TRANSGENIC PATHOGEN-RESISTANT ORGANISM

Abstract
Transgenic pathogen-resistant organism whose genome contains at least two different genes under the control of active promoters with pathogen-inhibiting action. This organism is distinguished by a synergistic pathogen-inhibiting action. This action is evident particularly when the genes code for the gene products chitinase (ChiS, ChiG), glucanase (GluG), protein synthesis inhibitor (PSI) and antifungal protein (AFP).
Description


[0001] Transgenic pathogen-resistant organism


[0002] The invention relates to a pathogen-resistant organism and to a process for generating it.


[0003] It is known in the state of the art that infestation of a plant by pathogens are caused a series of different reactions. These include, for example, changes in the cell wall structure, the synthesis of phytoalexins which have antimicrobial activity, the accumulation of so-called PR proteins (pathogenesis-related), protease inhibitors and enzymes with hydrolytic functions (Hahlbrock and Grisebach in Ann. Rev. Plant. Physiol., 30 (1979), 105-130).


[0004] Many pathogens (fungi and insects) have chitin as a constituent of their cell wall. By contrast, plants possess no chitin. It has now been demonstrated in some cases that there is enhanced production of chitinases in plants after infestation by pathogens. Chitinases are among the enzymes with hydrolytic functions and they catalyze chitin breakdown. It has now been possible to show that plants acquire an increased resistance to pathogens by the production of chitinases.


[0005] It is furthermore known to use a gene from barley plants whose gene product codes for an inhibitor of fungal protein synthesis. The incorporation of a corresponding inhibitor gene in transgenic plants led to improved resistance to fungi.


[0006] Finally, it has also been disclosed that the use of a polypeptide from Aspergillus giganteus is able to protect, by virtue of its antifungal activity, plants from infestation by fungi.


[0007] However, given this state of the art there is a need to provide further transgenic pathogen-resistant organisms. Moreover, the organisms which are particularly desired are those whose resistance is increased overall by comparison with the known organisms or is extended with respect to the number of possible pathogens.


[0008] This problem is solved by a transgenic pathogen-resistant organism having the features of claim 1.


[0009] The invention is based on the surprising finding that the incorporation of at least two different genes with pathogen-inhibiting action into the genome of an organism assists the latter to resist pathogens to an extent going far beyond an additive effect of each of the genes on its own.


[0010] The dependent claims indicate further embodiments of the invention.


[0011] The genes can code for gene products which reduce the vitality of fungi. In particular, the genes can be of fungal, bacterial and plant, animal or viral origin. In particular, the gene products have properties which promote resistance to fungi. The gene products are chitinase (ChiS, ChiG), glucanase (GluG), protein synthesis inhibitor (PST) and antifungal protein (AFP).


[0012] The transgenic pathogen-resistant organism can be a plant, and tobacco, potato, strawberry, corn, rape or tomato plants are preferred.


[0013] The invention also relates to DNA-transfer vectors with inserted DNA sequences as are indicated in detail in this description.


[0014] The invention Furthermore relates to a process for the generation of pathogen-resistant organisms as are described herein, wherein at least 1 gene with pathogen-inhibiting action is transferred into the genome of an organism, and the pathogen-resistant organism is obtained (a) by crossing the organism with another, optionally transgenic, organism which contains at least one other gene with pathogen-inhibiting action, and subsequently selecting, and/or (b) by transformation of this other gene with pathogen-inhibiting action into the organism. The process can be used with DNA-transfer vectors with inserted DNA sequences corresponding to a gene with pathogen-inhibiting action as described herein.


[0015] Finally, the invention relates to a process for the generation of pathogen-resistant organisms, wherein vectors which comprise more than one gene with pathogen-inhibiting action are used for the transformation into the genome of an organism.


[0016] The invention also relates to a process for ensuring the resistance of organisms to pathogens, characterized in that the organism used is a transgenic pathogen-resistant organism according to any or claims 1 to 7 or an organism whose genome contains at least one gene complying with the definitions used herein (see claims 1 to 7, and at least one substance which is not expressed by the organism but corresponds to any other one of the gene products complying with the definitions given in this application (claims 1 to 7) is applied to the organism.


[0017] It was possible to achieve the synergistic effects very particularly with transgenic pathogen-resistant organisms to which the gene sequences which coded for proteins of the attached sequence listings A to E, or corresponded to the latter, were transferred or transfected.


[0018] ChiS


[0019] A DNA fragment which is 1.8 Kb in size, that codes for a chitinase called ChiS was isolated from the soil bacterium Serratia marcescens. In vitro investigations with purified ChiS protein showed that it is able effectively to inhibit the growth of fungi, even in low concentrations. The reason for the inhibition is that the ChiS protein has a chitinase activity which is able to damage the tips of the fungal hyphae. In this way the fungus is unable to grow further and is inhibited.


[0020] PSI


[0021] The PSI gene originates from barley and codes for a protein which inhibits protein synthesis by fungi. In vitro tests show that even low concentrations of PSI are sufficient to inhibit various fungi such as, for example, Rhizoctonia solani.


[0022] AFP


[0023] It is possible for a polypeptide which has antifungal activity to be isolated from the fermentation broth of Aspergillus giganteus and to be sequenced. This polypeptide is suitable as antifungal agent, for example as spraying agent and as preservative for industrial products and human and animal foods. It can furthermore be combined with other substances which have pesticidal activity, fertilizers or growth regulators. Inhibitory activities against fungi were detectable inter alia against various Aspergillus, Fusaria, Phytophthora and Trichophyton species.


[0024] ChiG and GluG


[0025] Two genes which code, respectively, for a chitinase (ChiG) and glucanase (GluG) can be isolated from certain types of barley. Purified ChiG protein or GluG protein inhibits various phytopathogenic fungi in vitro (inter alia Rhizoctonia solani) (see R. Leah et al., Journal of Biological Chemistry, Vol. 266, No. 3 (1991), pages 1564-1573).


[0026] The inventors have now found, completely surprisingly, that an at least binary combination of expression of PSI, AFP, ChiS, ChiG or GluG leads to synergistic effects in respect of the acquired resistance to fungi in transgenic plants. In particular, the effects of the individual substances in the combination are markedly exceeded. These include resistance to the fungus Rhizoctonia solani, Sclerotinia infestation, Botrytis infestation, etc.


[0027] Combinations according to the invention are (DNA and/or polypeptides):


[0028] binary combinations


[0029] ChiS, GluG; ChiS, PSI; ChiS, ChiG; ChiS, AFP; GluG, PSI; GluG, ChiG; GluG, AFP; PSI, ChiG; PSI, AFP;


[0030] ternary combinations


[0031] ChiS, GluG, PSI; ChiS, GluG, ChiG; ChiS, GluG, AFP; GluG, PSI, ChiG; GluG, PSI, AFP; PSI, ChiG, AFP; ChiG, AFP, GluG


[0032] quaternary combinations


[0033] ChiS, GluG, PSI, AFP; ChiS, GluG, PSI, ChiG;


[0034] quinary combination


[0035] ChiS, GluG, PSI, AFP, ChiG


[0036] The invention furthermore relates to the combined use of the proteins with pathogen-inhibiting action, preferably ChiS, PSI, AFP, ChiG and GluG, against pathogens. Combined use also means in this context that at least a first pathogen-inhibiting substance is expressed by the organism and at least a second substance which has pathogen-inhibiting action is applied to the organism from outside.


[0037] The agents according to the invention also include those which contain the abovementioned proteins in at least binary combination. The agents according to the invention can contain other active substances besides the proteins. The other active substances can be pesticides, fertilizers and/or growth regulators, and the agents according to the invention can be prepared in various formulations such as concentrates, emulsions, powders, formulations on carriers, mixtures with other active substances, etc. The ChiS/PSI and AFP/PSI combination is particularly preferred. These proteins can be used particularly effectively to inhibit the growth of Rhizoctonia solani, especially in tobacco crops.


[0038] The invention also relates to the use in a process according to the invention of a DNA sequence which codes at least for a polypeptide of sequences A to E, or to a pathogen-resistant organism, where its genome contains at least two different genes under the control of active promoters with pathogen-inhibiting action, where the genes are in each case selected from the group of sequences A to E. The invention furthermore includes DNA sequences which hybridizes with a DNA sequence which codes for polypeptides of amino-acid sequences A to E; where these DNA sequences can be of natural synthetic [sic] or semisynthetic origin and can be related to the abovementioned DNA sequence by mutations, nucleotide substitutions, nucleotide deletions, nucleotide insertions and inversions of nucleotide sequences, and codes for a polypeptide with pathogenic activity. The invention furthermore relates to a recombinant DNA molecule which contains at least one DNA sequence which accords with the preceding statements, where this DNA molecule can be in the form of a cloning or expression vector.


[0039] The invention relates to appropriate host organisms and intermediate hosts which are transformed with a recombinant DNA molecule which accords with the preceding statements. Preferred as intermediate host in the generation of a pathogen-resistant transgenic organism are strains of bakeria, in particular so-called Agrobakeria strains.


[0040] The invention furthermore relates to the transgenic pathogen-resistant organisms obtained by the process according to the invention, in particular tobacco, potato, corn, pea, rape and tomato plants.


[0041] The DNA sequences according to the invention are, as a rule, transferred together with a promoter. Promoter sequences are recognized by the plant transcription apparatus and thus lead to constitutive expression of the gene associated with them in plants. The promoter can, however, also be pathogen-inducible and/or wound-inducible (WUN1) and/or tissue-specific and/or development-specific.


[0042] The genetic manipulation operations necessary for carrying out the invention, especially for expression of the gene in plants, are generally known. See for example the publication by Maniatis et al. in “Molecular cloning: A laboratory manual”, Cold Spring Harbor (1982).


[0043] The invention is explained in detail in the following examples.


[0044] All the standard methods of molecular biology were carried out, unless otherwise indicated, as described by Maniatis et al. “Molecular cloning: a laboratory manual”, Cold Spring Harbor (1982).


[0045] The DNA coding for amino-acid sequences A to E was initially cloned in a manner known per se and then transferred by conjugation into A. Tumefaciens LBA 4404 (A. Hoekema et al., Nature 303, 179-180). This took place by the method described by Van Haute et al. in EMBO J. 2, 411-418 (1983).


[0046] The transfer of DNA into that Agrobacterium was checked by isolating Agrobacterium DNA by the method described by Ebert et al. in Proc. Natl. Acad. Sci. USA 84 5745-5749 (1987). Restriction cleavage of the DNA, transfer to Hybond-N membrane (Amersham) and hybridization with a radioactively labeled DNA probe provided information about successful DNA transfer into the Agrobacterium.


[0047] The transformed Agrobacterium was then used to transform tobaco, rape, strawberry, tomato and potato plants.


[0048] The LBA4404 Agrobacteria required for the infection were initially cultivated in selective antibiotic medium (P. Zambrisky et al. in EMBO J., 1, 147-152 (1983)), sedimented by centrifugation and washed in YEB medium without antibiotics (YEB=0.5% meat extract; 0.2% yeast extract; 0.5% peptone; 0.5% sucrose; 2 mM MgSO4). After renewed sedimentation and taking up in MgSO4 it was possible to use the bacteria for the infection.


[0049] The so-called leaf disk method was used for the infection.


[0050] Sterile leaves were used for the leaf disk infection. Leaf pieces about 1 cm in size are dipped in the previously described Agrobacteria suspension and subsequently transferred to 3MS medium (medium described by T. Murashige and F. Skoog in Physiol. Plant., 15, 473-497 (1962); 3MS=MS−3% sucrose). After incubation at 25° C. to 27° C. with 16 hours of light for two days, the leaf pieces were transferred to MSC16 medium (according to T. Murashige (see above); MSC16=MS+0.5 μg/ml BAP+0.1 μg/ml NAA+100 μg/ml kanamycin sulfate+500 μg/ml Claforan). Shoots appearing after 4-6 weeks were cut off and transplanted to MSC15 medium (according to Murashige (see above); MSC15=MS+2% sucrose, 500 μg/ml Claforan+100 μg/ml kanamycin sulfate). Shoots with root formation were analyzed further.


[0051] Monocotyledonous plants (including corn), but some dicotyledonous plants too, were transformed by direct gene transfer into protoplasts. These protoplasts were subsequently regenerated to intact plants (Example: J. Potrykus in Biotechnology 8 (1990), 535).


[0052] The resulting transgenic plants were infected with the fungus Rhizoctonia solani for testing purposes. For this purpose, fungal cultures were grown and thoroughly mixed in standard soil. This soil was then distributed in a dish and planted with the plants to be tested.


[0053] For the evaluation, each plant on a dish was assigned a value from 0 to 3. It was possible to calculate from this for each plant line an index which resulted from the sum of the values. The classification is as follows:


[0054] 0=no symptoms (healthy)


[0055] 1=slightly reduced size (compared with a non-infected control); no or very slight visible infestation


[0056] 2=severe reduction in growth; severe symptoms of infestation


[0057] 3=dead


[0058] The rating is carried out in each case 14 days after the start of the series of tests.






EXAMPLE 1

[0059] Fungus inhibition test with combined proteins


[0060] The intention initially was to show that the proteins used here have synergistic effects in their combination. Fungal growth tests in vitro were carried out for this purpose.


[0061] These entailed a defined amount of Rhizoctonia solani fungal mycelium being mixed with 100 μl of potato dextrose solution and incubated in microtiter plates at 25° C. In this test there is a linear correlation between the growth of the fungus and the increase in the optical density at 405 nanometers. The inhibitory effect of proteins can be detected from a smaller increase in the optical density.


[0062] 2-3 mycelium balls were taken from a liquid culture of R. Solani, mixed with 100 μl of KGB medium in an Eppendorf vessel and carefully homogenized with a glass mortar. This suspension was then mixed with 10 ml of KGB medium and passed through a sterile 100 μm screen. The optical density of this mycelium fragment suspension (100 μl aliquot) was adjusted to a value of 0.06-0.07 at 405 nanometers by adding medium. 100 μl samples were placed on a microtiter plate and mixed with the proteins to be tested. 7 parallels were measured per mixture. Mixtures which were mixed with the corresponding amounts of buffer served as controls. The plates were incubated in the dark at 25° C. for 48 hours, and the optical density of the cultures was measured at regular intervals.


[0063] Calculation of whether two proteins act together in an additive synergistic or antagonistic manner in the inhibition of fungal growth is possible from the measured data with the aid of the Colby formula which is described hereinafter and generally used (S. R. Colby in Wheeds, 15 (1967), 20-22).


[0064] To do this it was initially necessary to calculate the growth inhibition E to be expected theoretically with an additive behavior (the expected efficacy). This is given by:




E=W
1+W2−((W1×W2)/100)



[0065] where W1 and W2 indicate the efficacies of the individual proteins, which is defined as that percentage deviation of the growth plot (in the presence of the protein) from the untreated control. The efficacy for a protein (at a defined time in the growth plot) is given by:




W
1=(OD(K)−OD(P))/OD(K)×100 (percent)



[0066] In this, OD(K) is the optical density of the untreated control and OD(P) is the optical density of the culture treated with the protein.


[0067] Thus, on combined use of two proteins, the following statements were possible: if the efficacy G measured in the experiment is identical to the expected value E, the behavior is additive. If, on the other hand, G is greater than E, the behavior is synergistic.


[0068] Using this test model, it emerged that the proteins ChiS, PSI, AFP, ChiG and GluG used in the Example surprisingly have synergistic inhibitory effects on various fungi, and these effects were achieved both by the combination of two types of protein and by multiple combination of the abovementioned proteins.


[0069] For example, the following values were determined from the combination of ChiS and PSI protein and from the combination of AFP protein and PSI protein on the fungus Rhizoctonia solani (in each case two different ChiS and AFP concentrations with a constant RIP concentration):


[0070] ChiS+PSI


[0071] The expected values were: E1=29.9% and E2=44.5% The measured values were: G1=60.4% and G2=64.1% The proteins ChiS and PSI therefore act together in a synergistic manner in the inhibition of the growth of R. Solani.


[0072]
FIG. 1 shows the results obtained with the combination of the proteins and with the individual substances. According to the Figure, various ChiS concentrations (0.5 μg/ml and 0.05 μg/ml) are combined with PSi protein (1.0 μg/ml).


[0073] AFP+PSI


[0074] The expected values were: E1=39.9% and E2=41.9% The measured values were: G1=57.7% and G2=65.4% The AFP and PSI combination also according to this shows a synergistic Inhibition of growth of the fungus R. Solani. FIG. 2 indicates the test results with various AFP concentrations (0.4 μg/ml and 0.04 μg/ml) combined with PSI protein (1.0 μg/ml).



EXAMPLE 2

[0075] Transgenic plants


[0076] In order to obtain the organisms according to the invention with DNA sequences which act together synergistically, initially transgenic plants which contained at least one of the genes which act together synergistically were generated.


[0077] ChiS in transgenic plants


[0078] Initially a ChiS gene was fused to plant regulatory sequences.


[0079] A ChiS gene 1.8 Kb in size was sequenced by using synthetic oligonucleotides in the dideoxy sequencing method of Sanger et al. in Proc. Natl. Acad. Sci. USA, 74 (1977), 5463-5467.


[0080] The 35S promoter originating from cauliflower mosaic virus (CamV) (400 bp (according to Töpfer et al. in Nucl. Acid. Res., 15 (1987), 5890)) underwent transcriptional fusion to the ChiS gene. The termination signal, which is 0.2 Kb in size, of the 35S gene of CamV, whose functionality in dicotyledonous plants is known, was used 3′ from the ChiS gene. The chimeric gene 35S-ChiS was cloned into the pLS034 vector by means of the Agrobacterium tumefaciens transformation system in tobacco and potato plants, and kanamycin-resistant plants were regenerated.


[0081] It was possible to detect both the ChiS gene and the corresponding mRNA as well as the gene product protein in the resulting plants.


[0082] PSI in transgenic plants


[0083] PolyA RNA was initially isolated from ripe barley seeds (Horaeum vulgare L. cv. Piggy) and deposited in a cDNA gene bank in λ-gt-11-phages. The details of the process are to be found in R. Lea in Plant. Biol., 12 (1989), 673-682. Monospecific PSI antibodies were then used to identify cDNA clones.


[0084] Subsequently, the PSI-positive λ-gt-11-phages were isolated, cloned further and sequenced by the dideoxy sequencing method of Sanger et al. indicated above. The DNA cloned into E. coli was then transferred in the manner described above by conjugation into Agrobacterium LBA4404.


[0085] Both the transferred gene and mRNA and gene product were detectable in corresponding transgenic tobacco, potato, rape, strawberry and tomato plants.


[0086] AFP in transgenic plants


[0087] For the cloning in the vector, the cDNA sequence of the antifungal peptide is provided with ends which can be ligated into BamH1 and Sall restriction cleavage sites. The cloning vector used was pDH51 (Pietrzak et al. in Nucl. Acids Res. 14 (1986), 5857). The vector pDH51 was opened with the restriction enzymes BamH1 and Sall between promoter and terminator. The vector pDH51 is a pUC18 derivative which contains promoter and terminator sequences of the 35S transcript from cauliflower mosaic virus. These sequences are recognized by the plant's transcription apparatus and lead to strong constitutive expression of the gene associated with them in plants. The DNA of the antifungal peptide is then cloned via the BamH1 and Sall cleavage site into the vector. Finally, the transcription unit—promoter, gene and terminator—is cut out of the vector using the restriction enzyme EcoRI and cloned into a plant transformation vector. The following vectors and their derivatives can, for example, be used as plant transformation vector:


[0088] pOCA18 (Olszewski et al. in Nucl. Acids Res., 16 (1988), 10765) pPCV310 (Koncz and Shell in MGG 204 (1986), 383) and pBin19 (Bevan et al. Nucl. Acids. Res. 12 (1984), 8711)


[0089] After the transcription unit and the vector had been ligated via the EcoRI cleavage site, the construct was conjugated into the Agrobacterium strain MP90RK (Koncz and Shell (see above)) or IHA101 (Hood et al. in J. Bacteriol. 168 (1986), 1291).


[0090] Transgenic tobacco, potato, strawberry, rape and tomato plants were then transformed by the method described above. Transformed shoots are selected on the basis of the cotransferred resistance to the antibiotic kanamycin. Expression of the antifungal protein in the transformed crop plants was checked and confirmed by DNA analysis (Southern blotting), RNA analysis (Northern blotting) and protein analysis with specific antibodies (Western blotting).


[0091] ChiG and GluG in transgenic plants


[0092] ChiG- and GluG-transgenic plants which were both Southern-, Northern- and Western-positive were obtainable in analogy to the plants described above.


[0093] ChiS, PSI, AFP, ChiG, GluG in transgenic monocotyledonous plants


[0094] It was possible by means of direct gene transfer to integrate the abovementioned genes into the genome of monocotyledonous plants such as, for example, corn. This resulted in transgenic plants which were Southern- and Northern- and Western-positive.


[0095] Combination of various fungus-resistance genes in transgenic plants


[0096] The previously obtained tobacco, corn, rape, strawberry, potato and tomato plants were crossed together and selected for plants containing in each case the fungus-resistant genes of both parents. In addition, transgenic plants were obtained by transforming them initially with one and then with one or more other gene. Finally, plants were also transformed with vectors which contained various resistance genes. Fungus-resistance tests were done with this plant material. Surprisingly, in all cases synergistic effects, not just additive effects, in respect of fungus resistance are observed.


[0097] For example, a tobacco plant which expresses ChiS and PSI shows a considerably greater resistance to Rhizoctonia infestation than the plants which expressed only ChiS or PSI or which would result from the additive resistance.


[0098] A synergistic inhibitory effect on infestation with Rhizoctonia solani also results from combined expression of PSI- and AFP-transgenic tobacco. Combination of two or more different genes (ChiS, RIP, AFP, ChiG and GluG) in a wide variety of transgenic plants also led to synergistic inhibitory effects on various fungi.


[0099] Whereas wild-type plants have index values from 38 to 46 in tests on 20 seedlings, it emerges with transgenic tobacco according to the invention that the latter grows as well in the presence of the fungus Rhizoctonia solani as do control plants (index value 10-12) cultivated on Rhizoctonia-free soil.


[0100] Sequence listing A and A′ (AFP)


[0101] Seq IDNo.: 1 (A)


[0102] Sequence type: complete nucleotide sequence with corresponding protein to the extent that it is encoded by an open reading frame, active protein (A′)


[0103] Sequence length: 51 amino acids (A′)


[0104] Strandedness: single strand


[0105] Topology: linear


[0106] Molecule type: cDNA


[0107] Original source: Aspergillus giganteus fermentation broth


[0108] Name: antifungal peptide (AFP)


[0109] Features (A): open reading frame of 177 nucleotides, the N-terminal amino acid of the active protein is marked by *.


[0110] Properties: antifungal agent, especially on Rhizoctonia solani, various Aspergillus, Fusaria and Trichophyton species.
1TTGCGACCCCCGTTGAAGCCGATTCTCTCACCGCTGGTGGTCTGGATGCAAGAGATGAGA  1------------------------------------------------------------ 60AACGCTGGGGGCAACTTCGGCTAAGAGAGTGGCGACCACCAGACCTACGTTCTCTACTCT                                             M  Q  E  M  4-GCGCGGCTTTTGGCCACATACAATGGCAAATGCTACAAGAAGGATAATATCTGCAAGTAC 61------------------------------------------------------------120CGCGCCCAAAACCGGRGRATGTTACCGTTTACGATGTTCTTCCTATTATAGACGTTCATG A  R  V  L  A  T  Y  N  G  K  C  Y  K  K D N I C K Y-AAGGCACAGAGCGGCAAGACTGCCATTTGCAAGTGCTATGTCAAAAAGTGCCCCCCGGAC121------------------------------------------------------------180TTCCGTGTCTCGCCCTTCTGACGGTAAACGTTCACGATACAGTTTTTCAGGGGGCGGGCTGK  A  Q  S  G  K  T  A  I  C  K  C  Y  V  K  X  C  P  R  D-GGCGGCGAAATGCGAGTTTGACAGCTACAAGGGGAAGTGCTACTGCTAGACGGTGAGCGAA181------------------------------------------------------------240CCGCGCTTTACGCTCAAACTGTCGATGTTCCCCTTCACGATGACGATCTGCCACTCGCGTTG  A  K  C  E  F  D  S  Y  K  G  K  C  Y  C  *GGGACGAATAGGCTGGGGGTTATTTTACTCTGCT241-----------------------------------275CCCTGCTTCATCCGACCCCCAATAAAATGAGACGAA′Ala-Thr-Tyr-Asn-Gly-Lys-Cys-Tyr-Lys-Lys-Asp-Asn-Ile-Cys-Lys-Tyr-Lys-Ala-Gln-Ser-Gly-Lys-Thr-Ala-Ile-Cys-Lys-Cys-Tyr-Val-Lys-Lys-Cys-Pro-Arg-Asp-Gly-Ala-Lys-Cys-Glu-Phe- Asp-Ser-Tyr-Lys-Gly-Lys-Cys-Tyr-Cys.


[0111] Ala-Thr-Tyr-Asn-Gly-Lys-Cys-Tyr-Lys-Lys-Asp-Asn-Ile-Cys-Lys-Tyr-Lys-Ala-Gln-Ser-Gly-Lys-Thr-Ala-Ile-Cys-Lys-Cys-Tyr-Val-Lys -Lys-Cys-Pro-Arg-Asp-Gly-Ala-Lys-Cys-Glu-Phe-Asp-Ser-Tyr-Lys-Gly-Lys-Cys-Tyr-Cys.


[0112] Sequence listing B and B′ (PSI)


[0113] Seq IDNo.: 2


[0114] Sequence type: nucleotide with corresponding protein


[0115] Sequence length: 1078 base pairs (B′=incomplete PSI-cDNA clone)


[0116] Strandedness: single strand


[0117] Topology: linear


[0118] Molecule type: complementary DNA


[0119] Original source: barley seeds (Hordeum vulgare L. cv. Piggy)


[0120] Immediate experimental source: cDNA gene bank in λ-gt-11 phages


[0121] Name: protein synthesis inhibitor


[0122] Features: 42 bp-lona 5′-non-translating region open reading frame of 843 base pairs (the stop codon is marked by an asterisk) 193 base pair-long 3′-non-translated end, possible polyadenylation signals are underlined


[0123] Properties: antifungal activity, especially on spores of Trichoderma reesii and fusarium sporotrichoides and on Rhizoctonia solani. 2CTTAATAGCACATCTTGTCCGTCTTAGCTTTGCATTACATCCATGGCGGCAAAGATGGCG                         *                 M  A  A  K  M  A                                          -1  1AAGAACGTGGACAAGCCGCTCTTCACCGCGACGTTCAACGTCCAGGCCAGCTCCGCCGAC K  N  V  D  K  F  L  F  T  A  T  F  N  V  Q  A  S  S  A  D             10                            20TACGCCACCTTCATCGCCGGCATCCGCAACAAGCTCCGCAACCCGGCGCACTTCTCCCAC Y  A  T  F  I  A  G  I  R  N  K  L  R  N  P  A  H  F  S  H             30                            40AACCGCCCCGTGCTGCCGCCGGTCGAGCCCAACGTCCCGCCGAGCAGGTGGTTCCACGTG N  R  P  V  L  P  P  V  E  P  F  V  P  P  S  R  W  F  H  V             50                            60GTGCTCAAGGCCTCGCCGACCAGCGCCGGGCTCACGCTGGCCATTCGGGCGGACAACATC V  L  K  A  S  P  T  S  A  G  L  T  L  A  I  R  A  D  N  I             70                            80TACCTGGAGGGCTTCAAGAGCAGCGACGGCACCTGGTGGGAGCTCACCCCGGGCCTCATC Y  L  E  G  F  K  S  S  D  G  T  W  W  E  L  T  P  G  L  I             90                           100CCCGGCGCCACCTACGTGGGGTTCGGCGGCACCTACCGCGACCTCCTCGGCGACACCGAC P  G  A  T  Y  V  G  F  G  G  T  Y  R  D  L  L  G  D  T  D            110                            120AAGCTGACCAACGTCGCTCTCGGCCGGCAGCAGCTCCCGGACGCGGTGACCGCCCTCCAC K  L  T  N  V  A  L  G  R  Q  Q  L  A  D  A  V  T  A  L  B            130                           140GGGCGCACCAAGGCCGACAAGCCGTCCGGCCCGAAGCAGCAGCAGGCGAGGGAGGCGGTG G  R  T  K  A  D  K  P  S  G  P  K  Q  Q  Q  A  R  E  A  V            150                           160CCGACGCTGCTGGTCATGCTGAACGAGGCCACGCGGTTCCAGACGGTGTCTGGGTTCGTG T  T  L  L  L  M  V  N  I  A  T  R  T  Q  T  V  S  G  E  V            170                           180GCCGGGTTGCTGCACCCCAAGGCGGTGGAGAAGAAGAGCGGGAAGATCGGCAATGAGATG A  G  L  L  M  P  K  A  V  E  K  K  S  G  K  I  G  N  E  M            190                           200AAGGCCCAGGTGAACGGGTGGCAGGACCTGTCCGCGGCGCTGCTGAAGACGGACGTGAAG K  A  Q  V  N  G  W  Q  D  L  S  A  A  L  L  K  T  D  V  K            210                           220CCTCCGCCGGGAAAGTCGCCAGGGAAGTTCGCGCCGATCGAGAAGATGGGCGTGAGGACG P  P  P  G  K  S  P  A  K  F  A  P  I  E  K  M  G  V  R  T            230                           240GCTGTACAGGCCGCCAACACCCTGGGGATCCTGCTGTTCGTGGAGGTGCCGGGTGGGTTG A  V  Q  A  A  N  T  L  G  I  L  L  F  V  E  V  P  G  G  L            250                           260ACGGTGGCCAAGGCGCTGGACGTGTTCCATGCGAGTGGTGGGAAATAGGTAGTTTTCCAG T  V  A  K  A  L  E  L  F  H  A  S  G  G  K  *GTATACGTGCATGGGTAGTGTAAAAGTCG+E,uns AATAAACATGTCACAGAGTGACGGACTGATATA+E,uns AATAAATAAATAAACGTGTCACAGAGTTACATATAAACA+E,uns AATAAATAAATAATTAAAAATGTCCAGTTTA47 TCGGTGACGACGCTGCTCCTCATGGTGAACGAGGCCACGCGGTTCCAGACGGTGTCGGGG A  V  T  T  L  L  L  M  V  N  E  A  T  R  F  Q  T  V  S  G                  170                           180TTCGTGGCCGGGCTGCTGCACCCCAAGGCGGTGGAGAAGAAGAGCGGGAAGATCGGCAAT F  V  A  G  L  L  H  P  K  A  V  E  K  K  S  G  K  I  G  N                  190                           200GAGATGAAGGCCCAGGTGAACGGGTGGCAGGACCTGTCCGCGCGGCTGCTGAAGACGGAC E  M  K  A  Q  V  N  G  N  Q  D  L  S  A  A  L  L  K  T  D            210                           220GTGAAGCCCCCGCCGGGAAAGTCGCCAGCGAAGTTCACGCCGATCGAGAAGATGGGCGTG V  K  P  P  P  G  K  S  P  A  K  F  T  P  I  E  K  M  G  V                  230                           240AGGACTGCTGAGCAGGCTGCGGCTACTTTGGGGATCCTGCTGTTCGTTGAGGTGCCGGGT R  T  A  E  Q  A  A  A  T  L  G  I  L  L  F  V  E  V  P  G                  250                           260GGGTTGACGGTGGCCAAGGCGCTGGAGCTGTTTCATGCGAGTGGTGGGAAATAGGTAGTT G  L  T  V  A  K  A  L  E  L  F  H  A  S  G  G  K  *            270                           280TTGCAGGTATACCTGCATGGGTAAATGTAAAAGTCG+E,uns AATAAAAATGTCACAGAGTGACGGACTGATATA+E,uns AATAAATT+E,uns AATAAACATGTCATCATGAGTGACAGACTGATATAAATAAATA


[0124] Sequence listing C (ChiS)


[0125] Seq IDNo.: 3


[0126] Sequence type: nucleotide


[0127] Strandedness: single strand (the activated strand is double strand)


[0128] Topology: linear


[0129] Molecule type: cDNA


[0130] Immediate experimental source: plasmid pLChiS from E. Coli strain A 5187


[0131] Original source: Cosmid bank from Serratia Marcescens


[0132] Name: ChiS protein (chitinase)


[0133] Properties: exo-chitinase
3   1CAGGGCGTTG TCAATAATGA CAACACCCTG GCTGAAGAGT GTGGTGCAAT  51ACTGATAAAT ATTTATCTTT GGTTAATAGA AAATTCACTA TCCTTATTTG 101TCATGTTTTG ATTTATCTTT GCTTAATAGA ATTCACGCTT GCTGAATAAA 151ACGCAGTTGA TAGCGCTGTT GTTTTTGCGC CTTTTTTATT TATAGTACTG 201AATGTACGCG GTGGGAATGA TTATTTCGCC ACGTGGAAAG ACGCTGTTGT 251TATTTATTGA TTTTAACGTT CGCGGATTAT TGCGGAATTT TTTCGCTTCG 301GCAATGCATC GCGACGATTA ACTCTTTTAT GTTTATCCTC TCGGAATAAA 351GGAATCAGTT ATGCGCAAAT TTAATAAACC GCTGTTGGCG CTGTTGATCG 401GCAGCACGGT GTGTTCCGCG GCGCAGGCCG CCGCGCCGGG CAAGCCGACG 451ATCGCCTGGG GCAACACCAA GTTCGCCATC GTTGAAGTTG ACCAGGCGGC 501TACCGCTTAT AATAATTTGG TGAAGGTAAA AAATGCCGCC GATGTTTCCG 551TCTCCTGGAA TTTATGGAAT GGCGACACCG GCACGACGGC AAAAGTTTTA 601TTAAATGGCA AAGAGGCGTG GAGTGGTCCT TCAACCGGAT CTTCCGGTAC 651GGCGAATTTT AAAGTGAATA AAGGCGGCGG TTATCAAATG CAGGTGGCAC 701TGTGCAATGC GGACGGCTGC ACCGCCAGTG ACGCCACCGA AATTGTGGTA 751GCCGACACCG ACGGCAGCGA TTTGGCGCCG TTGAAAGAGC CGCTGCTGGA 801AAAGAATAAA CGGTATAAAC AGAACTCCGG CAAAGTGGTC GGTTCTTATT 851TCGTCGAGTG GGGCGTTTAC GGGCGCAATT TCACCGTCGA CAAGATCCCG 901GCGCAAAACC TGACCCACCT GCTGTACGGC TTTATCCCGA TCTGCGGCGG 951CAATGGCATC AACGACAGCC TGAAAGAGAT TGAAGGCAGC TTCCAGGCGT1001TGCAGCGCTC CTGCCAGGGC CGCGAGGACT TCAAAGTCTC GATCCACGAT1051CCGTTCGCCC CGCTGCAAAA AGCGCAGAAG GGCGTGACCG CCTGGGATGA1101CCGGTACAAG GGCAACTTCG GCCAGCTGAT GGCGCTGAAG CAGGCGCATC1151CTGACCTGAA AATCCTGCCG TCGATCGGCG GCTGGACGCT GTCCGACCCG1201TTCTTCTTCA TGGGCGACAA GGTGAAGCGC GATCGCTTGG TCGGTTCGGT1251GAAAGAGTTC CTGCAGACCT GGAAGTTCTT CGACGGCGTG GATATCGACT1301GGGAGTTGGG GGGCGGCAAA GGCGCCAACC CTAACCTGGG CAGCCCGCAA1351GACGGGGAAA CGTATGTGCT GCTGATGAAG GAGCTGCGGG CGATGCTGGA1401TCAGCTGTCG GTGGAAACGG GCCGCAAGTA TGAGCTGACC TCCGCCATCA1451GCGCCGGTAA GGACAAGATC GACAAGGTGG CTTACAACGT TGCGCAGAAC1501TCGATGGATC ACATGTTGCT GATGAGCTAC GACTTCTATG GCGCCTTCGA1551TCTGAAGAAC GTGGGGCATC AGACCGCGCT GAATGCGCCG GCCTGGAAAC1601CGGACACCGC CTACACCACG GTGAACGGCG TCAATGCGCT GCTGGCGCAG1651GGCGTCAAGC CGGGCAAAAT CGTCGTCGGC ACCGCCATGT ATGGCCGCGG1701CTGGACCGGG GTGAACGGCT ACCAGAACAA TATTCCGTTC ACCGGCACCG1751CCACCGGGCC GGTTAAAGGC ACCTGGGAGA ACGGTATCGT GGACTACCGC1801CAAATCGCCG GCCAGTTCAT GAGCGGCGAG TGGCAGTATA CCTACGACGC1851CACGGCGGAA GCGCCTTACG TGTTCAAACC TTCCACCGGC GATCTGATCA1901CCTTCGACGA TGCCCGCTCG GTGCAGGCTA AAGGCAAGTA CGTGTTGGAT1951AAGCAGCTGG GCGGCCTGTT CTGGTGGGAG ATCGACGCGG ATAACGGCGA2001TATTCTCAAC AGCATGAACG CCAGCCTGGG CAACAGCGCC GGCGTTCAAT2051AATCGGTTGC AGTGGTTGCC GGGGGATATC CTTTCGCCCC CGGCTTTTTC2101GCCGACGAAA GTTTTTTTAC GCCGCACAGA TTGTGGCTCT GCCCCGAGCA2151AAACGCGCTC ATCGGACTCA CCCTTTTGGG TAATCCTTCA GCATTTCCTC2201CTGTCTTTAA CGGCGATCAC AAAAATAACC GTTCAGATAT TCATCATTCA2251GCAACAAAGT TTTGGCGTTT TTTAACGGAG TTAAAAACCA GTAAGTTTGT


[0134] Sequence listing D (ChiG)


[0135] Seq IDNo.: 4


[0136] Sequence type: nucleotide


[0137] Sequence length: 1013 nucleotides


[0138] Molecule type: cDNA


[0139] Original source: barley seeds (Hordeum vulgare L.)


[0140] Name: ChiG (chitinase G)


[0141] Feature: 63 pb-long 5′-non-translating initial region, 798 pb open reading frame, 152 pb-long 3′-non-translated end, reading stop codons are marked by an asterisk, the probable signal peptide sequences are underlined, the amino-acid sequence of a 26 kD chitinase preprotein with 266 amino acids is indicated below the nucleotide sequence, the underlined AT-rich sequence in position 905 is probably a polyadenylation signal.


[0142] Properties antifungal activity, especially on Trichoderma reesii and Fusarium sporotrichoides as well as Rhizoctonia solani and Botrytis cinerea. D 4CCTACGACAGTAGCGTAACGGTAAACACCGAGTACGGTACTCTGTGCTTTGTTGGCTCGC  60                *     *ACAATGAGATCGCTCGCGGTGGTGGTGGCCGTGGTAGCCACGGTGGCCATGGCCATCGGC 120   +E,uns  M  R  S  L  A  V  V  V  A  V  V  A  T  V  A  M  A  I  G             −20                           −10ACGGCGCGCGGCAGCGTGTCCTCCATCGTCTCGCGCGCACAGTTTGACCGCATGCTTCTC 180+E,uns  T  A  R  G  S  V  S  S  I  V  S  R  A  Q  F  D  R  M  L  L          −1  1                           10CACCGCAACGACGGCGCCTGCCAGGCCAAGGGCTTCTACACCTACGACGCCTTCGTCGCC 240+E,uns R  R  N  D  G  A  C  Q  A  K  G  F  Y  T  Y  D  A  F  V  A           20                            30GCCGCAGCCGCCTTCCCGGGCTTCGGCACCACCGGCAGCGCCGACGCCCAGAAGCGCGAG 300+E,uns  A  A  A  A  F  P  G  F  G  T  T  G  S  A  D  A  Q  K  R +E,uns  E           40                            50GTGGCCGCCTTCCTAGCACAGACCTCCCACGAGACCACCGGCGGGTGGGCGACTGCACCG 360+E,uns  V  A  A  F  L  A  Q  T  S  H  E  T  T  G  G  W +E,uns  A  T  A  P           60                            70GACGGGGCCTTCGCCTGGGGCTACTGCTTCAAGCAGGAACGTGGCGCCTCCTCCGACTAC 420+E,uns  D  G  A  F  W  W  G  Y  C  F  K  Q  E  R  G  A  S  S  D  Y          80                             90TGCACCCCGAGCGCACAATGGCCGTGCGCCCCCGGGAAGCGCTACTACGGCCGCGGGCCA 480 C  T  P  S  A  Q  W  P  C  A  P  G  K  R  Y +E,uns  Y  G  R  G  P          100                           110ATCCAGCTCTCCCACAACTACAACTATGGACCTGCCGGCCGGGCCATCGGGGTCGATCTG 540+E,uns  I  Q  L  S  H  N  Y  N  Y  G  P  A  G  R  A  I  G  V  D  L          120                           130CTGGCCAACCCGGACCTGGTGGCCACGGACGCCACTGTGGGCTTTAAGACGGCCATCTGG 600+E,uns  L  A  N  P  D  L  V  A  T  D  A  T  V  G  F  K  T  A  I  W         140                           150TTCTGGATGACGGCGCAGCCGCCCAAGCCATCGAGCCATGCTGTGATCGCCGGCCAGTGG 660 F  W +E,uns  M  T  A  Q  P  P  K  P  S  S  H  A  V  I  A  G  Q  W          160                           170AGCCCGTCAGGGGCTGACCGGGCCGCAGGCCGGGTGCCCGGGTTTGGTGTGATCACCAAC 720+E,uns  S  P  S  G  A  D  R  A  A  G  R  V  P  G  F  G  V  I  T  N          180                           190ATCATCAACGGCGGGATCGAGTGCGGTCACGGGCAGGACAGCCGCGTCGCCGATCGAATC 780+E,uns  I  I  N  G  G  I  E  C  G  H  G  Q  D  S  R  V  A  D  R  I          200                           210GGGTTTTACAAGCGCTACTGTGACATCCTCGGCGTTGGCTACGGCAACAACCTCGATTGC 840+E,uns  G  F  Y  K  R  Y  C  D  I  L  G  V  G  Y  G  N  N  L  D  C          220                           230TACAGCCAGAGACCCTTCGCCTAATTAATTAGTCATGTATTAATCTTGGCCCTCCATAAA 900+E,uns  Y  S  Q  R  P  F  A  *         240ATAC+E,uns AATAAGAGCATCGTCTCCTATCTACATGCTGTAAGATGTAACTATGGTAACCTTTT 960ATGGGGAACATAACAAAGGCATCTCGTATAGATGCTTTGCTA121013


[0143] Sequence listing E (GluG)


[0144] Seq IDNo.: 5


[0145] Sequence type: nucleotide with corresponding protein


[0146] Sequence length: 1249 nucleotides


[0147] Molecule type: cDNA


[0148] Original source: barley seed (Hordeum vulgare L.)


[0149] Name: GluG (glucanase)


[0150] Feature: 48 bp-long 5′-non-translating initial region open reading frame of 1002 bp 199 pb-long 3′-non-translated end, the underlined At-rich sequence at position 1083 and 1210 are probably polyadenylation signals, the derived amino-acid sequence of the encoded preprotein of 334 amino acids is indicated below the nucleotide sequence. E
5GGCAGCATTGCATAGCATTTGAGCACCAGATACTCCGTGTGTGCACCAATGGCTAGAAAA  60                                                +E,uns  M  A  R  K                                                 −28                      *                  *GATGTTGCCTCCATGTTTGCAGTTGCTCTCTTCATTGGAGCATTCGCTGCTGTTCCTACG 120+E,uns  D  V  A  S  M  F  A  V  A +E,uns    L  I  G  A  F  A  A  V  P  T             −20                           −10AGTGTGCAGTCCATCGGCGTATGCTACGGCGTGATCGGCAACAACCTCCCCTCCCGGAGC 180+E,uns  S  V  Q  S  I  G  V  C  Y  G  V  I  G  N  N  L  P  S  R  S          −1 +1                         10GACGTGGTGCAGCTCTACAGGTCCAAGGGCATCAACGGCATGCGCAT{overscore (CTACTTCGCCGAC)} 240 D  V  V  Q  L  Y  R  S  K  G  I  N  G  M  R  I  Y  F  A  D          20                            30{overscore (GGGCAGGCCCTCTCGGCCGTCCGCAACTCCGGCATCGGCCTCATCCTCGACATCGGC)}AAC 300 G  Q  A  L  S  A  V  R  N  S  G  I  G  L  I  L  D  I  G  N          40                            50GACCAGCTCGCCAACATCGCCGCCAGCACCTCCAACGCGGCCTCCTGGGTCCAGAACAAC 360 D  Q  L  A  N  I  A  A  S  T  S  N  A  A  S  W  V  Q  N  N          60                            70GTGCGGCCCTACTACCCTGCCGTGAACATCAAGTACATCGCCGCCGGCAACGAGGTGCAG 420 V  R  P  Y  Y  P  A  V  N  I  K  Y  I  A  A  G  N  E  V  Q          80                            90GGCGGCGCCACGCAGAGCATCCTGCCGGCCATGCGCAACCTCAACGCGGCCCTCTCCGCG 480 G  G  A  T  Q  S  I  L  P  A  M  R  N  L  N  A  A  L  S  A         100                           110GCGGGGCTCGGCGCCATCAAGGTGTCCACCTCCATCCGGTTCGACGAGGTGGCCAACTCC 540 A  G  L  G  A  I  K  V  S  T  S  I  R  F  D  E  V  A  N  S         120                           130TTCCCGCCCTCCGCCGGCGTGTTCAAGAACGCCTACATGACGGACGTGGCCCGGCTCCTG 600 F  P  P  S  A  G  V  F  K  N  A  Y  M  T  D  V  A  R  L  L         140                           150GCGAGCACCGGCGCGCCGCTGCTCGCCAACGTCTACCCCTACTTCGCGTACCGTGACAAC 660 A  S  T  G  A  P  L  L  A  N  V  Y  P  Y  F  A  Y  R  D  N         160                           170CCCGGGAGCATCAGCCTGAACTACGCGACGTTCCAGCCGGGCACCACCGTGCGTGACCAG 720 P  G  S  I  S  L  N  Y  A  T  F  Q  P  G  T  T  V  R  D  Q         180                           190AACAACGGGCTGACCTACACGTCCCTGTTCGACGCGATGGTGGACGCCGTGTACGCGGCG 780 N  N  G  L  T  Y  T  S  L  F  D  A  M  V  D  A  V  Y  A  A         200                           210CTGGAGAAGGCCGGCGCGCCGGCGGTGAAGGTGGTGGTGTCGGAGAGCGGGTGGCCGTGG 840 L  E  K  A  G  A  P  A  V  K  V  V  V  S  E  S  G  W  P  S         220                           230GCGGGCGGGTTTGCGGCGTCGGCCGGCAATGCGCGGACGTACAACCAGGGGCTGATCAAC 900 A  G  G  F  A  A  S  A  G  N  A  R  T  Y  N  Q  G  L  I  N         240                           250CACGTCGGCGGGGGCACGCCCAAGAAGCGGGAGGCGCTGGAGACGTACATCTTCGCCATG 960 H  V  G  G  G  T  P  K  K  R  E  A  L  E  T  Y  I  F  A  M         260                           270TTCAAGGAGAACCAGAAGACCGGCCACGCCACGGAGAGGAGCTTCGGGCTCTTCAACCCG1020 F  N  E  N  Q  K  Y  G  D  A  T  E  R  S  F  G  L  F  N  P         280                           290GACAAGTCGCCGGCATACAACATCCAGTTCTAGTACGTGTAGCTACCTAGCTCACATACC1080 D  K  S  P  A  Y  N  I  Q  F  *         300TA+E,uns AATAAATAAGCTGCACGTACGTACGTAATGCGGCATCCAAGTGTAACGTAGACACGTA1140CATTCATCCATGGAAGAGTGCAACCAAGCATGCGTTAACTTCCTGGTGATGATACATCAT1200CATGGTATGAATAAAAGATATGGAAGATGTTATGA151249


[0151]


Claims
  • 1. Transgenic pathogen-resistant organism characterized in that its genome contains at least two different genes under the control of active promoters with pathogen-inhibiting action.
  • 2. Transgenic pathogen-resistant organism according to claim 1, characterized in that the genes code for gene products which reduce the vitality of fungi.
  • 3. Transgenic pathogen-resistant organism according to claim 1 or 2, characterized in that the genes are of fungal, bacterial, plant, animal or viral origin.
  • 4. Transgenic pathogen-resistant organism according to claim 2 or 3, characterized in that the gene products have properties promoting resistance to fungi.
  • 5. Transgenic pathogen-resistant organism according to claim 4, characterized in that the gene products are chitinase (ChiS, ChiG), glucanase (GluG), protein synthesis inhibitor (PSI) and antifungal protein (AFP).
  • 6. Transgenic pathogen-resistant organism according to any of claims 1 to 5, characterized in that the latter is a plant.
  • 7. Transgenic pathogen-resistant organism according to claim 6, characterized in that it is a tobacco, potato, strawberry, corn, rape or tomato plant.
  • 8. DNA-transfer vectors with inserted DNA sequences according to one or more of the preceding claims.
  • 9. Process for the generation of pathogen-resistant organisms according to any of claims 1-7, characterized in that at least one gene with pathogen-inhibiting action is transferred into the genome of an organism, and the pathogen-resistant organism is obtained (a) by crossing the organism with another, optionally transgenic, organism which contains at least one other gene with pathogen-inhibiting action, and subsequently selecting, and/or (b) by transformation of at least one other gene with pathogen-inhibiting action into the organism.
  • 10. Process according to claim 9, characterized in that DNA-transfer vectors with inserted DNA sequences corresponding to a gene with pathogen-inhibiting action as described in any of claims 1 to 5 are used.
  • 11. Process for the generation of pathogen-resistant organisms according to any of claims 1-7, characterized in that vectors which comprises more than one gene with pathogen-inhibiting action are used for the transformation into the genome of an organism.
  • 12. Process for ensuring the resistance of organisms to pathogens, characterized in that the organism used is a transgenic pathogen-resistant organism according to any of claims 1 to 7 or an organism whose genome contains at least one gene complying with the definitions of claims 1 to 7, and at least one substance which is not expressed by the organism but corresponds to any other one of the gene products complying with claims 1 to 7 is applied to the organism.
Priority Claims (1)
Number Date Country Kind
P 42 34 131.0 Oct 1992 DE
Divisions (2)
Number Date Country
Parent 08812025 Mar 1997 US
Child 09138873 Aug 1998 US
Parent 08457797 Jun 1995 US
Child 08812025 Mar 1997 US
Continuations (1)
Number Date Country
Parent 08134416 Oct 1993 US
Child 08457797 Jun 1995 US