Transgenic mouse model for prostate cancer

Abstract

Several lines of transgenic mice have been generated using the prostate-specific rat probasin (PB) gene promoter to drive expression of the SV40 T antigen (Tag) coding region. Mice expressing high levels of the transgene specifically display progressive forms of prostatic cancer that histologically resemble human prostate cancer ranging from mild prostatic intraepithelial neoplasia (PIN) to large multinodular malignant adenocarcinoma with metastasis. Adenocarcinomas of the prostate have been detected as early as 10 weeks of age with extracapsular extension (ECE) and seminal vesicle invasion (SVI). Immunohistochemical analysis of tumor tissue has demonstrated that dorsolateral prostate-specific secretory proteins were confined to well differentiated ductal epithelial cells adjacent to, or within the poorly differentiated tumor mass. Prostate tumors in the mice also display elevated levels of nuclear p53, and a decreased heterogenous pattern of androgen receptor (AR) expression as observed in advanced human prostate cancer. The establishment of breeding lines of transgenic mice that reproducibly develop prostate cancer with metastasis provides a unique animal model system to study the molecular basis of transformation of normal prostatic cells and the factors influencing the progression to metastatic prostate cancer.

Description

FIELD OF THE INVENTION

The present invention is concerned with a novel transgenic non-human eukaryotic animal model and in vitro cell lines derived from transgenic animal tissues, which permit 1) development of methodologies for the identification, diagnosis and staging of prostate cancer and resulting metastatic disease and 2) the development and rapid screening of organic and inorganic chemical compounds, agents including radiation, and gene-based therapies for the prevention and treatment of prostate cancer and resulting metastatic disease.

BACKGROUND TO THE INVENTION

Prostate Cancer

Prostate cancer will likely claim the lives of 35,000 men in the United States this year alone and some 200,000 more men will be diagnosed with the disease (Silverger, Boring & Squires, 1990). However, progress toward understanding the biology of prostate cancer and the development of new therapies for this disease has been slowed, in part, by the need for new in vivo model systems that adequately reproduce the spectrum of benign, latent, aggressive and metastatic forms of the human disease.

Prostate cancer is a disease quite unique to man. Although naturally occurring prostatic disease has been reported in some canine (Berry, Coffey, & Ewing, 1984) and rodent (Noble, 1977; Pollard, 1973; Pollard & Luckert, 1987; Shain, McCullough, Nitchuk, & Boesel, 1977; Shain, McCullough, & Segaloff, 1975) species, these animals have not provided the appropriate models to adequately study the molecular mechanisms related to the early development and progression of human prostate cancer. To this end, we initiated a research program to establish a transgenic animal model for prostate cancer using a prostate-specific transgene expression system that has been developed based on the regulatory elements of the rat probasin (rPB) gene.

Probasin Gene

The rPB gene encodes an androgen- and zinc-regulated protein specific to the dorsolateral epithelium (Dodd, Sheppard & Matusik, 1983; Matusik, Kreis, McNicol, Sweetland, Mullin, Fleming, et al., 1986; Sweetland, Sheppard, Dodd & Matusik, 1988). Isolation of the rPB gene has facilitated identification of cis-acting androgen response regions within the 5' flanking region (Rennie, Bruchovsky, Leco, Sheppard, McQueen, cheng, et al., 1993). More recently, the ability of the prostate specific rPB gene promoter to target heterologous genes specifically to the prostate in transgenic mice has been demonstrated (Greenber, DeMayo, Sheppard, Barrios, Lebovitz, Finegold, et al., 1994). In these studies, an expression cassette carrying 426 base pairs (bp) of the rPB gene promoter and 28 bp of 5' untranslated region (5'UT) was found to be sufficient to target expression of a bacterial chloramphenicol acetyl transferase (CAT) reporter gene specifically to the prostatic epithelium. These studies demonstrated that the minimal rat probasin promoter was specifically regulated by androgens in vivo with the ability to target developmentally- and hormonally- regulated expression of a heterologous gene specifically to the prostate in transgenic mice.

The latter studies, showing prostate-specific targeting of heterologous gene expression products is described in the aforementioned U.S. Ser. No. 08/351,365 and published in the corresponding WO 94/03594, the disclosures of which are incorporated herein by reference.

SV40 T Antigen

The SV40 early region-tumor antigens (Tag) have the ability to induce transformation in vivo (Brinstar, Chen, Messing, Van Dyke, Levine, & Palmiter, 1984). The SV40 large T antigen acts as an oncoprotein through interactions with the retinoblastoma(Rb) (DeCaprio, Ludlow, Figge, Shew, Huang, Lee, et al., 1988) and p53 (Lane & Crawford, 1979; Linzer & Levine, 1979) tumor suppressor gene products. The small t antigen interacts with a protein phosphatase (Pallas, Shahrik, Martin, Jaspers, Miller, Brautigan, et al., 1990) presumably to regulate activity of the mitogen activated protein kinase activation pathway and the AP-1transcription factor activity (Frost, Alberts, Sontag, Guan, Mumby, & Feramisco, 1994). The SV40 early region tumor antigens have been used successfully in transgenic mice to induce a transformed state in a variety of systems from pancreas (Hanahan, 1985), mammary gland (Tzeng, Guhl, Graessmann, & Graessmann, 1993), to the ductal epithelium of lung and kidney (Choi, Lee & Ross, 1988) and others (see (Adams & Cory, 1991) for review). Since the loss of wild-type p53 and Rb have been implicated in development and progression of prostate cancer (Bookstein, Rio, Madreperla, Hong, Allred, Grizzle, et al., 1990; Cooke, Quarmby, Mickey, Isaacs, & French, 1988; Isaacs, Carter, & Ewing, 1991; Rubin, Hallahan, Ashman, Brachman, Beckett, Virudachalam, et al., 1991), we hypothesized that directly expressing SV40 tumor antigens in the prostate epithelium of transgenic mice might provide a new mouse model for the development and progression of prostate cancer.

Transgenic Animal Models

Previous efforts to establish experimental animal models of prostate cancer have explored other primate systems (Habenicht, el-Etreby, Lewis, Ghoniem, & Roberts, 1989), or have focussed primarily on the effects of sex hormones that displays a very low frequency of spontaneous prostatic disease. For example, rats treated with sex hormones (Noble, 1977) developed adenocarcinoma of the prostate, as did rats treated with methylnitrosourea (Pollard & Luckert, 1987), testosterone and cyproterone (Pollard, Luckert & Snyder, 1989) or methylnitrosourea, dimethylbenzanthracene, or dimethylaminobiphenyl after sequential treatment with cyproterone acetate and testosterone propionate (Bosland & Prinsen, 1990; Bosland, Prinsen, Dirksen, & Spit, 1990). In addition, prostate tumors arise following cadmium (Waalkes, Rehm, Riggs, Bare, Devor, Poirer, et al., 1988) administration to Wistar�Crl:(WI)BR! rats and estradiol and dimethylaminobiphenyl (Shirai, Fukushima, Ikawa, & Ito, 1986) administration to F344 rats. Unfortunately, these protocols induce highly variable primary tumors and are not amenable to studying the molecular events involved in the progression of latent locally defined disease to adenocarcinoma and metastasis. Similarly, efforts to develop in vitro models for prostate cancer have produced the Dunning (Bogden, Taylor, Moreau, & Coy, 1990) (Cooke, et al., 1988), PC-3 (Rubin, et al., 1991) and PC-82 (van & Schroder, 1988) cell lines that are capable of inducing xenograft tumors. More recently, new LnCaP sublines have been developed that are androgen-independent (Thalman, Anezinis, Chang, Zhau, Kim, Hopwood, et al., 1994). However, these systems do not facilitate characterization of the earliest events in the progression of prostate cancer and established tumor cell lines may have been selected either for a number of genetic alterations not found in the primary tumors or acquired mutations in vitro (Carroll, Voeller, Sugars, & Gelmann, 1993; Rubin, et al., 1991). To this end, in vivo gene transfer studies were pursued recently in an attempt to develop a new generation of prostate cancer research models.

Retrovirus mediated gene transfer has been used to develop a mouse prostate reconstitution model (MPR). In this system, the Ha-ras and c-myc genes are first introduced into the fetal urogenital sinus and a reconstituted organ is then transplanted under the renal capsule of host mice leading to the rapid development of adenocarcinoma (Thompson, Southgate, Kitchener, & Land, 1989). MPR has been used previously to demonstrate that co-operativity between Ha-ras and c-myc leads to the transformation of reconstituted prostates (Thompson, Kadmon, Timme, Merz, Egawa, Krebs, et al., 1991; Thompson, Timme, Kadmon, Park, Egawa, & Yoshida, 1993a; Thompson, Truong, Timme, Kadmon, McCune, Flanders, et al., 1993b; Thompson, et al., 1989), and that dietary fenretinide can reduce the incidence of these tumors (Slawin, Kadmon, Park, Scardino, Anzano, Sporn, et al., 1993). Furthermore, MPR studies have demonstrated that TGF.beta.1 may be a marker in the progression of prostate disease from benign to malignant status (Thompson, et al., 1993b), and more recently, that p53 inactivation is related to increase tumorigenesis, and metastasis (Timme, Park, Ren, Eastham, Baley, Kadmon, et al., 1994).

Previous attempts by other investigators to establish transgenic targeting systems based on the regulatory elements of cellular or viral genes known to be expressed in the prostate have met only with limited success.

Studies in vivo demonstrate that C3(1) is induced 2-to-4 fold transcriptional by androgens (Parker et al, 1988; Parker and Needham, 1985), causing the authors to suggest post-transcriptional regulation (page and Parker, 1982).

When a fragment of the rat C3(1) gene was fused to a heterologous .beta.-gal reporter gene, the spatial pattern of C3(1)-.beta.gal fusion transgene expression was not found to be uniform (Buttyan & Slawin, 1993). Mice carrying a C3(1)-Tag transgene have recently been generated (Maroulakou, Anver, Garrett, & Green, 1994). In the two lines of C3(1)-Tag mice that have been propagated, the males develop prostatic hyperplasia and adenocarcinoma while the female mice develop mammary carcinoma. In general, the majority of male mice were observed to develop prostate adenocarcinoma by 8 months of age. Interestingly, a number of phenotypic abnormalities were also observed in the founder mice with only two animals surviving longer than 20 weeks. The founders displayed osteosarcomas, proliferative lesions of the thyroid, salivary glands and nasal epithelium as well as an unusual form of chondrodysplasia. Therefore, the C3(1)-Tag construct used in these studies appears to lack regulatory regions required to limit expression exclusively to the prostate. In addition, the C3(1) transgene is responsive to both male and female sex hormones. In another case, mice carrying a truncated mouse mammary tumor virus long terminal repeat (MMTV-LTR)-int-2 cDNA construct were originally reported to exhibit a phenotype consistent with benign prostatic hyperplasia (Muller, Lee, Dickson, Peters, Pattengale, & Leder, 1990; Tutrone, Ball, Ornitz, Leder, & Richie, 1993). However, further histological evaluation has revealed the pathology actually occurs in the ampullary gland (G. Cunha, unpublished observations). When a fragment of the promoter for human prostate specific antigen (PSA) was used to target an activated Ha-ras oncogene to the prostate in transgenic mice, the mice developed salivary gland tumors with no apparent pathology in prostate gland (Schaffner, Barrios, Shaker, Rajagopalan, Huang, Tindall, et al., 1994). It is interesting to note that the promoter for the PSA gene, a member of the kallikrein gene family (Riegman, Vlietstra, van, Romijn, & Trapman, 1989), directed expression in salivary gland in transgenic mice since similar observations were not reported in previous transgenic studies using a kallikrein rKlK1 promoter Tag constructs (Smith, Lechago, Wines, MacDonald, & Hammer, 1992).

SUMMARY OF THE INVENTION

In accordance with one aspect of the invention, there is provided a transgenic non-human eukaryotic animal, specifically a mouse, as well as the descendants and ancestors of such animal, which are animal models of human prostate cancer. Such transgenic animals have genomically integrated therewith a nucleic acid molecule comprising:

a first segment which is a 5' flanking region of the rat probasin gene as shown in FIG. 8, (SEQ ID NO: 1)

a segment which is an oncogene encoding the SV40 early region-tumor antigens (Tag) (SEQ ID NO: 2)

The first and second segments of the nucleic acid molecule are operatively connected to effect oncogene product expression in the prostate of the animal.

The nucleic molecule may cointegrate with a matrix attachment region (MAR) that can increase the chance of expression of a randomly integrated transgene molecule. The level of oncogene expression appears to be related to the time of tumor development. In general, all male mice will, following puberty, display pathology of the prostate gland ranging from prostatic intraepithelial hyperplasia (PIN) to adenocarcinoma, with the likelihood of advanced metastatic disease increasing with the age of the animal and the level of transgene expression.

The transgenic animal may have a disease state caused by expression of said oncogene and comprising prostatic hyperplasia, androgen-responsive tumors and androgen-unresponsive tumors. The oncogene segment may be one encoding the SV40 large T antigen or the SV40 small t antigen.

The present invention also provides immortal cell lines derived from prostate tissue of the transgenic animals with such cell line representing a stage of the progression of prostate cancer.

The ability to induce hyperplasia and adenocarcinoma of the prostate in transgenic mice as a consequence of rPB directed oncogene expression, as described herein, provides distinct advantages over previously described model systems. Since both males and females appear to be fertile, it is not anticipated that a biogenic system will need to be implemented to overcome infertility problems as described previously in transgenic studies using the MMTV-LTR promoter (Ornitz, Moreadith, & Leder, 1991; Tutrone, et al., 1993). In addition, the specificity of the rPB promoter facilitates long term studies and the establishment of immortalized cell lines representing the various stages of progression of prostate cancer by reducing the morbidity and mortality associated with tumor development in other organ sites, such as salivary gland, cartilage and thyroid as reported for transgenic mice carrying a C3(1)-Tag construct (Maroulakou, et al., 1994).

BRIEF DESCRIPTION OF DRAWINGS

The file of this patent application contains at least one drawing executed in color, namely FIGS. 2 to 7. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

FIG. 1 contains a schematic representation of the PB-Tag transgene. The elements are: -426 to +1, the 5' flanking region of the rat PB gene; +1 to +28, portion of the non-coding first exon of PB (the nucleotide sequence of the -426 to +1 and +1 to +28 elements are shown in the aforementioned U.S. Ser. No. 08/351,365 and WO 94/03594 and FIG. 8); ATG and TAA, delimit the open reading frames; and AATAAA, polyadenylation signals. The alternatively spliced transcripts for T and t antigens are shown. The location and orientation of the primers used for RT-PCR analysis are denoted as A and B.

FIG. 2 shows tissue specific expression of PB-Tag in transgenic mice. RNA was analyzed by reverse-transcriptase polymerase chain reaction (RT-PCR). The migration of the 484nut PCR product is shown.

FIG. 3 comprising panels A and B, shows characterization of epithelial hyperplasia in the prostate of a transgenic mouse. Serial paraffin sections were stained with hematoxylin and eosin. A. Prostate of non-transgenic littermate showing typical columnar morphology (200 X). B. Prostate from line 5666 showing polymorphonuclear ductal epithelium and a loss of tall columnar morphology (200 X).

FIG. 4 comprising panels A to I, contains histological analysis of prostate tumors in PB-Tag mice. Paraffin sections were stained with hematoxylin and eosin unless otherwise noted. A. Section through mouse prostate shows poorly differentiated tumor surrounding the urethra (20 X). B. Higher magnification of section shown in (A) demonstrating the hyperchromatic and angular nuclei and small amounts of eosinophilic cytoplasm (200 X). C. Section through human prostate showing poorly differentiated tumor (250 X). D. Higher magnification of section shown in (C) demonstrating sparse stroma and large, polymorphonuclear epithelium (500 X). E. Immunohistochemical analysis of Tag expression showing poorly differentiated tumor with adjacent well-differentiated prostatic ducts (40 X). Dark regions indicate immunoreactivity. F. Poorly differentiated ducts with secretions and Tag-immunoreactive cells in lumen (40 X). G. Immunocytochemical localization of mouse dorsolateral secreted proteins within well differentiated ducts adjacent to (25 X) and H, within the prostate tumor mass (55 X). I. Immunohistochemical localization of p53 with Ab-CM-5. Brown regions indicate immunoreactivity showing even distribution of p53 (400 X). Counterstain is methyl green.

FIG. 5 comprising panels A to E, contains immunohistochemical analysis of androgen receptor expression in mouse and human prostate cancer. Paraffin sections were stained with Ab-U402. Brown regions indicate immunoreactivity. Counterstain is eosin. A. Poorly differentiated tumor in a transgenic mouse showing heterogeneous AR staining (200 X). B. Glandular components within mouse tumors contain high percentage of nuclei displaying strong AR staining (400 X). C. Section through mouse testis as positive control for AR immunostaining (50 X). D. Poorly differentiated human prostate cancer showing heterogeneous staining for AR (250 X), and E, as in (D) (500 X).

FIG. 6 comprising panels A to D, contains histological analysis of prostate tumors in PB-Tag mice line 8247. Paraffin sections were stained with hematoxylin and eosin. A. Section through mouse dorsolateral prostate of F2 male 9288 at age 10 weeks shows glands with intraepithelial hyperplasia (40 X). B. Section through dorsolateral prostate of F1 male 8866 at age 22 weeks shows predominantly hyperplastic glandular epithelium (40 X). C. Section through dorsolateral prostate of F0 male 8247 at age 40 weeks shows cribrifrom and flattened ducts with poorly differentiated adenocarcinoma (40 X). D. Section through dorsolateral prostate of F1 male 8484 at age 20 weeks shows poorly differentiated invasive adenocarcinoma with few remaining ductal structures.

FIG. 7 comprising panels A and B, contains histological analysis of metastatic prostate cancer in PB-Tag mice line 8247. A. Section through primary tumor of dorsolateral prostate of male 1453 at age 10 weeks shows poorly differentiated invasive adenocarcinoma with few remaining ductal structures. B. Section through prostate cancer metastasis in lymph node from male 1453.

FIG. 8 shows the PB rat genomic sequence from -426 to +28 bp (SEQ ID NO: 1). The start of transcription is shown as V with the number starting immediately after as +1. All negative numbering is relative to the start site of transcription. Sequences beyond +28 define additional number sequences of the first exon for PB.

FIG. 9 contains the complete nucleotide sequence (SEQ ID NO: 2) and restriction enzyme map of the SV40 genome. The structural gene encoding the large T and small t antigen oncoproteins starts from the ATG codon at nucleic acid 82 and terminates at the TAA codon at nucleic acid 603 for the small t antigen and at nucleic acid 2552 for the large T antigen. The alternative splice sites are indicated.

FIG. 10 is a diagrammatic representation of plasmid pBSV-1 containing the SV40 genome showing the restriction sites and location of the large T-antigen encoding element. The plasmid is sized 9.6 kbp with the SV40 insert sized 5.2 kpb. The calculated size of the tag is 94 k.

FIG. 11 is a diagrammatic representation of phagemid pBluescript SK +/-, which is a 2958 basepair phagemid derived from pUC19. The SK designation indicates the polylinker is oriented such that lacZ transcription proceeds from Sac I to Kpn I.

FIG. 12 is a diagrammatic representation of the plasmid pPB-Tag showing the restriction sites.

DESCRIPTION OF PREFERRED EMBODIMENT

As discussed above and in the prior U.S. patent application and WO 94/03594, the rat probasin (rPB) -426/+28 bp promoter fragment targets prostate specific expression that is androgen regulated. In accordance with the present invention, we have now achieved probasin targeting to the prostate in transgenic animals, namely transgenic mice, of the SV 40 early region-tumor antigens, including the large T antigen, to induce prostatic hyperplasia or cancer in the transgenic mouse. These animal lines also have been successfully bred to pass on the disease to their progeny. We have found that the level of oncogene expression appears to be related to the time of the tumor development. In general, all male mice will, following puberty, display pathology of the prostate gland ranging from prostatic intraepithelial hyperplasia (PIN) to adenocarcinoma, with the likelihood of advanced metastatic disease increasing with the age of the animal and level of transgene expression.

The rPB directed oncogene expression achieved herein, leading to epithelial hyperplasia and adenocarcinoma, enables there to be provided transgenic non-human eukaryotic animal models for human prostate disease and also immortalized cell lines representing various stages of progression of prostate cancer.

The expression of the large T-antigen in the transgenic mice provided herein is accompanied by an increased detection of nuclear p53 protein. In addition, prostatic cancer cells produced in the transgenic mice provided herein have a decreased detectable androgen receptor, which suggests that the tumors have progressed to an androgen independent state as does human prostate cancer, whereby the transgenic mice provided herein may be a model for the progression of cancer from an androgen-dependent to an androgen-independent state.

The development of the transgenic mice herein and the provision of the cell lines from prostatic tissue of such transgenic mice permits the development of methodologies for the identification, diagnosis and staging of prostate cancer and resulting metastatic disease. Further those transgenic mice provide a unique animal model system to study the molecular basis of transformation of normal prostatic cells and the factors influencing the progression of metastatic prostate cancer. In addition, such transgenic mice and cell lines may be used for the screening and development of various chemical compounds, agents including radiation and gene-based therapies on prostate cancer, for the prevention and treatment of prostate cancer.

EXAMPLES

Example 1

Construction of the Transgene

To construct the rat probasin-SV40 T antigen transgene (FIG. 1), the plasmid pBSV-1 (FIG. 10) was digested with BglI, blunt-ended with T4 polymerase, and digested with BamHI to liberate the Tag structural gene. The Tag structural gene was then ligated into pBluescript SK+/- (Stratagene, FIG. 11) carrying the rPB-426/+28 fragment (SEQ ID NO: 1) that had been digested with BamHI and EcoRV, to give the plasmid rPB-Tag. To prepare a linear transgene for microinjection, the plasmid was digested with BssHII, purified by agarose gel electrophoresis and recovered by absorption to Qiagen matrix (Qiaex). The matrix attachment region (MAR) was prepared as described previously (Greenberg, et al., 1994).

Example 2

Production and Screening of Transgenic Mice

Generation of transgenic mice, isolation of mouse tail DNA, and polymerase chain reaction (PCR) based screening assay were as described previously (Greenberg, et al., 1994). The sequences of the synthetic oligonucleotides used in PCR reactions were as follows (5'=3'):

A: CCGGTCGACCGGAAGCTTCCACAAGTGCATTTA (SEQ ID NO: 3) B. AGGCATTCCACCACTGCTCCCATTCATC (SEQ ID NO: 4) The architecture of transgene co-integration was analyzed by Southern blotting tail DNA (20 .mu.g) digested with Pst I. Blots were hybridized with .sup.= P-labelled Tag-specific probes prepared by the random-oligolabelling method (sp. activity>10.sup.9 cpm/.mu.g), washed, and exposed to presensitized XAR5 (Kodak) film.

Example 3

Characterization of Transgenic Mice

To determine whether targeted expression of the SV40 T antigen (Tag) would result in transformation of the prostatic glandular epithelium, lines of transgenic mice were generated with a construct carrying the -426/+28 bp PB promoter fragment (SEQ ID NO: 1) fused to the SV40 Tag gene (SEQ ID NO: 2) (FIG. 1). As the upstream matrix attachment region (MAR) of the chicken lysozyme gene has been demonstrated previously to further mediate elevated and tissue-restricted expression of a PB-CAT transgene, lines of PB-Tag mice were also generated by coinjection with the MAR sequence. Mice were generated in both the C57B1/6 and FVB backgrounds as strain specific responses to oncogene mediated transformation of prostate epithelium had been reported previously (Thompson, et al., 1993a).

A total of nine independent founder animals were generated with the PB-Tag construct, of which four carried co-integrated MAR sequences. The founder transgenic mice are identified in the following Table I:

TABLE I__________________________________________________________________________ Time toConstruct FounderID Sex Birth Date Fertile Express Tumors__________________________________________________________________________PB-Tag 5666 M 9/27/92 Yes Yes 1 yearPB-Tag 5669 M 9/27/92 Yes Yes 1 yearPB-Tag 5672 M 9/28/92 Yes Yes ND*PB-Tag 5679 F 9/28/92 Yes Yes 1 yearPB-Tag 7250 M 4/12/93 Yes Yes NDPB-Tag/MAR 8079 M 10/2/93 No Yes 10 weeksPB-Tag/MAR 9244 F 11/8/93 Yes No NDPB-Tag/MAR 8247 M 11/8/93 Yes Yes 20 weeksPB-Tag/MAR 8549B M 2/7/94 ND ND ND__________________________________________________________________________ *ND Not Determined

All PB-Tag founder animals successfully passed the transgene on to progeny, with exception of one male (ID 8079) that died at 10.2 weeks that upon necropsy was found to have a large prostate tumor. As previously reported for the PB-CAT studies, PB-Tag expression was found not to be copy number dependent.

The tissue distribution of prostate-restricted PB-Tag expression in line 5666, as shown in FIG. 2, was found to resemble that determined previously in mice carrying a PB-CAT fusion construct (Greenberg, et al., 1994) with transgene expression restricted to the prostate. The highest levels of transgene expression were detected in the ventral and dorsal lobes of the prostate in sexually mature males. Similar patterns of expression were observed for all lines examined. Histological evaluation of the male accessory glands of line 5666 revealed a profound epithelial hyperplasia in the ventral prostate by 33 weeks of age characterized by excessive and somewhat disorganized ductal epithelium that had diminished cytoplasm (FIG. 3B) in contrast to the tall columnar epithelium observed in the controls (FIG. 3A). As determined by immunohistochemical staining for Tag expression, the absolute level of transgene expression in line 5666 epithelium was low.

In contrast, founder mouse 8079 developed a large, multinodular neoplasm infiltrating most portions of the prostate by 10 weeks of age (FIGS. 4A, B). Histologically the tumor resembles advanced stage human prostate cancer (FIGS. 4C, D). The neoplastic cells were relatively small and pleomorphic with very hyperchromatic and often angular or molded nuclei and small amounts of eosinophilic cytoplasm. Mitoses were frequently observed, with cells arrayed in nests separated by delicate stroma. These cells surrounded, sometimes infiltrated and often replaced prostatic glands. One lateral lobe of the prostate was partially uninvolved but had malignant cells infiltrating the subepithelial stroma. Atypical hyperplasia of the epithelium was focally present in non-neoplastic glands.

The neoplasm in mouse 8079 displayed very high levels of Tag protein expression in the nuclei of over 80% of the neoplastic cells as determined by immunohistochemical analysis (FIGS. 4E, F). Positively straining nuclei were plentiful in epithelial cells lining some of the non-tumoral glands and interestingly, most of the Tag positive nuclei were indistinguishable from their unstained neighbours.

To confirm the prostatic origin of the neoplasia, immunohistochemical analysis was performed with an antibody prepared against secretions from mouse dorsolateral prostate (Donjacour, Rosales, Higgins, & Cunha, 1990). This antibody specifically recognizes secretory proteins of differentiated epithelial cells and not other cellular components of the mouse dorsolateral prostate. As shown in FIGS. 4G and 4H, only the ducts adjacent to the large tumor as well as some differentiated epithelial cells within the tumor mass showed high levels of dorsolateral specific proteins. These proteins were not detected in the undifferentiated epithelial cells within the tumor tissue.

It has been demonstrated previously that p53 nuclear accumulation is significantly more common in higher grade human prostate cancer (Aprikian, Sarkis, Fair, Zhang, Fuks, & Cordon-Caro, 1994). Since the SV40 large T antigen is known to bind and stabilize p53 in the nucleus (Levine & Momand, 1990; Levine, Momand, & Finley, 1991; Quartin, Cole, Pipas, & Levine, 1994; Shaulsky, Goldfinger, Tosky, Levine, & Rotter, 1991) it was not unexpected that immunohistochemical analysis demonstrated elevated levels of nuclear p53 protein in the neoplastic cells in mouse 8079 (FIG. 4I). It was interesting, however, to observe that the majority of nuclei exhibiting the strongest p53 staining were larger and more pleomorphic than their non-staining neighbors. There was no p53 immunoreactivity detected in the hyperplastic epithelium of line 5666 or in non-transgenic controls.

One of the hallmarks of human prostate cancer is the rapid progression of the disease following failure of hormonal therapies, indicative of androgen-independent tumor growth. Although the relationship between the loss of functional androgen receptor (AR) and the progression to androgen independence remains to be established, AR heterogeneity is often observed in human prostate cancer (Tilley, Lim-Tio, Horsfall, Aspinall, Marshall, & Skinner, 1994) and has been proposed as a response predictor for hormonal therapy (Sadi & Barrack, 1993). To determine the AR status of the tumors in mouse 8079, immunohistochemical analysis was performed using the U402 antibody specific to the NH2 terminal of AR (Husmann, Wilson, McPhaul, Tilley, & Wilson, 1990; Tilley, et al., 1994). Intense nuclear staining was observed in well differentiated epithelium with more than 70% of epithelial cell nuclei stained for AR. Surrounding stromal components showed heterogeneous staining, with smooth muscle cell nuclei also positive for AR. The normal glandular components adjacent to or within tumors contained a higher percentage of nuclei stained for AR with a greater intensity of staining compared to glands in normal tissues (FIG. 4B). In contrast, the poorly differentiated tumors showed marked heterogeneity of staining, with only 5% of tumor nuclei immunoreactive for AR (FIGS. 5A, B). The intensity of staining in the AR positive cell nuclei, however, was only slightly reduced from that of the normal glands. Similar patterns of AR staining are observed in human prostate carcinoma (Tilley, et al., 1994) as illustrated by the poorly differentiated stage D2 tumor shown in FIGS. 5D and 5E.

In addition to founder male 8079, prostate cancer has been detected in male offspring of a transgenic line established from founder male 8247,generated in the C57B1/6 inbred strain. When maintained in a pure C57B1/6 background, male progeny of line 8247 reproducibly display focal and invasive adenocarcinoma of the prostate by 20 weeks. A developmental study of the pathology in line 8247 has shown that intraepithelial hyperplasia can be detected in males by 10 weeks of age (FIG. 6A), and by 22 weeks of age nearly all prostatic glands are hyperplastic (FIG. 6B). Prostate glands that contain many cribriform structures in addition to adenocarcinoma can be detected in males as old as 40 weeks of age (FIG. 6C) and invasive adenocarcinoma is detected as early as 20 weeks of age in this line (FIG. 6D). When transgenic line 8247 is maintained by C57Bl/6.times.FVB crosses, male offspring reproducibly rapidly develop large adenocarcinomas by 20 weeks of age with metastasis to the lymph nodes. Histologic characterization of the primary tumors and metastasis is shown in FIG. 7. The establishment of additional breeding lines that display prostate cancer demonstrates the reproducibility of the transgenic strategy. Since no other pathology has been observed to date in these mice, this confirms the tissue-specificity of the PB-targeting system.

SUMMARY OF THE DISCLOSURE

In summary of this disclosure, the rPB promoter has been used to target expression of the SV40 early region genes (Tag) specifically to the prostate of transgenic mice. These mice develop epithelial hyperplasia and adenocarcinoma of the prostate with metastasis, that histologically resemble advanced human prostate cancers, as early as 10 weeks of age. The tumors display elevated levels of nuclear p53 and heterogenous androgen receptor expression. Expression of Tag was found to be restricted to the prostatic epithelium. The rPB promoter appears to be unique in its ability to target developmentally- and hormonally-regulated expression of a heterologous gene specifically to the prostate. The ability to induce prostatic disease in a transgenic mouse as a consequence of specifically targeted oncogene expression provides a novel animal model system with which to study prostate cancer and for the evaluation of strategies for the treatment and prevention of prostate cancer including gene therapy. Modifications are possible within the scope of this invention.

REFERENCES

1. Adam, J. M., & Cory, S. (1991). Transgenic models of tumor development. Science, 254, 1161-1167. 2. Aprikian, A. G., Sarkis, A. S., Fair, W. R., Zhang, Z.-F., Fuks, Z., & Cordon-Caro, C. (1994). Immunohistochemical determination of p53 protein nuclear accumulation in prostatic adenocarcinoma. Journal Urology, 151, 1276-1280. 3. Berry, S. J., Coffey, D. S., & Ewing, L. L. (Ed.). (1984). A comparison of human and canine benign prostatic hyperplasia. Berlin: Congressduck. 4. Bogden. A. E., Taylor, J. E., Moreau, J. P., & Coy, D. H. (1990). Treatment of R-3327 prostate tumors with a somatostatin analogue (somatuline) as adjuvant therapy following surgical castration. Cancer Res., 50(9), 2646-2650. 5. Bookstein, R., Rio, P., Madreperla, S. A., Hong, F., Allred, C., Grizzle, W. E., & Lee, W. H. (1990). Promoter deletion and loss of retinoblastoma gene expression in human prostate carcinoma. Proc. Natl. Acad. Sci. USA 87(19), 7762-7766. 6. Bosland, M. C., & Prinsen, M. K. (1990). Induction of dorsolateral prostate adenocarcinoma and other accessory sex gland lesions in male wistar rats by a single administration of N-methyl-N-nitrosourea, 7,12-dimethylbenz(a)anthracene, and 3,2'-dimethyl-4-aminobiphenyl after sequential treatment with cyproterone acetate and testosterone propionate. Cancer Res., 50, 691-699. 7. Bosland, M. C., Prinsen, M. K., Dirksen, T. J. M., & Spit, B. J. (1990). Characterization of adenocarcinoma of the dorsolateral prostate induced in wistar rats by N-methyl-N-nitrosourea, 7,12 dimethylbenz(a)anthracene, and 3,2'-dimethyl-4-aminobiphenyl, following sequential treatment with cyproterone acetate and testosterone propionate. Cancer Res., 50, 700-709. 8. Brinster, R. L., Chen, H. Y., Messing, A., Van Dyke, T., Levine, A. J., & Palmiter, R. D. (1984). Transgenic mice harboring SV40 T-antigen genes develop characteristic brain tumors. Cell, 37, 367-379. 9. Buttyan, R., & Slawin, K. (1993). Rodent models for targeted oncogenesis of the prostate gland. Cancer and Metastasis Rev., 12, 11-19. 10. Carroll, A. G., Voeller, H. J., Sugars, L. & Gelmann, E. P. (1993). p53 oncogene mutations in three human prostate cancer cell lines. Prostate, 23(2), 123-134. 11. Choi, Y., Lee, I., & Ross, S. R. (1988). Requirement for the simian virus 40 small antigen in tumorigenesis in transgenic mice. Mol. Cell Biol., 8(8), 3382-3390. 12. Cooke, D. B., Quarmby, V. E., Mickey, D. D., Isaacs, J. T., & French, F. S. (1988). Oncogene expression in prostate cancer: dunning r3327 rat dorsal prostatic adenocarcinoma system. Prostate, 13(4), 263-272. 13. DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J.-Y., Huang, C.-M., Lee, W.-H., Marsilio, E., Paucha, E., & Livingston, D. M. (1988). SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 17, 275-283. 14. Dodd, J. G., Sheppard, P. C., & Matusik, R. J. (1983). Characterization and cloning of highly abundant mRNAs of the rat dorsal prostate. J. Biol. Chem., 258, 10731-10737. 15. Donjacour, A. A., Rosales, A., Higgins, S. J., & Cunha, G. R. (1990). Characterization of antibodies to androgen-dependent secretory proteins of the mouse dorsolateral prostate. Endocrinology, 1343-1354. 16. Frost, J. A., Alberts, A. S., Sontag, E., Guan, K., Mumby, M. C., & Feramisco, J. R. (1994). Simian virus 40 small t antigen cooperates with mitogen activated kinases to stimulate AP-1 activity. Molecular and Cellular Biol., 14, 6244-6252. 17. Greenberg, N. M., DeMayo, F. J., Sheppard, P. C., Barrios, R., Lebovits, R., Finegold, M., Angelopolou, R., Dodd, J. G., Duckworth, M. L., Rosen, J. M., & Matusik, R. J. (1994). The rat probasin gene promoter directs hormonally- and developmentally-regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol., 8, 230-239. 18. Habenicht, U. F., el-Etreby, M. F., Lewis, R., Ghoniem, & Roberts, J. (1989). Induction of metachromasia in experimentally induced hyperplastic/hypertrophic changes in the prostate of the cynomolgus monkey (Macaca fascicularis). J. Urol., 142, 1624-1626. 19. Hanahan, D. (1985). Heritable formation of pancreatic .beta.-cell tumors in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature, 315, 115-122. 20. Husmann, D. A., Wilson, C. M., McPhaul, M. J., Tilley, W. D., & Wilson, J. D. (1990). Antipeptide antibodies to two distinct regions of the androgen receptor localize the receptor protein to the nuclei of target cells in the rat and human prostate. Endocrinology, 126, 2359-2368. 21. Isaacs, W. B., Carter, B. S., & Ewing, C. M. (1991). Wild-type p53 suppresses growth of human prostate cancer cells containing mutant p53 alleles. Cancer Res., 51(17), 4716-4720. 22. Lane, D. P., & Crawford, L. V. (1979). T-antigen is bound to host proteins in SV40-transformed cells. Nature, 278, 261-263. 23. Levine, A. J., & Momand, J. (1990). Tumor suppressor genes: the p53and retinoblastoma sensitivity genes and gene products. Biochem. Biophys. Acta. 1032(1), 119-136. 24. Levine, A. J., Momand, J., & Finlay, C. A. (1991). The p53 tumor suppressor gene. Nature, 351(6326), 453-456. 25. Linzer, D. I. H., & Levine, A. J. (1979). Characterization of a 54 K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell, 17, 43-52. 26. Marculakou, I. G., Anver, M., Garrett, L. & Green, J. E. (1994). Prostate and mammary adenocarcinoma in transgenic mice carrying a C3(1) simian virus 40 large tumor antigen fusion gene. Proc. Natl. Acad. Sci. USA, 91, 11236-11240. 27. Matusik, R. J., Kreis, C., McNicol, P., Sweetland, R., Mullin, C., Fleming, W. H., & Dodd, J. G. (1986). Regulation of prostatic genes: Roles of androgens and zinc in expression. J. Biochem. Cell Biology, 64, 601-607. 28. Muller, W. J., Lee, F. S., Dickson, C., Peters, G., Pattengale, P., & Leder, P. (1990). The int-2gene product acts as an epithelial growth factor in transgenic mice. EMBO J., 9(3), 907-913. 29. Noble, R. L. (1977). The development of prostatic adenocarcinoma in Nb rats following prolonged sex hormone administration. Cancer Research, 37, 1927-1931. 30. Ornitz, D. M., Moreadith, R. W., & Leder, P. (1991). Binary system for regulating transgene expression in mice: Targeting int-2 gene expression with yeast GAL4/UAS control elements. Proc. Natl. Acad. Sci. USA, 88, 698-702. 31. Pallas, D. C., Shahrik, L. K., Martin, B. L., Jaspers, S., Miller, T. B., Brautigan, D. L., & Roberts, T. M. (1990). Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell, 60, 167-176. 32. Pollard, M. (1973). Spontaneous adenocarcinomas in aged germfree Wistar rats. J. Natl. Cancer Inst., 51, 1235-1241. 33. Pollard, M., & Luckert, P. H. (1987). Autochthonous prostate adenocarcinomas in Lobund-Wistar rats: a model system. Prostate, 11(3), 219-227. 34. Pollard, M., Luckert, P. H. & Snyder, D. L,. (1989). The promotional effect of testosterone on induction of prostate cancer in MNU-sensitized L-W rats. Cancer Lett, 45(3), 209-212. 35. Quartin, R. S., Cole, C. N., Pipas, J. M., & Levine, A. J. (1994). The amino-terminal functions of the simian virus 40 large T antigen are required to overcome wild-type p53-mediated growth arrest of cells. J. Virol., 68(3), 1334-1341. 36. Rennie P. S., Bruchovsky, N., Leco, K. J., Sheppard, P. C., McQueen, S. A., Cheng, H., Snoek, R., Hamel, A., Bock, M. E., MacDonald, B. S., Nickel, B. E., Chang, C., Liao, S., Cattini, P. A., & Matusik, R. J. (1993). Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol. Endocrinol., 7, 23-36. 37. Riegman P. H., Vlietstra, R. J., van, d.K.J.A., Romijn, J. C., & Trapman, J. (1989). Characterization of the prostate-specific antigen gene: a novel human kallikrein-like gene. Biochem. Biophys. Res. Commun. 159(1), 95-102. 38. Rubin, S. J., Hallahan, D. E., Ashman, C. R., Brachman, D. G., Beckett, M. A., Virudachalam, S., Yandell, D. W., & Weichselbaum, R. R. (1991). Two prostate carcinoma cell lines demonstrate abnormalities in tumor suppressor genes. J. Surg. Oncol. 46(1). 31-36. 39. Sadi, M. V., & Barrack, E. R. (1993). Image analysis of androgen receptor immunostatining in metastatic prostate cancer. Heterogeneity as a predictor of response to hormonal therapy. Cancer, 71, 2574-2580. 40. Schaffner, D. L., Barrios, R., Shaker, M., Rajagopalan, S., Huang, S., Tindall, D. J., Young, C. Y. F., Overbeek, P. A., Lebovitz, R. M., & Lieberman, M. W. (1994). Transgenic mice carrying a PSArasT24 hybrid gene develop salivary gland and GI tract neoplasms. Laboratory Investigation, in press. 41. Shain, S. A., McCullough, B., Nitchuk, M., & Boesel, R. W., (1977). Prostate carcinogenesis in the AXC rat. Oncology, 34(3), 114-122. 42. Shain, S. A., McCullough, B., & Segaloff, A. (1975). Spontaneous adenocarcinomas of the ventral prostate of aged AXC rats. J. Natl. Cancer Inst., 55(1), 177-180. 43. Shaulsky, G., Goldfinger, N., Tosky, M. S., Levine, A. J., & Rotter, V. (1991). Nuclear locatlization is essential for the activity of p53 protein. Oncogene, 6(11), 2055-2065. 44. Shirai, T., Fukushima, S., lkawa, Y., & Ito, N. (1986). Induction of prostate carcinoma in situ at high incidence in F344 rats by a combination of 3,2'-dimethyl-4-aminobiphenyl and ethinyl estradiol. Cancer Res., 46, 6423-6426. 45. Silverberg, E. S., Boring, C. C. & Squires, T. S. (1990). Cancer Statistics. CA Cancer J. Clin. 40, 9-26. 46. Slawin, K., Kadmon, D., Park, S. H., Scardino, P. T., Anzano, M., Sporn, M. B., & Thompson, T. C. (1993). Dietary fenretinide, a synthetic retinoid, decreases the tumor incidence and the tumor mass of ras+myc-induced carcinomas in the mouse prostate reconstitution model system. Cancer Res., 53(19), 4461-4465. 47. Smith, M. S., Lechago, J., Wines, D. R., MacDonald, R. J., & Hammer, R. E. (1992). Tissue-specific expression of kallikrein family transgenes in mice and rats. DNA Cell Biol., 11(5), 345-358. 48. Sweetland, R., Sheppard, P. C., Dodd, J. G., & Matusik, R. J. (1988). Post-castration rebound of an androgen regulated prostatic gene. Mol. Cell Biochem. 84, 3-15. 49. Thalman, G. N., Anezinis, P. E., Chang, S.-M., Zhau, H. E., Kim, E., Hopwood, V. L., Pathak, S., von Eschenbach, A. C., & Chung, L. W. K. (1994). Androgen-independent cancer progression and bone metastasis in the LnCaP model of human prostate cancer. Cancer Research, 54, 2577-2581. 50. Thompson, T. C., Kadmon, D., Timme, T. L., Merz, V. W., Egawa, S., Krebs, T., Scardino, P. T., & Park, S. H. (1991). Experimental oncogene induced prostate cancer. Cancer Surv. 11, 55-71. 51. Thompson, T. C., Timme, T. L., Kadmon, D., Park, S. H., Egawa, S., & Yoshida, K. (1993a). Genetic predisposition and mesenchymal-epithelial interactions in ras+myc-induced carcinogenesis in reconstituted mouse prostate. Molecular Carcinogenesis, 7(3), 165-179. 52. Thompson, T. C., Truong, L. D., Timme, T. L., Kadmon, D., McCune, B. K., Flanders, K. C., Scardino, P. T., & Park, S. H. (1993b). Transgenic models for the study of prostate cancer. Cancer 71(3 Suppl), 1165-1171. 53. Thompson, T. T., Southgate, J., Kitchener, G., & Land, H. (1989). Multistage carcinogenesis induced by ras and myc oncogenes in a reconstituted organ. Cell, 56, 917-930. 54. Tilley, W. D., Lim-Tio, S. S., Horsfall, D. J., Aspinall, J. O., Marshall, V. R., & Skinner, J. M. (1994). Detection of discrete androgen receptor epitopes in prostate cancer by immunostaining: Measurement by color video image analysis. Cancer Research, 54, 4096-4102. 55. Timme, T. L., Park, S. H. Ren, C., Eastham, J. A., Baley, P. A., Kadmon, D., Donehower, L. A., & Thompson, T. C. (1994). The use of a novel mouse model for prostate cancer metastasis to analyze the role of p53 gene loss and alteration during progression. AACR Proceedings, 35, 584. Tutrone, R. F. J., Ball, R. A., Ornitz, D. M., Leder, P. & Richie, J. P. (1993). Benign prostatic hyperplasia in a transgenic mouse: a new hormonally sensitive investigatory model. J. Urology, 149, 633-639. 57. Tzeng, Y. J., Guhl, E., Graessmann, M., & Graessmann, A. (1993). Breast cancer formation in transgenic animals induced by the whey acidic protein SV40 T antigen (WAP-SV-T) hybrid gene. Oncogene, 8(7), 1965-1971. 58. van, S. G. J., & Schroder, F. H. (1988). Androgen-dependent human prostate cancer in nude mice. The PC-82 tumor model. Am. J. Clin. Oncol., 2. 59. Waalkes, M. P., Rehm, S., Riggs, C. W., Bare, R. M., Devor, D. E., Poirer, L. A., Wenk, M. L., Henneman, J. R., & Balaschak, M. S. (1988). Cadmium carcinogenesis in male Wistar �Crl:(WI)BR! rats: dose-response analysis of tumor induction in the prostate and testes and at the injection site. Cancer Res., 48, 4656-4663. __________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 4- (2) INFORMATION FOR SEQ ID NO: 1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 556 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 467..547#1: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- AAGCTTCCAC AAGTGCATTT AGCCTCTCCA GTATTGCTGA TGAATCCACA GT - #TCAGGTTC 60- AATGGCGTTC AAAACTTGAT CAAAAATGAC CAGACTTTAT ATTCTTACAC CA - #ACATCTAT 120- CTGATTGGAG GAATGGATAA TAGTCATCAT GTTTAAACAT CTACCATTCC AG - #TTAAGAAA 180- ATATGATAGC ATCTTGTTCT TAGTCTTTTT CTTAATAGGG ACATAAAGCC CA - #CAAATAAA 240- AATATGCCTG AAGAATGGGA CAGGCATTGG GCATTGTCCA TGCCTAGTAA AG - #TACTCCAA 300- GAACCTATTT GTATACTAGA TGACACAATG TCAATGTCTG TGTACAACTG CC - #AACTGGGA 360- TGCAAGACAC TGCCCATGCC AATCATCCTG AAAAGCAGCT ATAAAAAGCA GG - #AAGCTACT 420#AGG GTC 475GAGGT CCAGATACCT ACAGAGCTCA CACAGC ATG#Val Met Arg# 1- ATC CTC CTC CTG CTC ACA CTG GAT GTG CTA GG - #T GTC TCC AGT ATG ATG 523Ile Leu Leu Leu Leu Thr Leu Asp Val Leu Gl - #y Val Ser Ser Met Met# 15# 556 TC AAA AAG AAG GTAGCAGACThr Asp Lys Asn Leu Lys Lys Lys# 25- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 5243 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- CGCCTCGGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAGGC TTTTTTGGAG GC - #CTAGGCTT 60- TTGCAAAAAG CTTTGCAAAG ATGGATAAAG TTTTAAACAG AGAGGAATCT TT - #GCAGCTAA 120- TGGACCTTCT AGGTCTTGAA AGGAGTGCCT GGGGGAATAT TCCTCTGATG AG - #AAAGGCAT 180- ATTTAAAAAA ATGCAAGGAG TTTCATCCTG ATAAAGGAGG AGATGAAGAA AA - #AATGAAGA 240- AAATGAATAC TCTGTACAAG AAAATGGAAG ATGGAGTAAA ATATGCTCAT CA - #ACCTGACT 300- TTGGAGGCTT CTGGGATGCA ACTGAGGTAT TTGCTTCTTC CTTAAATCCT GG - #TGTTGATG 360- CAATGTACTG CAAACAATGG CCTGAGTGTG CAAAGAAAAT GTCTGCTAAC TG - #CATATGCT 420- TGCTGTGCTT ACTGAGGATG AAGCATGAAA ATAGAAAATT ATACAGGAAA GA - #TCCACTTG 480- TGTGGGTTGA TTGCTACTGC TTCGATTGCT TTAGAATGTG GTTTGGACTT GA - #TCTTTGTG 540- AAGGAACCTT ACTTCTGTGG TGTGACATAA TTGGACAAAC TACCTACAGA GA - #TTTAAAGC 600- TCTAAGGTAA ATATAAAATT TTTAAGTGTA TAATGTGTTA AACTACTGAT TC - #TAATTGTT 660- TGTGTATTTT AGATTCCAAC CTATGGAACT GATGAATGGG AGCAGTGGTG GA - #ATGCCTTT 720- AATGAGGAAA ACCTGTTTTG CTCAGAAGAA ATGCCATCTA GTGATGATGA GG - #CTACTGCT 780- GACTCTCAAC ATTCTACTCC TCCAAAAAAG AAGAGAAAGG TAGAAGACCC CA - #AGGACTTT 840- CCTTCAGAAT TGCTAAGTTT TTTGAGTCAT GCTGTGTTTA GTAATAGAAC TC - #TTGCTTGC 900- TTTGCTATTT ACACCACAAA GGAAAAAGCT GCACTGCTAT ACAAGAAAAT TA - #TGGAAAAA 960- TATTCTGTAA CCTTTATAAG TAGGCATAAC AGTTATAATC ATAACATACT GT - #TTTTTCTT1020- ACTCCACACA GGCATAGAGT GTCTGCTATT AATAACTATG CTCAAAAATT GT - #GTACCTTT1080- AGCTTTTTAA TTTGTAAAGG GGTTAATAAG GAATATTTGA TGTATAGTGC CT - #TGACTAGA1140- GATCCATTTT CTGTTATTGA GGAAAGTTTG CCAGGTGGGT TAAAGGAGCA TG - #ATTTTAAT1200- CCAGAAGAAG CAGAGGAAAC TAAACAAGTG TCCTGGAAGC TTGTAACAGA GT - #ATGCAATG1260- GAAACAAAAT GTGATGATGT GTTGTTATTG CTTGGGATGT ACTTGGAATT TC - #AGTACAGT1320- TTTGAAATGT GTTTAAAATG TATTAAAAAA GAACAGCCCA GCCACTATAA GT - #ACCATGAA1380- AAGCATTATG CAAATGCTGC TATATTTGCT GACAGCAAAA ACCAAAAAAC CA - #TATGCCAA1440- CAGGCTGTTG ATACTGTTTT AGCTAAAAAG CGGGTTGATA GCCTACAATT AA - #CTAGAGAA1500- CAAATGTTAA CAAACAGATT TAATGATCTT TTGGATAGGA TGGATATAAT GT - #TTGGTTCT1560- ACAGGCTCTG CTGACATAGA AGAATGGATG GCTGGAGTTG CTTGGCTACA CT - #GTTTGTTG1620- CCCAAAATGG ATTCAGTGGT GTATGACTTT TTAAAATGCA TGGTGTACAA CA - #TTCCTAAA1680- AAAAGATACT GGCTGTTTAA AGGACCAATT GATAGTGGTA AAACTACATT AG - #CAGCTGCT1740- TTGCTTGAAT TATGTGGGGG GAAAGCTTTA AATGTTAATT TGCCCTTGGA CA - #GGCTGAAC1800- TTTGAGCTAG GAGTAGCTAT TGACCAGTTT TTAGTAGTTT TTGAGGATGT AA - #AGGGCACT1860- GGAGGGGAGT CCAGAGATTT GCCTTCAGGT CAGGGAATTA ATAACCTGGA CA - #ATTTAAGG1920- GATTATTTGG ATGGCAGTGT TAAGGTAAAC TTAGAAAAGA AACACCTAAA TA - #AAAGAACT1980- CAAATATTTC CCCCTGGAAT AGTCACCATG AATGAGTACA GTGTGCCTAA AA - #CACTGCAG2040- GCCAGATTTG TAAAACAAAT AGATTTTAGG CCCAAAGATT ATTTAAAGCA TT - #GCCTGGAA2100- CGCAGTGAGT TTTTGTTAGA AAAGAGAATA ATTCAAAGTG GCATTGCTTT GC - #TTCTTATG2160- TTAATTTGGT ACAGACCTGT GGCTGAGTTT GCTCAAAGTA TTCAGAGCAG AA - #TTGTGGAG2220- TGGAAAGAGA GATTGGACAA AGAGTTTAGT TTGTCAGTGT ATCAAAAAAT GA - #AGTTTAAT2280- GTGGCTATGG GAATTGGAGT TTTAGATTGG CTAAGAAACA GTGATGATGA TG - #ATGAAGAC2340- AGCCAGGAAA ATGCTGATAA AAATGAAGAT GGTGGGGAGA AGAACATGGA AG - #ACTCAGGG2400- CATGAAACAG GCATTGATTC AGAGTCCCAA GGCTCATTTC AGGCCCCTCA GT - #CCTCACAG2460- TCTGTTCATG ATCATAATCA GCCATACCAC ATTTGTAGAG GTTTTACTTG CT - #TTAAAAAA2520- CCTCCCACAC CTCCCCCTGA ACCTGAAACA TAAAATGAAT GCAATTGTTG TT - #GTTAACTT2580- GTTTATTGCA GCTTATAATG GTTACAAATA AAGCAATAGC ATCACAAATT TC - #ACAAATAA2640- AGCATTTTTT TCACTGCATT CTAGTTGTGG TTTGTCCAAA CTCATCAATG TA - #TCTTATCA2700- TGTCTGGATC CCCAGGAAGC TCCTCTGTGT CCTCATAAAC CCTAACCTCC TC - #TACTTGAG2760- AGGACATTCC AATCATAGGC TGCCCATCCA CCCTCTGTGT CCTCCTGTTA AT - #TAGGTCAC2820- TTAACAAAAA GGAAATTGGG TAGGGGTTTT TCACAGACCG CTTTCTAAGG GT - #AATTTTAA2880- AATATCTGGG AAGTCCCTTC CACTGCTGTG TTCCAGAAGT GTTGGTAAAC AG - #CCCACAAA2940- TGTCAACAGC AGAAACATAC AAGCTGTCAG CTTTGCACAA GGGCCCAACA CC - #CTGCTCAT3000- CAAGAAGCAC TGTGGTTGCT GTGTTAGTAA TGTGCAAAAC AGGAGGCACA TT - #TTCCCCAC3060- CTGTGTAGGT TCCAAAATAT CTAGTGTTTT CATTTTTACT TGGATCAGGA AC - #CCAGCACT3120- CCACTGGATA AGCATTATCC TTATCCAAAA CAGCCTTGTG GTCAGTGTTC AT - #CTGCTGAC3180- TGTCAACTGT AGCATTTTTT GGGGTTACAG TTTGAGCAGG ATATTTGGTC CT - #GTAGTTTG3240- CTAACACACC CTGCAGCTCC AAAGGTTCCC CACCAACAGC AAAAAAATGA AA - #ATTTGACC3300- CTTGAATGGG TTTTCCAGCA CCATTTTCAT GAGTTTTTTG TGTCCCTGAA TG - #CAAGTTTA3360- ACATAGCAGT TACCCCAATA ACCTCAGTTT TAACAGTAAC AGCTTCCCAC AT - #CAAAATAT3420- TTCCACAGGT TAAGTCCTCA TTTAAATTAG GCAAAGGAAT TCTAGCCACA CT - #GTAGCAAG3480- GCAGTTGTTC TTTGTCTGGA GAGTCATCTG TAAACTGTTT TTCAGCTGCT AA - #GCTTTTAC3540- TTAAGCCTTT TTGATGTTCA TCAGGATTGC CCATTTGAGG ATTTAAAAAG CA - #CTCCACCT3600- CAGTGAAGCT GTCTACTCCA GTTTTAACTC CTAGAACTTC TATTCCTCCT TT - #TATGACGA3660- GCTTTGGCAC TTGCACTGGT TCCTTTGGTT TTTTGGGAGC TGCCCCTGGA CA - #ACTTCCTT3720- TTCTTTTTGT TGGGGCCATC TTCATAAGCT TTTAGAGCAG AAGTAACACT TC - #CGTACAGG3780- CCTAGAAGTA AAGGCAACAT CCACTGAGGA GCAGTTCTTT GATTTGCACC AC - #CAGGAGCC3840- TCAAATTTTT CAATAAATTC ACCTGACTGC ACATTAGGAC TTTGGCTTTG AG - #CTTCCCAC3900- CTCTCAGTTA CTTGCTGAAT ACTGTCTGCT TCATCAATAT TATCATAGGT GT - #GCCCAAAT3960- GATATTTGCA ACCCTTCCCT GTTGGCTACT TGTCTCACCA TTGTAGGCCT AA - #TGGGAGAC4020- AAAGTAGAGT AGTAATCTTG TAAAGAGTTA TACCAATTAA CAGGAGCATT AA - #TTACTGTC4080- CAAGTAGTTT CCTCTAAAAA CCTTGCCAAA CTGTCCCTTA AATATCTTTG GG - #TTCTTCTT4140- TCAAGCTCCT GTGAGGTGAG CCTAGGAATG TCATTTTGTA TTACACGCCA AA - #AAGCTTGA4200- GAAATGGCAT TAAAAAGTGT TGGACCCCAA TGTCTGGGGT CAAGATACTG AA - #CACTGTGA4260- ACAAAGGTTT GTACTCCAGG AAATAAAATA TCATAGTAAT CATCTGGCCT AT - #ACAAATCT4320- ACAGCCATTC CTGGTTGTTG ATATAAACCA ACAGTAGAAA CTTTGTGATC CC - #AGTCACTA4380- AAAAATCTAT ACCCCACTTG AGCAACAGCG CTCACACCAG TCACAGTTTG CA - #GTAAAGCT4440- GCAAATCCAG CTATAGCAGC AGGAGCCCCA GATATCACAG CATAGGCCTG TG - #GAGTGAGG4500- CCTATAGCAG CAATTGCCTC AGAGGTTGTT AGGCCTTCAA CAGTAGCAAC AG - #ATGCAAGT4560- TGCACTTCAA TTGCAGCAGC GGCCTCTCCA GCAGCAATTT CAGCTACTGA AA - #ATCCAGTA4620- GCAGCAGCAG CTTCAGACAC AGTAGCAATT AGGTCCCCCA ACAGTGTTAA AG - #CAGCACCC4680- ATGGACCTGA AATAAAAGAC AAAAAGACTA AACTTACCAG TTAACTTTCT GG - #TTTTTCAG4740- TTAACCTTTC TGGTTTTTTG CGTTTCCCGT CAACAGTATC TTCCCCTTCA CA - #AAATTGCA4800- GCAAAAGCTC TAAAACAAAC ACAAAAAGGC GTTGAGCTGT TTTTTTACTT TC - #AGTCCATG4860- ACCTACGAAC CTTAACGGAG GCCTGGCGTG ACAGCCGGCG CAGCACCATG GC - #CTGAAATA4920- ACCTCTGAAA GAGGAACTTG GTTAGGTACC TTCTGAGGCG GAAAGAACCA GC - #TGTGGAAT4980- GTGTGTCAGT TAGGGTGTGG AAAGTCCCCA GGCTCCCCAG CAGGCAGAAG TA - #TGCAAAGC5040- ATGCATCTCA ATTAGTCAGC AACCAGGTGT GGAAAGTCCC CAGGCTCCCC AG - #CAGGCAGA5100- AGTATGCAAA GCATGCATCT CAATTAGTCA GCAACCATAG TCCCGCCCCT AA - #CTCCGCCC5160- ATCCCGCCCC TAACTCCGCC CAGTTCCGCC CATTCTCCGC CCCATGGCTG AC - #TAATTTTT5220# 5243CCGA GGC- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 33 TTCC ACAAGTGCAT TTA- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 28 CTCC CATTCATC__________________________________________________________________________

Claims

1. A transgenic mouse susceptible to prostate tumor formation having genomically-integrated in the mouse a nucleic acid molecule, comprising:

a first segment which is a 5' flanking region of the rat probasin gene as shown in FIG. 8 (SEQ ID NO:1), and

a second segment which is an oncogene encoding the SV40 early region-tumor antigen (Tag)(SEQ ID NO:2), said first and second segments being operatively linked such that said mouse expresses said tumor antigen specifically in the prostate of said mouse to effect tumor formation therein.

2. The transgenic mouse of claim 1 wherein said mouse has a matrix attachment region cointegrated therewith.

3. The transgenic mouse of claim 1 wherein said oncogene is that encoding the SV40 large T antigen.

4. The transgenic mouse of claim 1 wherein said oncogene is that encoding the SV40 small t antigen.

5. The transgenic mouse of claim 1 having a disease state caused by said expression of said oncogene, wherein said disease state comprises one of prostatic hyperplasia, androgen-responsive tumors or androgen-unresponsive tumors.

6. An immortal cell line derived from prostatic tissue of the transgenic mouse of claim 1 and representing a stage of progression of prostate cancer.

7. The cell line of claim 6 which represents a stage of hyperplasia.

8. The cell line of claim 6 which represents a stage of androgen-response.

9. The cell line of claim 6 which represents a stage of androgen-unresponse.

10. The plasmid pPB-Tag comprising the 5' flanking region of the rat probasin gene operatively linked to an SV40 early region tumor antigen, as shown in FIG. 12.