Patent Application
20230392126
A computer readable form of the Sequence Listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The Sequence Listing is contained in the file created on Feb. 17, 2023 having the file name “16-1381-WO-US-CON.xml” and is 168,007 bytes in size.
This disclosure relates to genetically engineered tissue organoids capable of noninvasively reporting sensed biochemical signals in an individual and/or providing a therapeutic agent to the individual to monitor and/or treat a disease or improve an individual's health.
Obesity and diabetes are examples of acute and growing global health concerns that can require careful monitoring and therapeutic intervention (see Ahima, R. S. Digging deeper into obesity. J Clin Invest 121, 2076-2079, 2011). Diabetes, in particular, often requires daily monitoring of blood glucose levels. However, such constant blood monitoring can be inconvenient, time consuming, and painful.
In addition, there are numerous other diseases such as phenylketonuria, substance addiction, and heart disease, to name a few, that exhibit elevated blood concentrations of specific disease-associated indicators or blood factors (e.g., amino acids, illicit chemicals, proteins, lipids, enzymes, metabolites, etc.). However, while certain diseases like diabetes can require constant indicator monitoring (i.e., blood glucose levels), others may only require periodic monitoring such as once a week or once a month or may even only require sporadic, on-demand monitoring.
Recent advances in blood factor monitoring have provided improved options for individuals, such as diabetics needing to monitor blood glucose levels. For example, implantable glucose monitors enable diabetics to continuously monitor blood glucose levels remotely using compatible smart devices. Indeed, biointegrated sensors can address various monitoring challenges in medicine by transmitting a wide variety of biological signals, including electrophysiological, physiological, and biochemical information continuously (see Kim et al. Flexible and stretchable electronics for biointegrated devices. Annual review of biomedical engineering 14, 113-128, 2012).
Concomitant with the requirements of blood monitoring for some individuals is the need to receive therapeutic agents to counter the underlying disease causing the elevated concentrations of disease-associated indicators. For example, diabetic individuals often require insulin supplementation. Insulin supplementation is typically self-administered by injection, which similar to blood monitoring, can be inconvenient, difficult to remember, time consuming, and painful. Fortunately, as with advances in blood monitoring technology, new biointegrated devices are becoming available that provide greater convenience to individuals requiring periodic, self-administered monitoring and administration of therapeutic agents. For example, devices combining glucose monitors and insulin pumps are available that constantly monitor glucose levels and periodically deliver rapid- or short-acting insulin through a catheter, as required. Further, “smart insulin patches” are being developed that integrate thin polymeric platforms covered with needles with live beta cells.
There are still other diseases where proteins or metabolites are either non-functional or expressed at insufficient levels but do not increase concentrations of a particular, telltale, disease-associated indicator. For example, hemophilia A and hemophilia B are genetic diseases where individuals express insufficient amounts of clotting factors VIII and IX, respectively. Yet, hemophiliacs can be treated by replacing these missing clotting factors which can be harvested from human blood or made recombinantly.
While advancements in biointegrated device design and fabrication using novel nano-materials has greatly accelerated development for applications in vivo, including brain, heart, and skin (see Kim et al. and Choi et al. Recent Advances in Flexible and Stretchable Bio-Electronic Devices Integrated with Nanomaterials. Advanced materials 28, 4203-4218, 2016), the requisite biomechanical interfaces for these devices still remain problematic. For example, stability, biocompatibility, and potential infection from the implanted devices remain technically challenging to the field. Moreover, current biointegrated devices either require replacement of batteries and/or therapeutic agent reservoirs and/or must be replaced themselves once their useful lifespan has been reached.
In light of the foregoing, there is a need for improved, stable, and permanent means for constantly monitoring a disease state and/or administering therapeutic agents and that can be physiologically tailored for a specific individual.
Provided herein are physiologically-tailored tissue organoids and methods of their use for monitoring and treating diseases.
In a first aspect, the invention provides a physiologically-tailored tissue organoid that includes a plurality of genetically engineered cells including at least one recombinant gene encoding a reporter molecule. The reporter molecule produces a detectable signal when associated with and/or contacting a predetermined blood factor. In one embodiment, tissue organoid includes a stratified skin graft grown from cells taken from an individual. In another embodiment, the tissue organoid includes a cultured skin graft grown from embryonic stem cells, human induced pluripotent stem cells, epidermal stem cells, or keratinocytes. In one embodiment, when the tissue organoid is biontegrated into an individual, the tissue organoid expresses the reporter molecule in proportion to a concentration of a blood factor in the individual's blood. In a further embodiment, the blood factor includes a cell, an enzyme, a protein, a polypeptide, an amino acid, a polynucleotide, a nucleic acid, a sugar, a lipid, a metabolite, a synthetic chemical compound, a naturally occurring chemical compound, a mineral, a metal, a bacterium, a virus, a prion, a disease indicator, or combinations thereof. In one embodiment, the physiologically-tailored tissue organoid is biointegrated into an individual. The individual can be an animal.
In a second aspect, the invention provides a physiologically-tailored tissue organoid includes a plurality of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent. When the therapeutic agent is administered to an individual in need thereof, the therapeutic agent improves the individual's health. In one embodiment, the therapeutic agent comprises an enzyme, a protein, a clotting factor, a vitamin, a peptide, a lipid, a toxin, or a combination thereof. In another embodiment, expression of the therapeutic agent is inducible by an inducer. The inducer can be one or more of heat, cold, light, a protein, a hormone, a lipid, a chemical, a metabolic change, an electric potential or field, and combinations thereof. In one embodiment, when expression of the therapeutic agent is induced, the therapeutic agent is released into the individual's circulation. In another embodiment, the physiologically-tailored tissue organoid can biointegrated into an individual. The individual can be an animal. The predetermined blood factor can be glucose.
In a third aspect, the invention provides a physiologically-tailored tissue organoid including a plurality of genetically engineered cells comprising at least one recombinant gene encoding a reporter molecule and at least one recombinant gene encoding a therapeutic agent. The therapeutic agent is expressed as a function of expression of the reporter molecule.
In a fourth aspect, the invention provides a method of monitoring a blood factor including biointegrating a tissue organoid according to any of the preceding aspects or embodiments into an individual and detecting a detectable signal produced by a reporter molecule expressed by the tissue organoid in response to a blood factor. The detectable signal is proportional to a concentration of the blood factor in the individual. In one embodiment of the method, the tissue organoids are biointegrated into an individual by grafting or surgical implantation. In another embodiment of the method, the detectable signal is detected by one or more of a fluorometer, a colorimeter, a bioluminescence monitoring system, and an electrical system with proper electrodes.
In a fifth aspect, the invention provides a method of treating a disease in an individual in need thereof. The method includes biointegrating a tissue organoid according to any of the preceding aspects or embodiments into an individual and administering a therapeutic agent to the individual. In one embodiment, the individual is a human.
In a sixth aspect, the invention provides a physiologically-tailored tissue organoid includes a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent. The therapeutic agent comprises at least one of mGLP1 and hBChE, and when the therapeutic agent is administered to an individual in need thereof, the therapeutic agent improves the individual's health. In one embodiment, the therapeutic agent improves the individual's health by reducing the individual's seeking and/or consumption of at least one of nicotine, alcohol, cocaine, and amphetamine.
In a seventh aspect, the invention provides a method of treating cocaine addiction in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises hBChE. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, hBChE is expressed constitutively or by induction with an inducer. In one embodiment, the expression of hBChE hydrolyzes cocaine in the blood of the individual. In one embodiment, the expression of hBChE causes decreased cocaine seeking and/or consumption by the individual.
In an eighth aspect, the invention provides a method of treating AUD in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, the mGLP1 or the analog thereof is expressed constitutively or by induction with an inducer. In one embodiment, the expression of mGLP1 or the analog thereof causes decreased alcohol seeking and/or consumption by the individual.
In a ninth aspect, the invention provides a method of treating nicotine addiction in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, mGLP1 or the analog thereof is expressed constitutively or by induction with an inducer. In one embodiment, the expression of mGLP1 or the analog thereof causes decreased nicotine seeking and consumption by the individual.
In a tenth aspect, the invention provides a method of treating amphetamine addiction in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, mGLP1 or the analog thereof is expressed constitutively or by induction with an inducer. In one embodiment, the expression of mGLP1 causes decreased amphetamine seeking and consumption by the individual.
In an eleventh aspect, the invention provides a method of treating obesity in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises peptide tyrosine tyrosine (PYY) or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, PYY or the analog thereof is expressed constitutively or by induction with an inducer. In one embodiment, the expression of PYY causes decreased food seeking and consumption by the individual.
In a twelfth aspect, the invention provides a method of treating the effects of aging in an individual in need thereof, the method including contacting a tissue organoid to the individual, the tissue organoid comprising a population of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises tissue inhibitor of metalloproteinases 2 (TIMP2) or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, TIMP2 or the analog thereof is expressed constitutively or by induction with an inducer. In one embodiment, the expression of TIMP2 causes a decrease in the negative effects of aging in an individual. In one embodiment, the negative effects of aging include memory loss, reduced vascular response, and/or reduced immune response.
These and other features and advantages of the present invention will be more fully understood from the following detailed description taken together with the accompanying claims. It is noted that the scope of the claims is defined by the recitations therein and not by the specific discussion of features and advantages set forth in the present description.
All publications, patents, and patent applications cited herein are hereby expressly incorporated by reference in their entirety for all purposes.
Before describing the present invention in detail, a number of terms will be defined. As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, reference to “a metabolite” means one or more metabolites.
It is noted that terms like “preferably,” “commonly,” and “typically” are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention. Rather, these terms are merely intended to highlight alternative or additional features that can or cannot be utilized in a particular embodiment of the present invention.
For the purposes of describing and defining the present invention it is noted that the term “substantially” as used herein represents the inherent degree of uncertainty that can be attributed to any quantitative comparison, value, measurement, or other representation. The term “substantially” is also used herein to represent the degree by which a quantitative representation can vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.
Methods well known to those skilled in the art can be used to construct genetic expression constructs, targeting vectors, and genetically engineered cells according to this invention. These methods include in vitro recombinant DNA techniques, synthetic techniques, in vivo recombination techniques, polymerase chain reaction (PCR) techniques, and others. See, for example, techniques as described in Green & Sambrook, 2012, MOLECULAR CLONING: A LABORATORY MANUAL, Fourth Edition, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1989, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Associates and Wiley Interscience, New York, and PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990, Academic Press, San Diego, CA).
As used herein, the terms “polynucleotide,” “nucleotide,” “oligonucleotide,” and “nucleic acid” can be used interchangeably to refer to nucleic acid comprising DNA, RNA, derivatives thereof, or combinations thereof.
As used herein, the term “genetically engineered” refers to the genetic manipulation of one or more cells, whereby the genome of the one or more cells has been augmented by at least one DNA sequence. Candidate DNA sequences include but are not limited to genes that are not naturally present, DNA sequences that are not normally transcribed into RNA or translated into a protein (“expressed”), and other genes or DNA sequences which one desires to introduce into the one or more cells. It will be appreciated that typically the genome of genetically engineered cells described herein is augmented through stable introduction of one or more recombinant genes. Generally, introduced DNA is not originally resident in the genetically engineered cell that is the recipient of the DNA, but it is within the scope of this disclosure to isolate a DNA segment from a given genetically engineered cell, and to subsequently introduce one or more additional copies of that DNA into the same genetically engineered cell, e.g., to enhance production of the product of a gene or alter the expression pattern of a gene. In some instances, the introduced DNA will modify or even replace an endogenous gene or DNA sequence by, e.g., homologous recombination, site-directed mutagenesis, and/or genome editing technology, including CRISPR (clustered regularly-interspaced short palindromic repeats), and/or mammalian transposon technology, such as by using the piggyBac™ transposon. In some instances, the introduced DNA is introduced into the recipient via viral vectors, including vectors derived from retrovirus, lentivirus, and adeno-associated virus. In some instances, the introduced DNA is introduced into the recipient skin directly with electroporation without skin stem cell isolation, culture, CRISPR editing, or grafting.
As used herein, the term “recombinant gene” refers to a gene or DNA sequence that is introduced into a genetically engineered cell, regardless of whether the same or a similar gene or DNA sequence may already be present in such a host. “Introduced,” or “augmented” in this context, is known in the art to mean introduced or augmented by the hand of man. Thus, a recombinant gene can be a DNA sequence from another species, or can be a DNA sequence that originated from or is present in the same species, but has been incorporated into a cell by methods to form a genetically engineered cell. It will be appreciated that a recombinant gene that is introduced into a cell can be identical to a DNA sequence that is normally present in the cell being transformed, and is introduced to provide one or more additional copies of the DNA to thereby permit overexpression or modified expression of the gene product of that DNA. Recombinant genes can also be introduced with different driving promoters or associated sequences that can alter the gene's expression level or pattern. Said recombinant genes are particularly encoded by cDNA. Non-coding sequences, such as short hairpin RNAs, microRNAs, or long non-coding RNAs, may also be included.
It is further contemplated that recombinant genes can be codon optimized to maximize protein expression in genetically engineered cells by increasing the translation efficiency of a particular gene. Codon optimization can be achieved, for example, by transforming nucleotide sequences of one species into the genetic sequence of a different species. Optimal codons help to achieve faster translation rates and high accuracy. As a result of these factors, translational selection is expected to be stronger in highly expressed genes. However, while optimal codon usage is contemplated herein for expression of disclosed proteins, all possible codons are contemplated for use herein for nucleic acids encoding any disclosed protein.
As used herein, the term “about” refers to ±10% of any particular value.
As used herein, the terms “or” and “and/or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and/or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”
As used herein, the term “blood factor” refers to any specific disease-associated indicator or factor that can circulate in the body, such as in the blood and/or lymphatic system. For example, a blood factor can be, without limitation, a cell, an enzyme, a protein, a polypeptide, an amino acid, a polynucleotide, a nucleic acid, a sugar, a lipid, a metabolite, a synthetic chemical compound, a naturally occurring chemical compound, a mineral, a metal, a bacterium, a virus, a prion, a disease indicator, and combinations or variations thereof.
As used herein, the term “reporter molecule” refers to any compound that can be produced biosynthetically by a genetically engineered host cell. For example, a reporter molecule can be an enzyme, a protein, a polypeptide, an amino acid, a polynucleotide, a nucleic acid, a sugar, a lipid, a metabolite, a synthetic chemical compound, a naturally occurring chemical compound, and combinations thereof. In one particular example, a reporter molecule can be a fluorescent protein, a fret-based biosensor, and/or a bioluminescent protein.
In one embodiment, the reporter molecule can be inducibly expressed, such as when a blood factor is perceived by the tissue organoid. Induction of expression can also be caused by administration of an inducer, as described herein elsewhere. When expressed by induction, the increased concentration of the reporter molecule functions to “report” the presence of the blood factor in question by producing a detectable signal. “Reporting” can be by any detectable means, such as, for example, fluorescing, producing a FRET signal, producing an electrical signal, and/or undergoing a conformational change.
Alternatively, a reporter molecule can be constitutively expressed but only “reports” when a signal produced by the reporter molecule is changed as a function of the perception of a blood factor by the reporter molecule. In this context, a change (increase or decrease) in signal can be proportionally associated with an increase in concentration of the blood factor.
In one embodiment, an external measurement device targeted at a tissue organoid expressing a reporter molecule can be used to noninvasively measure the relative amount of a blood factor in the patient. In one embodiment, it is contemplated that the reporter molecule can directly or indirectly associate with or contact a blood factor to produce a detectable signal that is proportional to the concentration of the blood factor in individual.
As used herein, the term “therapeutic agent” refers to a substance that when administered to an individual in need thereof, improves the individual's health. For example, a therapeutic agent can be, without limitation, an enzyme, a protein, a clotting factor, a vitamin, a peptide, a lipid, a toxin, a hormone, a polysaccharide, and combinations thereof. In one particular example, a therapeutic agent can be insulin or an analogue thereof that when administered to an individual in need thereof improves the individual's health by regulating the individual's blood sugar levels. In another particular example, a therapeutic agent can be a hormone, such as GLP1, that when administered to an individual in need thereof improves an individual's health by inducing the individual's satiety response, for example, to help regulate food intake. In a further particular example, a therapeutic agent can be an enzyme, such as phenylalanine hydroxylase (PAH), that when administered to an individual in need thereof improves an individual's health by reducing the concentration of phenylalanine in the patient's blood. Moreover, a therapeutic agent can be any compound that can be produced biosynthetically by a genetically engineered host cell, such as an epidermal cell. Therapeutic agents can include proteins and other substances derived from one species and administered to another species in native and/or modified forms.
As used herein, the term “individual” refers to any animal. Examples of individuals include humans, domesticated animals, household pets, and other animals without limitation. Further examples of individuals include animals having a disease.
As used herein, the term “physiologically tailored” refers to a state in which a tissue organoid has been created to be physiologically and/or immunologically compatible with an individual. For example, a physiologically tailored tissue organoid can be a tissue organoid grown from an individual's own cells or from cells that are physiologically compatible and that do not trigger an immune response from the individual when the individual's immune system is exposed to the tissue organoid, such as when the tissue organoid is surgically grafted into or onto the individual or otherwise biointegrated.
As used herein, the term “tissue organoid” refers to a collection of cells forming a tissue that has been genetically modified and that can be biointegrated in vivo via surgical transplantation or grafting (for example, on an individual's skin). For example, a tissue organoid can be a cultured, stratified skin graft grown from genetically engineered stem cells or keratinocytes taken from an individual. In addition to in vitro construction, it is envisioned that tissue organoids could be constructed in situ on an individual.
The cultured skin graft can be engineered to express one or more proteins or other molecules of interest under predetermined conditions, such as in response to the presence, absence, or change in levels of one or more blood factors. The protein or other molecule of interest can be a reporter molecule, a therapeutic agent, an inducer, and/or any other molecule or compound that can be produced biosynthetically by a genetically engineered host cell.
As used herein, the term “inducer” refers to a physical stimulus and/or chemical stimulant that induces expression of one or more genes within a tissue organoid and/or activation and/or release of a reporter molecule or therapeutic agent from a tissue organoid. Non-exclusive examples of inducers can include heat, cold, light, a protein, a peptide, a hormone, a lipid, a chemical, a metabolic change, a metabolite, an electric potential or field, and combinations thereof. Specific examples of inducers include doxycycline, a reporter molecule, and ethanol. It is further contemplated that inducers can induce expression and/or release of a reporter molecule or therapeutic agent in a dose-dependent manner.
In one embodiment, the present disclosure is directed to a physiologically tailored, biointegratable tissue organoid that can monitor levels of one or more blood factors in an individual. The tissue organoid can be transplanted or grafted onto the individual to provide a permanent or temporary (e.g., for one, two, three, six, twelve, or sixty months or longer) continuous monitor of one or more blood factors and/or source of therapeutic agent(s). For example, the tissue organoid can be a fully stratified skin graft cultured from the individual's own epidermal stem cells that is surgically grafted onto the individual's skin. Once biointegrated into the patient's skin, the tissue organoid forms a part of the patient's skin thereby preventing potential infections by eliminating the need for piercing the skin to monitor blood factor concentration. Further, because the tissue organoid is derived from the patient's own cells, the risk of host rejection of the tissue organoid is reduced.
Tissue organoids when biointegrated are nourished like any other tissue of the individual and concomitantly are exposed to circulating blood factors. In this context, tissue organoids can be genetically engineered to carry one or more stable genetic modifications (e.g., genome-integrated modifications) such as one or more genes encoding a reporter molecule that are expressed when a blood factor is perceived by or comes in contact with the tissue organoid.
In another embodiment, a reporter molecule can be constitutively expressed within the tissue organoid but only “reports” by producing a detectable signal (e.g., fluoresces, produces a FRET signal, produces an electrical signal, bioluminesces, produces a colorimetric change, and/or undergoes a conformational change) when associated with and/or contacting a predetermined blood factor. It is contemplated that the reporter molecule may directly or indirectly associate with or contact a blood factor to produce a detectable signal. External measurement devices targeted at the tissue organoid can be used to noninvasively measure the relative amount of perceived blood factor in the patient. In another embodiment, it is contemplated that reporter molecules produced by the tissue organoid are released systemically and can therefore be detected in another part of the body.
In one specific embodiment, a contemplated tissue organoid is a blood glucose monitor that expresses a reporter molecule in proportion to the relative blood glucose concentration of an individual. For example, the tissue organoid can express a fluorescent or bioluminescent reporter protein in relative proportion to glucose blood concentrations. The relative amount of the reporter protein can externally be measured, such as by a fluorometer or colorimeter and the concentration of the blood factor can therefore be determined. It is further contemplated that an inverse relationship between a reporter molecule and a particular blood factor is possible such that the relative amount of reporter molecule decreases in response to an increase in the blood factor concentration.
It is further contemplated that a tissue organoid could produce a reporter molecule that can be detected by measuring the reporter molecule in sweat, tears, mucus, plasma, urine, feces, or combinations thereof.
In another embodiment, the present disclosure is directed to a physiologically tailored, biointegratable tissue organoid that can express a therapeutic agent that passes the epidermal/dermal barrier to reach the circulation and have a therapeutic effect.
In a specific embodiment, the tissue organoid can be induced to express a therapeutic agent constitutively or by administration of an inducer to the individual. For example, a tissue organoid can express GLP1 upon stimulation with an inducer, such as doxycycline in a dose-dependent manner. In this way, the amount of therapeutic agent expressed by a tissue organoid can be tailored to an individual's specific need at a particular time.
In one embodiment, a tissue organoid expresses both a reporter molecule and a therapeutic agent.
Genetic Constructs
Tissue organoids can include genetically engineered cells capable of expressing reporter molecules and/or therapeutic agents. Genes encoding reporter molecules and/or therapeutic agents can be stably introduced into the genomes of cells using any technology that permits genome editing, such as CRISPR. However, other approaches are contemplated herein. When using CRISPR for genetically engineering cells, any integration locus suitable for genome editing can be used. Examples of integration loci include AAVSI (adeno-associated virus integration site 1), HPRT1 (hypoxanthine phosphoribosyltransferase-1), and/or human Rosa26 locus. Use of the HPRT1 locus offers the advantage that correctly integrated cells can be selected based on their resistance to 6-TG (2-amino-6-captopurine). Further, CRISPR targeting vectors can incorporate a drug resistance gene (puromycin; “puro”) for cell selection, which may elicit an immune reaction in vivo. If this occurs, the targeting vector could be modified so that a puro coding sequence would be flanked with two LoxP sites. The puro sequence can be removed in vitro by transient expression of Cre recombinase after selection of targeted clones.
Cell Selection and Tissue Growth
Suitable cells that can be used for tissue organoid construction include epidermal stem cells, such as those isolated from human skin. Other sources for epidermal stem cells include induced human pluripotent stem cells. Further examples of suitable cells include embryonic stem cells and human induced pluripotent stem cells.
Once isolated, the stem cells can be transfected with a targeting vector carrying one or more reporter molecule coding genes and/or one or more therapeutic agent coding genes and selected for correct integration of the targeting vector by Southern blot and other available methods. Correctly integrated genetically engineered epidermal stem cells can then be induced to differentiate to form stratified skin tissue when seeded on decellularized dermis and exposed to an air/liquid interface within a cell culture insert. Once grafts are ready, they can be transplanted to donor patients with well-established protocols.
Transplantation
Tissue organoids can be implanted into skin of individuals via known surgical procedures, such as skin grafting. Other suitable procedures include direct application of engineered skin stem cells to patient skin. Once implanted, the tissue organoids can be allowed to heal and fully biointegrate into the individual's skin.
Reporter Molecule Detection
Detection of reporter molecules of biointegrated tissue organoids can be performed by any means known in the art suitable for detecting the reporter molecule to be measured. For example, fluorometers and/or colorimeters can be used to measure changes in fluorescence, color, or luminescence associated with reporter molecule expression. Further, intravital bioluminescence imaging can be performed using a bioluminescence monitoring system, such as Xenogen. Additional examples of measurement devices that can be used to measure reporter molecules include electrical systems with proper electrodes.
Tissue Organoid Standardization
Once a tissue organoid is biointegrated into an individual, for example, a blood glucose monitoring tissue organoid, the response of the organoid to blood glucose concentrations can be standardized such that a given reporter response is indicative of a specific blood glucose concentration. This can be accomplished by measuring different blood glucose concentrations using a standard blood glucose meter and associating the specific concentrations measured with the relative reporter molecule signals at each concentration. One example of such as standardization test is the intraperitoneal glucose tolerance test. Similar clinical standardization techniques can be performed for tissue organoids that are engineered to detect other specific blood factors. It is envisioned that once the tissue organoid “readout” is correlated to blood factor concentration, no further direct blood testing will be necessary.
Therapeutic Platform Development
The present disclosure is also directed to tissue organoids for treating multiple medical issues simultaneously or as needed. For example, a physiologically tailored, biointegratable tissue organoid is envisioned that can express one or more therapeutic agents designed to address an individual's specific medical needs and thereby form a biointegratable therapeutic platform. For example, therapeutic platforms can be designed to express multiple therapeutic agents such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or more therapeutic agents at one time or at different times depending upon an individual's needs. For example, each therapeutic agent to be expressed by the therapeutic platform can be individually and separately induced by an inducer such that for each therapeutic agent to be expressed, a separate inducer must be introduced to cause expression of the therapeutic agent. Alternatively, therapeutic agents that could advantageously be expressed at the same time, such as 2 or more therapeutic agents, can each be inducible by the same inducer.
Further, while some embodiments described herein are directed to expression of therapeutic agents for treatment of an existing illness, disease, and/or deficiency or absence of a required physiological substance (e.g., an enzyme, a protein, a clotting factor, a vitamin, a peptide, a lipid, etc.), it is further envisioned that a therapeutic agent can be expressed in anticipation of a physiological insult or stress. For example, tissue organoids made to express a therapeutic agent to counter the effects of a harmful chemical or substance could be induced to express the therapeutic agent in anticipation of exposure to the harmful chemical. In this way, the therapeutic agent has been expressed in the individual before the harmful chemical or substance is encountered by the individual. In another example, tissue organoids can be made to express a therapeutic agent in anticipation of blood loss, a low oxygen environment, and/or other physiological insult.
In another embodiment, the present disclosure is directed to physiologically tailored, biointegratable tissue organoids that can express therapeutic agents with multiple therapeutic effects. For example, a tissue organoid can be designed to express a single therapeutic agent, such as GLP1 that can be used to combat both alcohol abuse and nicotine abuse.
In one particular embodiment, it is envisioned that a tissue organoid designed to express GLP-1 (an anti-alcohol and anti-nicotine therapeutic agent) and BChE (an anti-cocaine therapeutic agent) can be biointegrated into an individual suffering from substance abuse or that is at risk for a relapse to eliminate or minimize the addictive effects of alcohol, nicotine, and cocaine at the same time.
In a further embodiment, GLP-1 analogs are contemplated for use herein. For example, contemplated analogs for use herein include Exendin-4 and Exendin-based therapies (e.g., Exenatide and Exenatide LAR), DPP-IV-resistant GLP-1 analogs (e.g., albiglutide), semaglutide (NN9535), liraglutide, taspoglutide, dulaglutide (GLP-1Fc, Trulicity®) (LY2189265), and derivatives thereof (see Gupta, V. Glucagon-like peptide-1 analogues: An overview, Indian J Endocrinol Metab. 17(3): 413-421 (2013)).
Relatedly, it is envisioned that pharmaceutical compositions including one or more inducers can be administered to an individual to cause expression of one or more therapeutic agents that are inducible by the administered inducers. For example, a formulation in a pharmaceutically-acceptable form, such as an oral, parenteral, inhalable, and/or topical medication, can contain 2 or more inducers each specific for a separate therapeutic agent to be expressed by a tissue organoid. In this way, tissue organoids can be designed to express multiple therapeutic agents and tailored therapeutic agent expression can be obtained.
In one particular example, a tissue organoid can be biointegrated into an individual where the tissue organoid is designed to express 5 different therapeutic agents, TA1, TA2, TA3, TA4, and TA5, each upon induction by a separate inducer, I1, I2, I3, I4, and I5, respectively. When needed, the individual can be administered a pharmaceutical composition including inducers I2, I3, and I5, for example, which causes expression of therapeutic agents TA2, TA3, and TA5. Alternatively, the individual can be administered a pharmaceutical composition including inducers I1, I2, and I4, for example, which causes expression of therapeutic agents TA1, TA2, and TA4. Multiple variations of therapeutic agent induction are envisioned without limitation. Moreover, multiple variations of pharmaceutical dosage forms are contemplated such as immediate release, delayed release, and/or extended release forms. In this way, a particular pharmaceutical composition can include, for example, inducers I1, I2, I3, I4, and I5, where inducers I1 and I5 are formulated for immediate release, inducers I2 and I3 are formulated for delayed release, and inducer II4 is formulated for extended release. Additional dosage forms such as implantable depots are contemplated. Combinations of any inducers in any dosage form or formulation are contemplated herein without limitation.
It is further envisioned that a tissue organoid can be designed to express multiple therapeutic agents where expression of one or more of the therapeutic agents is inducible and expression of one or more of the therapeutic agents is constitutive.
It is further envisioned that a tissue organoid can be cultured that include multiple populations of transformed cells where each population is designed to express a different therapeutic agent than the other populations within the tissue organoid. Any number of separate populations of cells is envisioned.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
The Examples that follow are illustrative of specific embodiments of the invention, and various uses thereof. They are set forth for explanatory purposes only and are not taken as limiting the invention.
Current integrated biosensors exhibit limitations in stability, biocompatibility, and increased risk of infection. One possibility to overcome these limitations is to transform a small portion of endogenous tissue into a biointegrated, long-lasting sensor for physiological and biochemical signals via genome editing technology (see Hsu et al. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278 (2014); Maeder et Genome-editing Technologies for Gene and Cell Therapy. Mol Ther 24, 430-446 (2016); and Wright et al. Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering. Cell 164, 29-44 (2016)). In this regard, the human skin and skin epidermal stem cells (see Blanpain et al. Epidermal stem cells of the skin. Annu Rev Cell Dev Biol 22, 339-373 (2006) and Watt, F. M. Mammalian skin cell biology: at the interface between laboratory and clinic. Science 346, 937-940 (2014)) have several unique advantages, making them particularly suited for genetic engineering and applications in vivo (
The procedure to isolate and culture primary epidermal stem cells is well established. Cultured epidermal stem cells can be induced to stratify and differentiate in vitro, and transplantation of epidermal autografts is minimally invasive, safe, and stable in vivo. Autologous skin grafts have been clinically used for treatment of burn wounds for decades (see Carsin, H. et al. Cultured epithelial autografts in extensive burn coverage of severely traumatized patients: a five year single-center experience with 30 patients. Burns: journal of the International Society for Burn Injuries 26, 379-387 (2000) and Coleman et al. Cultured epidermal autografts: a life-saving and skin-saving technique in children. Journal of pediatric surgery 27, 1029-1032 (1992)). In this example, tissue organoids derived from genome-edited epidermal stem cells are shown to be useful for continuous monitoring of blood glucose level in vivo.
Reagents and Plasmid DNA Constructions
Guinea pig anti K5, rabbit anti K14, rabbit anti K10 and Loricrin antibodies were generous gifts from Dr. Elaine Fuchs at the Rockefeller University. Rat monoclonal β4-integrin (CD104, BD 553745) was obtained from BD Pharmingen® (Franklin lakes, NJ). Ser10 pho-histone antibody was obtained from EMD Millipore® (06-570, Billerica, MA). Cleaved caspase-3 antibody was obtained from Cell Signaling Technology® (#9661, Danvers, MA). Insulin ELISA kit was obtained from EMD Millipore® Corp. (EZRMI-13K, Billerica, MA). GLP-1 ELISA kit was obtained from Sigma® (RAB0201-1kt, St. Louis, MO). Other chemicals or reagents were obtained from Sigma®, unless otherwise indicated.
Lentiviral vector encoding Luciferase (SEQ ID NO: 1) and H2B-RFP (SEQ ID NO: 2) has been described before (Liu et al., 2015; Yue, 2016). Plasmid encoding hCas9-D10A mutant was a gift from George Church, obtained from Addgene (plasmid #41816). Plasmid encoding gRNA expression cassette was constructed with primers: AAG GAA AAA AGC GGC CGC TGT ACA AAA AAG CAG G (SEQ ID NO: 3); and gGA ATT CTA ATG CCA ACT TTG TAC (SEQ ID NO: 4), using gBlock as a template. Rosa26-targeting gRNA is constructed with primers: ACA CCG GCA GGC TTA AAG GCT AAC CG (SEQ ID NO: 5), AAA ACG GTT AGC CTT TAA GCC TGC CG (SEQ ID NO: 6), ACA CCG AGG ACA ACG CCC ACA CAC Cg (SEQ ID NO: 7), AAA ACG GTG TGT GGG CGT TGT CCT CG (SEQ ID NO: 8). AAVS1-targeting gRNA is constructed with primers: ACA CCG TCA CCA ATC CTG TCC CTA GG (SEQ ID NO: 9), AAA ACC TAG GGA CAG GAT TGG TGA CG (SEQ ID NO: 10), ACA CCG CCC CAC AGT GGG GCC ACT AG (SEQ ID NO: 11), AAA ACT AGT GGC CCC ACT GTG GGG CG (SEQ ID NO: 12). Rosa26 targeting vector is constructed with pRosa26-GT as template (a gift from Liqun Luo, addgene plasmid 40025) using primers: GAC TAG TGA ATT CGG ATC CTT AAT TAA GGC CTC CGC GCC GGG TTT TGG CG (SEQ ID NO: 13), GAC TAG TCC CGG GGG ATC CAC CGG TCA GGA ACA GGT GGT GGC GGC CC (SEQ ID NO: 14), CGG GAT CCA CCG GTG AGG GCA GAG GAA GCC TTC TAA C (SEQ ID NO: 15), TCC CCC GGG TAC AAA ATC AGA AGG ACA GGG AAG (SEQ ID NO: 16), GGA ATT CAA TAA AAT ATC TTT ATT TTC ATT ACA TC (SEQ ID NO: 17), CCT TAA TTA AGG ATC CAC GCG TGT TTA AAC ACC GGT TTT ACG AGG GTA GGA AGT GGT AC (SEQ ID NO: 18). AAVS1 targeting vector (SEQ ID NO: 40) was constructed with AAVS1 hPGK-PuroR-pA donor (a gift from Rudolf Jaenisch, addgene plasmid 22072) as template using primers: CCC AAG CTT CTC GAG TTG GGG TTG CGC CTT TTC CAA G (SEQ ID NO: 19), CCC AAG CTT CCA TAG AGC CCA CCG CAT CCC C (SEQ ID NO: 20), CAG GGT CTA GAC GCC GGA TCC GGT ACC CTG TGC CTT CTA GTT GC (SEQ ID NO: 21), GGA TCC GGC GTC TAG ACC CTG GGG AGA GAG GTC GGT G (SEQ ID NO: 22), CCG CTC GAG AAT AAA ATA TCT TTA TTT TCA TTA CAT C (SEQ ID NO: 23), GCT CTA GAC CAA GTG ACG ATC ACA GCG ATC (SEQ ID NO: 24). Genotyping primers for CRISPR mediated knockin: GAG CTG GGA CCA CCT TAT ATT C (SEQ ID NO: 25), GGT GCA TGA CCC GCA AG (SEQ ID NO: 26), GAG AGA TGG CTC CAG GAA ATG (SEQ ID NO: 27).
Culture of Mouse and Human Primary Keratinocytes
Primary mouse keratinocytes were isolated from the epidermis of newborn mice using trypsin, after prior separation of the epidermis from the dermis by an overnight dispase treatment. Keratinocytes were plated on mitomycin C-treated 3T3 fibroblast feeder cells until passage 3. Cells were cultured in E-media supplemented with 15% serum and a final concentration of 0.05 mM Ca2+.
Primary human neonatal epidermal keratinocytes were obtained from Thermo Fischer® (C0015C), and cultured with Epilife® medium (Thermo Fischer, M-EPICF-500) with manufacturer's recommended procedures. Calcium shift was performed to induce differentiation of primary keratinocytes by increasing the calcium concentration in culture media to 1.5 mM.
Cells are routinely screened for the presence of mycoplasma using the ATCC Universal Mycoplasma Detection Kit (Catalogue #30-1012K). Cells are screened every 6 months and any mycoplasma contamination will result in the cells being discarded and replaced with previous, mycoplasma-free passages.
Cell Cycle Analysis:
Propidium iodide (PI) staining followed by flow cytometry were used to determine the effect of cell cycle profiles. Mouse and human epidermal cells were cultured in two 6 cm cell culture dish for 24 hours, respectively. Cells were trypsinized, and 1×105 cells from each dish were collected, followed by one PBS wash. Fixation of cells was carried out using 70% (v/v) ice cold ethanol for 1 hour. Then, the fixed cells were centrifuged at 500 g at 4° C. for 10 minutes, followed by PBS wash for two times. The cells were then treated with 75 μg RNAse A in 100 μL PBS and incubated at 37° C. for 1 hour. After incubation, the cells were collected by centrifuging at 500 g at 4° C. for 10 minutes, followed by another PBS wash. The cell pellet was re-suspended in 200 μL PBS, in addition of PI solution at a final concentration of 25 ng/μL. After staining, the cells were analyzed immediately using flow cytometer BD FACSCanto™ II (BD Biosciences, San Jose, CA) with an excitation wavelength at 488 nm and emission at 585 nm. DNA content and histograms of cell cycle distribution were analyzed using FlowJo™ software, version 10 (FLOWJO LLC, OR).
Protein Biochemical Analysis
Western blotting was performed as described previously (Blanpain et al.). Briefly, equal amounts of the cell lysates were separated on a SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted onto a nitrocellulose membrane. The immunoblot was incubated with Odyssey® blocking buffer (Li-Cor) at room temperature for 1 h, followed by an overnight incubation with primary antibody. Blots were washed three times with Tween 20/Tris-buffered saline (TBST) and incubated with a 1:10000 dilution of secondary antibody for 1 h at room temperature. Blots were washed three times with TBST again. Visualization and quantification was carried out with the LI-COR Odyssey® scanner and software (LI-COR Biosciences).
Skin Organoid Culture and Transplantation
Decellularized dermis (circular shape with 1 cm diameter) was prepared by EDTA treatment of newborn mouse skin (Maeder et al.). An aliquot containing 1.5×106 cultured keratinocytes was seeded onto the dermis in cell culture insert. After overnight attachment, the skin culture was exposed to air/liquid interface.
For grafting with skin organoids, CD1 (isogenic mouse keratinocyte transplantation) males or Nude (human keratinocyte transplantation) females with the ages of 6-8 weeks were anesthetized. A silicone chamber bottom with the interior diameter of 0.8 cm and the exterior diameter of 1.5 cm was implanted on its shaved dorsal mid-line skin, which was used to hold the skin graft. A chamber cap was installed to seal the chamber right after a piece of graft was implanted. About one week later, the chamber cap was removed to expose the graft to air. A single dose of 0.2 mg α-CD4 (GK1.5) and 0.2 mg α-CD8 (2.43.1) antibodies was administered intraperitoneally for skin grafting.
Obesity Induced by High Fat Diet and Glucose Tolerance Test
Male CD-1 mice with skin transplants were housed (5 per cage, ˜8 weeks old) in a central-controlled animal facility for air, humidity and temperature. These mice were fed either a regular chow or an HFD (60% kcal from fats, 20% from carbohydrates, and 20% from proteins) purchased from Bio-Serv (Frenchtown, NJ). Body weight and food intake were measure biweekly.
For glucose tolerance testing, an intraperitoneal glucose tolerance test (IPGTT) was performed on mice fed an HFD for 10 weeks. Mice were fasted for 6 h before the test. Animals were injected (1 g/kg glucose/body weight, i.p.) with glucose dissolved in saline, and blood glucose was measured at 0, 10, 20, 30, 60 and 90 minutes using glucose test strips and glucose meters.
To induce hypoglycemia, CD1 mice with skin grafts were fasted for 4 h and injected (2 U/kg, i.p.) with insulin purchased from Sigma (St. Louis, MO). Blood glucose levels were determined thereafter at 0, 15, 30, 45, and 60 minutes.
Intravital Imaging of Mice
Optical imaging was performed in the integrated small animal imaging research resource (iSAIRR) at the University of Chicago. Bioluminescence images were acquired on an IVIS Spectrum (Caliper Life Sciences®, Alameda, CA) after animal was injected with luciferin (100 mg/kg). Acquisition and image analysis were performed with Living Image 4.3.1 software.
Wound healing in grafted skin were imaged by multiphoton microscope in the light microscopy center at the University of Chicago. Images were analyzed with Image J software.
Histology and Immunofluorescence
Skin or wound samples were embedded in OCT, frozen, sectioned, and fixed in 4% formaldehyde. For paraffin sections, samples were incubated in 4% formaldehyde at 4° C. overnight, dehydrated with a series of increasing concentrations of ethanol and xylene, and then embedded in paraffin. Paraffin sections were rehydrated in decreasing concentrations of ethanol and subjected to antigen unmasking in 10 mM Citrate, pH 6.0. Sections were subjected to hematoxylin and eosin staining or immunofluorescence staining, as described in Wright et al. Antibodies were diluted according to manufacturer's instruction, unless otherwise indicated.
Statistical Analysis
Statistical analysis was performed using Excel or OriginLab software. Box plots are used to describe the entire population without assumptions on the statistical distribution. A student t test was used to assess the statistical significance (P value) of differences between two experimental conditions (2 tailed distribution unless specified). All experiments were repeated at least three times, unless otherwise specified. For all figures, statistical tests are justified and meet the assumption of the tests. The variance between different test groups that are being statistically compared is similar.
For all the experiments, the sample size was chosen based upon our preliminary test and previous research. There is no sample exclusion for all the in vitro analysis. For in vivo experiments, animals that died before the end of the experiment were excluded. The exclusion criteria is pre-established. No randomization or blinding was used in this study.
Despite the potential clinical applications, research in skin epidermal stem cells has been greatly hampered by the lack of an appropriate model. Although it has been shown that mouse skin or human skin can be transplanted onto immunodeficient mice, the lack of an intact immune system in this model forecloses prediction of potential outcomes of this procedure in vivo. Immune clearance of engineered cells has been a major complication for somatic gene therapy (see Collins, M. & Thrasher, A. Gene therapy: progress and predictions. Proceedings. Biological sciences/The Royal Society 282 (2015)). Additionally, it remains technically challenging to perform skin organoid culture with mouse epidermal stem cells and generate mouse skin substitute for transplantation. To resolve these issues, a new organotypic culture model with mouse epidermal stem cells in vitro was developed by culturing the cells on top of acellularized mouse dermis (
Tissue Organoids
Exposure to the air/liquid interface can induce stratification of cultured epidermal cells to generate a skin-like organoid in vitro. Transplantation of such cultured skin organoids to nude hosts leads to efficient skin engraftments (see Liu, H et al. 2015 and Yue, J et al. 2016). Using a modified surgical procedure and skin graft maintenance protocol, engrafting the isogenic mouse skin substitute onto an immunocompetent host (CD1 and C57BL/6J strains) with or without the silicone dome chamber for skin transplantation (
Grafted cells in immunocompetent hosts readily expressed exogenous genes, such as Luciferase and Histone H2B-RFP (
Engineered Blood Glucose Monitors
A biointegrated sensor for noninvasive monitoring of blood glucose level in vivo could remove the need for diabetic patients to draw blood multiple times a day. Additionally, continuous monitoring of glucose allows patients to better maintain blood glucose levels by altering insulin dosage or diet according to the prevailing glucose values. Currently, most continuous glucose monitoring sensors are enzyme electrodes or microdialysis probes implanted under skin. These sensors usually require oxygen for activity, and are insufficiently stable in vivo and poorly accurate under low glucose condition. Presence of interfering electroactive substances in tissues can also cause impaired responses and signal drift in vivo, which necessitate frequent calibrations of current sensors. A fluorescence-based glucose sensor in skin would likely be more stable, have improved sensitivity, and resolve the issue of electrochemical interference from the tissue (see Pickup et al. Fluorescence-based glucose sensors. Biosensors & bioelectronics 20, 2555-2565 (2005)).
To engineer epidermal stem cells for glucose sensing, intracellular expression of a sugar binding protein, glucose/galactose-binding protein (GGBP) (Jeffery, C. J. Engineering periplasmic ligand binding proteins as glucose nanosensors. Nano reviews 2, 2011) was examined. GGBP transports glucose within the periplasm of E. coli, and binding with glucose can lead to a large conformational change in the protein (Jeffery, 2011). This property of GGBP has been exploited to develop protein sensors for glucose based on FRET (fluorescence resonance energy transfer) or bioluminescence imaging (see Fehr et al. In vivo imaging of the dynamics of glucose uptake in the cytosol of COS-7 cells by fluorescent nanosensors. J Biol Chem 278, 19127-19133, (2003); Saxl et al. A fluorescence lifetime-based fibre-optic glucose sensor using glucose/galactose-binding protein. The Analyst 136, 968-972 (2011); Teasley Hamorsky et al. A bioluminescent molecular switch for glucose. Angewandte Chemie 47, 3718-3721 (2008); Tian et al. Structure-based design of robust glucose biosensors using a Thermotoga maritima periplasmic glucose-binding protein. Protein science: a publication of the Protein Society 16, 2240-225 (2007) and Veetil et al. A glucose sensor protein for continuous glucose monitoring. Biosensors & bioelectronics 26, 1650-1655 (2010). WT (wild type) GGBP has very high glucose binding affinity (Kd=0.2 μm). To generate a probe corresponding to physiologically relevant range of glucose, a CFP/YFP FRET sensor with A213R/L238S double mutant of GGBP (SEQ ID NO: 28) (Kd=10 mM) (Amiss, T. J., Sherman, D. B., Nycz, C. M., Andaluz, S. A. & Pitner, J. B. Engineering and rapid selection of a low-affinity glucose/galactose-binding protein for a glucose biosensor. Protein science: a publication of the Protein Society 16, 2350-2359) was engineered via CRISPR-mediated genome editing in mouse epidermal stem cells. DNA vectors encoding the D10A mutant of Cas9 (CRISPR associated protein 9) (Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389 (2013) (SEQ ID NO: 29), two gRNAs (guide RNA) (SEQ ID NO: 30), (SEQ ID NO: 31) targeting the mouse Rosa26 locus, and a Rosa26-targeting vector (SEQ ID NO: 32) were developed. The targeting vector contained two homology arms for the Rosa26 locus, flanking an expression cassette that encoded a GGBP fusion protein (
Primary epidermal keratinocytes were isolated from CD1 newborn mice, and electroporated with the Rosa26 targeting vector together with plasmids encoding Cas9 and Rosa26-specific gRNAs. Clones were isolated upon selection, and the correct integration to the Rosa26 locus was confirmed by both PCR screening and southern blotting analysis (
To test whether intradermal electroporation would also be an effective means of introducing a reporter, CD1 mice were electroporated intradermally with plasmid DNA encoding luciferase and tdTomato and expression was assayed by bioluminescence imaging (
To test glucose sensing in vitro, the cells were exposed to medium containing increasing amounts of glucose. Quantification of FRET ratio by microscopic imaging showed an excellent correlation of FRET ratio with extracellular glucose concentration, ranging from 0-10 mM (
Expression of the GGBP fusion protein in epidermal cells did not significantly change cell proliferation (
To investigate the potential applicability in vivo of the engineered blood glucose monitor, a skin organoid culture was prepared with engineered epidermal stem cells, and the organoid was grafted onto CD1 host animals (
To test the skin sensor for lower glucose concentration, we induced hypoglycemia by insulin administration to fasted animals. Intravital imaging of the grafted skin again showed excellent correlation of the FRET ratio changes with glucose level (
Engineered Tissue Organoids
If an engineered blood glucose monitor could be engineered to produce or regulate insulin levels in response to blood glucose levels, it could approximate an “artificial endocrine pancreas” that would automatically maintain glucose level in patients. Thus, introduction of an expression cassette into epidermal stem cells that encodes both a GGBP reporter and a therapeutic protein could achieve continuous glucose monitoring and diabetes treatment with a single skin transplantation. GLP1 (glucagon-like peptide 1) is released from the gut upon food intake and acts both as a satiety signal to reduce food consumption and as an incretin hormone to stimulate insulin release and inhibit glucagon secretion. Indeed, GLP1 receptor agonists have previously been used to treat type 2 diabetes. Therefore, a new Rosa26 targeting vector containing an expression cassette that encodes a GLP1 and mouse IgG-Fc fragment (for enhanced stability and secretion of GLP1) fusion protein together with the GGBP reporter was developed (
Engineered epidermal cells exhibited robust GLP1 production and secretion (
To examine the potential applicability in diet-induced obesity and diabetes, GLP1/GGBP-expressing cells and control cells (GGBP alone) were transplanted into two cohorts of CD1 adult male mice. The mice were fed a high fat diet (HFD) to induce obesity in grafted animals. Compared with animals on a regular chow diet, the HFD greatly accelerated body weight gain in mice grafted with control cells. By contrast, GLP1 expression led to significant inhibition in body weight increase (
IPGTT was performed to examine glucose homeostasis. Expression of GLP1 significantly reduced glycemic excursion in vivo as determined by both direct measurement of blood glucose or intravital imaging of the GGBP reporter (
Human Tissue Organoids
To test the feasibility of glucose sensing with human epidermal stem cells, human skin organoids were cultured from primary epidermal keratinocytes isolated from human newborn foreskin. The human epidermal keratinocytes readily produce organoids in vitro, which can be transplanted to nude mice. When infected with lentivirus, the grafted human cells exhibited robust expression of the exogenous Luciferase gene (
For CRISPR-mediated genome editing, vectors encoding two gRNAs targeting the human AAVS1 (adeno-associated virus integration site 1) locus and an AAVS1-targeting vector (
Expression of the GGBP fusion protein did not significantly change cell proliferation (
In this study, technical hurdles were overcome to establish a unique mouse-to-mouse skin transplantation model with immunocompetent hosts. The results provide key evidence supporting the feasibility of cutaneous monitoring of blood glucose level in vivo. The same platform can be also exploited for development of other biosensors and ex vivo cutaneous gene therapy for stable delivery of therapeutic proteins in vivo, such as GLP1, providing a promising treatment for many otherwise terminal or severely disabling diseases (see Christensen, R. et al. Skin genetically engineered as a bioreactor or a ‘metabolic sink’. Cells, tissues, organs 172, 96-104, (2002) and Del Rio, M. et al. Current approaches and perspectives in human keratinocyte-based gene therapies. Gene therapy 11 Suppl 1, S57-63, (2004)).
In this report, by combining CRISPR-mediated genome editing with epidermal stem cell platform, a skin graft with controllable release of GLP1 (glucagon-like peptide-1) was developed and demonstrated therapeutic effect in vivo by reducing glycemic excursions in diet-induced obese and diabetic mice. GLP1 is a major physiological incretin that controls homeostasis of blood glucose by stimulation of glucose-dependent insulin secretion, inhibition of glucagon secretion, delay of gastric emptying, and protection of islet beta-cell mass (see Ross et al. 2010, Sandoval et al. 2015). However, native GLP1 must be delivered through a parenteral route to achieve its effect as it has an extremely short circulating half-life. Thus, somatic gene transfer may provide a more effective way for long term and stable delivery of GLP1 in vivo in order to treat diabetes (Prud'homme et al. 2007; Rowzee et al. 2011).
The recent development of genome editing technology, including CRISPR (clustered regularly-interspaced short palindromic repeats) system, has made it possible to perform precise genetic engineering, providing an ideal tool for somatic gene therapy (Cox et al., 2015; Hotta et al. 2015; Wright et al. 2016). However, clinical application of CRISPR technology has been challenging due to inadequate efficacy in vivo using conventional delivery approach. Thus, the development of an ex vivo platform that can combine both precise genome editing in vitro with effective application of engineered cells in vivo will provide significant benefits for the treatment of many human diseases.
Skin epidermal stem cells (Blanpain and Fuchs, 2006; Watt, 2014) have several unique advantages, making them particularly suited for somatic gene therapy ex vivo: i) Human skin is the largest and most accessible organ in the body, offering availability for collection of epidermal stem cells with well-established procedures (Rasmussen et al., 2013; Rheinwald and Green, 1975, 1977). Moreover, it is easy to monitor the skin for potential off-target effects of gene targeting and, if necessary, to remove it in case of an adverse consequence. Cultured epidermal stem cells can be readily induced to differentiate and the resultant stratified skin tissue can be transplanted to donor patients with well-established protocols (Blanpain and Fuchs, 2006; Watt, 2014). Comparing with other somatic gene therapy approach, autologous skin grafts are relatively inexpensive, and the procedure is minimally invasive, safe, and has been clinically used for treating burn wounds for decades (Carsin et al. 2000; Coleman and Siwy, 1992). Somatic gene therapy with epidermal stem cells is tissue specific. Anatomically, skin epidermis is not directly vascularized but receives nutrients from blood vessels located in the underlying dermal tissue. The physical separation by the basement membrane precludes potential dissemination of genetically modified cells in vivo, making it extremely tissue specific and safe for the cutaneous gene therapy. iv) Epidermal stem cells can withstand long-term culture in vitro without losing stemness Rheinwald and Green, 1975), making it possible to perform precise genome editing with non-viral approaches. Potential genotoxicity, particularly from viral vectors, has been a significant hurdle for somatic gene therapy (Kotterman et al. 2015; Kustikova et al. 2010). v) Epidermal stem cells have low immunogenicity. Gene therapy-derived products can be recognized as foreign antigens by the host immune system, which may mount an immune response leading to clearance of genetically modified cells. However, skin autograft or allograft developed from cultured epidermal stem cells can achieve long term and stable transplantation in human patients without eliciting significant immune reaction (Centanni et al., 2011; Zaulyanov and Kirsner, 2007). vi) It has been well documented that proteins secreted by skin epidermal cells, such as ApoE (apolipoprotein E) and large blood clotting proteins Factor VIII and Factor IX, can cross the epidermal/dermal barrier and reach circulation to achieve therapeutic effect in a systematic manner (Christensen et al., 2002; Del Rio et al., 2004; Fakharzadeh et al., 2000; Fenjves et al., 1989; Gerrard et al., 1993; Morgan et al., 1987). Thus, the potential applicability of skin stem cell therapy is broad, and beyond the skin diseases.
This example demonstrates that genome-edited epidermal stem cells can be exploited for robust, controllable delivery of GLP1 in vivo and effective treatment of diabetes and obesity in a clinically-relevant setting.
Reagents and Plasmid DNA Constructions
Guinea pig anti K5, rabbit anti K14, rabbit anti K10 and Loricrin antibodies were generous gifts from Dr. Elaine Fuchs at the Rockefeller University. Rat monoclonal 84-integrin (CD104, BD 553745) was obtained from BD Pharmingen (Franklin lakes, NJ). Ser10 pho-histone antibody was obtained from EMD Millipore (Billerica, MA). Cleaved caspase-3 antibody was obtained from Cell Signaling Technology (Danvers, MA). Insulin ELISA kit was obtained from EMD Millipore Corp (Billerica, MA). GLP-1 ELISA kit was obtained from Sigma (St. Louis, MO). Other chemicals or reagents were obtained from Sigma, unless otherwise indicated.
Lentiviral vector encoding Luciferase (SEQ ID NO: 1) and H2B-RFP (SEQ ID NO: 2) has been described before (Liu et al., 2015; Yue, 2016). Plasmid encoding hCas9-D10A mutant was a gift from George Church, obtained from Addgene (plasmid #41816). Plasmid encoding gRNA expression cassette was constructed with primers: AAG GAA AAA AGC GGC CGC TGT ACA AAA AAG CAG G (SEQ ID NO: 3); and gGA ATT CTA ATG CCA ACT TTG TAC (SEQ ID NO: 4), using gBlock as a template. Rosa26-targeting gRNA is constructed with primers: ACA CCG GCA GGC TTA AAG GCT AAC CG (SEQ ID NO: 5), AAA ACG GTT AGC CTT TAA GCC TGC CG (SEQ ID NO: 6), ACA CCG AGG ACA ACG CCC ACA CAC Cg (SEQ ID NO: 7), AAA ACG GTG TGT GGG CGT TGT CCT CG (SEQ ID NO: 8). AAVS1-targeting gRNA is constructed with primers: ACA CCG TCA CCA ATC CTG TCC CTA GG (SEQ ID NO: 9), AAA ACC TAG GGA CAG GAT TGG TGA CG (SEQ ID NO: 10), ACA CCG CCC CAC AGT GGG GCC ACT AG (SEQ ID NO:11), AAA ACT AGT GGC CCC ACT GTG GGG CG (SEQ ID NO: 12). Rosa26 targeting vector is constructed with pRosa26-GT as template (a gift from Liqun Luo, addgene plasmid 40025) using primers: GAC TAG TGA ATT CGG ATC CTT AAT TAA GGC CTC CGC GCC GGG TTT TGG CG (SEQ ID NO: 13), GAC TAG TCC CGG GGG ATC CAC CGG TCA GGA ACA GGT GGT GGC GGC CC (SEQ ID NO: 14), CGG GAT CCA CCG GTG AGG GCA GAG GAA GCC TTC TAA C (SEQ ID NO: 15), TCC CCC GGG TAC AAA ATC AGA AGG ACA GGG AAG (SEQ ID NO: 16), GGA ATT CAA TAA AAT ATC TTT ATT TTC ATT ACA TC (SEQ ID NO: 17), CCT TAA TTA AGG ATC CAC GCG TGT TTA AAC ACC GGT TTT ACG AGG GTA GGA AGT GGT AC (SEQ ID NO: 18). AAVS1 targeting vector (SEQ ID NO: 40) was constructed with AAVS1 hPGK-PuroR-pA donor (a gift from Rudolf Jaenisch, addgene plasmid 22072) as template using primers: CCC AAG CTT CTC GAG TTG GGG TTG CGC CTT TTC CAA G (SEQ ID NO: 19), CCC AAG CTT CCA TAG AGC CCA CCG CAT CCC C (SEQ ID NO: 20), CAG GGT CTA GAC GCC GGA TCC GGT ACC CTG TGC CTT CTA GTT GC (SEQ ID NO: 21), GGA TCC GGC GTC TAG ACC CTG GGG AGA GAG GTC GGT G (SEQ ID NO: 22), CCG CTC GAG AAT AAA ATA TCT TTA TTT TCA TTA CAT C (SEQ ID NO: 23), GCT CTA GAC CAA GTG ACG ATC ACA GCG ATC (SEQ ID NO: 24). Genotyping primers for CRISPR mediated knockin: GAG CTG GGA CCA CCT TAT ATT C (SEQ ID NO: 25), GGT GCA TGA CCC GCA AG (SEQ ID NO: 26), GAG AGA TGG CTC CAG GAA ATG (SEQ ID NO: 27).
Skin Organoid Culture and Transplantation
Decellularized dermis (circular shape with 1 cm diameter) was prepared by EDTA treatment of newborn mouse skin (Prunieras et al., 1983). An aliquot of 1.5×106 cultured keratinocytes was seeded onto the dermis in a cell culture insert. After overnight attachment, the skin culture was exposed to air/liquid interface.
For grafting with skin organoids, CD1 males with the ages of 6-8 weeks were anesthetized. A silicone chamber bottom with the interior diameter of 0.8 cm and exterior diameter of 1.5 cm was implanted on its shaved dorsal mid-line skin, which was used to hold the skin graft. A chamber cap was installed to seal the chamber immediately after a piece of graft was implanted. About one week later, the chamber cap was removed to expose the graft to air. A single dose of 0.2 mg α-CD4 (GK1.5) and 0.2 mg α-CD8 (2.43.1) antibodies was administered intraperitoneally for skin grafting.
Histology and Immunofluorescence
Skin or wound samples were embedded in OCT, frozen, sectioned, and fixed in 4% formaldehyde. For paraffin sections, samples were incubated in 4% formaldehyde at 4° C. overnight, dehydrated with a series of increasing concentrations of ethanol and xylene, and then embedded in paraffin. Paraffin sections were rehydrated in decreasing concentrations of ethanol and subjected to antigen unmasking in 10 mM Citrate, pH 6.0. Sections were subjected to hematoxylin and eosin staining or immunofluorescence staining. Antibodies were diluted according to manufacturer instructions, unless otherwise indicated.
Cell Cycle Analysis:
Propidium iodide (PI) staining followed by flow cytometry were used to determine the effect of cell cycle profiles. Mouse and human epidermal cells were cultured in two 6 cm cell culture dish for 24 hours, respectively. Cells were trypsinized, and 1×105 cells from each dish were collected, followed by one PBS wash. Fixation of cells was carried out using 70% (v/v) ice cold ethanol for 1 hour. Then, fixed cells were centrifuged at 500 g at 4° C. for 10 minutes, followed by 2×PBS wash. Cells were then treated with 75 μg RNAse A in 100 μl PBS and incubated at 37° C. for 1 hour. After incubation, the cells were collected by centrifuging at 500 g at 4° C. for 10 minutes, followed by another PBS wash. The cell pellet was resuspended in 200 μl PBS with PI solution at a final concentration of 25 ng/μl. After staining, the cells were analyzed immediately using flow cytometer BD FACSCanto™ II (BD Biosciences, San Jose, CA) with an excitation wavelength at 488 nm and emission at 585 nm. DNA content and histograms of cell cycle distribution were analyzed using FlowJo™ software, version 10 (FLOWJO LLC, OR).
Protein Biochemical Analysis
Western blotting was performed to assess protein biochemistry. Briefly, equal amounts of cell lysates were separated on an SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted onto a NC membrane. The immunoblot was incubated with Odyssey blocking buffer (Li-Cor) at room temperature for 1 h, followed by an overnight incubation with primary antibody. Blots were washed three times with Tween 20/Tris-buffered saline (TBST) and incubated with a 1:10000 dilution of secondary antibody for 1 h at room temperature. Blots were washed three times with TBST again. Visualization and quantification were carried out with the LI-COR Odyssey scanner and software (LI-COR Biosciences).
Obesity Induced by High Fat Diet and Glucose and Insulin Tolerance Tests
Male CD-1 mice were housed (5 per cage, ˜8 weeks old) in a central-controlled animal facility for air, humidity, and temperature. These mice were fed either a regular chow or an HFD (60% kcal from fats, 20% from carbohydrates, and 20% from proteins) purchased from Bio-Serv (Frenchtown, NJ). Body weight and food intake were measure biweekly.
For glucose and insulin tolerance tests, an intraperitoneal glucose tolerance test (IPGTT) was performed on mice fed an HFD for 10 weeks. Mice were fasted for 6 h before the test. Animals were injected (1 g/kg glucose/body weight, i.p.) with glucose dissolved in saline, and blood glucose was measured at 0, 30, 60 and 90 min using glucose test strips and glucose meters. An intraperitoneal insulin tolerance test was carried out 1 week after IPGTT. Mice were fasted for 4 h and injected (2 U/kg, i.p.) with insulin purchased from Sigma (St. Louis, MO). Blood glucose levels were determined thereafter at 0, 30, 60 and 90 min.
Statistical Analysis
Statistical analysis was performed using Excel or OriginLab software. Box plots were used to describe the entire population without assumptions on the statistical distribution. A student t test was used to assess the statistical significance (P value) of differences between two experimental conditions.
Ectopic Expression of GLP1 in Epidermal Stem Cells Via CRISPR-Mediated Genome Editing
By genetic engineering of skin epidermal stem cells, skin can potentially be transformed into an in vivo reactor that produces GLP1 in a controllable manner (
To test CRISPR-mediated genome editing in mouse epidermal stem cells, DNA vectors encoding the D10A mutant of Cas9 (CRISPR associated protein 9) (Ran et al., 2013), two gRNAs (guide RNA) targeting the mouse Rosa26 locus, and a Rosa26-targeting vector were developed. The targeting vector contains two homology arms for the Rosa26 locus, flanking an expression cassette that encodes a GLP-1 and mouse IgG-Fc fragment fusion protein (
Primary epidermal keratinocytes were isolated from CD1 newborn mice, and electroporated with the Rosa26 targeting vector together with plasmids encoding Cas9 and Rosa26-specific gRNAs. Clones were isolated upon selection, and the correct integration to the Rosa26 locus was confirmed by both PCR screening and southern blotting analysis (
To confirm that modified epidermal cells were not tumorigenic, the potential anchorage-independent growth of cells was examined, and the results indicated that epidermal stem cells with GLP1 targeting cannot grow in suspension with or without doxycycline stimulation (
Stable Delivery of GLP1 In Vivo Through Skin Transplantation
To investigate the potential therapeutic effect of GLP1 in vivo, skin organoid cultures with epidermal keratinocytes targeted with a GLP1-expression vector or a control vector, and transplant the organoids to CD1 host animals (
Cutaneous Gene Transfer with GLP1 can Achieve Therapeutic Effects In Vivo
To examine the potential effect in diet-induced obesity and diabetes, GLP1-expressing cells and control cells were grafted onto two cohorts of CD1 adult mice, and a high fat diet (HFD) was used to induce obesity in the grafted animals. Doxycycline was applied to half of the animals to induce expression of GLP1. To minimize gender difference, only male animals were used. Compared with animals on regular chow diet, HFD greatly accelerated body weight gain in mice grafted with control cells or GLP1 cells without doxycycline treatment. Induction of GLP1 expression with doxycycline led to a significant decrease in body weight in mice grafted with GLP1 cells but not control cells (
To examine glucose homeostasis, IPGTT (intraperitoneal glucose tolerance test) and ITT (insulin tolerance test) were performed. HFD resulted in decreased glucose tolerance in control mice or GLP1-grafted mice without doxycycline treatment
Cutaneous Delivery of GLP1 with Human Epidermal Stem Cells
To test the feasibility of cutaneous gene therapy with human epidermal stem cells, human skin organoids were cultured from primary epidermal keratinocytes isolated from human newborn foreskin. When infected with lentivirus, the grafted human cells exhibited robust expression of the exogenous Luciferase gene (
To examine CRISPR-mediated genome editing in human epidermal cells, vectors encoding two gRNAs targeting human AAVS1 (adeno-associated virus integration site 1) locus, and an AAVS1-targeting vector (
Expression of the GLP1 fusion protein in human cells did not significantly change cell proliferation (
Somatic gene therapy provides a promising therapeutic approach for treatment of a variety of otherwise terminal or severely disabling diseases (Collins and Thrasher, 2015). Skin epidermal stem cells represent an ideal platform for ex vivo gene therapy, allowing efficient genetic manipulation with minimal risk of tumorigenesis or other detrimental complications in vivo (Christensen et al., 2002; Del Rio et al., 2004). In addition to expression of therapeutic agent (e.g., hormones and/or protein factors), such as GLP-1, ectopic expression of metabolic enzymes in skin epidermal cells can also transform engineered tissue organoids into a potential “metabolic sink” for correction of various metabolic disorders (Christensen et al., 2002). Thus, the applicability of such a cutaneous gene therapy platform is very broad. Because of the minimally invasive and safe nature of skin transplantation, should an efficient preclinical model for cutaneous gene therapy be established and encouraging results be obtained from animal models, human clinical tests could start relatively easily.
Diabetes is a major health issue worldwide (Ahima, 2011; Ashcroft and Rorsman, 2012). The peptide hormone GLP1 has the essential requisite properties to maintain homeostatic levels of glucose in order to effectively treat diabetes. Compounds that elongate half-life of endogenous GLP1 or synthetic GLP1 receptor agonists have already been clinically used for adjunctive antidiabetic treatments (Ross and Ekoe, 2010; Sandoval and D'Alessio, Physiology of proglucagon peptides: role of glucagon and GLP-1 in health and disease. Physio. Rev. 95, 513-548 (2015)). Somatic gene transfer that can stably deliver GLP1 to the patients has been proposed as a more effective way for diabetes treatment (Prud'homme et al., 2007; Rowzee et al., 2011). In this regard, skin constitutes a tempting target organ, providing a long-lasting, safe, and affordable way for GLP1 delivery. Here, controllable release of GLP1 was demonstrated in engineered tissue organoids and proven to be therapeutically effective in vivo, thus laying the essential groundwork for developing novel therapeutic approach for combating obesity and diabetes.
Gene therapy-derived products can be recognized as foreign antigens by the host immune system, which may mount an immune response leading to the clearance of genetically modified cells (Collins and Thrasher, 2015). However, the model developed in this study provides a unique approach. Within normal skin epidermis, the Langerhans cells function as the sole cell type that expresses major histocompatibility complex (MHC) class II and presents antigen (Haniffa et al., 2015). Epidermal keratinocytes only express MHC class I molecules on their cell surface, and are considered as “non-professional” antigen presenting cells. Thus, in the engineered tissue organoids described here (generated from epidermal stem cells), without the presence of Langerhans cells or leukocytes as antigen presenting cells, potential antigenicity and immunogenicity are significantly reduced. It has been shown that skin allografts developed from cultured human keratinocytes can been clinically used for the treatment of wounds, without eliciting significant immune reaction (Centanni et al., 2011; Zaulyanov and Kirsner, 2007). The present results demonstrate for the first time that grafted skin stem cells expressing therapeutic proteins can be efficiently and stably grafted to host mice with intact immune systems. The present results further demonstrate the potential of cutaneous gene therapy for the treatment of various human diseases in the future.
Drug addiction is characterized by the development of compulsive drug-seeking and taking and a high likelihood of relapse when an addicted individual is exposed to drugs or drug-associated cues, even long after abstention (Kalivas et al. Drug addiction as a pathology of staged neuroplasticity. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 33: 166-180 (2008); Koob et al. Neurocircuitry of addiction. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 35: 217-238 (2010); O'Brien et al. Conditioning factors in drug abuse: can they explain compulsion? Journal of psychopharmacology 12: 15-22 (1998)). Cocaine is a commonly abused drug that causes significant morbidity and mortality. Although a variety of pharmacological targets and behavioral interventions have been explored, there are currently no FDA-approved medications for treating cocaine use or relapse in users, and there are no effective interventions for the acute emergencies that result from cocaine overdose (Heard et al. Mechanisms of acute cocaine toxicity. The open pharmacology journal 2: 70-78, (2008); Zimmerman, J. L. Cocaine intoxication. Critical care clinics 28: 517-526 (2012)). We recently demonstrated that the epidermal progenitor cells of the skin can be readily genome edited in vitro using CRISPR (clustered regularly interspaced short palindromic repeats) and transplanted back into donor mice (see Liu, H et al., 2015; Yue, J et al., 2016; Yue et al. Engineered epidermal progenitor cells can correct diet-induced obesity and diabetes. Cell stem cell (2017)). This unique ex vivo platform can provide a long-lasting, effective, and safe way for somatic gene delivery. Here, we report that this skin stem cell-based platform for long-term delivery of a cocaine hydrolase in vivo can efficiently and specifically protect against cocaine-seeking and acute overdose.
BChE (butyrylcholinesterase) is a natural enzyme that is present in hepatocytes and plasma and hydrolyzes its normal substrate acetylcholine. BChE can also hydrolyze cocaine at low catalytic efficiency into benzoic acid and ecgonine methylester, which are low in toxicity and rewarding properties, i.e., they are not addictive substances. Recent advances in protein engineering have greatly enhanced catalytic potency and substrate specificity of BChE for cocaine hydrolysis, and for protecting against cocaine-induced behaviors, including acquisition and reinstatement of IVSA (intravenous self-administration). The modified hBChE (E30-6) has more than 4400 times higher catalytic efficiency (kcat/KM) than wild-type (WT) hBChE with significantly reduced activity for acetylcholine (see Zheng et al. A highly efficient cocaine-detoxifying enzyme obtained by computational design. Nat Commun. 5: 3457 (2014)). However, purified recombinant hBChE has a short half-life in vivo after i.v. injection, making it useful only for acute treatment of cocaine abuse. In recent clinical trials, an hBChE-albumin fusion protein, TV-1380, was ineffective in facilitating cocaine-abstinence in dependent individuals, most likely due to the short half-life of the protein and also the inefficient intramuscular route of injection (Cohen-Barak et al. Safety, pharmacokinetics, and pharmacodynamics of TV-1380, a novel mutated butyrylcholinesterase treatment for cocaine addiction, after single and multiple intramuscular injections in healthy subjects. Journal of clinical pharmacology 55: 573-583 (2015); Gilgun-Sherki et al. Placebo-controlled evaluation of a bioengineered, cocaine-metabolizing fusion protein, TV-1380 (AlbuBChE), in the treatment of cocaine dependence. Drug and alcohol dependence 166: 13-20 (2016)). Therefore, the ability to stably deliver engineered hBChE in vivo to allow continuous activity could lead to cocaine abstinence in dependent individuals and prevent establishment of cocaine dependence in others.
Reagents and Plasmid DNA Constructions
Unless indicated to the contrary, reagents and experimental procedures follow those described in Example No. 2 above. Human BChE quantikine ELISA kit was obtained from R&D systems (Minneapolis, MN).
Human (SEQ ID NO: 41) and mouse BChE (SEQ ID NO: 43) with point mutations {Zheng, 2014 #794} were codon-optimized and synthesized from IDT (Integrated DNA Technology, Coralville, IA), and PCR amplified with primers A-D, respectively: GCT CTA GAG CCA CCA TGC AGA CTC AGC ATA CCA AGG (SEQ ID NO: 47), CGG GAT CCA CCG GTT TAG AGA GCT GTA CAA GAT TCT TTC TTG (SEQ ID NO: 48), CCC AAG CTT GCC ACC ATG CAT AGC AAA GTC ACA ATC (SEQ ID NO: 49), ACG CGT CGA CTT AGA GAC CCA CAC AAC TTT CTT TCT TG (SEQ ID NO: 50).
Skin Organoid Culture and Transplantation
Skin organoid culture and transplantation was performed following the procedures described in Example No. 2 above.
Engraftment
Engraftment followed the procedures described in Example No. 2 above unless otherwise indicated below.
Cocaine-Induced Behaviors
For all behavioral experiments except where noted, C57BL/6J mice were used. Roughly equal numbers of adult male and female mice were group-housed until surgery. Mice were maintained under controlled temperature and humidity conditions on a 12 h:12 h light:dark cycle (lights on at 7:00). Water and food were available ad libitum. Mice weighed around 25-30 g at the beginning of the experiments. All procedures followed National Institutes of Health Guide for the Care and Use of Laboratory Animal and were approved by the University of Chicago Institutional Animal Care and Use Committee.
Drug: Cocaine HCl and methamphetamine HCl (Sigma-Aldrich, Saint Louis, MO) were dissolved in sterile saline and delivered intraperitoneally at appropriates doses in a volume of 10 mL/kg. Ethanol (Sigma-Aldrich, Saint Louis, MO, 95%, density=0.816) was prepared in 20% (v/v) diluted in sterile saline and delivered intraperitoneally at appropriate doses. Vehicle (sterile saline) was intraperitoneally administered at 10 mL/kg as a control.
CPP apparatus: The CPP apparatus (
Acquisition of CPP: A biased CPP procedure was used similar to that from a previous study (Yan et al., 2013). Acquisition of CPP consisted of three sequential procedures—pretest, conditioning, and test. After 7-12 days of recovery from engrafting surgeries, mice underwent pretest on Day 1, where mice were allowed to freely explore the entire chamber for min once daily. Mice that spent more than 500 s in the grey compartment or more than 800 s in either of the large compartments were excluded from the study. Following the pretest day, mice underwent conditioning and testing on Days 2-5. Starting on Day 2, mice received an i.p. injection of drug (10 mg/kg cocaine in cocaine CPP or 2 g/kg ethanol in ethanol CPP) and were confined to the white chamber for 30 min. At least 5 hours after in the same day, mice received an i.p. injection of saline and were confined to the black compartment for 30 min. On Day 6 (test day) mice were allowed to explore the entire chambers for 20 min and time spent in each area was recorded.
Extinction and reinstatement of CPP: Following CPP acquisition, mice underwent extinction, in which the procedure was identical to that in the test day. In each extinction day, mice were allowed to explore the entire chambers for 20 min and time spent in each area was recorded. Extinction was performed until the CPP decreased to a level that was not different from that of the pretest in consecutive two days. On the following day of the last extinction, mice underwent reinstatement procedures, in which mice that were trained for cocaine CPP received an i.p. injection of 15 mg/kg cocaine, and mice that were trained for ethanol CPP received an i.p. injection of 1 g/kg ethanol. Immediate after injection, mice were allowed to explore the entire chambers for 20 min and time spent in each area was recorded.
Acute drug overdose test: Two weeks after grafting surgery, 4 groups of GhBChE and 4 groups of GWT mice (n=8 each in each group) received i.p. injections of cocaine at 40, 120, and 160 mg/kg. As a control, 4 groups of GhBChE and 4 groups of GWT mice (n=8 each) received i.p. injections of methamphetamine (METH) at 34, 68 (LD50), 100, and 160 mg/kg. Two each of GhBChE and GWT mice with CD1 mice as hosts were also used to videotape acute cocaine (80 mg/kg) induced behaviors. Mice were monitored for 2 h following injection and percent of cocaine- and METH-induced lethality was calculated.
Specific methods: One group of GhBChE and one group of GWT mice (n=9 in each group) were trained for cocaine CPP 7 days after engraftment (
Statistical Analysis
Statistical analysis was performed using Excel or OriginLab software. Box plots are used to describe the entire population without assumptions on the statistical distribution. A student t test was used to assess the statistical significance (P value) of differences between two experimental conditions. For cocaine behavioral analysis, CPP results were analyzed using repeated-measures ANOVA with within factor time (testing days) and between factor treatment (engraftment). Significant effects were further analyzed with Fisher's t-tests.
To carry out CRISPR-mediated genome editing in mouse epidermal progenitor cells, DNA vectors were developed encoding the D10A mutant of Cas9 (CRISPR associated protein 9; Ran et al., 2013), two gRNAs (guide RNA) targeting the mouse Rosa26 locus, and a Rosa26-targeting vector. The targeting vector contains two homology arms for the Rosa26 locus, flanking an expression cassette that encodes the modified hBChE gene (
To efficiently transplant mouse epidermal progenitor cells, a new organotypic culture model with mouse epidermal progenitor cells was developed in vitro by culturing the cells on top of acellularized mouse dermis. Exposure to the air/liquid interface can induce stratification of cultured cells to generate a skin-like organoid in vitro. Expression of hBChE did not change the ability of epidermal stem cells to stratify (
To first determine whether engrafting hBChE-expressing cells protects mice from acute systemic toxicity of cocaine, we delivered different doses of cocaine to grafted mice and calculated the lethality rates of cocaine. Doses of 40, 80, 120, 160 mg/kg of cocaine had nearly lethality in mice grafted with hBChE-expressing cells (GhBChE), whereas 80 mg/kg of cocaine induced roughly 50% lethality and 120 and 160 mg/kg cocaine induced 100% lethality in control mice grafted with WT epidermal cells (GWT) (
Next, protection against development of cocaine-seeking was assessed using the conditioned place preference (CPP) paradigm, which is thought to model reward learning and seeking because experimental animals approach and remain in contact with cues that have been paired with the effects of the reward. hBChE-expressing cells were grafted to cocaine-naïve mice with GWT animals as controls. After 4 days of place conditioning, GWT mice spent significantly more time in environments previously associated with cocaine, whereas GhBChE mice showed no such preference (
To determine whether engrafting hBChE-expressing cells affect cocaine-induced reinstatement of drug-seeking, hBChE-expressing cells were grafted in mice that previously acquired cocaine CPP. Following 10 days of recovery, we performed extinction training and drug-elicited reinstatement. After a priming dose of cocaine injection, the preference for the previously cocaine-associated environment was restored in the GWT mice but not in the GhBChE mice (
To test the feasibility of cutaneous gene therapy with human epidermal progenitor cells, we cultured human skin organoids from primary epidermal keratinocytes isolated from human newborn foreskin. To perform CRISPR-mediated genome editing in human cells, we developed vectors encoding two gRNAs targeting human AAVS1 (adeno-associated virus integration site 1) locus, and an AAVS1-targeting vector (
This study demonstrates for the first time that grafted skin stem cells expressing hBChE can be highly drug-specific in addressing several key aspects of cocaine abuse including reducing development of cocaine-seeking, preventing cocaine-induced reinstatement of drug-seeking and protecting against acute cocaine overdose. Because of the high levels of hBChE present, this approach is very efficient with little individual variation. Cutaneous gene delivery with engineered epidermal stem cells may provide therapeutic opportunities for drug abuse or co-abuse beyond cocaine.
For instance, glucagon-like peptide 1 (GLP1) is a major physiological incretin that controls food intake and glucose homeostasis (Sandoval et al., 2015). Several GLP1 receptor agonists have been approved by the FDA to treat type II diabetes. Our recent study indicates that skin-derived expression of GLP1 can effectively correct diet-induced obesity and diabetes in mice (Yue et al., 2017). Interestingly, GLP1 receptor agonists can also attenuate the reinforcing properties of alcohol and nicotine in rodents (Skibicka, K. P., The central GLP-1: implications for food and drug reward. Front Neurosci. 7, 181 (2013); Egecioglu et al. The glucagon-like peptide 1 analogue Exendin-4 attenuates alcohol mediated behaviors in rodents. Psychoneuroendocrinol. 38, 1259-1270 (2013); Shirazi et al., Gut peptide GLP-1 and its analogue, Exendin-4, decrease alcohol intake and reward. PLoS One. 8, e61965 (2013); Vali& et al. The glucagon-like peptide 1 receptor agonist liraglutide attenuates the reinforcing properties of alcohol in rodents. Addict. Biol. 21, 422-437 (2016)). Thus, future studies will determine whether a constitutive or inducible expression of GLP1 from skin transplants can reduce alcohol and nicotine use and relapse in patients with alcohol use disorder and nicotine dependence. Additionally, it will be important to investigate whether co-expression of hBChE and GLP1 in skin can be used for treatment of alcohol and cocaine and ethanol and nicotine co-abuse, which occurs with high frequency and significantly increases the risk of drug-related morbidity and mortality.
Epidermal stem cells of the skin provide an ideal platform for ex vivo gene therapy, allowing efficient genetic manipulation with minimal risk of tumorigenesis or other detrimental complications in vivo. Cultured human epidermal progenitor cells have been used to generate CEA (cultured epidermal autograft), which has been clinically used to treat massive burn wounds for decades. Engineered skin stem cells and CEA have also been used to treat other skin diseases, including vitiligo and skin genetic disorders, such as epidermolysis bullosa. The regenerated skin is stable in vivo and can last for long term in the clinical follow-up studies. As such, the cutaneous gene therapy is long-lasting, minimally invasive and safe.
Gene therapy-derived products can be recognized as foreign antigens by the host immune system, which may mount an immune response leading to the neutralization of the therapeutic molecules or the clearance of genetically modified cells (Collins and Thrasher, 2015). Our skin transplantation model built with WT isogenic animals provides a unique approach to examine this process in vivo. Skin epidermal keratinocytes have low immunogenicity. Within normal skin epidermis, the Langerhans cells function as the only cell type that expresses major histocompatibility complex (MHC) class II and presents antigen. Epidermal keratinocytes are considered as “non-professional” antigen presenting cells. Thus, in skin substitute generated from epidermal progenitor cells, without the presence of Langerhans cells or leukocytes as antigen presenting cells, potential antigenicity and immunogenicity are significantly reduced. Consequently, engineered skin grafts are generally well taken and immunologically tolerated in WT isogenic animals. Indeed, skin-derived expression of hBChE in host mice with intact immune systems can be stable for more than 10 weeks without significant decrease in the serum level of engineered enzyme, strongly suggesting that the low immunogenicity of skin environment may help to reduce the antigenicity and immune reaction toward hBChE. Moreover, the oldest GhBChE mice are 6 months old and healthy with no tissue rejections lending further support for the long-lasting feasibility of cutaneous gene therapy targeting cocaine abuse. Taken together, these results show promise for cutaneous gene therapy as a safe and cost-effective therapeutic option for cocaine abuse in the future.
Alcohol use disorder (AUD) is one of the foremost public health problems. AUD involves problems controlling drinking, continuing to use alcohol even when it causes problems, having to drink more to get the same effect, or having withdrawal symptoms when one decreases or stops drinking (Koob et al. Neurobiology of addiction: a neurocircuitry analysis. Lancet Psychiatry 3, 760-773 (2016); Koob, G. F. Neurocircuitry of alcohol addiction: synthesis from animal models. Handb. Clin. Neurol. 125, 33-54 (2014)). 7.2 percent or 17 million adults in the United States ages 18 and older had an AUD in 2012 (Grant et al. Epidemiology of DSM-5 alcohol use disorder: results from the national epidemiologic survey on alcohol and related conditions III. JAMA Psychiatry 72, 757-766 (2015)). There are three FDA-approved medications and behavioral counseling for stopping or reducing drinking and preventing relapse in humans (Johnson, B. A. Update on neuropharmacological treatments for alcoholism: scientific basis and clinical findings. Biochem. Pharmacol. 75, 34-56 (2008)). However, only 1.3 million receive treatment (NIAAA, 2015). Moreover, not all people respond to these medications and types of treatment, and not all people follow the treatment regimens offered (Cohen et al. Alcohol treatment utilization: findings from the national epidemiologic survey on alcohol and related conditions. Drug Alcohol Depend. 86, 214-221 (2007)). Consequently, additional approaches are needed for combating AUD. Indeed, if a treatment were available that prevented an individual from desiring to consume alcohol, such a treatment could ultimately lead to the individual stopping consumption of alcohol.
Glucagon-like peptide 1 (GLP1) is a gastrointestinal peptide and a major physiological incretin that controls food intake and glucose homeostasis (Sandoval et al. 2015). Several GLP1 receptor agonists have been approved by the FDA to treat type II diabetes. Interestingly, GLP1 receptor agonists can also attenuate the reinforcing properties of alcohol in rodents (Skibicka, K. P., The central GLP-1: implications for food and drug reward. Front Neurosci. 7, 181 (2013); Egecioglu et al. The glucagon-like peptide 1 analogue Exendin-4 attenuates alcohol mediated behaviors in rodents. Psychoneuroendocrinol. 38, 1259-1270 (2013); Shirazi et al., Gut peptide GLP-1 and its analogue, Exendin-4, decrease alcohol intake and reward. PLoS One. 8, e61965 (2013); Vallöf et al. The glucagon-like peptide 1 receptor agonist liraglutide attenuates the reinforcing properties of alcohol in rodents. Addict. Biol. 21, 422-437 (2016); Sorensen et al. Effects of the GLP-1 agonist Exendin-4 on intravenous ethanol self-administration in mice. Alcohol Clin. Exp. Res. 40, 2247-2252 (2016); Suchankova et al. The glucagon-like peptide-1 receptor as a potential treatment target in alcohol use disorder: evidence from human genetic association studies and a mouse model of alcohol dependence. Transl. Psychi. 5, e583 (2015)).
While GLP1 may be potentially used in treating AUD (Suchankova et al. 2015), the native GLP1 must be delivered through a parenteral route to achieve its effect, and it has an extremely short circulating half-life (Sandoval and D'Alessio, 2015). Therefore, the somatic gene transfer approach used in Example No. 2 was used to determine the efficacy of GLP1 in treating AUD in mice.
Unless indicated to the contrary, reagents and experimental procedures follow those described in Example No. 2 above.
Modified GLP1
The GLP1 gene (mGLP1 or DImGLP1) was modified to produce a novel protein with longer half-life in vivo (Kumar et al., Gene therapy of diabetes using a novel GLP-1/IgG1-Fc fusion construct normalizes glucose levels in db/db mice. Gene therapy 14, 162-172, (2007)). To be able to stably deliver mGLP1 in vivo and control its expression, we made a Rosa26-targeting vector encoding a Gly8-mutant mGLP1 and mouse IgG-Fc fragment fusion protein (SEQ ID NO: 45) driven by a dox-dependent promoter (
Fusion with IgG-Fc further enhances mGLP1 stability and circulation half-life when expressed in epidermal cells (Kumar et al., 2007), and it can pass the blood-brain barrier to reach the brain (Pardridge, W. M., CSF, blood-brain barrier, and brain drug delivery. Expert Opin. Drug Deliv. 13, 963-975 (2016)). The Rosa26 allele has been widely used as a safe locus for gene targeting in mice (Soriano, P., Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genetics 21, 70-71, (1999)). To use CRISPR-mediated genome editing, vectors encoding the D10A mutant Cas9 (CRISPR associated protein 9) (Ran et al., 2013) and two gRNA (guide RNA) targeting the mouse Rosa26 allele were developed. The D10A mutation in Cas9 and double nicking system reduce the undesired off-target mutagenesis in the genome to a minimum level (Ran et al., 2013).
Skin Organoid Culture and Transplantation
The epidermal progenitor cells were isolated from newborn pups of CD1 or C57BL/6J mice. Cells were transfected with the targeting vector and plasmids encoding Cas9 and Rosa26-specific gRNAs. Targeted clones were selected in the medium containing puromycin, and correct incorporation into the Rosa26 locus was confirmed by PCR and southern blots (
When fed with dox food, GGLP1 mice began to display significantly enhanced levels of mGLP1 in the blood within 3 days (
mGLP1 expression attenuated ethanol-induced CPP in GLP1 mice (
GLP1 mice did not exhibit significant ethanol-induced CPP. Following 2 free explorations (Pre-test) on day 1, separate groups of GLP1 and GWT mice (n=9 each) received alternative ethanol (2 g/kg) and saline i.p. injections twice daily for the next 4 days, as previously described (Chen et al., Dopamine D1 and D3 receptors are differentially involved in cue-elicited cocaine seeking. J. Neurochem. 114, 530-541 (2010); Kong et al., Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine. Neurosci. 176, 152-161 (2011)). CPP expression was tested on day 6. Results represent mean±SEM time spent on the drug-paired side minus the saline-paired side. Repeated-measures ANOVA with test days as the within group factor and status of grafting as the between-subject factor were used (Chen et al., 2010; Kong et al., 2011). F value was calculated and Newman-Keuls post-hoc test was performed (Chen et al., 2010; Kong et al., 2011). GLP1 and GWT mice were on dox food for the entire duration.
These results demonstrate that mGLP1 expression attenuated ethanol-induced CPP. Therefore, tissue organoids expressing mGLP1 have the potential for treating AUD. In addition, Egecioglu et al., also reported that GLP-1 receptor agonist, Exendin-4 (Ex4) attenuates nicotine-induced locomotor stimulation, accumbal dopamine release, and the expression of conditioned place preference in mice (Egecioglu et al., 2013). Therefore, it is believed that tissue organoids expressing mGLP1 can also be used to treat nicotine addiction. It follows that tissue organoids expressing mGLP1 can also be used to treat individuals with AUD who are addicted to nicotine at the same time. Moreover, it is believed that tissue organoids designed to express multiple therapeutic agents, such as mGLP1 and hBChE can be used to reduce incidents of cocaine and ethanol and/or nicotine co-abuse and potentially reduce abuse and co-abuse of other drugs, such as amphetamines (see Skibicka K. P. The central GLP-1: implications for food and drug reward, Front Neurosci. 7:181 (2013)). It is also contemplated herein to that GLP-1 analogs (see above) can be employed in a similar fashion.
Alcoholism is a debilitating disease characterized by dependence on alcohol consumption and is often associated with social and/or health problems. Medications are available to treat alcoholism that discourage alcohol consumption by causing nausea when consuming alcohol, by reducing the pleasure associated with drinking, or by reducing the craving for alcohol. However, as with all medications, treatment compliance is difficult. Treatment compliance is further complicated when the medications are for breaking an addiction and require self-administration. Therefore, automatic administration of a therapeutic agent for combatting alcoholism induced when alcohol is consumed would be desirable.
Therefore, a tissue organoid engineered to express one or more alcohol-inducible genes encoding a spider-derived pain peptides, such as DkTx (S2-DkTx; SEQ ID NO: 36) or VaTx (S2-VaTx3; SEQ ID NO: 35) is prepared as described above (see
After engineering an alcohol-inducible therapeutic tissue organoid, the organoid is transplanted into mice before and after training mice in a two-bottle choice paradigm. This paradigm tests how well the system works for protecting mice from acquiring or relapsing into alcohol drinking. In the mouse housing cages, there are two liquid bottles with one containing regular drinking water, and the other a certain percentage of an alcohol solution. The amount of alcohol or water consumption is measured daily. Previous work has established that mice prefer drinking alcohol over water over a period, reflecting the rewarding effects of alcohol.
Therefore, with an alcohol-inducible therapeutic tissue organoid implanted, mice are expected to never develop the preference (acquisition) or relapse into alcohol drinking (relapse).
Similarly, a human patient with a biointegrated tissue organoid, according to this example, experiences 1) pain or discomfort from the expressed toxin and 2) lack of reward from the expressed GLP-1/GLP-1 analog when alcohol metabolites activate the expression of the therapeutic agent (e.g., a spider-derived toxin and GLP-1 or GLP-1 analog). In this way, the therapeutic agents expressed in response to alcohol metabolites work synergistically, and the patient is disinclined to drink.
Silent heart attacks have few or no overt “classical” symptoms, such as chest pressure, chest heaviness, arm pain, neck pain, jaw pain, shortness of breath, sweating, extreme fatigue, dizziness, and nausea. However, though nearly half of heart attacks are silent, they are correlated with similar risk of death as “overt” heart attacks, and if successfully diagnosed, they may treated with similar medications and lifestyle changes. Therefore, the ability to monitor factors indicative of silent heart attacks would be beneficial, such as Heart-type Fatty Acid-Binding Protein (H-FABP) and myocardial myoglobin.
A tissue organoid engineered to report occurrence of a silent heart attack is prepared as described above using a targeting vector harboring genes encoding reporter molecules specific for H-FABP (SEQ ID NO: 62) and myocardial myoglobin (SEQ ID NO: 63).
Cerebrovascular accidents or “strokes” are the sudden death of brain cells due to lack of oxygen when the blood flow to the brain is impaired by blockage or blood vessel rupture. Glial fibrillary acidic protein (GFAP) (SEQ ID NO: 64) is a biomarker associated with symptoms of acute stroke. S100B (SEQ ID NO: 65) is a marker associated with astrocyte damage and increased BBB permeability associated with stroke. The ability to monitor such markers of strokes would permit earlier intervention when an individual experiences a stroke.
Therefore, a tissue organoid engineered to report occurrence of a stroke is prepared as described herein using a targeting vector harboring genes encoding reporter molecules specific for GFAP (SEQ ID NO: 64) and S100B (SEQ ID NO: 65).
PKU is the most prevalent inherited disease involving the metabolism of amino acids. It results from mutations in the gene encoding a key hepatic enzyme, phenylalanine hydroxylase (PAH), which catalyzes the hydroxylation reaction that converts phenylalanine to tyrosine. If untreated, PKU will lead to a dramatic increase of plasma phenylalanine levels, causing profound and irreversible mental disability, epilepsy, and other behavioral problems. The current treatment of PKU is stringent dietary restriction of natural protein intake and supplementation of amino acids other than phenylalanine by a chemically manufactured protein substitute, which can prevent most of the complications of the disease after birth. However, it has been well documented that neuropsychological deficits still exist for patients with dietary restriction, and maintaining the dietary control has been proven difficult, especially in adolescents, young adults, and pregnant women. Somatic gene therapy holds the potential for development of more effective treatment for PKU.
Although PAH is naturally a hepatic enzyme, it has been speculated that circulating phenylalanine could be adequately cleared by ectopic expression of PAH in tissues other than liver, such as T cells, muscle cells, and skin epidermal cells. However, a potential issue is that catalytic activity of PAH requires a non-protein cofactor, BH4 (tetrahydrobiopterin), which is synthesized de novo from guanosine triphosphate in hepatocytes by a three-enzyme pathway involving GTP cyclohydrolase I (GTPCH), 6-pyruvoyltetrahydrobiopterin synthase (PTPS), and sepiapterin reductase (SR). Without sufficient supplement of BH4 or reconstitution of the BH4 synthetic pathway, ectopic expression of PAH cannot function properly. Transgenic mice that express both PAH and GTPCH, the rate limiting enzyme for BH4 synthesis, under various skin specific promoters cannot sufficiently rescue the phenylalanine defects in vivo, suggesting that alternative approaches must be pursued to convert skin epidermis to an effective “phenylalanine sink.”
Enzyme replacement therapy has been proposed for treatment of PKU. Phenylalanine ammonia-lyase (PAL) is an attractive alternative for clearance of phenylalanine. PAL can carry out non-oxidative deamination of L-phenylalanine to form ammonia and trans-cinnamic acid (cinnamate), which can be excreted as hippurate in urine, along with small amounts of cinnamic and benzoic acid. Unlike PAH, PAL is an autocatalytic enzyme that requires no cofactors, making it a simple and effective way to remove plasma phenylalanine.
Preliminary results in mouse epidermal keratinocytes show efficient expression of PAL upon infection with lentivirus encoding PAL and degradation of phenylalanine in culture media much faster than cells expressing PAH. Exogenous expression of PAL in epidermal progenitor cells does not significantly alter cell proliferation or differentiation in vitro, and the cells readily generate skin organoids when cultured on top of acellularized dermis. Therefore, using CRISPR-mediated genome editing with epidermal progenitor cell technology the possibility for treatment of PKU by cutaneous expression of PAL is investigated.
The mouse model of PKU has been developed by ENU (N-ethyl-N-nitrosourea)-mediated mutagenesis in BTBR strain (Jax strain 002232).
With establishment of skin engraftment in PAH mutant mice, plasma phenylalanine level are monitored. Three weeks post skin grafting with PAL expressing cells or control cells (BTBR epidermal progenitor cells treated with control vectors), blood samples are collected from the tail clipping biweekly for up to 30 weeks. Plasma is separated by centrifugation. Phenylalanine concentration is determined by established fluorometric protocol. Lowering of phenylalanine level restores melanin biosynthesis, and leads to a change of fur color. Potential alteration in fur coat color is recorded weekly for all the grafted animals. It has been demonstrated before that treatment of PKU has gender-dependent response, for both viral vector-mediated therapy and enzyme replacement therapy with modified PAL. Thus, two different cohorts of animals (male and female) are established to test the potential gender-dependent effect of cutaneous gene therapy in vivo.
At the endpoint of the experiment (30 weeks), grafted animals are euthanized and tissue samples (grafted skin, host skin, and liver) are collected. Presence of enzyme activity in the tissues is determined by PAH and PAL activity assay.
In vitro analysis demonstrated that exogenous expression of PAL in mouse epidermal cells can clear ˜120 nmol of phenylalanine/hour/106 cells. Thus, two 1 cm2 epidermal grafts that contain ˜2×107 metabolically active cells is likely to remove 57 pmol of phenylalanine per day, which would be sufficient for a complete reversal of hyperphenylalaninemia (PAH mutant mice usually have ˜2 mM of plasma phenylalanine). A complete phenotypic change from brown hair coat to dark black fur is also expected. For tissue enzymatic analysis, PAL activity detection in grafted skin is expected but not in other tissues. PAH activity is absent in the liver of the mutant mice. Female mice are more resistant to PKU therapy. If this is the case for cutaneous gene therapy, female PAH mutant mice are tested to determine whether they require larger skin grafts or more grafts than male mice for correction of hyperphenylalaninemia.
One potential issue is that overexpression of PAL can lead to excessive removal of phenylalanine in mice and cause hypophenylalaninemia, which has been reported for human PKU patients receiving enzyme replacement therapy with recombinant PAL. If this occurs, a Tet (tetracycline)-inducible system to drive PAL expression as described above can be used. Expression level of PAL can be controlled by administration of different dose of Doxycycline.
Approach 1: Express PAL Gene in Grafted Cells
Although exogenous expression of PAL does not alter cell proliferation or differentiation program in mouse epidermal keratinocytes, expression of PAL could impair human keratinocyte growth or skin regeneration. If this occurs, a Tet-inducible system to drive PAL gene expression is used (see
Approach 2: Immune Intolerance of PAL
If exogenous expression of PAL indeed leads to a severe immune response that cannot be suppressed, expression of PAH, the natural phenylalanine processing enzyme, is tested for use in treatment of PKU. Although PAH requires BH4 as cofactor, it has been shown that co-expression of GTPCH and PTPS together with PAH in muscle can result in stable and long-term reduction of plasma phenylalanine in mice model. Therefore, a Rosa26 targeting vector harboring a triple-cistronic expression cassette encoding PAH (SEQ ID NO: 54), GTPCH (SEQ ID NO: 55), and PTPS (SEQ ID NO: 56) is developed.
Targeted epidermal progenitor cells are examined both in vitro and in vivo for phenylalanine clearance and potential therapeutic effect for PKU. If co-expression of PAH, GTPCH, and PTPS is not sufficient, a Rosa26 targeting vector harboring a quadruple-cistronic expression cassette encoding PAH, GTPCH, PTPS, and SR (SEQ ID NO: 57) is developed to reconstitute the entire BH4 de novo synthesis pathway in a tissue organoid.
Hemophilia is an inherited blood clotting disorder caused by a deficiency of clotting Factor VIII (type A) or IX (type B) in the blood plasma. The unstoppable bleeding itself can be life-threatening, but hemophiliacs usually also suffer from recurrent bleeding into soft tissues, joints and muscles, leading to chronic synovitis, crippling arthropathy and physical disability. Hemophilia is an excellent candidate for cutaneous gene therapy because both Factor VIII and IX are secreted proteins and, therefore, their exogenous expression in epidermal cells could correct the deficiency. In addition, particularly for hemophilia A, the coding sequence of Factor VIII is more than 7 kb (kilobase), far beyond the packaging limitation of typical viral vectors used for gene therapy, such as AAV (adeno-associated virus) vectors. Somatic gene therapy in skin provides a more sustained and affordable treatment for hemophilia A than the current standard therapy by intravenous infusions with purified Factor VIII.
Previous work has demonstrated that Factor VIII and IX can be expressed in human or mouse epidermal keratinocytes, and exogenously expressed clotting factors can pass the epidermal/dermal barrier to reach the circulation. Particularly, when transgenic skin that expresses Factor VIII under the involucrin promoter is grafted onto immunocompromised hosts (Factor VIII and Rag1 double knockout), epidermal expression of Factor VIII significantly restores the plasma Factor VIII level, strongly supporting the feasibility of treatment of hemophilia A with cutaneous gene therapy approach.
A Factor VIII expression gene with B domain deletion (SEQ ID NO: 58) is envisioned, where the B domain, which is a long internal domain and functionally disposable for blood coagulation is removed. The transfection targeting vector is envisioned to further incorporate a Tet-inducible system to control excessive expression of Factor VIII.
Development of an inhibitory antibody against Factor VIII is the most severe complication of current enzyme replacement therapy. If expression of mouse Factor VIII in the mutant mice (Factor VIII-deficient) induces antibody production, three approaches are employed:
For Hemophilia B, similar approaches are taken as those described above using Factor IX.
Development of skin engraftment procedures with immunocompetent mice provides a unique opportunity to evaluate potential immune responses after cutaneous gene therapy. To examine potential inflammatory infiltration in vivo upon tissue organoid engraftment, grafted skin tissues are collected at different time points post engraftment. Potential infiltration of immune cells are assessed by immunofluorescence staining with α-CD3, α-CD4, α-CD8 (T cell), α-B220 (B cell), α-CD11c (dendritic cell), α-Mac-1 (macrophage), α-CD335 (NK cells), and α-Gr1 (granulocytes) antibodies. The presence of Langerhans cells in the skin grafts is determined by staining with an α-CD1a antibody. In addition, skin samples are stained for MHC class I and II antigens, including HLA-ABC and HLA-DR, as indicators for potential graft rejection, tissue antigenicity, and epidermal reactivity.
As a secondary approach, immune responses are assessed by flow cytometry (fluorescence-activated cell sorting), which allows for a more comprehensive and quantitative analysis of immune cell populations. For this purpose, specific panels of antibodies are developed to more closely examine the phenotypes of immune cells that are changing in response to engraftment. These experiments are guided by results from immunofluorescence staining of sections. For example, if differences in the number and/or location of macrophages in stainings are seen, then a ‘macrophage panel’ is set up that allows determination of whether the recruited macrophages adopt a pro-inflammatory M1 (CD38, CD274, CD319) or an anti-inflammatory M2 (CD206, CD163, TFRC) phenotype using surface markers. Similarly, if the staining experiments indicate a T-cell response, then a ‘T cell panel’ comprised of CD3 (all T cells), CD4 (helper T cell), CD8 (killer T cell), FoxP3/CD25 (regulatory T cell), and CD44/CD62L (activated T cell) is implemented. Understanding the precise nature of the immune response (i.e., immunogenic vs. tolerogenic) is required to determine whether the host response to engraftment requires modulation.
To determine whether engraftment of modified-epidermis can increase the host white blood cells specific for grafted keratinocytes, in vitro cellular proliferation assay are carried out. Peripheral blood mononuclear cells (PBMC) are isolated before and after skin transplantation, and assessed for cellular proliferation assay with either irradiated autologous PBMC or irradiated epidermal progenitor cells with modified expression. Phytohemagglutinin is used as a positive control.
To examine NK (natural killer) cells activity toward epidermal progenitor cells, PBMC isolated from grafted animals are used. An in vitro cytotoxicity assay is performed to determine the activity of NK cells at different effector: target ratios. A NK-sensitive cell line is used as a positive control.
To examine the immunogenicity of the modified protein, blood samples from grafted animals at different time points (up to 6 months) are collected. Serum antibody levels are determined by ELISA (enzyme-linked immunosorbent assay) analysis. As a positive control, an intravenous injection of the recombinant modified protein is injected into the mice.
Biointegrated tissue organoids can be for temporary use and removed surgically. However, skin stem cell technology permits another non-invasive and effective way to achieve clearance of grafted cells.
To test this possibility, a Rosa26 targeting vector encoding phenylalanine ammonia lyase (PAL) (SEQ ID NO: 51) together with inducible “suicide” genes HSV-TK (Herpes Simplex Virus Thymidine Kinase) (SEQ ID NO: 52) and yCD (yeast cytosine deaminase) (SEQ ID NO: 53) was used for epidermal progenitor cell transfection. Results (data not shown) indicate that both suicide genes were expressed safely in epidermal progenitor cells, and efficiently induced cell death upon treatment with prodrugs (ganciclovir and 5-fluorocytosine, respectively).
A potential issue is that high level of suicide gene expression (TK or yCD) may lead to bystander effect that causes cell death in the surrounding tissue. To prevent this, a Tet promoter can be used to drive the suicide gene expression resulting in suicide gene expression levels being controlled by administration of doxycycline.
Therefore, tissue organoids are contemplated that encode a reporter molecule and/or a therapeutic agent along with an inducible suicide gene to remove the biointegrated tissue organoid by non-surgical means.
Recent reports have shown that nearly 40% of American adults and approximately 20% of children are obese. Peptide YY (PYY) (SEQ ID NO: 66) is associated with hunger and satiation and is released from cells in the ileum and colon in response to feeding. Increased levels of PYY are believed to be associated with satiation. The administration of PYY, in accordance with the present disclosure, may allow those that suffer from obesity to decrease their food intake, thereby making it possible for them to not only lose weight, but maintain weight loss.
Therefore, a tissue organoid engineered to treat and/or prevent obesity is prepared as described herein using a targeting vector encoding PYY (SEQ ID NO: 66). It is anticipated that increased PYY levels will decrease craving in individuals receiving the PYY-expressing tissue organoid. As a result, it is anticipated that the individuals will experience decreased food seeking and consumption thereby treating and/or preventing obesity.
The global anti-aging market is estimated to be $250 Billion. Effects of aging include, but are not limited to, vascular and heart diseases and decreases in immune response. Tissue inhibitor of metalloproteinases 2 (TIMP2) (SEQ ID NO: 67) encodes a protein that is a natural inhibitor of matrix metalloproteinases (MMP). TIMP2 is found in high concentrations very early in age but declines with age. Memory studies with mice have shown that older mice perform comparably with younger mice following injections with TIMP2 (Castellano et al., Nature, 544, 488-492 (2017)). Controlled administration of TIMP2 may have anti-aging effects such as memory improvement.
Therefore, a tissue organoid engineered to treat and/or prevent the effects of aging is prepared as described herein using a targeting vector encoding TIMP2 (SEQ ID NO: 67). It is anticipated that increased TIMP2 levels will exhibit anti-aging effects in individuals receiving the TIMP2-expressing tissue organoid. As a result, it is anticipated that treated individuals can experience a decrease in the negative effects of aging, which can include memory loss, reduced vascular response, and/or reduced immune response.
Similarly, tobacco use is a major cause of death from cardiovascular disease, pulmonary disease and cancer (Nature, 362, 2295-2303 (2010)). The Center for Disease Control claims that nearly 480,000 people die each year from tobacco-related deaths. It has been long determined that nicotine is responsible for the additive properties of tobacco. Nicotine replacement therapies which include the transdermal nicotine patch and nicotine gum were the first FDA approved treatments for use in smoking cessation. While nicotine replacement is commonly used, other forms of treatment are available which include antibdepressant bupropion (National Institute on Drug Abuse, Tobacco/Nicotine, Research Report Series (2012). Despite the numerous treatments available, nicotine abuse still remains prevalent. Egecioglu et al., reported that GLP-1 receptor agonist, Exendin-4 (Ex4) attenuates nicotine-induced locomotor stimulation, accumbal dopamine release, and the expression of conditioned place preference in mice (Egecioglu et al., 2013). Therefore, it is believed that tissue organoids expressing mGLP1 can also be used to treat nicotine addiction.
Unless indicated to the contrary, reagents and experimental procedures follow those described in Example No. 2 above.
Modified GLP1
The GLP1 gene (mGLP1) was modified to produce a novel protein with longer half-life in vivo (Kumar et al., Gene therapy of diabetes using a novel GLP-1/IgG1-Fc fusion construct normalizes glucose levels in db/db mice. Gene therapy 14, 162-172, (2007)). To be able to stably deliver mGLP1 in vivo and control its expression, we made a Rosa26-targeting vector encoding a Gly8-mutant mGLP1 and mouse IgG-Fc fragment fusion protein (SEQ ID NO: 45) driven by a dox-dependent promoter (
Fusion with IgG-Fc further enhances mGLP1 stability and circulation half-life when expressed in epidermal cells (Kumar et al., 2007), and it can pass the blood-brain barrier to reach the brain (Pardridge, W. M., CSF, blood-brain barrier, and brain drug delivery. Expert Opin. Drug Deliv. 13, 963-975 (2016)). The Rosa26 allele has been widely used as a safe locus for gene targeting in mice (Soriano, P., Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genetics 21, 70-71, (1999)). To use CRISPR-mediated genome editing, vectors encoding the D10A mutant Cas9 (CRISPR associated protein 9) (Ran et al., 2013) and two gRNA (guide RNA) targeting the mouse Rosa26 allele were developed. The D10A mutation in Cas9 and double nicking system reduce the undesired off-target mutagenesis in the genome to a minimum level (Ran et al., 2013).
Skin Organoid Culture and Transplantation
The epidermal progenitor cells were isolated from newborn pups of CD1 or C57BL/6J mice. Cells were transfected with the targeting vector and plasmids encoding Cas9 and Rosa26-specific gRNAs. Targeted clones were selected in the medium containing puromycin, and correct incorporation into the Rosa26 locus was confirmed by PCR and southern blots (
When fed with dox food, mGLP1 mice began to display significantly enhanced levels of mGLP1 in the blood within 3 days (
GLP1 expression attenuated nicotine-induced CPP in GLP1 mice (
GLP1 mice did not exhibit significant nicotine-induced CPP. Following 2 free explorations (Pre-test) on day 1, separate groups of mGLP1 and GWT (n=7 each) received alternative nicotine (0.4 mg/kg) and saline i.p. injections twice daily for the next 4 days, as previously described (Chen et al., Dopamine D1 and D3 receptors are differentially involved in cue-elicited cocaine seeking. J. Neurochem. 114, 530-541 (2010); Kong et al., Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine. Neurosci. 176, 152-161 (2011)). CPP expression was tested on day 6. Results represent mean±SEM time spent on the drug-paired side minus the saline-paired side. Repeated-measures ANOVA with test days as the within group factor and status of grafting as the between-subject factor were used (Chen et al., 2010; Kong et al., 2011). F value was calculated and Newman-Keuls post-hoc test was performed (Chen et al., 2010; Kong et al., 2011). GLP1 and GWT mice were on dox food for the entire duration.
These results demonstrate that mGLP1 expression attenuated nicotine-induced CPP. Therefore, tissue organoids expressing mGLP1 have the potential for treating nicotine abuse. Moreover, it is believed that tissue organoids designed to express multiple therapeutic agents, such as mGLP1 and hBChE can be used to reduce incidents of cocaine and ethanol and/or nicotine co-abuse and potentially reduce abuse and co-abuse of other drugs, such as amphetamines (see Skibicka K. P. The central GLP-1: implications for food and drug reward, Front Neurosci. 7:181 (2013)). It is also contemplated herein to that GLP-1 analogs (see above) can be employed in a similar fashion.
GAGTGCCGCTGGTACCTGGGCGGCTGCAAGGAG
GACTCCGAGTGCTGCGAGCACCTGCAGTGCCAC
TCCTACTGGGAGTGGTGCCTGTGGGACGGCTCC
TTC
CGACGGAAGCGAGGGATATCGGCCATGGTT
FURIN SITE-> IGG-FC
FURIN SITE-> IGG-FC
Having described the invention in detail and by reference to specific aspects and/or embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. More specifically, although some aspects of the present invention may be identified herein as particularly advantageous, it is contemplated that the present invention is not limited to these particular aspects of the invention.
This application is a continuation application of U.S. application Ser. No. 16/467,754, filed Jun. 7, 2019, which is a national stage application under 35 U.S.C. § 371 of International Application No. PCT/US2017/065374, filed Dec. 8, 2017, which claims the benefit of U.S. Provisional Application No. 62/432,346, filed Dec. 9, 2016; U.S. Provisional Application No. 62/432,350, filed Dec. 9, 2016; and U.S. Provisional Application No. 62/554,560, filed Sep. 5, 2017, the disclosures of each of which are explicitly incorporated by reference herein.
This invention was made with government support under grant number R01AR063630 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62432346 | Dec 2016 | US | |
| 62432350 | Dec 2016 | US | |
| 62554560 | Sep 2017 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16467754 | Jun 2019 | US |
| Child | 18171694 | US |
