TT 25589.23035.32681.6 3690.9585.4610 519422663.81231.8 61140.32093.4841.6 92165.474677685.6 121292.45085.13585.9 187277.45374.92379.1 227618.66227.91551.9 25881.11279.8406.4 28681.61225.7473.9 323075.22775608.8 391632.9899.5688.9 74674.61139.7213 78602.8776.3332.11431160.716761672.41744702.610677.13826.81751231.92531.92307.71911657.11377.8368.22122035.6954.21663.42221651.73755.41669.92334679.324761506.62343971.44526.5997.62373521.82951.32673.5238837.61069.71860.52452170763.61392.9250710.8864.91823.22521463.91199.91019.22641315.61221.6936.8290507.2648.3294.62942997.47108.22160.72961245.41172.51318.3342728.8977.2710.613a4SEQSignalIDThyFolBen_02014_40083_H133A_822TTfa_EA40173_VDX842TTfa_EA40191_VDX862TT 23403.43423.52246.6 3644.4950.11313.2 53439.5754.32119 61373.7987.7834.7 97457.52730.99307.8 123978.99462.8777.5 186386.91591.29546.6 222652.57124.711054.7 251887.7470.8703.9 28548.5562.4596.8 324425.52120.31084.1 391103.11110.2898.4 74285.9895.8532.1 78643.1346.6533.31431979.93302.91686.61745408.1608.25072.81752650.36596.82600.8191667.72665.71382.12121357.82545.21590.22222239.9471548.82337318.711617.910868.42342395.92832.76005.32372275.32639.32406.62381181.82124.41586.72452082.52302.12846.425016841718862.92521166.71579.6590.4264654.21604.23062.9290342431.8458.82942978.3651.53533.72962132.41762.9815.33421058.5488.3475.4SEQSignalIDfa_EA40192_VDX863TTfa_EA40193_VDX864TTfa_EA40194_VDX865TT 22723.34130.42828.3 3344.41731.12576.9 53324.71663.94423 61399.91115.41872.1 97048.53775.76931.3 124280.848212268.2 184979.55005.24409.5 224669.94776.95782.5 25714.5445.9698.2 28915.91194.11041 322638.92593.11919.9 391375.11520.41744.1 74841.21938.61109.5 78680.5621.5385.81432406.62255.43419.11745907.12956.12670.21754704.831235286.8191740.21133.33678.22121326.31135.11079222584.1899.41002.22336925.95416.914212.92342493.82128.86818.72372595.11857.22546.12382125.32039.51859.12452280.83973.81520.62502782.61973.41594.32521623.21735.21584.32641460.81510.12018.9290602.3745977.62944065.92720.42292.82961040.31787.6932.6342759.3658.3851.213a5SEQSignalIDfa_EA40195_VDX866TTfa_EA40196_VDX867TTfa_EA40197_VDX869TT 23243.62969.93761.4 3728.9548.2531.1 52392.76268.73870.9 61534965.42782.8 98238.38829.94175.6 123334.627523382.5 189146.38150.57796.3 224665.58163.53812 25555.6524.61592.8 281115.3604918.9 321089.31808.71245.6 391606.81418.21392.4 74638.22085.2694.7 78480.6603.6959.814330032033.23441.717433224573.54168.21754747.72573.25834.51912724.1726831.22122362.71705.92344.8222271.72039.4683.423310892.96981.910048.52344015.43229.54734.42372159.92415.22194.823814511111.61037.42452059.12548.62180.92503534.3993.32513.32521589.81334.12762.42641335.11560.11656.9290496.3626.2584.92942869.44842.42762.92961414.4882.41284342595.6660.61442.5SEQSignalIDfa_EA40219_VDX907TTfa_EA40220_VDX908TT02014_40327_H133A_920TT 23352.12486.73109.7 37961204.6981.6 5102163635.211319.3 62638.61155.72100.9 91650.47363.23172 123589.16717.73191.1 188021.581858907.1 224001.75539.56346.7 252057.74103.3886.1 281190.9999.1998.2 3242027454.61100.2 391443.3949.81388.7 741778.1557.71486.9 781000.3476721.11433224.12461.32701.217459823022.25710.71754666.33540.837511911991.31556.8643.42121259.81288.51033.62221370.8728.81675.22336773.9158033520.92347233.32712.88148.32372990.72565.82364238914.91634.91078.92452093.217301329.4250878.9686.3980.42521267.31857.61608.2264942.7950.41076.1290549.5309.7613.42944119.22299.83497.82961106.41493.4888.53421050.3607.51278.613a6SEQSignalID02014_40332_H133A_938TT02014_40334_H133A_941TT02014_40335_H133A_940TT 21963.72662.22416.5 3942.5342749.1 522183903.13011.1 6939.51239.91853.8 95245.31988.91165.8 122500.421003597.7 185929.77819.75335.4 222265.86298.22112.7 251160.2916.5614.7 28617.6408.5740.7 322918.83242.33083.9 391356.6876.81855 741102.1826.71384.4 78361.5383.5482.71431394.92889.21838.11742198.31887.53921.81751391.43677.82169.31911235.1364.71283.52121625.4871.11083.8222503.4638.5320.12338499.41999.94012.12342067.72973.72630.42372763.11501.127242381055.61055.71596.5245751.41076.1915.22501050.61474.32517.1252987.81382.52070.72641278.31261.1826.2290786.4936.8952.12942197.52064.72836.2296635.2572.8700.9342718.6866.8735.7SEQSignalIDEA02014_40374_H133A_921TTEA02014_40376_H133A_923TTEA02014_40377_H133A_924TT 23047.72043.63322 31300.6549.31182 51669.81508.31453.3 6837.71477.81129.4 941378735.74453.3 125716.26694.63667.8 184017.52899.75013.3 223386.64519.54186.6 251055.51184.4828.4 28477.3701.3550.8 321411.44079.52063.5 391231.3982.11248 74296.9632.9787.7 78578.5351.8389.9143177615633881.91743076.41858.11967.317521692397.25896.8191616.41037.719572121086.21450.7981.12221707.81089.4640.82333345.810991.611095.52342027.1159732402371997.92249.32941.12381035.61810.91257.52452714.42120.11553.62501428.11169.42857.1252881.91589.32217.2264865.31055.91034.7290312.4385.71231.12942573.51835.42657.62961768.21426.32462.5342770.7565.31695.113a7SEQEA02014_SignalID40378_H133A_925TT40379_H133A_926TT40380_H133A_927TT 232743025.42424.9 31545.11151.1687.6 53661.81323.27949.9 61371.51220.81831 910387.711670.16402.7 125829.96903.84783.9 1866484053.17410.2 226859.76621.23008.1 251035.63448.21347.1 281087917.1747.8 325212.96841.63282.5 391228.71245.7762.4 74823.9721.61460.4 78713.8377.6621.31431953.52925.72861.817430291818.45264.11753229.14827.23821.11911112.45308.2841212890.9915.6729.1222480.12895.3605.62336680.79190.52236.92341871.24194.14428.82372758.42108.72070.12381210.71289.5774.32452369.71585.8785.1250971.81387.31193.52521417.1990.91186.92641089.9538.3758.6290565.1601.8485.32942574.61541.33862.32961821.81115.31015.1342621757.4791.6SEQEA02014_SignalID40387_H133A_955TT40388_H133A_956TT40389_H133A_957TT 22302.62724.62641.3 3424.7420.6609.2 548604059.34895.3 62330.91642.81963.8 93105.34256.68744.8 122874.53494.12451 184600.23912.916235.3 221369.92480.54685 25365.31587.2816.8 2810571169.8974.1 322814.24083.18121.2 39904.91136.21862.7 742781.4970.2839 78212.8421.3891.41431243.32335.12564.31743925.24789.14553.51751561.74603.84098.3191861.6865.21964.92121264.11494.21177.2222145.2425.31712.4233441.53626.611326.82341260.815994627.72371655.92140.32820.62381017.91645.61150.62451808.42014.91185.62502014.82033608.62521561.42006.118382641340.41171.9933.1290597.5511.7852.72942639.93968.83955.72961379.41444.1867.3342504.5671.61320.313a8SEQSignalIDEA02014_40390_H133A_959TEA02014_40391_H133A_960TTEA02014_40392_H133A_961TT 21817.91937.62632.3 3605.6546.8697.5 58452.711532.95852.5 62508.71035.11581.2 91557.317159.34950.2 128423.63364.43626.3 189560.75478.78997.6 225745.28584.65849.4 252003.7619.6797.7 281280.71023.3810.5 325819.514306760.1 39844.61193.72035 741794.4871.91342.7 781290.5705.2582.11433606.51206.526101745367.931972890.417561121232.13258.2191628.6681.71024.6212762850.912012223380.62257.21397.92331273.23459.25807.22344522.84556.74306.92371813.82740.92387.62381451897.71411.1245841.715421434.2250834.9839.61111.725216121068.91122.22641720.71090.3766.9290548.7268.4292.12944894.22878.61768.42961074.9850.9729.83421199.4802.1874.5SEQSignalIDEA02014_40393_H133A_962TTThyPapCan_02014_40090_H133A_829TTThyPapCan_02014_40091_H133A_830TT@IC 22613.72167.71372.7 3480.41793.51236.1 55194.83735.82822.7 61561.51568.41723.3 91272.33597.73243.8 121198.75938.43878.6 184601.26673.36322.9 222275.24413.32539.9 25887.62860.83257.2 28604.5703.2592.2 32736.35057.76877.1 391643.1906.4977.6 741207.3873.7438.1 78644.6514.24631433369.82462.61861.91742641.34481.74198.61755085.33246.92442.8191538.5913.3723.7212690.9797.9784222127.7892.4646.72331846.14170.64565.32342687.83024.63006.12371999.71879.217082381416.3966.6803.62451628.41415.81521.52502545.81268.4993.62521770.91379.11201.1264838.8728.41170.1290366.4284.9221.62942181.62628.21888.8296975.71061.8946.43421428.7842.766113a9SEQThyPapCan_02014_. . . SignalID40092_H133A_831TT40093_H133A_832TT40095_H133A_834TT 22960.83724.83502.5 31034.71002.2539.6 51648.62929.13651.5 61182.81644.71603.7 91637.65720.93045.3 124300.13654.13555.9 186335.83922.63579.6 22397345335478.5 257110.326802117.2 28550.31205.7660.4 323476.18075.32580 39973.91322.91283.6 74611.81044.91510.9 78179.8404.5344.81432333.52803.83730.71742628.95254.62333.91753237.95586.35010.71913519.91826.91761.92129571085.31218.42223373.31016723.723311130.316096.316100.32342382.42253.42236.62372141.42712.72749.7238719.82489.21179.1245873.31325.616932502074.612952234.82521496.72444.62031.7264931.21035.71188290499.8667.3663.229420104135.12098.42962128.82051.62507.5342835.31453.21071.6SEQThyPapCan_02014_. . . SignalID40096_H133A_835TT40097_H133A_836TT40098_H133A_837TT@I2 22185.52399.12900.3 3891.3452.91885.7 51611.83731.13572.5 6966.32282.61818.1 914515197.67768.2 123946.622992877.5 183282.23591.89567 222546.72145.47779.3 255212.6869.38325.2 28730.8642.1734.4 322524.92454.37864.8 39847.11328.71793.3 74831.5519.6513.4 78133.7582.7482.51432073.12033.93437.3174922.65487.525441752460.92800.94480.61911360.1531.42426.7212764.91307.91161.52223010.1829.71642.523310534.62873.813024.1234842.4176735772372120.82269.82385.2238806.11516.41336.1245870.81916.11869.52501654.72588.91104.72521605.81808.11897.2264746.71074.11170.2290626.9634.4625.82941207.13722.12055.42962156.510012034.3342615.51084120913a10SEQSignalIDThyPapCan_02014_40099_H133A_838TT@I202014_40317_H133A_839TTpc_EA40200_VDX879TT 23540.316573331 31796.3750.61334.9 5495426023011.2 62558.41246.91008.5 945383328.91097.2 1225446420.65055.9 189287.150856074.5 225415.438503537 2512197.912963368.6 28915.5631842.7 324804.93883.43039.3 391409.27561855 74992.8349.3597.9 78352259.9342.41434199.61314.82573.11743924.51399.15622.61756697.715904211.21913745.9816.24875.52121219.11064.81480.32228593.9434.61994.523320899.6465737907.72343763.91496.43667.82372711.12046.91892.2238994.11047.31092.42451339.11019.42826.72501736710.82570.52522933.11316.31849.22641426.69872826.4290666.3368.14872943175.81237.34622.72961837.4899.126393421355.2406.11662.9SEQSignalIDpc_EA40201_VDX881TTpc_EA40202_VDX882TTpc_EA40203_VDX883TT 23253.13349.33642 31248.1477.8697.9 52106.61504.92070.9 61708.8874.6704.3 91789.6857.21327.3 124641.73423.22283 185157.67305.15996.2 223100.82588.42125.9 254941.81669.91166.3 28869.9606.5459.6 325722.33401.71964.8 39135614211878.4 74708.5741.6421.6 78434.8172.4207.21435070.94302.93455.31744217.61231.41538.61757931.37786.35294.61913853.92370.51807.82121571.71350.2874.72222235.1980.8748.423322959.212092.730504.22342431.21077.61447.823729192374.32011.2238929.6877.7776.82451538.11379.81254.92501597.718991923.82522395.526211992.72641272.72511.51495.4290665.4692.17062943449.7976.81074.72962217.52398.42049.3342803.31501.386313a11SEQSignalIDpc_EA40204_VDX884TTpc_EA40205_VDX885TTpc_EA40206_VDX886TT 22895.12994.73397.6 31144932.31277.6 51096.31151.44943.4 6916.19451696.2 92396.93699.91671.3 123762.23308.43095.3 189468.36669.210475.1 223823.42813.44326.9 251322.84964227.5 28563.6333.7602.3 324985.4854.71788.8 3996315621937.7 74417443.9383.6 78169.9266.2346.41432357.92936.429611741096.52227.918251753559.14964.653951915320.28526.64668.12121168.21634.11396.4222805.9739.22330.223325920.637919.3334382341882.81513.32438.52372950.61089.91886.52381037.61240818.82451151.51872.72007.725033242153.42363.725216411236.41558.62641120.12994.21776.5290624.5516.4692.12941273.13050.215572962601.32023.62244.2342723.2973.5587SEQSignalIDpc_EA40207_VDX890TTpc_EA40208_VDX892TTpc_EA40209_VDX893TT 24328.14435.35980.3 33294.11361.2475.7 51741.83416.4653.5 61593.61278.6740.7 91488.62591.91644.7 122865.45996.81644.2 1818044.89220.211224.4 227811.178371650.1 254437.51271.9878.1 28782.9724.2636.5 322423.62099.4629.4 391973.71774.11387.6 74600.6814.2578.6 78207.7507.4117.71436472.64513.43395.71741268.55715380.617512711.37961.85835.71914129.580054597.42121197.91161.51523.42223890.4873.81137.42337762.123325.920940.72344528.92232.71253.92372930.82484.42082.4238709.91096.2877.72451316.82042.31717.42501885.42787.93192.22522605.71944.32613.42641401.31517.12362.8290520.9778.61209.72941442.83564.9424.12962054.12777.343473422028.3679.8746.213a12SEQSignalIDpc_EA40210_VDX894TT02014_40319_H133A_903TT02014_40320_H133A_904TT 24563.83729.22859.9 3475.3827.44626.7 51717.53130.11505.9 6698.91153.22668.3 93017.43184.76316.2 121662.348507880.2 1871866997.214099 221195.23583.46058.2 25587.7868.928372.6 28728.8621.51685.2 321503.22517.719668.7 391609.61035.81140.8 74240.3718.9623.5 78196.7180.1370.11431838.33062.81513.21741548.41810.31087.61752462.75545.81615.41913292.32497.13479.22121289.51230.1645.1222502.2315.38484.123340786.71656217697.82341248.41443.83706.72371286.12852.72832.72381382.71243.2990.624521741000.7703.12502738.62792.31076.82521078.41615.72091.12642550.8948.7659.3290518.9745.91057.12941936.21348.3757.52962194.31614.61446.4342612.9748.4366.7SEQSignalID02014_40328_H133A_928TT02014_40330_H133A_932TT02014_40331_H133A_933TT 22475.33977.23386.3 3246.32009.21481.9 51737.41875.44763.8 611041295.61385.4 91911.33801.92397.6 1230355874.23637.2 1811077.79724.610100.8 224793.76322.54421.3 25667.235264180.2 28927.3646.4882.8 323607.71986.96399.2 3912051028.31359.6 74583.29531021.1 78543465.1373.71432903.23977.33056.11742910.33511.63939.41754518.27011.25184.619110855805.42286.32121795.66391130.82221685.84996.9611.82333636.919787.14648.92342565.52733.92463.92372610.72178.62681.62381636.41423.21469.22452029.71000.11302.22501439.33692.82113.92522366.61895.92343.22641351811.71104.5290320.1924.21016.32942287.32252.82351.2296729.62955.61690.234210611424.5894.413a13SEQSignalIDEA02014_40375_H133A_922TTEA02014_40381_H133A_945TTEA02014_40382_H133A_946TT 21365.72250.13658.1 3935.61124.41023.9 57421.5656.73000.3 61026.6982.61628.3 910992.71452.22478.2 1230072413.75402.5 184106.51506.89107.3 224766.35493.63034.7 25900.410351.11252.1 28685.81022.4714.8 32309919843215.8 391012.3480.51173 74987.561.1894.2 78418.8111.9529.11432030.11411.53847.81742288.4269.94741.51752412.32138.96427.7191617.2983.62182.42121018.3208.91054.6222725.68103.4443.92334450.91177.320110.223419262079.32095.52372547.12912.43040.22381822.6264.61023.92452699.8113.41230.82501198.12491802.62521311.3613.62434.62641364.1382.41206.6290463.81223.5805.12942024.9340.94085.32961214407.71761.4342619828.41154.4SEQSignalIDEA02014_40383_H133A_947TTEA02014_40384_H133A_948TTThyFolCan_02014_40084_H133A_823TT 222993252.83923.8 32053.61187.91004.7 54151.21730.93450.3 61939.71023.91961.6 94581.51567.63548.1 127248.94382.66659.3 186629.59741.97072.7 224839.34984.84552 2510112.43841.37385.3 281191.6656.5625.4 3212202.33643.54762.1 391094.8781.31099.1 74877.1629887.2 78188.7371.9650.21432492.62091.22930.61742231.52488.17050.31753285.33691.44648.51912820.320811043.3212964.8771.1591.52224302.9143310512.723319683.94061.32305.12342384.82482.76283.22372736.13005.42681.3238929.21088.11176.92451359.88871067.62501764.82220.81112.42522260.91332.71526.72641095.11210.51451.3290865.9867.2932.72941859.82226.13796.82961917.23476.11298.6342639.7934.8111013a14SEQSignalIDThyFolCan_02014_40085_H133A_824TTThyFolCan_02014_40086_H133A_825TTThyFolCan_02014_40088_H133A_827TT 24103.91719.42824.5 32480.6144.5880.5 52190.21199.74743.6 6678.72589.22824.2 96166.7326.15428.5 122872.91257.44087.8 182329.34765.311522.2 224848.81224.53611.1 2511319.1234.53308.3 28772.7206.8830.6 3222721393.65410.1 39892.8541.9838.5 74126.82071.9988.3 78253.6307.6635.61432718.21570.72322.81743231399.828171754437.415844411.61912214.1575.36412121667.2662.2577.722213107.5470.61030.123331961087.32932.32341659.88752243.32374693.9830.43700.2238206.3244.81695.9245248.74251273.9250935.9379.82284.42521005.51023.31166.6264231.55891480.9290638.4233961.8294253.41349.83087.12961530.81570.61591.53421457.8712.81052.1SEQSignalIDThyFolCan_02014_40089_H133A_828TT02014_40318_H133A_840TTfc_EA40212_VDX896TT 23008.42542.72391.5 3497.61222.41069.4 52936.83696.7776.8 61605.51411.71403.4 92131.99187.910000.2 123981.77045.43506.5 187266.23045.44683.8 226001.88784.31719.5 25557.13685.8383.8 281057.11256.51118.8 323330.713825869 39941.310413461.7 741357.4696.81290.4 78920.6422.6705.51432621.61038.84569.21749345.58768849.81754784.91387.47804.91911208.41370.94609.821218641229590.62223020.4431.9641.9233708112626.74567.82341839.413287454.42372563.53040.51008.92382546.21614.21880.42451215.41333.62807.1250894.4867.2844.32521884.31524.6678.42641740.6670.92459.5290668.6430.59962947034.21137.37044.62961110.61647.71498.9342946.9436.81893.813a15SEQSignalIDfc_EA40214_VDX898TTfc_EA40215_VDX899TTfc_EA40216_VDX900TT 22470.73328.24429.9 3226.4523.31216.2 51037.23614.51440.6 6997685.71641.1 9384.91897.9973.8 129940.91131.54352.5 184150.77715.25736.9 22499.644662120.9 251721.2191210485.2 28232.1706.8501.4 322728.837532644.6 391006.61103.31192.6 742642.5794.9374.8 78294.6280.8131.21432141.42616.65902.7174407.12263.742701752416.23697.79897.31911436.82900.85153.2212839.51241.8173.4222293.51318.16645.423317314.718164.12971.62342834.41575.63547237945.93105.61268.9238702.91189744.7245914.61729.71038.5250845.92673.52175.82521300.42454.31377.7264467.61277.4638.7290573.7617.2993.4294507.11922.12827.12962156.225631832.8342535.6937.42261.2SEQSignalIDfc_EA40217_VDX901TTfc_EA40218_VDX902TTfc_EA40221_VDX909TT 2993.82649.94427.4 3230.64172364.4 533191487.49590 6967.82453.42537.2 9468.7915.83339.3 123202.24269.615203.8 18555.29139.47575.1 22208.21563.81471.9 25826.110026640.8 28122.6779.4645.5 321820.83404.510045.3 39880.82310.8346.3 741621.81057.9294 78136.4344.4391.31433882.43860.32140.31742006.52076.14365.11756489.55706.62832.4191165.9963.5512.1212186.6451.1539.9222426.3623.32727.52332885.82068.715099.5234904.63783.56440.12372192.9893.12333.7238554.4383.3908.6245839.4784.2459.1250702.91305.7723.22521061.41235.82869.526420581076.7569.3290767.41281.3866.12941753.31585.82926.6296533.72130.32647.83421949.2975.7618.513a16SEQSignalIDfc_EA40222_VDX910TTEA02014_40386_H133A_954TTEA02014_40394_H133A_967TT 22362.114171834.4 3254.5263.8293.1 52789.18005.61358.8 61096.61050.71291.7 9834.81052.42701.2 122031.64283.72805.1 189498.518893.215454.8 221449.51020888.3 25541.3253.5572.5 28502.3443868.6 321205.97122.3811.1 391215.41031.1511 741385.41477.5509.1 78367.5834.2200.71431956.71083.11486.71744466.42823.71156.31751799.112641758.7191560.21494607.92121046.1307.8548.8222248.3533.11356.42331183.6612.71063.52341886.73460.31207.2237934.6933.52133.3238834.9291.11034.12451509.7786.6657.12502406.81245.71247.12521536.81182.41035.62641315.8582.81373.3290732.4835.3683.829428172372.1929.52961088.415412014.6342763.6866.9722.2SEQSignalIDEA02014_40395_H133A_968TTEA02014_40396_H133A_969TTEA02014_40397_H133A_970TT 22135.53006.21378.8 3346.3346.5230.2 5637.31214.11214.7 6987.41223.82564.6 91171.46080440.4 124294.14966.41686.4 182385.43575.214192.8 222585.43721.5727.2 253378.9709.2372 28378.9964.1341.9 322553.97971753.4 397222166.1527.2 741159.31031.4495.4 78235.3433.7262.914327462538.41943.71743547.91541.52214.31754539.53663.32264.41912943.22727.41474.7212340.4982.96472221194.21169.8228.22335528.16265.310762342384.13860.63322.72377911890.71257.5238380.8946.4415245384.94773.4447.62506591647.1595252526.78931276.72649581622.3508.62901744.3523850.22942611.81279.42097.3296621.41368.3981.8342559594.3445.913a17SEQSignalIDEA02014_40405_H133A_982TTEA02014_40406_H133A_983TTpb1pb2pb3pb4pb5′ 23615.62106204.1324.2178.6206.6249.1 3765372.2171.5303.8159.161.190.2 52446.1394107.919.968.874.669 61051.61176211.6214.4318.6218.8355.4 92059.21081.41818.829.29.7134 123520391.511.49.19.933.88.3 184633.41333994.250.767.674.929.7 226678.8403.580.18.858.96.85 251229.9601.5197.1106.765.218.787.1 28778.2197.611.496.611.31.7 321302.94182.68.721.630.566.164.6 392104699246.6121.142.8122.8171.7 741189.71142.359.994.470.3295.2 78833.680.94845.566.949.5119.71432842.21778.2290291.2190.465.6203.51743307.3329.829.842.825.811.513.91753878.91966.8165.7282.2158.367.2249.21913952.2527846.8181.4148.297.3152.12122201.71134.370.455.73.58799.8222469451.7120.4148.457.749.65823311069.25607139.876.97.65.623435903449.5186201.3165.354.8141.12372057.6740.2135.3150.716.614.5192381679.4432.322.543.811.46.25.12452301.61040.57.112.722.55.94.6250434.61079.497.8138.933.771.346.8252844.61446.135.680.329.663.388.52641125.71084.5102.831.6147.6101.5163.3290347.9466.935.87.314.487.271.72941601.7575.2105.194.541.531.935.3296872.81349.1217.8162.6186.2171.2212.5342948.7482.8296.5220.2308.1126.3298.613a18SignalSEQ IDpb6′pb7′pb8′pd10pd11pd12pd9 2167.6233.9232.6116.9204.5293.279.6 3110.38822190.774.990.9129.5 529.770.2182.532.634.5130.512.9 6226.5440.1207219.7275.2134.1193.1 928.926.830.932.45.325.720.3 126.618.861.438.210.74.111.6 1853.637.831.868.8117.570.823.4 2216.910.632.16.429.221.23.1 25127123.7118.79.710.664.96.6 2813.24.943.388.11226.6 3236.451.525.117.217.219.711 39326.5182.627.3126.2151.926182.7 7448.22939.855.335.376.96.2 7892.12093.126.911.956.6104.8143176.4224.5248.5126.2184.6162.8249.617440.8149.824.210.615.681.416.8175262.5355.4207.821.6213.9175.8193.7191151.2310.793.365.7108.495.979.321293.6121.7141.730.842.6108.493.222283.582.860.716.45071.166.9233144.764.116.576.470.88.123440.4248.143.845.5143.330.977.2237223.8141.1129.557.621.911.518.723832.127.666.510.533.47.761.624519.87.24.82.411.24.76.725075.3109.265.385.7119.9118.766.4252103.891.294.81769.376.122.5264151224.6129.9122.899.861.524.829021.827.650.749.36.22.7329491.158.44024.852.667.831.7296282.4299.2143.7149.7197.9205.2147.7342304.5437.8327.490.9247.6224.4268.6









TABLE 13b










13b1












SEQ
ThyMixBen_02014_. . ._Signal












ID
40062_H133A_800TT
40063_H133A_801TT
40064_H133A_802TT
40065_H133A_804TT





 83
156.7
114.3
73.8
240.3


142
28.3
7.9
15
28.4


136
100.4
23.4
15.3
106.9


137
527.2
47
32.3
177.2


152
237.5
230.4
188.7
465.2


160
291.6
141.9
80.9
323.1


163
15.6
53.1
25.1
70.8


165
190.2
230.7
142.4
483.5


210
436.9
8.6
18.4
343.7


214
269.2
134.4
167.7
141.8


219
217
19.6
7.9
85.6


224
588.2
121.4
119.2
275.2


225
508.1
30.1
42.3
107.3


226
57.3
48.2
80.9
103.9


309
257.7
20.6
20.7
75.5


332
287.1
17
26.1
103.8


346
622.2
18.3
24
17.6













SEQ
ThyMixBen_02014_. . ._Signal












ID
40066_H133A_805TT
40067_H133A_806TT
40068_H133A_807TT







 83
173
193.6
291.2



142
26.9
25.8
14.2



136
28.3
14.9
56



137
19.5
53.1
404.6



152
183
260.9
190.9



160
98.1
120.3
219.7



163
20.1
56.1
47.8



165
179.3
241.7
410.9



210
31.8
8
148.1



214
145.7
140.5
349.1



219
21.8
26.7
115.1



224
136.6
240.5
392.5



225
59.4
29.5
147.3



226
43.5
12.3
88.9



309
19.2
24
833.9



332
115.9
68.8
37.9



346
20.7
13.2
442.1











13b2












SEQ
02014_. . ._Signal












ID
40198_H133A_871TT
40321_H133A_913TT
40322_H133A_914TT
40323_H133A_915TT





 83
39.5
90.2
76.4
255.8


142
25.3
22.5
12.9
34.4


136
9.8
31.8
16.8
132


137
227.8
53.6
68.7
60.1


152
184.4
214.3
253.2
294.7


160
267.5
250.7
206.5
328.8


163
44.3
56.4
23.9
98.5


165
174.3
221.8
185.5
266.3


210
25.8
153.6
42
55.5


214
43.2
83.6
110.6
213.7


219
56.6
53.5
45.2
122.1


224
269.7
357.4
260
191.5


225
204.8
322.6
114.2
55.6


226
11.9
57.4
69.9
22


309
37.9
37
28.2
53


332
9.9
59.2
66.7
57.8


346
28.6
263.8
11.1
27.2













SEQ
02014_. . ._Signal












ID
40324_H133A_917TT
40325_H133A_918TT
40326_H133A_919TT







 83
150.8
109.7
142.6



142
8.5
20.6
67.7



136
115.4
130
7.2



137
29.6
133.2
29



152
313.8
251.3
294.2



160
191.1
220.8
114.4



163
35.2
68
41.8



165
104.6
217.1
159.9



210
8.2
152
49.1



214
132.6
89.3
138.7



219
24.4
124
41.3



224
168.8
330.8
169.8



225
121.8
317.6
95.8



226
67.5
33.6
19.3



309
10.2
32.6
24.2



332
13
40.5
9



346
32.5
153.4
61.1











13b3











SEQ
ThyFolBen_02014_. . ._Signal












ID
40079_H133A_818TT
40080_H133A_819TT
40081_H133A_820TT
40082_H133A_821TT
40083_H133A_822TT





 83
63.4
151.8
104.1
27.5
138.9


142
15
20.2
18.8
18.4
23


136
17.6
135.4
77.1
31.7
17.7


137
24.7
36.1
18
28.4
42.6


152
62.1
176.7
146.4
273.3
328.2


160
153
138.1
131
192.4
124.1


163
6.9
21.4
35
63.5
13.4


165
28.7
155.3
112.6
135.2
222.6


210
27.5
10.4
8.1
9.9
32.7


214
211.7
210.8
83.9
166.4
160.2


219
18.7
111.8
45.7
10.9
29.6


224
114.7
241.8
100
160.9
242.4


225
69.4
63.8
145.4
110.9
126.1


226
92.1
95.5
36.3
74.5
67.2


309
16.8
17.1
12.1
18.8
27.3


332
40
20.5
21
11
6.6


346
7.2
27.1
18.6
29.3
26.7










13b4













SEQ
fa_EA40 . . ._Signal














ID
191_VDX862TT
192_VDX863TT
193_VDX864TT
194_VDX865TT
195_VDX866TT







 83
26.9
24.4
56.7
155.1
22.3



142
16.1
22.4
14.5
54.8
17.1



136
23
59
20.4
121.4
12.5



137
26.7
32.4
19.4
45.2
32.8



152
75.7
189.4
211.4
320.4
194



160
239.5
101.4
91.3
292.1
55.8



163
48.5
47.6
23.1
168.3
35.4



165
26.5
94.3
81.1
197.9
112.9



210
32.2
16.2
23.8
81.4
25.3



214
119.9
130.9
141.7
235.4
263.7



219
80.6
7.6
15.9
20.9
25



224
50.9
25.8
50
80
32.6



225
66.7
41.4
64.4
69.5
18.1



226
76
2.8
3.5
99.1
88.6



309
6.7
15.2
9.4
62.6
20.2



332
9.6
36.9
10.8
91.1
103



346
25.1
16.5
20.8
89.5
34.2













SEQ
fa_EA40 . . ._Signal












ID
196_VDX867TT
197_VDX869TT
219_VDX907TT
220_VDX908TT





 83
94.8
63
41.9
256


142
15.8
15
21.9
23.9


136
88.4
77.1
47.1
36.8


137
30.8
55.2
97
63.4


152
75.5
314
114.8
260


160
86.8
53.7
47.4
145.4


163
13.4
51.5
13.5
60.4


165
164.6
155.9
29.7
250.4


210
22.7
140.5
15.5
200.8


214
30.4
124.9
57
241


219
10
16.5
23.4
20.1


224
99.7
136.4
137.5
167


225
94.7
51.1
51.6
149.8


226
18.3
60.6
6.4
11.6


309
18.4
15.9
10.2
33.3


332
30.1
12.3
19.7
36.5


346
20.9
18.3
11.3
114.6










13b5












SEQ
02014_. . ._Signal












ID
40327_H133A_920TT
40332_H133A_938TT
40334_H133A_941TT
40335_H133A_940TT





 83
216.8
145.1
58.1
102.1


142
22.2
7.9
6.6
14.5


136
71.7
30.1
47.9
57.1


137
47
48.1
69.1
57.4


152
252.7
189
184.9
138.7


160
153.6
179.9
121.9
66.6


163
53.3
13
69.1
38.6


165
146.9
146.7
85.1
120


210
24
59.1
21.5
23.8


214
90.5
224.7
178.7
139.3


219
36.4
17.5
14.9
63.3


224
180.2
126.6
154.2
161


225
59.7
197.5
83.8
115.7


226
31.9
58.1
33.7
34.5


309
27.1
7.7
6.2
15.6


332
83.8
7.3
40.7
47.6


346
17
18.8
27.6
24.4










13b6













SEQ
EA02014_. . ._Signal












ID
40374_H133A_921TT
40376_H133A_923TT
40377_H133A_924TT







 83
174.4
32.7
69.1



142
13.7
19.8
16.5



136
24.2
9.3
12.1



137
38.3
143.4
28.2



152
178.2
230.8
155



160
125.2
133.5
74.9



163
54.4
4.9
35.5



165
218.9
155.1
206



210
36.8
25
20.6



214
126.7
186.1
167.2



219
32.3
25.5
15.3



224
220.8
301.9
129.7



225
158
221.8
127.9



226
37.5
33.4
9.6



309
26.1
16
17.8



332
26.3
38.5
6.7



346
20.7
151.4
21.6














SEQ
EA02014_. . ._Signal












ID
40378_H133A_925TT
40379_H133A_926TT
40380_H133A_927TT







 83
86.6
67.7
204.9



142
57.7
22.9
18.9



136
25.3
190.4
16.3



137
77.5
156.1
255.2



152
237.4
235.7
70



160
197
170.1
234



163
46.1
65.2
59.9



165
85.6
158.1
532.5



210
25.8
19.8
551.3



214
114.1
191.9
161.4



219
10.2
95.6
18.5



224
178.8
308.2
270.9



225
65.6
269.4
60.6



226
57.2
80.8
18.1



309
31.8
32.6
49.2



332
11.6
73.5
21.6



346
19.2
179.4
53.6











13b7











SEQ
EA02014_. . ._Signal











ID
40387_H133A_955TT
40388_H133A_956TT
40389_H133A_957TT
40390_H133A_959TT





 83
29.1
121.5
70.7
28.8


142
16.7
14.2
10.8
21.4


136
15.7
27.8
67.7
45.9


137
28.5
44.8
34.5
50


152
85.4
163
183.4
127.1


160
121.9
51.9
175
137.4


163
47
27.7
43.6
80.1


165
42.2
122.9
103.8
150.6


210
27.1
5.2
20.4
73.7


214
36.4
68.3
165.9
25.3


219
23.3
51
29.1
25.7


224
143.8
95.1
128.8
78.7


225
140.5
83.1
34.3
54


226
4.3
24.7
84.1
47.7


309
18.7
11.4
26.7
44.2


332
11.1
4
37.9
14.1


346
21.8
22.1
12.8
35.7













SEQ
EA02014_. . ._Signal












ID
40391_H133A_960TT
40392_H133A_961TT
40393_H133A_962TT







 83
121.6
120.5
34



142
18.6
16.5
21.9



136
15.4
8.2
43



137
31.3
162.2
18.5



152
298.3
193
221.2



160
208.5
125.9
162.9



163
29.7
33.8
44.4



165
253.3
106.9
221.6



210
29.4
38.7
85



214
129.8
165.9
100.9



219
67
20.8
21



224
108.8
152
109



225
62.8
114.7
94.3



226
33.3
66.1
13.3



309
20.6
34.1
35.2



332
17.8
13.1
11.5



346
38.7
29.6
10.1











13b8











SEQ
ThyPapCan_02014_. . ._Signal












ID
40090_H133A_829TT
40091_H133A_830TT@IC
40092_H133A_831TT
40093_H133A_832TT
40095_H133A_834TT





 83
304.3
199.4
258.5
171.4
112.3


142
26
34.7
22.4
19.1
16.4


136
122.2
116.6
21.7
27.3
30.7


137
40.7
72
23.8
36.8
19.5


152
611.5
682.6
236.2
170.5
200.6


160
218.1
244.7
225.4
68.9
76.4


163
17.8
119.7
38.9
51.8
52.9


165
370.6
263.3
353.8
154.1
165.1


210
223.2
249.8
303
9.7
30.2


214
178.4
246.7
155.4
188.3
138.6


219
36.8
136.4
64.9
24.3
19.1


224
364.7
427.6
180
191.1
163.6


225
333.9
213.5
221
124.6
137.2


226
179.2
142
57
15.4
13.7


309
88.8
136.6
48.8
22.1
23.6


332
92
56.9
42.4
61.1
34.4


346
58.4
61
197.1
38
29.1












SEQ
ThyPapCan_02014_. . ._Signal












ID
40096_H133A_835TT
40097_H133A_836TT
40098_H133A_837TT@I2
40099_H133A_838TT@I2





 83
186.5
28.5
137.1
85.9


142
25.8
12.1
22.5
15.4


136
110.2
143.8
14.1
140.7


137
31.5
29.6
29.4
32.5


152
104
136.4
118
155.9


160
137.3
83.2
171.7
66.7


163
42.7
25.5
57.2
23.6


165
233.2
100.4
227.9
213.3


210
94.5
21.9
42.1
23.1


214
133.7
69
298.6
90.8


219
25.9
11.7
13.6
23.8


224
211.5
36.2
303.4
164.5


225
195.1
46.9
145.6
34.3


226
91.8
33.5
132.6
38


309
40.5
16.5
33.9
24.7


332
70.6
14.5
108.1
60.8


346
281.5
37.5
30.8
33










13b9













SEQ
Signal












ID
02014_40317_H133A_839TT
pc_EA40200_VDX879TT
pc_EA40201_VDX881TT







 83
288.1
25.7
32.9



142
16.1
21.2
23.5



136
62.8
160.5
141.2



137
45.4
155.5
35.5



152
383.4
197
90.6



160
142.9
79.7
181.6



163
60.7
102.6
138.6



165
238.4
123.6
227.1



210
134.1
184.4
28.4



214
189.2
173
50



219
26.8
30.4
13.3



224
215.8
139.5
255.3



225
167.5
35.2
98.1



226
49.4
43.4
84.3



309
340.8
33.7
32



332
15.9
39.9
67.1



346
14.3
37.9
36.5














SEQ
Signal












ID
pc_EA40202_VDX882TT
pc_EA40203_VDX883TT
pc_EA40204_VDX884TT







 83
29.2
58.6
184.4



142
7.6
21.5
30.6



136
8.7
13.2
19.4



137
63.9
41.5
31.1



152
123.7
188
240



160
205.4
157.5
137.8



163
54.2
51.3
9.1



165
113.8
224.6
241.9



210
42.7
12.1
10



214
164.7
109.2
250.7



219
78.6
34.3
34.8



224
96.9
181.3
163.2



225
32.4
221.4
54.3



226
16.4
141.3
27.2



309
22.8
29.8
45.9



332
14.3
88.5
25.2



346
33.5
28.7
37.4











13b10












SEQ
pc_EA40 . . . Signal














ID
205_VDX885TT
206_VDX886TT
207_VDX890TT
208_VDX892TT
209_VDX893TT
210_VDX894TT





 83
22.9
81.5
34.1
159.2
88.7
43.6


142
26.4
22.6
8.7
10.8
18.5
23.6


136
28.1
18.2
9.6
14.6
17.3
22.5


137
207.7
94.4
68.8
83.7
17.8
140.4


152
77.3
225.5
227.5
95.5
301.1
59.9


160
294.5
164.6
110.3
84.5
105.6
163


163
140.9
34
25.9
9.3
41.9
83.5


165
241.8
101.4
193.6
161.9
112.8
190.6


210
416.8
24.1
45.5
15.1
26.9
15.6


214
323.3
139.5
148.2
174.1
104.5
142.1


219
131.8
12
25.9
48.9
14.4
96.2


224
215.3
136.2
126
193.8
195.4
67.1


225
49.5
105
54.2
97.4
33
38.8


226
181.1
55.2
34.1
4
15
125.1


309
89.7
47.4
58.6
17.8
23.5
72.3


332
73
66.8
48.2
27.5
41.1
25.3


346
13.6
107.7
145.3
12.7
18.3
20










13b11













SEQ
02014_40 . . ._Signal














ID
319_H133A_903TT
320_H133A_904TT
328_H133A_928TT
330_H133A_932TT
331_H133A_933TT







 83
58.3
226.6
92.7
79.2
106.8



142
14.5
118.3
7.4
8
13



136
18.9
87
29.4
86.9
9.3



137
24.4
174.5
25.7
135.9
31.8



152
178.1
137.4
176.6
151.1
166.2



160
83.2
205
93.5
103.6
73.3



163
31.5
100.2
19.2
40.5
33.4



165
223.6
235.9
161.5
132.8
132



210
35.5
99.9
16.4
124.9
17



214
118.8
178
25.6
115.6
117



219
15.1
80.2
27.7
54.2
38.2



224
174.5
323.7
223.3
203
185.3



225
170.3
200.3
180.3
157.3
157.2



226
65.2
26.9
25.2
4.6
35.7



309
11.1
270.7
15.9
91.5
18.6



332
12
77.4
15.1
7.2
7.3



346
30.4
387.2
25.4
204.4
14.7











13b12













SEQ
EA02014_403 . . ._Signal














ID
75_H133A_922TT
381_H133A_945TT
382_H133A_946TT
383_H133A_947TT
384_H133A_948TT







 83
88.1
22.1
193.5
166.9
73.7



142
12
19.6
13.2
21.6
16.9



136
11.8
12.3
52
46.7
107.9



137
51.3
182.2
43.4
23.9
14.5



152
341
139
248.1
299.5
84.2



160
95.6
102
99.5
184.6
90.4



163
77.6
41.6
25.9
51.7
4.9



165
254.8
63.5
172.6
209.2
81.1



210
8.8
78.8
28.8
44
92.5



214
79
94.5
148.7
101.7
82.7



219
22.7
31.8
63.9
23.8
18.1



224
190.5
194.7
212
278.9
201.1



225
48.8
135.5
46.8
274.4
97.5



226
20
24
90.8
45.3
8.8



309
30.5
195
29.7
53.4
37.9



332
10.4
4.2
9.2
75
44



346
19.1
298.1
35.4
251.2
37.2











13b13













SEQ
ThyFolCan_02014_400 . . ._Signal














ID
84_H133A_823TT
85_H133A_824TT
86_H133A_825TT
88_H133A_827TT
89_H133A_828TT







 83
242
70.1
71.2
24.8
145.4



142
19.8
12.5
35.7
17.7
19.6



136
35.7
21
59.4
20.3
9



137
86.1
23.7
116.3
18.2
48.6



152
271.9
199.6
213.1
140.9
202.5



160
134.5
134.1
415.1
162.4
154



163
64.5
46.1
82.1
15.5
57.8



165
189.3
222.6
239
223.8
145.3



210
8.8
236.3
50
21.8
33.8



214
33.1
71.3
121.6
157.3
100.8



219
24.8
64.8
82.1
14.1
60.2



224
213
96.4
371.4
159.1
92.8



225
164.9
103.3
224.4
145.2
98.3



226
10.3
5
24
30.5
21.6



309
15
33.3
38.4
14.9
19.5



332
77.6
55.7
124.1
10.6
84.5



346
39
124.6
31.5
29.5
21.3











13b14












SEQ
Signal












ID
02014_40318_H133A_840TT
fc_EA40212_VDX896TT
fc_EA40214_VDX898TT
fc_EA40215_VDX899TT





 83
189.9
110.7
51.4
35.8


142
18.9
20.5
246.2
18.5


136
22.6
105.2
21.3
20.3


137
32.3
40.6
46.3
33.8


152
306
216.1
317.8
169.4


160
99.5
197.5
240.4
68.7


163
52.1
29.7
70.7
75.3


165
236.7
142.2
147
168


210
26.5
108.8
39.9
25.5


214
115.1
63.9
59
129.9


219
16.2
46.2
62.7
39.4


224
203.9
194.6
321.6
225.2


225
198
53.6
82.8
52.5


226
31
57.3
111.5
66.7


309
17.2
40.2
44.3
43


332
51.4
26.5
129.1
7.8


346
11
27.8
21.6
19.4













SEQ
Signal












ID
fc_EA40216_VDX900TT
fc_EA40217_VDX901TT
fc_EA40218_VDX902TT







 83
104.6
22.8
44.7



142
20.7
25.8
28.6



136
33.6
24.5
24.4



137
23.9
90.6
48.5



152
154.6
169.3
374.5



160
146.7
210.5
196.7



163
13.6
25.1
59.3



165
174.2
28.5
89.4



210
42.2
11
24.4



214
150.1
194.1
218.2



219
42.1
92.3
39.4



224
238
212.5
187.3



225
250.7
72
53.5



226
24.8
41
79.9



309
20.2
21.3
63.8



332
5.6
37.8
31.6



346
320.2
24.3
210.6











13b15












SEQ
Signal












ID
fc_EA40221_VDX909TT
fc_EA40222_VDX910TT
EA02014_40386_H133A_954TT
EA02014_40394_H133A_967TT





 83
312.2
30.6
105.2
42.2


142
17.8
9.9
41.7
30.5


136
63.1
87.5
38
29.7


137
170.4
111.7
78.6
32.1


152
624.7
121
215.4
212.7


160
257.9
30.5
247.6
161.6


163
21.6
27
43.5
50.7


165
251.9
105
92.7
136.3


210
34
37.1
49
43.9


214
257.9
176.9
168.4
69.9


219
117.7
25.9
43.2
42.1


224
55.1
150
176.9
280.1


225
205.8
42.3
66.7
320.3


226
84.9
14.8
148.6
26


309
745.6
9.7
53.6
42


332
15.9
7.6
69.9
10.3


346
48
25
54.7
142.6













SEQ
Signal












ID
EA02014_40395_H133A_968TT
EA02014_40396_H133A_969TT
EA02014_40397_H133A_970TT







 83
47.9
24.4
46.5



142
11.8
16.7
25.7



136
206.6
10.1
99.2



137
20.5
29.4
18.2



152
160.9
216.7
214.3



160
192.1
87.9
538.8



163
56.9
72.4
48.7



165
166.5
123.8
180.7



210
21.1
7.4
167.3



214
113.6
140.1
14



219
24
12.6
57.9



224
184.5
194.4
374.4



225
27
66.2
54.6



226
47.6
36.9
21.7



309
23.5
14.6
71



332
63.6
13.3
26.8



346
73.6
16.6
79.7











13b16













SEQ
Signal
















ID
EA02014_40405_H133A_982TT
EA02014_40406_H133A_983TT
pb1
pb2
pb3
pb4
pb5′







 83
58.1
37.8
524.7
768.1
855.6
1163.9
876.3



142
19.4
37.4
1289.3
1088.9
659.7
732.6
1415



136
94.2
11
1770.1
1622.7
523
979.3
617.3



137
17.6
111.2
1871
2554
1313.7
781.1
2087.1



152
255.8
37.6
9696.4
9404.8
1099.8
9900.7
7060



160
54.7
347.1
1273.2
1171.6
907
937.4
926.2



163
32.9
59.7
833
682.5
559.6
358.6
467.8



165
71.8
232.2
1217.8
986.3
1278.9
2537.1
1464.3



210
5.2
33.2
3401
2546.6
756.3
4893
1770.8



214
212.6
165
1384.3
1540
636.7
656.5
1213.9



219
14.1
43.6
1692.6
1911.7
912
2112.2
1417.9



224
137
228.2
2481.3
3104.2
1905.4
2292.4
2242.7



225
109.6
153.4
2367.8
2860.8
1887.6
2052.6
2116.6



226
41.6
11
797.2
969.9
617.1
626.6
920



309
20.7
30.6
5357.5
5904
3572.6
6641.9
3580.9



332
6.8
60.2
258.8
304.2
110.1
255.3
363.3



346
27
57.3
1584.2
1705.7
1507.5
1626.3
1587.1











13b17













SEQ
Signal
















ID
pb6′
pb7′
pb8′
pd10
pd11
pd12
pd9







 83
818.3
333.4
692.1
709.8
699.7
926.2
534.7



142
1287.9
565.2
2004.2
821.9
904.8
1619.6
282.5



136
1039
962.2
1013.5
1147.9
840.9
599.8
284



137
1881.4
667.8
2058.1
2182.1
1678.9
1632.9
912.1



152
3657.7
2025
2993.5
11129.5
11824.2
11963.5
1607



160
1154.5
301.4
473.2
1849.5
1424.7
660
242



163
628.5
6534.3
1863.4
148.7
247.4
230.2
4365.5



165
1485.2
889
1904.7
1404.2
1560.4
1123.6
1919.6



210
2729.4
595.1
5286.8
7026.5
3861.8
1028.8
1724.8



214
871.1
442.3
644.5
936.1
939.1
852
347.7



219
1216.7
411.6
959.7
1085.9
1974.4
1580.2
245.9



224
2039.1
1488.3
1844.2
2280.1
2823.4
1252.3
1246.6



225
2214.8
1494.6
2186
1961.1
2628.3
1184.1
1230.7



226
822.2
437.3
684.5
540.5
839.5
1062.8
273.7



309
3787.2
1401.5
3537
3522.1
4518.1
5118.1
931.7



332
218.7
630.6
462.4
168.4
220.4
242.2
322.8



346
1682.4
909
2317.6
1193.5
1748.9
2159
622.7

















TABLE 14










Control Genes








SEQ ID NO:
Gene Name










Control Genes for Blood








142
Bone marrow stromal cell antigen 1 (BST1)


219
Leucocyte immunoglobulin-like receptor-6b (LIR-6)


309
Bridging integrator 2 (BIN2)







Control Genes for Thyroid








9
Cysteine-rich, angiogenic inducer, 61 (CYR61)


12
Selenoprotein P, plasma, 1 (SEPP1)


18
Insulin-like growth factor-binding protein 4 (IGFBP4)

















TABLE 15a








SEQ ID
























BN_800TT
BN_801TT
BN_802TT
BN_804TT
BN_805TT
BN_806TT
BN_807TT
BN_871TT





142
28.3
7.9
15
28.4
26.9
25.8
14.2
25.3


219
217
19.6
7.9
85.6
21.8
26.7
115.1
56.6


309
257.7
20.6
20.7
75.5
19.2
24
833.9
37.9






BN_913TT
BN_914TT
BN_915TT
FA_917TT
FA_918TT
FA_919TT
FA_818TT
FA_819TT





142
22.5
12.9
34.4
8.5
20.6
67.7
15
20.2


219
53.5
45.2
122.1
24.4
124
41.3
18.7
111.8


309
37
28.2
53
10.2
32.6
24.2
16.8
17.1






FA_820TT
FA_821TT
FA_822TT
FA_842TT
FA_862TT
FA_863TT
FA_864TT
FA_865TT





142
18.8
18.4
23
10
16.1
22.4
14.5
54.8


219
45.7
10.9
29.6
28.9
80.6
7.6
15.9
20.9


309
12.1
18.8
27.3
15.2
6.7
15.2
9.4
62.6






FA_866TT
FA_867TT
FA_869TT
FA_907TT
FA_908TT
FA_920TT
FA_938TT
FA_940TT





142
17.1
15.8
15
21.9
23.9
22.2
7.9
6.6


219
25
10
16.5
23.4
20.1
36.4
17.5
14.9


309
20.2
18.4
15.9
10.2
33.3
27.1
7.7
6.2
















FA_941TT
Fa_EA40374_921TT
Fa_EA40376_923TT
BN_EA40377_924TT
Fa_EA40378_925TT





142
14.5
13.7
19.8
16.5
57.7


219
63.3
32.3
25.5
15.3
10.2


309
15.6
26.1
16
17.8
31.8
















Fa_EA40379_926TT
BN_EA40380_927TT
Fa_EA40387_955TT
Fa_EA40388_956TT
Fa_EA40389_957TT





142
22.9
18.9
16.7
14.2
10.8


219
95.6
18.5
23.3
51
29.1


309
32.6
49.2
18.7
11.4
26.7

















Fa_EA40390_959TT
Fa_EA40391_960TT
Fa_EA40392_961TT
Fa_EA40393_962TT
PC_829TT
PC_830TT





142
21.4
18.6
16.5
21.9
26
34.7


219
25.7
67
20.8
21
36.8
136.4


309
44.2
20.6
34.1
35.2
88.8
136.6



















PC_831TT
PC_832TT
PC_834TT
PC_835TT
PC_836TT
PC_837TT
PC_838TT
PC_839TT





142
22.4
19.1
16.4
25.8
12.1
22.5
15.4
16.1


219
64.9
24.3
19.1
25.9
11.7
13.6
23.8
26.8


309
48.8
22.1
23.6
40.5
16.5
33.9
24.7
340.8






PC_879TT
PC_881TT
PC_882TT
PC_883TT
PC_884TT
PC_885TT
PC_886TT
PC_890TT





142
21.2
23.5
7.6
21.5
30.6
26.4
22.6
8.7


219
30.4
13.3
78.6
34.3
34.8
131.8
12
25.9


309
33.7
32
22.8
29.8
45.9
89.7
47.4
58.6






PC_892TT
PC_893TT
PC_894TT
PC_903TT
PC_904TT
PC_928TT
PC_932TT
PC_933TT





142
10.8
18.5
23.6
14.5
118.3
7.4
8
13


219
48.9
14.4
96.2
15.1
80.2
27.7
54.2
38.2


309
17.8
23.5
72.3
11.1
270.7
15.9
91.5
18.6
















Pc_EA40375_922TT
Pc_EA40381_945TT
Pc_EA40382_946TT
Pc_EA40383_947TT
Pc_EA40384_948TT





142
12
19.6
13.2
21.6
16.9


219
22.7
31.8
63.9
23.8
18.1


309
30.5
195
29.7
53.4
37.9


















FC_823TT
FC_824TT
FC_825TT
FC_827TT
FC_828TT
FC_840TT
FC_896TT





142
19.8
12.5
35.7
17.7
19.6
18.9
20.5


219
24.8
64.8
82.1
14.1
60.2
16.2
46.2


309
15
33.3
38.4
14.9
19.5
17.2
40.2






FC_898TT
FC_899TT
FC_900TT
FC_901TT
FC_902TT
FC_909TT
FC_910TT





142
246.2
18.5
20.7
25.8
28.6
17.8
9.9


219
62.7
39.4
42.1
92.3
39.4
117.7
25.9


309
44.3
43
20.2
21.3
63.8
745.6
9.7
















Fc_EA40386_954TT
Fc_EA40394_967TT
Fc_EA40395_968TT
Fc_EA40396_969TT
Fc_EA40397_970TT





142
41.7
30.5
11.8
19.4
37.4


219
43.2
42.1
24
14.1
43.6


309
53.6
42
23.5
14.6
71


















Fc_EA40405_982TT
Fc_EA40406_983TT
pb1_Signal
pb2_Signal
pb3_Signal
pb4_Signal
pb5′_Signal





142
16.7
25.7
1289.3
1088.9
659.7
732.6
1415


219
12.6
57.9
1692.6
1911.7
912
2112.2
1417.9


309
20.7
30.6
5357.5
5904
3572.6
6641.9
3580.9


















pb6′_Signal
pb7′_Signal
pb8′_Signal
pd10_Signal
pd11_Signal
pd12_Signal
pd9_Signal





142
1287.9
565.2
2004.2
821.9
904.8
1619.6
282.5


219
1216.7
411.6
959.7
1085.9
1974.4
1580.2
245.9


309
3787.2
1401.5
3537
3522.1
4518.1
5118.1
931.7
















TABLE 15b










Signal








SEQ ID


















PC_984TT
PC_986TT
FA_987TT
PC_988TT
PC_989TT
FA_992TT
FA_993TT





142
25.1
125.8
18.5
11.4
13.7
11.8
113.6


219
17.5
25.7
22.6
11.3
32.4
61.9
25.2


309
27.6
661.8
15.7
47.4
29.8
33.2
28.4






FA_994TT
FA_995TT
FA_996TT
FA_998TT
FA_999TT
FA_1001TT
FA_1002TT





142
20.6
25.2
34.1
21.8
31.4
12.7
74.6


219
25.9
36.3
41.5
24.9
16.4
26.5
25.5


309
16.8
26.3
19.4
22.5
14.6
32.3
47.7






FA_1004TT
FA_1005TT
FA_1006TT
FA_1010TT
FA_1013TT
FA_1014TT
FA_1017TT





142
24.7
20.1
67.7
14.9
48.9
29.8
26.9


219
27.5
11.7
53.3
112.9
35.1
39.5
27.2


309
39.5
10.3
34.6
83.2
46.8
20
25.7






FA_1018TT
FA_1020TT
FA_1023TT
FA_1024TT
FA_1026TT
FA_1027TT
FA_1028TT





142
25.1
25.5
35.6
26.9
27.9
15.2
24.5


219
66.3
26
6.1
26
59.3
18.8
31.7


309
31
37.4
20.6
46.9
51.4
8.8
33.3






FA_1029TT
FA_1030TT
FA_1031TT
FA_1032TT
FA_1034TT
FA_1035TT
FC_1037TT





142
10.6
14
20
21.6
31.9
17.1
17.8


219
12.5
33.5
15.1
15
68.5
25.6
63.5


309
20.7
13
21.5
32.2
52.6
24.6
26.2






PC_1039TT
PC_1040TT
PC_1041TT
PC_1042TT
PC_1043TT
PC_1044TT
PC_1045TT





142
16.1
22.7
99.5
129.8
20.7
79.2
16.4


219
27.9
29.5
23.6
29
21.5
19.8
38.4


309
585.3
37.6
48.7
41
32.8
59.2
112.3












PC-



PC_1046TT
PC_1047TT
PC_1048TT
PC_1049TT
PC_1050TT
PC_1051TT
FV_1052TT





142
22.4
81.2
24.7
37.5
25.9
26.6
26.4


219
11.1
97.5
61.8
14.9
14.7
109.1
30.6


309
22.5
207.8
35.4
64
39.5
56.7
28.2






PC_1053TT
PC_1054TT
PC_1055TT
PC_1059TT
PC_1060TT
PC_1061TT
PC_1062TT





142
12.8
18.5
24.4
22.7
24.6
15.8
25.6


219
12.6
19.6
10.2
24.5
82.6
53.7
20.7


309
20.4
22.1
24
18.9
32.3
54.5
29.1






PC-
PC-
PC-
PC-
PC-
PC-
PC-



FV_1064TT
FV_1065TT
FV_1066TT
FV_1067TT
FV_1068TT
FV_1069TT
FV_1071TT





142
16.7
11.3
25.5
17.4
17.5
14
16.7


219
174.4
20.3
132.4
24.8
12.3
14.8
18.8


309
30.4
169.6
49.4
16.9
135.5
18.1
7.6






PC-



FV_1072TT
FA_1073TT
FA_1074TT
FA_1075TT
FA_1076TT
FC_1077TT
FC_1078TT





142
14
25.5
22.7
27
16.4
15.8
38.9


219
8.7
73.2
57
54.3
69.9
20
17.1


309
29.9
145.4
21
53
24.3
9.1
32.9





















PC-








FC_1079TT
PC-FV_1080TT
FV_1081TT
FC_1082TT
pb1
pb2
pb3
pb4





142
31.9
10.2
22
19.5
1289.3
1088.9
659.7
732.6


219
40.1
17.4
38.3
88.1
1692.6
1911.7
912
2112.2


309
27.1
23.4
40.8
12.9
5357.5
5904
3572.6
6641.9



















pb5′
pb6′
pb7′
pb8′
pd10
pd11
pd12
pd9





142
1415
1287.9
565.2
2004.2
821.9
904.8
1619.6
282.5


219
1417.9
1216.7
411.6
959.7
1085.9
1974.4
1580.2
245.9


309
3580.9
3787.2
1401.5
3537
3522.1
4518.1
5118.1
931.7










F. Signature Normalized to Control Genes


We further examined our 5-gene and 4-gene signatures by normalizing these genes to the three selected thyroid control genes as an algorithm for gene chip data normalization. The average fluorescent intensities of the three thyroid control genes were used for signature gene signal normalization. The performance of both signatures improved slightly when these two signatures were normalized. The sensitivity and specificity of the two signatures are listed in Table 16, and the ROC curves are shown in FIGS. 4a and 4b.

TABLE 16The performances of the 4-gene and 5-gene signatures normalizedto control genesTumorBenign4-Gene SignaturePositive3311Negative327Sensitivity92% (0.78, 0.97)Specificity71% (0.55, 0.83)5-Gene SignaturePositive338Negative330Sensitivity92% (0.78, 0.97)Specificity79% (0.64, 0.89)


G. Signature Validation with Two-Round Amplified Probes


To determine if the FNA samples lack sufficient thyroid cells to provide enough probe material for hybridizing to the Affymetrix U133a gene chips after one round of amplification, two-round amplification of the target RNAs we performed two-round amplification with 47 samples that are among the 74 independent validation sample set. The data obtained show that the performances of the 5-gene and 4-gene signatures are identical with either one-round or two-round amplifications. The ROC curves of the two gene signatures with two different target preparations are shown in FIGS. 5a, 5b, 5c, and 5d.


EXAMPLE 4
Cross Validation with Independent Samples

A. Cross Validation with the 83 Independent Fresh Frozen Thyroid Samples


83 independent thyroid samples were processed and profiled with the U133a chip. The number of samples in each category is list in Table 17.

TABLE 17Fresh Frozen sample collection for signature validationSample TypeNumber of SamplesFollicular Adenoma18Follicular Thyroid Carcinoma1Papillary Carcinoma, Follicular Variant18Papillary Thyroid Carcinoma11Adenomatoid Nodules18Adenomatoid Nodules w/Hashimoto1Multinodular Hyperplasia16


The performance of the 4-gene signature and the 5-gene signature was assessed with LDA using the same cut-off value as in the training set. Both signatures gave equivalent performance in these samples, and they are comparable with the performance in the 98 training set. The sensitivity and specificity for both signatures are shown in Table 18, and the ROC curves are demonstrated in FIGS. 6a and 6b.

TABLE 184-Gene and 5-gene signatures performance in 83 validation samplesTumorBenign4-Gene SignaturePositive2011Negative1042Sensitivity67% (0.49, 0.81)Specificity79% (0.67, 0.88)5-Gene SignaturePositive2424Negative629Sensitivity80% (0.63, 0.90)Specificity55% (0.41, 0.67)


B. Signature Validation with the 47 Fine Needle Aspirate (FNA) Thyroid Samples


47 thyroid FNA samples were processed and profiled with the UI33a chip. The number of samples in each category is list in Table 19.

TABLE 19FNA sample collection for signature validationSample TypeNumber of SamplesFollicular Adenoma10Follicular Thyroid Carcinoma2Papillary Carcinoma, Follicular Variant3Papillary Thyroid Carcinoma13Adenomatoid Nodules10Adenomatoid Nodules w/Hashimoto1Multinodular Hyperplasia8


The performance of the 4-gene signature and the 5-gene signature was assessed with LDA model. Both signatures gave equivalent performance in the FNA samples, and they are comparable with the performance in the 98 training set. The sensitivity and specificity for both signatures are shown in Table 20, and the ROC curves are demonstrated in FIGS. 7a and 7b.

TABLE 204-Gene and 5-gene signatures performance in 47 FNA samplesTumorBenign4-Gene SignaturePositive154Negative325Sensitivity94% (0.74, 0.99)Specificity62% (0.44, 0.77)5-Gene SignaturePositive1710Negative119Sensitivity94% (0.74, 0.99Specificity66% (0.47, 0.80)


C. Signature Performance in 28 Paired Fresh Frozen and FNA Thyroid Samples


Within the 83 fresh frozen and the 47 FNA sample collections there are 28 samples that were from the same patient. The direct comparison of our signatures in these paired samples demonstrates how well the signature will translate into the final molecular assay. The performance of the 4-gene signature and the 5-gene signature was assessed with the LDA model. Both signatures gave equivalent performance in the fresh frozen and FNA samples. These results demonstrated that our 4-gene and 5-gene signatures can perform equally well in both sample types, and proved the approach using fresh frozen samples for gene/signature identification is valid. The sensitivity and specificity for both signatures are shown in Table 21, and the ROC curves are demonstrated in FIGS. 8a and 8b.

TABLE 214-Gene and 5-gene signatures performance in 28 matchedfresh frozen and FNA samplesFresh FrozenFNATumorBenignTumorBenign4-Gene SignaturePositive104127Negative31118Sensitivity77% (0.50-0.92)92% (0.67-0.99)Specificity73% (0.48-0.89)53% (0.30-0.75)5-Gene SignaturePositive117127Negative2818Sensitivity85% (0.58-0.96)92% (0.67-0.99)Specificity53% (0.30-0.75)53% (0.30-0.75)


EXAMPLE 5
Real-Time Quantitative Rt-PCR

Sample Acquisition:


In order to determine whether a subset of the gene profiles and/or controls would give adequate specificity and sensitivity with RT-PCR, the following experiment was performed. The following has the advantage of requiring only one round of RNA amplification.


A total of 107 thyroid biopsies were analyzed in our study: 26 follicular adenoma, 23 follicular carcinoma, 38 papillary carcinoma, 5 normal, 3 papillary carcinoma follicular variant, 3 Hashimoto thyroiditis, 2 microfollicular adenoma, 1 diffuse goiter, 1 goiter with papillary hyperplasia, 1 Hurthle cell adenoma, 1 hyperplasia with papillary structure, 1 multinodular goiter, 1 oncocytic hyperplasia, 1 thyroiditis. Total RNA isolation was extracted by using the Trizol reagent according to the manufacturer's instructions. RNA concentrations were determined by absorbance readings at 260 nm with the Gene-Spec (Hitachi) spectrophotometer. The isolated RNA was stored in RNase-free water at −80° C. until use.


Primer and Probe Design:


The primers and hydrolysis probes were designed using Oligo 6.0 and the Genebank sequences for thyroid cancer status markers (Table 22). These primers and probe sets were designed such that the annealing temperature of the primers was 62° C. and the probes 5-10° C. higher and amplicon size ranges from 100-150 bp. Genomic DNA amplification was excluded by designing our primers around exon-intron splicing sites. Hydrolysis probes were labeled at the 5′ nucleotide with FAM as the reporter dye and at 3′ nucleotide with TAMRA as the quenching dye.

TABLE 22AccessionProductTarget#Forward Primer (SEQ ID NO:)Reverse Primer (SEQ ID NO:)Probe Sequence (SEQ ID NO:)LengthSGENENM_003020gaaagcggaggagtgtcaatcca (364)ggttttcgtctagcatcttctcttta (365)atctacaaggacagagactggataatgttg (366)130TESTICAN1AF231124gtgagctgtgaagaggagcaggaa (367)ctttggtcccagctcccgttca (368)cctcaggggattttggcagtggtgggtccg (369)102GABRENM_004961taaactccgccatcctcgtatcaa (370)cagtggtgacaatctggcacacaa (371)ccgtgcccatgcccgtacccgtgca (372)113CDH3NM_001793ctgaagcaggatacatatgacgtgca (373)agggtccagggcaggtttcgaca (374)catggcagtcgcacacagtggccctga (375)124FN1NM_002026tggtgccatgacaatggtgtgaacta (376)catcatcgtaacacgttgcctcatga (377)aagattggagagaagtgggaccgtcaggga (378)148TPO-1NM_000547catctgtgacaacactggcctca (379)gccacacttgtcgtcttgaggaa (380)caaattccccgaagactttgagtcttgtgacagc (381)148TPO-2NM_000547aacctgcgtagactccgggaggc (382)gccagtgcgtgtccacctgca (383)ctcgggtgacttggatctccatgtcgctgg (384)124KCNAB1-1NM_003471tgaaagttccagggcttcactgaa (385)agctgaggtagtgtgcatcccaga (386)ctaccagtggttgaaagaaagaattgtaagtgaag (387)138KCNAB1-2NM_003471tagctgttgcgtggtgcctgagaa (388)tgatgtcatctttgggagaacctgaa (389)aaggtgtgagttctgtgctcctgggatcat (390)119FABP4-1NM_001442gaaagaagtaggagtgggctttgcca (391)ggcccagtatgaaggaaatctcagta (392)aaaggtactttcagatttaatggtgatcacatccc (393)143FABP4-2NM_001442aggaaagtcaagagcaccataacctta (394)gacgcattccaccaccagtttatca (395)ttgattttccatcccatttctgcacatgta (396)123DOI1-1NM_000792gggtaaatctggcccttggaactaca (397)cccgttggtcacctagaattgaggta (398)cccagaggaagttcgtgctgttctggaaaa (399)106DOI1-2NM_000792tgcatcagatggctgggctttta (400)gctctggttctgcatggtgtcca (401)catcagaaatcaccagaaccttcaggatcg (402)142B-ACTINNM_001101tcacccacactgtgcccatctacga (403)cagcggaaccgctcattgccaatgg (404)atgccctcccccatgccatcctgcgt (405)295GOLGIN67NM_015003gcatggtgatctttgtgaggcga (406)ctcctggtggtcctgcatctca (407)ctcaccaacagcgtggagcctgcacaagga (408)139PAX8BC001060actccagcttgctgagttcccca (409)actccagcttgctgagttcccca (410)attattacagttccacatcaaggccgagtgca (411)125HERCNM_003922gggtgcttttcatgaggtttgtgtca (412)tgaggtaggcagactgtcgtaaggcc (413)ccaacactgctgacatttctcagagatttcaaat (414)219DDIT3NM_004083cctggaaatgaagaggaagaatcaa (415)agctctgactggaatctggagagtga (416)aatcttcaccactcttgaccctgcttctctgg (417)142ITM1NM_152713tggctggtcaggatatacaaggtaaa (418)tcaacgtcctaaatgtgatgtgctca (419)cctggataatcgaggcttgtcaaggacataaa (420)117C1OF24NM_052966tctgaaagtgataaaggaagctgcta (421)ctttagatctgttaagctggacacac (422)cttgaagaaacacaacttatttgaagataacatg (423)103MOT8NM_018836acggcctataacgagaccctgca (424)gaagaggagggtcggtttccattaa (425)ttctcacgagtgcgtcagggcatctgtgc (426)133ARG2NM_00172atttgaccctacactggctccagc (427)gatccagtgctgatagcaaccctgta (428)actcctgttgtcgggggactaacctatcgaga (429)119


Real-Time Quantitative RT-PCR:


Gene specific real-time quantitative RT-PCR amplification of 21 thyroid cancer status genes and a housekeeping gene was performed using the TaqMan One-Step RT-PCR Master Mix (2×) (Applied Biosystems) and the ABI Prism 7900HT sequence detection system (Applied Biosystems). In a 25 μl one-step reaction total RNA (10 ng) was added to a mix that contained: 1×RT-PCR Master Mix, 0.25 U/μl Multiscribe Enzyme, 0.6 μM primers and 0.25 μM probe. Cycling parameters were 48° C. for 30 min and 95° C. 10 min, followed by 40 cycles of 95° C. 15 sec and 62° C. 1 min. Real-time PCR monitoring was achieved by measuring fluorescent signal at the end of the annealing phase for each cycle. The number of cycles to reach the fluorescence threshold was defined as the cycle threshold (Ct value). To minimize the errors arising from the integrity of the RNA in the samples β-actin mRNA was amplified as an internal reference. External standards were prepared by 10-fold serial dilutions of known thyroid cancer positive RNA and used to ensure linearity throughout our assays. Results were expressed in mean Ct value and samples were excluded that had a standard deviation greater then one. The results are provided in Tables 23a, 23b, 23c, 24a and 24b.


The data show that the two gene signature shown in Table 23b is not as sensitive and specific as the four-gene signature from which it was derived. Table 24 shows that use of the PAX8 gene in an RT-PCR reaction as a control for thyroid-specific tissue is effective in an RT-PCR reaction.


Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention.

TABLE 23Aembedded imageembedded imageembedded imageembedded imageembedded imageembedded imageembedded imageembedded imageembedded image









TABLE 23B















embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 23C















embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 24A















embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 24B















embedded image









embedded image









embedded image









embedded image









embedded image









embedded image


















TABLE 25










Sequence identifications











SEQ


Accession



NO:
psid
Name
No.
Description














1
200635_s_at

AU145351
Hs.75216 prot tyrosine phosphatase, rec.






type, F


2
200771_at

NM_002293
laminin, gamma 1


3
201069_at

NM_004530
matrix metalloproteinase 2


4
201117_s_at
CPE
NM_001873
carboxypeptidase E


5
201150_s_at

NM_000362
tissue inhibitor of metalloproteinase 3


6
201185_at

NM_002775
protease, serine, 11


7
201203_s_at

AI921320
ribosome binding protein 1


8
201212_at

NM_005606
cysteine protease


9
201289_at
CYR61
NM_001554
cysteine-rich, angiogenic inducer, 61


10
201292_at

NM_001067
topoisomerase (DNA) II alpha


11
201418_s_at
SOX4
NM_003107
SRY (sex determining region Y)-box 4


12
201427_s_at
SEPP1
NM_005410
Selenoprotein P, plasma, 1


13
201430_s_at
DPYSL3
NM_001387
dihydropyrimidinase-like 3


14
201431_s_at
DPYSL3
NM_001387
dihydropyrimidinase-like 3


15
201438_at
COL6A3
NM_004369
collagen, type VI, alpha 3


16
201474_s_at
ITGA3
NM_002204
integrin, α 3 transcript variant a


17
201505_at
LAMB1
NM_002291
laminin, beta 1


18
201508_at
IGFBP4
NM_001552
Insulin-like growth factor-binding protein 4


19
201525_at
APOD
NM_001647
apolipoprotein D


20
201645_at
HXB
NM_002160
hexabrachion (tenascin C, cytotactin)


21
201650_at
KRT19
NM_002276
keratin 19


22
201667_at
GJA1
NM_000165
gap junction protein, α 1, 43 kD (connexin 43)


23
201744_s_at
LUM
NM_002345
lumican


24
201792_at
AEBP1
NM_001129
AE-binding protein 1


25
201852_x_at

AI813758
Collagen, type III, alpha 1


26
201893_x_at

AF138300
decorin variant A


27
201983_s_at

AW157070
epidermal growth factor receptor


28
202133_at

AA081084
Transcriptional co-activator w PDZ-binding






motif


29
202219_at
SLC6A8
NM_005629
solute carrier family 6, member 8


30
202237_at
NNMT
NM_006169
nicotinamide N-methyltransferase


31
202286_s_at

NM_002353
tumor-associated calcium signal transducer 2


32
202291_s_at

NM_000900
matrix Gla protein


33
202310_s_at

NM_000088
proalpha 1 (I) chain of type I procollagen


34
202350_s_at
MATN2
NM_002380
matrilin 2 precursor, transcript variant 1


35
202357_s_at
BF
NM_001710
B-factor, properdin


36
202363_at

AF231124
testican-1


37
202376_at
SERPINA3
NM_001085
Ser (or Cys) proteinase inhib clade A mem 3


38
202404_s_at
COL1A2
NM_000089
collagen, type I, alpha 2


39
202440_s_at

NM_005418
suppression of tumorigenicity 5


40
202504_at
ATDC
NM_012101
ataxia-telangiectasia group D-assoc. protein


41
202575_at
CRABP2
NM_001878
cellular retinoic acid-binding protein 2


42
202588_at
AK1
NM_000476
adenylate kinase 1


43
202712_s_at
CKMT1
NM_020990
creatine kinase, mitochondrial 1


44
202796_at
KIAA1029
NM_007286
synaptopodin


45
202826_at
SPINT1
NM_003710
serine protease inhibitor, Kunitz type 1


46
202834_at
SERPINA8
NM_000029
Ser (or Cys) proteinase inhib, clade A mem 8


47
202898_at
KIAA0468
NM_014654
KIAA0468 gene product


48
202992_at
C7
NM_000587
complement component 7


49
203021_at
SLPI
NM_003064
secretory leukocyte protease inhibitor


50
203083_at
THBS2
NM_003247
thrombospondin 2


51
203180_at
ALDH1A3
NM_000693
aldehyde dehydrogenase 1 family, mem. A3


52
203228_at
PAFAH1B3
NM_002573
platelet-activating factor acetylhydrolase,






isoform lb, γ sub


53
203256_at
CDH3
NM_001793
cadherin 3, type 1, P-cadherin (placental)


54
203349_s_at
ETV5
NM_004454
ets variant gene 5 (ets-related molecule)


55
203352_at
ORC4L
NM_002552
origin recognition complex, subunit 4-like


56
203354_s_at

NM_015310


57
203381_s_at

NM_000041


58
203382_s_at
APOE
NM_000041
apolipoprotein E


59
203407_at
PPL
NM_002705
periplakin


60
203417_at
MFAP2
NM_017459
microfibrillar-associated protein 2, tran var 1


61
203438_at

NM_003714
stanniocalcin 2


62
203453_at
SCNN1A
NM_001038
sodium channel, nonvoltage-gated 1 α


63
203499_at
EPHA2
NM_004431
EphA2


64
203548_s_at

NM_000237
lipoprotein lipase


65
203570_at
LOXL1
NM_005576
lysyl oxidase-like 1


66
203632_s_at
GPRC5B
NM_016235
G protein-coupled rec, fam C, group 5, mem B


67
203673_at
TG
NM_003235
thyroglobulin


68
203699_s_at

NM_013989
type II iodothyronine deiodinase


69
203700_s_at
DIO2
NM_013989
deiodinase, iodothyronine, type II, tran var 1


70
203786_s_at
TPD52L1
NM_003287
tumor protein D52-like 1


71
203851_at
IGFBP6
NM_002178
insulin-like growth factor binding protein 6


72
203854_at
IF
NM_000204
I factor (complement)


73
203859_s_at
PALM
NM_002579
paralemmin


74
203875_at

NM_003069
SWISNF related, matrix assoc, actin dep






regulator of chromatin subfam a mem 1


75
203881_s_at

NM_004010
dystrophin, includes DXS142, DXS164,






DXS206, DXS230, DXS239, DXS268,






DXS269, DXS270, DXS272 (DMD), transcript






variant Dp427p2


76
203889_at
SGNE1
NM_003020
secretory granule, neuroendocrine protein 1


77
203911_at
RAP1GA1
NM_002885
RAP1, GTPase activating protein 1


78
203934_at
KDR
NM_002253
kinase insert domain receptor


79
203986_at
GENX-3414
NM_003943
genethonin 1


80
204105_s_at
NRCAM
NM_005010
neuronal cell adhesion molecule


81
204124_at
NaPi-IIb
AF146796
Na dependent phosphate transporter isoform


82
204149_s_at
GSTM4
NM_000850
glutathione S-transferase M4


83
204152_s_at

AI738965
manic fringe (Drosophila) homolog


84
204154_at
CDO1
NM_001801
cysteine dioxygenase, type I


85
204259_at
MMP7
NM_002423
matrix metalloproteinase 7 (matrilysin, uterine)


86
204260_at
CHGB
NM_001819
chromogranin B (secretogranin 1)


87
204268_at
S100A2
NM_005978
S100 calcium-binding protein A2


88
204288_s_at
ARGBP2
NM_021069
ArgAbl-interacting prot ArgBP2, trans var 2


89
204298_s_at
LOX
NM_002317
lysyl oxidase


90
204337_at

NM_005613
regulator of G-protein signalling 4


91
204416_x_at
APOC1
NM_001645
apolipoprotein C-I


92
204424_s_at

NM_018640
neuronal specific transcription factor DAT1


93
204433_s_at

NM_006038
spermatogenesis associated PD1


94
204442_x_at
LTBP4
NM_003573
latent transforming GFβ binding protein 4


95
204452_s_at

NM_003505
frizzled 1


96
204476_s_at
PC
NM_022172
pyruvate carboxylase


97
204503_at
EVPL
NM_001988
envoplakin


98
204591_at
CHL1
NM_006614
cell adhesion molecule w/ homology to






L1CAM homolog L1


99
204600_at
EPHB3
NM_004443
EphB3


100
204623_at
TFF3
NM_003226
trefoil factor 3 (intestinal)


101
204625_s_at

NM_000212
integrin, β 3 (platelet glycoprotein IIIa, CD61)


102
204697_s_at
CHGA
NM_001275
chromogranin A


103
204741_at
BICD1
NM_001714
Bicaudal D (Drosophila) homolog 1


104
204753_s_at
HLF
NM_002126
hepatic leukemia factor


105
204754_at
HLF
NM_002126
hepatic leukemia factor


106
204755_x_at
HLF
NM_002126
hepatic leukemia factor


107
204787_at
Z39IG
NM_007268
Ig superfamily protein


108
204797_s_at
EMAPL
NM_004434
echinoderm microtubule-associated pro-like


109
204869_at

AL031664
DNA seq RP4-531H16 chrom 20p11.22-12


110
204870_s_at
PCSK2
NM_002594
proprotein convertase subtilisinkexin type 2


111
204933_s_at
TNFRSF11B
NM_002546
TNFR superfamily, member 11b


112
204934_s_at
HPN
NM_002151
hepsin (transmembrane protease, serine 1)


113
204944_at
PTPRG
NM_002841
protein tyrosine phosphatase receptor type G


114
204964_s_at
SSPN
NM_005086
sarcospan (Kras oncogene-associated gene)


115
204975_at
EMP2
NM_001424
epithelial membrane protein 2


116
204990_s_at
ITGB4
NM_000213
integrin, beta 4


117
205051_s_at
KIT
NM_000222
v-kit Hardy-Zuckerman 4 feline sarcoma viral






oncogene homolog


118
205110_s_at
FGF13
NM_004114
fibroblast growth factor 13


119
205153_s_at
TNFRSF5
NM_001250
TNFR superfamily, mem 5


120
205168_at
DDR2
NM_006182
discoidin domain receptor family, member 2


121
205258_at
INHBB
NM_002193
inhibin, β B (activin AB β polypeptide)


122
205286_at

NM_003222
transcription factor AP-2 gamma


123
205325_at
KIAA0273
NM_014759
KIAA0273 gene product


124
205336_at
PVALB
NM_002854
parvalbumin


125
205402_x_at
PRSS2
NM_002770
protease, serine, 2 (trypsin 2)


126
205413_at
C11ORF8
NM_001584
chromosome 11 open reading frame 8


127
205455_at
MST1R
NM_002447
macrophage stimulating 1 receptor


128
205470_s_at
KLK11
NM_006853
kallikrein 11


129
205479_s_at
PLAU
NM_002658
plasminogen activator, urokinase


130
205481_at
ADORA1
NM_000674
adenosine A1 receptor


131
205485_at
RYR1
NM_000540
ryanodine receptor 1 (skeletal)


132
205490_x_at
connexin 31
NM_024009
gap junction protein, beta 3, 31 kD


133
205531_s_at
GA
NM_013267
breast cell glutaminase


134
205593_s_at
PDE9A
NM_002606
phosphodiesterase 9A


135
205614_x_at
MST1
NM_020998
macrophage stimulating 1


136
205627_at

NM_001785
cytidine deaminase


137
205639_at

NM_001637
acyloxyacyl hydrolase


138
205683_x_at
TPSB1
NM_003294
tryptase beta 1


139
205689_at
KIAA0435
NM_014801
KIAA0435 gene product


140
205700_at
RODH
NM_003725
oxidative 3 α hydroxysteroid dehydrogenase;






retinol dehydrogenase; 3-hydroxysteroid






epimerase


141
205710_at
LRP2
NM_004525
low density lipoprotein-related protein 2


142
205715_at
BST1
NM_004334
bone marrow stromal cell antigen 1


143
205717_x_at

NM_002588
protocadherin gamma subfamily C, 3


144
205728_at

AL022718
DNA seq from clone 1052M9 on chrom Xq25


145
205747_at
CBLN1
NM_004352
cerebellin 1 precursor


146
205778_at
KLK7
NM_005046
kallikrein 7 (chymotryptic, stratum corneum)


147
205858_at
NGFR
NM_002507
nerve growth factor receptor


148
205927_s_at
CTSE
NM_001910
cathepsin E


149
205980_s_at
ARHGAP8
NM_015366
Rho GTPase activating protein 8


150
206002_at
GPR64
NM_005756
G protein-coupled receptor 64


151
206114_at
EPHA4
NM_004438
EphA4


152
206390_x_at

NM_002619
platelet factor 4


153
206594_at
KIAA0135
NM_015148
KIAA0135 protein


154
206595_at
CST6
NM_001323
cystatin EM


155
206714_at
ALOX15B
NM_001141
arachidonate 15-lipoxygenase, second type


156
206757_at
PDE5A
NM_001083
phosphodiesterase 5A, cGMP-specific


157
206866_at
CDH4
NM_001794
cadherin 4, type 1, R-cadherin (retinal)


158
206884_s_at
SCEL
NM_003843
sciellin


159
206912_at
FOXE1
NM_004473
forkhead box E1 (thyroid transcription factor2)


160
207111_at

NM_001974
egf-like module cont., mucin-like, hormone






rec-like seq 1


161
207144_s_at
CITED1
NM_004143
Cbpp300-interacting transactivator, with






GluAsp-rich carboxy-terminal domain, 1


162
207173_x_at

NM_001797
OB-cadherin-1


163
207674_at
FCAR
NM_002000
Fc fragment of IgA


164
207695_s_at
IGSF1
NM_001555
immunoglobulin superfamily, member 1


165
207795_s_at
CD94
AB009597


166
207826_s_at
ID3
NM_002167
inhibitor of DNA binding 3, dominant negative






helix-loop-helix protein


167
207923_x_at
PAX8
NM_013953
paired box gene 8


168
208396_s_at
PDE1A
NM_005019
phosphodiesterase 1A, calmodulin-dependent


169
208451_s_at
C4B
NM_000592
complement component 4B


170
208712_at
PRAD1
M73554
cyclinD1


171
208747_s_at

NM_001734
subcomponent C1s, α- and β-chains


172
209021_x_at

BC001331
Similar to KIAA0652 gene product


173
209035_at

NM_002391
midkine


174
209071_s_at

AF159570
regulator of G-protein signalling 5


175
209079_x_at

AF152318
protocadherin gamma A1


176
209173_at

NM_006408
putative secreted protein XAG


177
209208_at

NM_004870
clone 015e11 My008 protein


178
209228_x_at

NM_006765
Putative prostate cancer tumor suppressor


179
209270_at
LAMB3
NM_000228
laminin S B3 chain


180
209280_at

NM_006039
chromosome 17 unknown product mRNA


181
209291_at

NM_001546
inhibitor of DNA binding 4, dominant negative






helix-loop-helix protein


182
209297_at
ITSN
AF114488
intersectin short isoform


183
209335_at

AI281593


184
209365_s_at
ECM1
NM_004425
extracellular matrix protein 1


185
209386_at

AI346835
transmembrane 4 superfamily member 1


186
209485_s_at
ORP1
AF274714
oxysterol-binding protein-related protein


187
209496_at

BC000069
retinoic acid receptor responder 2


188
209505_at

NM_005654
nuclear receptor subfam 2, group F, mem 1


189
209506_s_at

BC004154
nuclear receptor subfam 2, group F, mem 1


190
209529_at

AF047760
phosphatidic acid phosphohydrolase type-2c


191
209596_at

AF245505
adlican


192
209598_at
KIAA0883
AB020690
KIAA0883 protein


193
209652_s_at

BC001422
Similar to placental growth factor, vascular






endothelial growth factor-related protein


194
209691_s_at

BC003541
hypothetical protein FLJ10488


195
209739_s_at

AI814551
GS2 gene


196
209772_s_at

X69397
cell surface antigen


197
209781_s_at
T-Star
AF069681
T-Star


198
209792_s_at

BC002710
kallikrein 10


199
209810_at
SP-B
J02761
pulmonary surfactant-associated protein B


200
209897_s_at

AF055585
neurogenic extracellular slit protein Slit2


201
209924_at

AB000221
small inducible cytokine subfamily A (Cys-






Cys), mem18, pulmonary/activation-reg


202
209946_at

U58111
FLT4 ligand


203
209990_s_at

NM_005458
GABA-B receptor


204
210051_at
cAMP-GEFI
U78168
cAMP-regulated guanine nucleotide exchange






factor I


205
210055_at

NM_000369
thyroid stimulating hormone receptor


206
210072_at

NM_006274
beta chemokine Exodus-3


207
210078_s_at

L39833
K+ channel beta subunit


208
210096_at

NM_000779
lung cytochrome P450 (IV subfamily) BI


209
210298_x_at
FHL1
AF098518
four and 1/2 LIM domains1 protein isoform B


210
210321_at

M36118
cytotoxin serine protease-C


211
210342_s_at
TPO
NM_000547
thyroid peroxidase


212
210372_s_at
TPD52L2
AF208012
tumor protein D52-like 2


213
210397_at

U73945
beta-defensin-1


214
210401_at

U45448
P2 × 1 receptor


215
210471_s_at

U33428
K+ channel β 1a subunit mRNA, alt spliced


216
210473_s_at
p58GTA
M37712
galactosyltransferase assoc protein kinase


217
210605_s_at

BC003610
Similar to milk fat globule-EGF factor 8


218
210640_s_at
GPCR-Br
U63917
G protein coupled receptor


219
210660_at
LIR-6
AF025529
leucocyte immunoglobulin-like receptor-6b


220
210727_at

NM_001741
Calcitonin, calcitonincalcitonin-rel polypeptide, α


221
210762_s_at
HP
NM_006094
HP protein


222
210809_s_at

D13665
osf-2 mRNA for osteoblast specific factor 2


223
210827_s_at
ESE-1
U73844
epithelial-specific transcription factor ESE-1a


224
211100_x_at

U82278
immunoglobulin-like transcript 1c


225
211101_x_at

U82276
immunoglobulin-like transcript 1a


226
211102_s_at

U82277
immunoglobulin-like transcript 1b


227
211161_s_at

AF130082
collagen, type III, alpha 1


228
211217_s_at

AF051426
slow delayed rectifier channel subunit


229
211538_s_at

U56725
heat shock 70 kD protein 2


230
211564_s_at

BC003096
Similar to LIM domain protein


231
211679_x_at
GABBR2
AF095784
GABA-B receptor R2


232
211813_x_at

AF138303
decorin D


233
211959_at
IGFBP5
AW007532
insulin-like growth factor binding protein 5


234
211964_at

AK025912
type IV collagen alpha (2) chain


235
212067_s_at

AL573058
complement component 1, r subcomponent


236
212253_x_at
KIAA0728
BG253119
KIAA0728 protein


237
212294_at

BG111761
DKFZp586B0918


238
212328_at
KIAA1102
AB029025
KIAA1102 protein


239
212344_at
KIAA1077
AW043713
KIAA1077 protein


240
212353_at
KIAA1077
AI479175
KIAA1077 protein


241
212354_at
KIAA1077
BE500977
KIAA1077 protein


242
212464_s_at
FN
X02761
fibronectin precursor


243
212724_at

NM_005168
ras homolog gene family, member E


244
212738_at

AV717623


245
212775_at

AI978623
KIAA0657 protein


246
212803_at

NM_005967
NGFI-A binding protein 2


247
212806_at
KIAA0367
AL138349
KIAA0367 protein


248
212850_s_at

AA584297
low density lipoprotein receptor-rel protein 4


249
212865_s_at

BF449063
collagen, type XIV, alpha 1 (undulin)


250
212912_at

AI992251
Ribosomal pro S6 kinase, 90 kDa, polypep 2


251
212992_at

AI935123


252
213029_at

AL110126
DKFZp564H1916


253
213306_at

AA917899
multiple PDZ domain protein


254
213381_at

N91149
DKFZp586M2022


255
213423_x_at

AI884858
Putative prostate cancer tumor suppressor


256
213553_x_at

W79394
apolipoprotein C-I


257
213668_s_at

AI989477
SRY (sex determining region Y)-box 4


258
213693_s_at

AI610869
mucin 1, transmembrane


259
213800_at

X04697
complement factor H 38-kDa N-term frag


260
213904_at

AL390170
DKFZp547E184


261
213924_at
FLJ11585
BF476502
hypothetical protein FLJ11585


262
214023_x_at

AL533838
tubulin, beta polypeptide


263
214175_x_at

AI254547
LIM domain protein


264
214239_x_at
Mel-18
AI560455
Zinc finger protein 144


265
214307_at

AI478172
homogentisate 1,2-dioxygenase


266
214434_at
KIAA0417
AB007877
KIAA0417 gene product


267
214632_at

NM_003872
neuropilin 2


268
214680_at

BF674712
neurotrophic tyrosine kinase receptor 2


269
214702_at
MSF-FN70
AJ276395
migration stimulation factor FN70


270
214763_at
FLJ13875
AK023937
FLJ13875


271
214803_at

BF344237
DKFZp564N1116


272
214955_at

AI912086
DNA seq clone 1170K4 chrom 22q12.2-13.1


273
214977_at
FLJ13790
AK023852
FLJ13790


274
215016_x_at
KIAA0728
BC004912
KIAA0728 protein


275
215034_s_at
FLJ13302
AI189753
FLJ13302


276
215076_s_at
FLJ11428
AU144167
FLJ11428


277
215243_s_at
GJB3
AF099730
connexin 31


278
215388_s_at

X56210
complement Factor H-related protein 1


279
215442_s_at

BE740743
thyroid stimulating hormone receptor


280
215443_at

BE740743
thyroid stimulating hormone receptor


281
215506_s_at

AK021882
highly sim to putative tumor sup NOEY2


282
215536_at

X87344
DMA, DMB, HLA-Z1, IPP2, LMP2, TAP1,






LMP7, TAP2, DOB, DQB2 and RING8, 9, 13,






14 genes


283
216356_x_at
KIAA0734
AB018277
KIAA0734 protein


284
216470_x_at

AF009664
T cell receptor β locus, 3 trypsinogen repeats


285
216569_at
FABP3-ps
U72237
fatty acid-binding protein pseudogene


286
217546_at

R06655


287
217561_at

BF447272


288
217592_at

AV684859


289
217767_at

NM_000064


290
217820_s_at
FLJ10773
NM_018212
hypothetical protein FLJ10773


291
217875_s_at
TMEPAI
NM_020182
transmem, prostate androgen induced RNA


292
218002_s_at
SCYB14
NM_004887
small inducible cytokine subfam B (Cys-X-






Cys), mem 14 (BRAK)


293
218182_s_at
CLDN1
NM_021101
claudin 1


294
218353_at

NM_025226
MSTP032 protein


295
218368_s_at
FN14
NM_016639
type I transmembrane protein Fn14


296
218418_s_at

NM_015493
DKFZP434N161


297
218469_at
CKTSF1B1
NM_013372
Cys knot superfamily 1, BMP antagonist 1


298
218537_at
FLJ20568
NM_017885
hypothetical protein FLJ20568


299
218546_at
FLJ14146
NM_024709
hypothetical protein FLJ14146


300
218613_at

NM_018422
hypothetical protein DKFZp761K1423


301
218653_at
SLC25A15
NM_014252
solute carrier family 25 (mitochondrial carrier;






ornithine transporter) member 15


302
218691_s_at
RIL
NM_003687
reversion-induced LIM protein


303
218844_at
FLJ20920
NM_025149
hypothetical protein FLJ20920


304
218856_at
LOC51323
NM_016629
hypothetical protein LOC51323


305
218952_at
SAAS
NM_013271
granin-like neuroendocrine peptide precursor


306
218960_at
TMPRSS4
NM_016425
transmembrane protease, serine 4


307
219010_at
FLJ10901
NM_018265
hypothetical protein FLJ10901


308
219127_at
MGC11242
NM_024320
hypothetical protein MGC11242


309
219191_s_at
BIN2
NM_016293
bridging integrator 2


310
219195_at
PPARGC1
NM_013261
peroxisome proliferative activated receptor, γ,






coactivator 1


311
219211_at
USP18
NM_017414
ubiquitin specific protease 18


312
219277_s_at
FLJ10851
NM_018245
hypothetical protein FLJ10851


313
219331_s_at
FLJ10748
NM_018203
hypothetical protein FLJ10748


314
219416_at
CSR1
NM_016240
CSR1 protein


315
219436_s_at
LOC51705
NM_016242
endomucin-2


316
219440_at
RAI2
NM_021785
retinoic acid induced 2


317
219463_at
HS1119D91
NM_012261
sim to S68401 (cattle) glucose induced gene


318
219476_at
MGC4309
NM_024115
hypothetical protein MGC4309


319
219525_at
FLJ10847
NM_018242
hypothetical protein FLJ10847


320
219527_at
FLJ20605
NM_017898
hypothetical protein FLJ20605


321
219561_at
LOC51226
NM_016429
COPZ2 for nonclathrin coat protein zeta-COP


322
219596_at
LOC56906
NM_020147
hyp protein from EUROIMAGE 511235


323
219597_s_at
DUOX1
NM_017434
dual oxidase 1


324
219743_at
HEY2
NM_012259
hairyenhancer-of-split rel with YRPW motif 2


325
219749_at
FLJ20967
NM_022071
hypothetical protein FLJ20967


326
219836_at
MGC10796
NM_024508
hypothetical protein MGC10796


327
219855_at
FLJ10628
NM_018159
hypothetical protein FLJ10628


328
219856_at
MGC2742
NM_023938
hypothetical protein MGC2742


329
219926_at
POP3
NM_022361
popeye protein 3


330
219932_at
VLCS-H1
NM_014031
v long-chain acyl-CoA synthetase homolog 1


331
219958_at
FLJ11190
NM_018354
hypothetical protein FLJ11190


332
220034_at

NM_007199
interleukin-1 receptor-associated kinase M


333
220108_at
GNA14
NM_004297
guanine nucl binding protein (G protein), α 14


334
220332_at
CLDN16
NM_006580
claudin 16


335
220595_at
DKFZp434B0417
NM_013377
hypothetical protein DKFZp434B0417


336
220751_s_at
C5ORF4
NM_016348
chromosome 5 open reading frame 4


337
221009_s_at
PGAR
NM_016109
PPAR(gamma) angiopoietin related protein


338
221073_s_at
NOD1
NM_006092
caspase recruitment domain 4


339
221147_x_at
WWOX
NM_018560
WW domain-containing oxidoreductase


340
221266_s_at
LOC81501
NM_030788
DC-specific transmembrane protein


341
221270_s_at
TGT
NM_031209
tRNA-guanine transglycosylase


342
221489_s_at

AF227517
sprouty (Drosophila) homolog 4


343
221577_x_at

AF003934
prostate differentiation factor


344
221636_s_at

AL136931
DKFZp586G2122


345
221701_s_at

AF352728
STRA6 isoform 1 mRNA, alternatively spliced


346
221724_s_at

AF200738
C-type lectin DDB27 short form


347
221795_at

AI346341
Similar to hypothetical protein FLJ20093


348
221796_at

AA707199
Similar to hypothetical protein FLJ20093


349
221799_at
KIAA1402
AB037823
KIAA1402 protein


350
221870_at

AI417917
FLJ22356 fis


351
221900_at

AI806793
collagen, type VIII, alpha 2


352
221928_at

AI057637
Weakly sim to 2109260A B cell growth factor


353
221959_at

BE672313
highly sim to HSU79298 Human clone 23803


354
32128_at

Y13710
alternative activated macrophage specific CC






chemokine 1


355
37004_at
SP-B
J02761
pulmonary surfactant-associated protein B


356
37117_at

Z83838
GTPase-activating protein sim to rhoGAP






protein. ribosomal protein L6 pseudogene


357
37152_at

L07592
peroxisome proliferator activated receptor


358
37408_at
KIAA0709
AB014609
KIAA0709 protein


359
38691_s_at
SP5
J03553
pulmonary surfactant protein


360
45297_at

AI417917


361
63305_at

D81792


362
823_at

HSU84487
CX3C chemokine precursor, alt spliced


363
91920_at

AI205180


364



SGENE forward primer


365



SGENE reverse primer


366



SGENE probe


367



TESTICAN1 forward primer


368



TESTICAN1 reverse primer


369



TESTICAN1 probe


370



GABRE forward primer


371



GABRE reverse primer


372



GABRE probe


373



CDH3 forward primer


374



CDH3 reverse primer


375



CDH3 probe


376



FN1 forward primer


377



FN1 reverse primer


378



FN1 probe


379



TPO-1 forward primer


380



TPO-1 reverse primer


381



TPO-1 probe


382



TPO-2 forward primer


383



TPO-2 reverse primer


384



TPO-2 probe


385



KCNAB1-1 forward primer


386



KCNAB1-1 reverse primer


387



KCNAB1-1 probe


388



KCNAB1-2 forward primer


389



KCNAB1-2 reverse primer


390



KCNAB1-2 probe


391



FABP4-1 forward primer


392



FABP4-1 reverse primer


393



FABP4-1 probe


394



FABP4-2 forward primer


395



FABP4-2 reverse primer


396



FABP4-2 probe


397



DOI1-1 forward primer


398



DOI1-1 reverse primer


399



DOI1-1 probe


400



DOI1-2 forward primer


401



DOI1-2 reverse primer


402



DOI1-2 probe


403



B-ACTIN forward primer


404



B-ACTIN reverse primer


405



B-ACTIN probe


406



GOLGIN67 forward primer


407



GOLGIN67 reverse primer


408



GOLGIN67 probe


409



PAX8 forward primer


410



PAX8 reverse primer


411



PAX8 probe


412



HERC forward primer


413



HERC reverse primer


414



HERC probe


415



DDIT3 forward primer


416



DDIT3 reverse primer


417



DDIT3 probe


418



ITM1 forward primer


419



ITM1 reverse primer


420



ITM1 probe


421



C1OF24 forward primer


422



C1OF24 reverse primer


423



C1OF24 probe


424



MOT8 forward primer


425



MOT8 reverse primer


426



MOT8 probe


427



ARG2 forward primer


428



ARG2 reverse primer


429



ARG2 probe









Claims
  • 1. A method of diagnosing thyroid cancer comprising the steps: a. obtaining a biological sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.
  • 2. A method of differentiating between thyroid carcinoma and benign thyroid diseases comprising the steps: a. obtaining a sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid carcinoma.
  • 3. A method of testing indeterminate thyroid fine needle aspirate (FNA) thyroid nodule samples comprising the steps: a. obtaining a sample from a patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of thyroid cancer.
  • 4. A method of determining thyroid cancer patient treatment protocol comprising the steps: a. obtaining a biological sample from a thyroid cancer patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are sufficiently indicative of cancer to enable a physician to determine the type of surgery and/or therapy recommended to treat the disease.
  • 5. A method of treating a thyroid cancer patient comprising the steps: a. obtaining a biological sample from a thyroid cancer patient; and b. measuring the expression levels in the sample of genes selected from the group consisting of those encoding mRNA: i. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or ii. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or iii. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or iv. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 wherein the gene expression levels above or below pre-determined cut-off levels are indicative of cancer; and c. treating the patient with thyroidectomy if they are cancer positive.
  • 6. The method of one of claims 1-5 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.
  • 7. The method of one of claims 1-5 wherein the SEQ ID NOs. are 199, 207, 255 and 354.
  • 8. The method of one of claims 1-5 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.
  • 9. The method of one of claims 1-5 wherein the sample is prepared by a method are selected from the group consisting of fine needle aspiration, bulk tissue preparation and laser capture microdissection.
  • 10. The method of claim 9 wherein the bulk tissue preparation is obtained from a biopsy or a surgical specimen.
  • 11. The method of one of claims 1-5 further comprising measuring the expression level of at least one gene encoding mRNA: a. corresponding to SEQ ID NOs: 142, 219 and 309; and/or b. corresponding to SEQ ID NOs: 9, 12 and 18; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 130, 190 and 276 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 9, 12 and 18 as depicted in Table 25.
  • 12. The method of one of claims 1-5 further comprising measuring the expression level of at least one gene constitutively expressed in the sample.
  • 13. The method of one of claims 1-5 wherein the specificity is at least about 40%.
  • 14. The method of one of claims 1-5 wherein the specificity is at least about 50%.
  • 15. The method of one of claims 1-5 wherein the specificity is at least about 60%.
  • 16. The method of one of claims 1-5 wherein the sensitivity is at least at least about 90%.
  • 17. The method of one of claims 1-5 wherein the sensitivity is at least at least about 92%.
  • 18. The method of one of claims 1-5 wherein the comparison of expression patterns is conducted with pattern recognition methods.
  • 19. The method of claim 18 wherein the pattern recognition methods include the use of a Cox proportional hazards analysis.
  • 20. The method of one of claims 1-5 wherein the pre-determined cut-off levels are at least about 1.5-fold over- or under-expression in the sample relative to benign cells or normal tissue.
  • 21. The method of one of claims 1-5 wherein the pre-determined cut-off levels have at least a statistically significant p-value over-expression in the sample having thyroid carcinoma cells relative to benign cells or normal tissue.
  • 22. The method of claim 21 wherein the p-value is less than about 0.05.
  • 23. The method of one of claims 1-5 wherein gene expression is measured on a microarray or gene chip.
  • 24. The method of claim 23 wherein the microarray is a cDNA array or an oligonucleotide array.
  • 25. The method of claim 24 wherein the microarray or gene chip further comprises one or more internal control reagents.
  • 26. The method of one of claims 1-5 wherein gene expression is determined by nucleic acid amplification conducted by polymerase chain reaction (PCR) of RNA extracted from the sample.
  • 27. The method of claim 26 wherein said PCR is reverse transcription polymerase chain reaction (RT-PCR).
  • 28. The method of claim 27, wherein the RT-PCR further comprises one or more internal control reagents.
  • 29. The method of claim 28, wherein the internal control reagent is a method of detecting PAX8 gene expression
  • 30. The method of claim 29, wherein PAX8 gene expression is measured using SEQ ID NOs: 409-411.
  • 31. The method of one of claims 1-5 wherein gene expression is detected by measuring or detecting a protein encoded by the gene.
  • 32. The method of claim 31 wherein the protein is detected by an antibody specific to the protein.
  • 33. The method of one of claims 1-5 wherein gene expression is detected by measuring a characteristic of the gene.
  • 34. The method of claim 33 wherein the characteristic measured is selected from the group consisting of DNA amplification, methylation, mutation and allelic variation.
  • 35. A method of cross validating a gene expression profile for thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. randomizing sample order; c. setting aside data from about 10%-50% of samples; d. computing, for the remaining samples, for factor of interest on all variables and selecting variables that meet a p-value cutoff (p); e. selecting variables that fit a prediction model using a forward search and evaluating the training error until it hits a predetermined error rate; f. testing the prediction model on the left-out 10-50% of samples; g. repeating steps c., -g. with a new set of samples removed; and h. continuing steps c)-g) until 100% of samples have been tested and record classification performance.
  • 36. The method according to claim 35 wherein the gene expression data obtained in step h. is represented by genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or b. recognized specifically by the probe sets selected from the group consisting of psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.
  • 37. A method of independently validating a gene expression profile for thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. normalizing the source variabilities in the gene expression data; c. computing for factor of interest on all variables that were selected previously; and d. testing the prediction model on the sample and record classification performance.
  • 38. The method according to claim 37 wherein the gene expression data obtained in step d. is represented by genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363; or b. recognized specifically by the probe sets selected from the group consisting of psids in Table 25 corresponding to SEQ ID NOs: 1, 4, 7, 8, 10-11, 13-17, 19-24, 26-27, 29-31, 33-35, 37-38, 40-52, 54-72, 75-82, 84-135, 138-141, 144-151, 153-159, 161-162, 164, 166-173, 176-198, 200-201, 203-206, 208-209, 212-213, 215-218, 220-221, 223, 227-233, 235-241, 243-244, 246-249, 251, 253-254, 256-263, 265-289, 291-293, 295-308, 310-331, 333-341, 343-345, 347-348, 350-353 and 355-363.
  • 39. A gene profile obtained by the method according to claim 37 or 38.
  • 40. A method of generating a posterior probability score to enable diagnosis of thyroid carcinoma patients comprising the steps: a. obtaining gene expression data from a statistically significant number of patient biological samples; b. applying linear discrimination analysis to the data to obtain selected genes; c. applying weighted expression levels to the selected genes with discriminate function factor to obtain a prediction model that can be applied as a posterior probability score.
  • 41. The method according to claim 40, wherein the linear discriminant analysis is calculated using the equation:
  • 42. A method of generating a thyroid carcinoma prognostic patient report comprising the steps: a. obtaining a biological sample from the patient; b. measuring gene expression of the sample; c. applying a Relapse Hazard Score to the results of step b.; and d. using the results obtained in step c. to generate the report.
  • 43. The method of claim 42 wherein the report contains an assessment of patient outcome and/or probability of risk relative to the patient population.
  • 44. A patient report generated by the method according to claim 42.
  • 45. A composition comprising at least one probe set selected from the group consisting of: SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354; or the psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
  • 46. A kit for conducting an assay to determine thyroid carcinoma prognosis in a biological sample comprising: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
  • 47. The kit of claim 46 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.
  • 48. The kit of claim 46 wherein the SEQ ID NOs. are 199, 207, 255 and 354.
  • 49. The kit of claim 46 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.
  • 50. The kit of claim 46 further comprising reagents for conducting a microarray analysis.
  • 51. The kit of claim 46 further comprising a medium through which said nucleic acid sequences, their complements, or portions thereof are assayed.
  • 52. Articles for assessing thyroid carcinoma status comprising: materials for detecting isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25.
  • 53. The articles of claim 52 wherein the SEQ ID NOs. are 36, 53, 73, 211 and 242.
  • 54. The articles of claim 52 wherein the SEQ ID NOs. are 199, 207, 255 and 354.
  • 55. The articles of claim 52 wherein the SEQ ID NOs. are 45, 215, 65, 29, 190, 199, 207, 255 and 354.
  • 56. The articles of claim 52 further comprising reagents for conducting a microarray analysis.
  • 57. The articles of claim 52 further comprising a medium through which said nucleic acid sequences, their complements, or portions thereof are assayed.
  • 58. A microarray or gene chip for performing the method of one of claims 1-5.
  • 59. The microarray of claim 58 comprising isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma or risk of relapse in a biological sample.
  • 60. The microarray of claim 59 wherein the measurement or characterization is at least about 1.5-fold over- or under-expression.
  • 61. The microarray of claim 59 wherein the measurement provides a statistically significant p-value over- or under-expression.
  • 62. The microarray of claim 59 wherein the p-value is less than about 0.05.
  • 63. The microarray of claim 59 comprising a cDNA array or an oligonucleotide array.
  • 64. The microarray of claim 59 further comprising or more internal control reagents.
  • 65. A diagnostic/prognostic portfolio comprising isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes selected from the group consisting of those encoding mRNA: a. corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242; and/or b. corresponding to SEQ ID NOs: 199, 207, 255 and 354; or c. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 36, 53, 73, 211 and 242 as depicted in Table 25; and/or d. recognized specifically by the probe sets selected from the group consisting of psids corresponding to SEQ ID NOs: 199, 207, 255 and 354 as depicted in Table 25 where the combination is sufficient to characterize thyroid carcinoma status or risk of relapse in a biological sample.
  • 66. The portfolio of claim 65 wherein the measurement or characterization is at least about 1.5-fold over- or under-expression.
  • 67. The portfolio of claim 65 wherein the measurement provides a statistically significant p-value over- or under-expression.
  • 68. The portfolio of claim 65 wherein the p-value is less than about 0.05.
Provisional Applications (1)
Number Date Country
60683173 May 2005 US