Two copies of the sequence listing (Copy 1 and Copy 2) and a computer readable form (CRF) of the sequence listing, all on CD-ROMs, each containing the file named SEQUENCE_LISTING.txt, which is approximately 901,120 Bytes (measured in MS-WINDOWS), are herein incorporated by reference.
The invention relates generally to plant molecular biology and more particularly to the expression of isopentenyl transferase genes in plants under the control of cell cycle promoters that function in plants.
One of the goals of plant genetic engineering is to produce plants with agronomically important characteristics or traits. Recent advances in genetic engineering have provided the requisite tools to transform plants to contain and express foreign genes. Particularly desirable traits or qualities of interest for plant genetic engineering include but are not limited to resistance to insects and other pests and disease-causing agents, tolerances to herbicides, enhanced stability, yield, yield stability, shelf-life, environmental tolerances, and nutritional enhancements. The technological advances in plant transformation and regeneration have enabled researchers to take pieces of DNA, such as a gene or genes from a heterologous source, or a native source, and incorporate the exogenous DNA into the plant's genome. The gene or gene(s) can then be expressed in the plant cell to exhibit the added characteristic(s) or trait(s). In one approach, expression of a novel gene that is not normally expressed in a particular plant or plant tissue confers a desired phenotypic effect(s).
Plant growth and development is controlled by a diverse array of phytohormones in response to endogenous signals and environmental cues. These molecules include auxins, gibberellins, ethylene, cytokinins, abscisic acid, brassinosteroids, oligosaccharides, jasmonates, salicylic acid, and polyamines. In recent years, the large-scale sequencing of plant genomes, together with extensive molecular, genetic and biochemical studies, has led to the elucidation of the biosynthetic pathways for cytokinin biosynthesis. This in turn has allowed for new approaches to crop improvement by manipulating the expression of genes regulating the plant hormone biosynthesis through novel combination of gene expression elements and structural genes. Prior work has shown through both forward and reverse genetic analyses that plant hormonal regulation is highly complex. This has made it difficult to develop transgenic plants with improved agronomic traits but without deleterious pleiotropic effects.
Isopentenyl transferase (IPT) is a gene that was first isolated from Agrobacterium tumefaciens T-DNA. It was shown that expression of IPT in transgenic plants resulted in elevated cytokinin accumulation, which was accompanied by morphological alterations of transgenic plants. Expression of IPT in an entire plant has phenotypes that are not advantageous, causing dwarfing, reduced leaf area, and thicker stems (Hlinkova, E., et al., Biologia Plantarum, Vol. 41: 25-37, 1998). Expression in entire plants also leads to stunting, loss of apical dominance, reduction in root initiation and growth, either acceleration or prolonged delayed senescence in leaves (depending on growth conditions), adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems (Li, et al., Dev Biol 153: 386-395, 1992). When IPT is constitutively expressed at high level through either the CaMV 35S promoter or the native IPT promoter, the transgenic plants would develop severely retarded shooty morphology and would fail to root (Klee et al., Ann Rev Plant Phys 38:467-486, 1987). Whole plants transformed with IPT genes with weaker or controlled expression, such as the promoter of heat shock protein genes, also display the effects of cytokinin overproduction, such as uncontrolled axillary bud growth as a result of the loss of apical dominance, the development of small, rounded or curling leaves, and the retardation of root formation (Medford et al., Plant Cell 1:403-413, 1989; Schmulling et al., FEBS Letters 249:401-406, 1989; Smigocki, PNAS 85: 5131-5135, 1991; Hewelt et al., Plant J 6: 879-891, 1994; Smart et al., Plant Cell 647-656, 1991; Van Loven et al., J Exp Bot 44: 1671-1678, 1993; Faiss et al., Plant J 12: 401-425, 1997). It was also shown that low level of constitutive IPT expression, such as that directed by a heat shock promoter under non-inductive conditions, would be sufficient to induce abnormal plant growth and development (Medford et al., Plant Cell 1:403-413 1989; Smigocki, PNAS 85: 5131-5135, 1991). Remarkably, such deleterious pleiotrophs occurred even when some seemingly tissue or organ specific promoters were used to drive the IPT expression in plants. For example, when an auxin-inducible bidirectional promoter from the soybean SAUR gene was used to drive the expression of IPT in transgenic tobacco plants, the transgene-produced cytokinin was present in a tissue- and organ-specific manner. Yet the localized overproduction of cytokinins still resulted in a number of morphological and physiological off-types, including stunting, loss of apical dominance, reduction in root initiation and growth, abnormal leaf development, adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems (Li, et al., Dev Biol 153: 386-395, 1992). When IPT was specifically expressed in developing seeds using a highly specific seed promoter, no seed size increase was observed (Roeckel et al., Transgenic Res 6:133-141, 1997). We show that, despite these and other teachings against expression of IPT in plants, the expression under certain cell cycle regulated promoters leads to advantageous phenotypes.
In accordance with the present invention, it has been found that a transgenic plant expressing a cytokinin biosynthetic protein under the regulatory control of a cell cycle regulated promoter exhibits improved yield related characteristics manifested in desirable phenotypes under field growing conditions. By this invention, therefore, compositions and methods of use related to DNA polynucleotides comprising a cell cycle regulated promoter operably linked to a polynucleotide encoding a cytokinin biosynthetic protein, e.g. an isopentenyl transferase, are provided. Also provided herein are transgenic plants and plant cells expressing a desired cytokinin biosynthetic protein under control of a cell cycle regulated promoter whose expression of an operably linked polynucleotide is highest in dividing cells as compared to non-dividing cells and methods of use related to such transgenic plants.
In accordance with one aspect of the invention transgenic plants expressing a cytokinin biosynthetic protein under the control of a cell cycle regulated promoter are provided wherein the plants exhibit at least one phenotypic trait selected from the group consisting of accelerated plant growth, increased organ size, increased organ number, increased reproductive organ number, increased seed size, increased silique number, and/or increased seed number when compared to a plant of the same species not expressing such cytokinin biosynthetic protein under the control of a cell cycle regulated promoter.
In accordance with a further aspect of the invention, recombinant DNA polynucleotides comprising a cell cycle regulated promoter that functions in plants operably linked to a DNA polynucleotide which encodes a protein involved in cytokinin biosynthesis are provided.
In accordance with another aspect of the invention, cell cycle regulated promoters are provided. More particularly, such promoters are identified from the 5′ upstream region of the family of cyclin genes, such as the promoter regions selected from the group consisting of the CycD3 and CycB1 genes.
Also provided are recombinant DNA polynucleotides encoding a protein that are similar to an isopentenyl transferase, encodes a protein that is substantially identical to, or hybridizes to a nucleic acid encoding, a protein selected from the group consisting of SEQ ID NO: 1, 2, 15, 17, 19, 21 and 22-359.
Also provided are recombinant DNA molecules with combinations of cyclin promoters and DNA polynucleotides encoding an isopentyl transferase and transgenic plants containing such a recombinant DNA molecule.
It has been discovered that a transgenic plant expressing a cytokinin biosynthetic protein under the regulatory control of a cell cycle regulated promoter exhibits improved yield related characteristics manifested in desirable phenotypes under field growing conditions. By this invention, therefore, compositions and methods of use related to DNA polynucleotides comprising a cell cycle regulated promoter operably linked to a polynucleotide encoding a cytokinin biosynthetic protein, e.g. an isopentenyl transferase, are provided. Also provided herein are transgenic plants and plant cells expressing a desired cytokinin biosynthetic protein under control of a cell cycle regulated promoter whose expression of an operably linked polynucleotide is highest in dividing cells as compared to non-dividing cells and methods of use related to such transgenic plants.
Isopentyl transferase (IPT) is a gene involved in cytokinin biosynthesis that may be isolated from many species. One particular IPT is a gene isolated from Agrobacterium tumefaciens T-DNA. It has been shown that expression of IPT in transgenic plants resulted in elevated cytokinin accumulation, which was accompanied by morphological alterations of transgenic plants. Constitutive expression of IPT in an entire plant exhibits phenotypes that are not advantageous for a growing crop. Herein it is shown that the expression of IPT under the regulatory control of a cell cycle regulated promoter whose expression is predominantly in dividing cells of the plant provides advantageous phenotypes directed to yield that are useful for a growing crop plant.
“Isopentyl transferase” or “isopentenyl transferase” or “IPT” or “ipt” as used herein includes any enzyme that catalyzes the reaction of adenosine 5′-monphosphate or adenosine 5;-triphosphate and dimethylallyl disphosphate to N6-(Δ2-isopentenyl)adenosine 5′-phosphate, including but not limited to all isopentenyl transferase/dimethylallyl transferase from all sources including plants, animals, and microbes (Buchanan, et al., Biochemistry and Molecular Biology of Plants, Courier Companies, Inc., USA, ISBN 0-943088-39-9; Haberer and Kieber, Plant Physiology 128:354 (2002)). “Isopentyl transferase” or “isopentenyl transferase” or “IPT” or “ipt” also includes any enzyme that increases cytokinin levels through a pathway which includes zeatinriboside-5′-monphosphate (ZMP) (Astot, et al., PNAS 97:14778-14883, 2000). Examples of IPT and IPT-like proteins that are within the scope of the invention include SEQ ID NOs: 2, 15, 17, 19, 21, and 22-359, and any protein related thereto, or any nucleotide sequence encoding such a protein including such nucleotide sequences that would hybridize to any of SEQ ID Nos: 1, 14, 16, 18 and 20 under stringent conditions as described hereinafter. IPT genes expected to function in the invention include, but are not limited to, for example, proteins which contain the motif found in many IPT genes, such as PF01715 are also expected to function in the invention. These latter motifs are from Pfam which describes IPT and IPPT as follows: IPT or isopentenyl transferase/dimethylallyl transferase synthesizes isopentenyladensosine 5′-monophosphate, a cytokinin that induces shoot formation on host plants infected with the Ti plasmid. IPPT is a family of IPP transferases (EC:2.5.1.8) also known as tRNA delta(2)-isopentenylpyrophosphate transferase, these enzymes modify both cytoplasmic and mitochondrial tRNAs at A(37) to give isopentenyl A(37). Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein families. Pfam version 12.0 (January 2004) contains alignments and models for 7316 protein families, based on the Swissprot 42.5 and SP-TrEMBL 25.6 protein sequence databases.
“Promoter,” as used herein, refers to a DNA polynucleotide that binds an RNA polymerase (either directly or indirectly through another transcription factors) and promotes transcription of a downstream DNA polynucleotide. The downstream DNA polynucleotide can be transcribed into an RNA that has function, such as rRNA, RNAi, dsRNA, or tRNA. Often, the RNA produced is a hetero-nuclear (hn) RNA that has introns which are spliced out to produce an mRNA (messenger RNA). A “plant promoter” is a native or non-native promoter that is functional in plant cells
A cell cycle regulated promoter is a promoter that is regulated in its expression during the cell cycle. Cell cycle regulated promoters, as used herein, are further characterized in that they express an operably linked polynucleotide at their highest levels in actively dividing cells as compared to non-dividing cells. Preferably, cell cycle regulated promoters of the present invention are characterized by a reduction of about 20%-about 30% in the expression level of an operably linked polynucleotide in non-dividing cells. More preferably, a cell cycle regulated promoter of the present invention has an expression pattern wherein 10% or less of the expression of an operably linked polynucleotide can be attributed to non-dividing cells. The promoters herein encompass not only the sequences of the cell cycle regulated promoters described herein, but sequences that hybridize (as defined hereinafter) to at least one of the cell cycle regulated promoter sequences provided herein and operative fragments thereof, that function as plant promoters in the same or similar manner. In particularly preferred embodiments, the cell cycle regulated promoter is a promoter isolated from a member of the cyclin gene family. Specific cyclin promoters include those selected from the group consisting of the promoters identified herein as CycD3 (SEQ ID NO:8) or CycB1 (SEQ ID NO:5), both Arabidopsis promoters. The term “cyclin” refers to a regulatory protein, comprising a protein domain of about 100 amino acids known as the “cyclin box”. The cyclin box is the binding site for cyclin-dependent kinases, allowing the cyclin to exert its regulatory effect on the kinase activity of the CDKs. A cyclin box can be identified by comparing the amino acid sequence of the protein with known cyclin boxes. An amino acid sequence identified as a cyclin box on the basis of sequence comparison should possess at least the 5 conserved residues required for cyclin activity R(97), D(126), L(144), K(155), and E(185) (indicated positions are from the sequence of CYCD2 from Arabidopsis thaliana) at equivalent positions. (See, e.g., Soni et al., Plant Cell, 7:85-103 (1995) and Renaudin et al., Plant Molecular Biology, 32:1003-1018 (1996)) (R=arginine, D=aspartic acid, L=leucine, K=lysine, and E=glutamic acid). Cyclin promoters are those promoters that drive the expression of cyclin genes at specific times within each cell cycle in the organism in which they occur, for example, plants. Specific cyclin promoters include those of specific cyclin genes, for example see the sequence listing and examples. Cell cycle progression requires the activation of cyclin-dependent kinases (CDKs) whose catalytic activity and substrate specificity are determined by cyclins and by other regulatory proteins (Hilde et al., Plant Molecular Biology, 43:583-593, 2000; Marcel and Murray, Current Opinion in Plant Biology, 4:44-49, 2002). The activity of the CDK-cyclin complexes is activated and deactivated at specific points in the cell cycle. Certain CDK-cyclin complexes are activated at the G1-S transition and trigger the start of DNA replication. Different CDK-cyclin complexes are activated at the G2/M transition and induce mitosis leading to cell division. As used herein, cell division control (CDC) genes are genes that control cell division, and are differently expressed during cell division. Promoters isolated from a CDC genes of specific types, for example, CDC2a (SEQ ID NO: 11) do not have expression patterns that provide high level expression predominantly in dividing cells.
A first nucleic acid or protein sequence displays “substantial identity” or “substantial similarity” to a reference nucleic acid sequence or protein if, when optimally aligned (with appropriate nucleotide or amino acid insertions or deletions totaling less than 20 percent of the reference sequence over the window of comparison) with the other nucleic acid (or its complementary strand) or protein, there is at least about 60% nucleotide sequence equivalence, even better would be 70%, preferably at least about 80% equivalence, more preferably at least about 85% equivalence, and most preferably at least about 90% equivalence over a comparison window of at least 20 nucleotide or amino acid positions, preferably at least 50 nucleotide or amino acid positions, more preferably at least 100 nucleotide or amino acid positions, and most preferably over the entire length of the first nucleic acid or protein. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm(s), preferably by computerized implementations of these algorithms (which can be found in, for example, Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.). The reference nucleic acid may be a full-length molecule or a portion of a longer molecule. Alternatively, two nucleic acids have substantial identity if one hybridizes to the other under stringent conditions. Appropriate hybridization conditions can be determined empirically, or can be estimated based, for example, on the relative G+C content of the probe and the number of mismatches between the probe and target sequence, if known. Hybridization conditions can be adjusted as desired by varying, for example, the temperature of hybridizing or the salt concentration (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989).
The term “recombinant DNAs” or “recombinant DNA molecules” as used herein means DNAs that contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes, and the like. The polynucleotide itself can come from either naturally occurring sources or can be created in the laboratory. It can also include all vectors created by DNA engineering, for example, all the DNA molecules included herein designated by pMON. For example, it can include molecules containing naturally occurring DNA or cDNA, or DNA molecules of synthetic origin in a plasmid, or isolated DNA. A “recombinant” polynucleotide or “recombinant DNA molecule” can be made by an artificial combination of two otherwise separated segments of a polynucleotide, e.g., by chemical synthesis or by the manipulation of isolated segments of polynucleotides by genetic engineering techniques. Techniques for nucleic-acid manipulation are well-known (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y. (1989); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. (1988). The terms “recombinant DNA construct”, “recombinant vector”, “expression vector” or “expression cassette” refer to any agent such as a plasmid, cosmid, virus, BAC (bacterial artificial chromosome), autonomously replicating polynucleotide, phage, or linear or circular single-stranded or double-stranded DNA or RNA polynucleotide, derived from any source, capable of genomic integration or autonomous replication, comprising a DNA molecule in which one or more DNA polynucleotides have been linked in a functionally operative manner.
Hybridization conditions are dependent on the sequence of the polynucleotide and will be different in different circumstances. As used herein “stringent conditions” are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific polynucleotide at a defined ionic strength and pH. The “thermal melting point” is the temperature (under defined ionic strength and pH) at which 50% of a target molecule hybridizes to a completely complementary molecule. Appropriate stringent conditions which promote DNA hybridization, for example, 6.0× sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0×SSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, incorporated herein by reference in its entirety. For example, the salt concentration in the wash step can be selected from a low stringent condition of about 2.0×SSC at 50° C. to a high stringency of about 0.2×SSC at 50° C. In addition, the temperature in the wash step can be increased from low stringent conditions at room temperature, about 22° C., to high stringent conditions at about 65° C. Both temperature and salt concentration may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. For the purposes of this disclosure, stringent conditions include at least one wash in 2.0×SSC at a temperature of at least about 50° C. for 20 minutes, or equivalent conditions.
A first polynucleotide is “operably linked” with a second polynucleotide when the polynucleotides are so arranged that the first polynucleotide affects the function of the second polynucleotide. Often, the two polynucleotides are part of a single contiguous polynucleotide molecule and sometimes are adjacent. For example, a promoter is operably linked to a gene if the promoter regulates or mediates transcription of the gene. A promoter is “naturally operably linked” to a structural gene if the promoter drives the transcription of the structural gene in the genome of an organism when said promoter and said structural gene are in their native locations within said genome.
“Heterologous” sequence refers to a sequence which originates from a foreign source or species or, if from the same source or species, is modified from its original form; for example, a gene from a fungus being expressed in a plant; or a gene from the same species present under a different promoter, or a promoter driving the expression of a gene or RNA in a non-native location within the genome.
An “isolated” nucleic acid sequence or DNA molecule is substantially separated or purified away from other nucleic acid sequences with which the nucleic acid is normally associated in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal or extrachromosomal DNA. The term embraces nucleic acids that are biochemically purified so as to substantially remove contaminating nucleic acids and other cellular components. The term also embraces recombinant nucleic acids and chemically synthesized nucleic acids.
“Native” refers to a naturally occurring (“wild-type”) nucleic acid sequence.
In a preferred embodiment, the instant invention comprises a transgenic plant comprising a recombinant DNA molecule having a cell cycle regulated promoter operably linked to a cytokinin biosynthetic enzyme. The plant may be a monocotyledonous plant or dicotyledonous, and includes but is not limited to corn, soybean, Arabidopsis, cotton, wheat, rice, and canola.
Recombinant DNA molecules of the instant invention can be transformed into a many commercially useful plants. In a preferred embodiment of the invention, a transgenic plant expressing the desired protein is to be produced. In this case the desired protein may be operably linked to particular promoter controlling expression in a cell cycle regulated way. Various methods for the introduction of a desired polynucleotide sequence encoding the desired protein into plant cells are available and known to those of skill in the art and include, but are not limited to: (1) physical methods such as microinjection, electroporation, and microprojectile mediated delivery (biolistics or gene gun technology); (2) virus mediated delivery methods; and (3) Agrobacterium-mediated transformation methods.
The most commonly used methods for transformation of plant cells are the Agrobacterium-mediated DNA transfer process and the biolistics or microprojectile bombardment mediated process (i.e., the gene gun). Typically, nuclear transformation is desired but where it is desirable to specifically transform plastids, such as chloroplasts or amyloplasts, plant plastids may be transformed utilizing a microprojectile mediated delivery of the desired polynucleotide.
Agrobacterium-mediated transformation is achieved through the use of a genetically engineered soil bacterium belonging to the genus Agrobacterium. A number of wild-type and disarmed strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants. Gene transfer is done via the transfer of a specific DNA known as “T-DNA” that can be genetically engineered to carry any desired piece of DNA into many plant species.
Agrobacterium-mediated genetic transformation of plants involves several steps. The first step, in which the virulent Agrobacterium and plant cells are first brought into contact with each other, is generally called “inoculation”. Following the inoculation, the Agrobacterium and plant cells/tissues are permitted to be grown together for a period of several hours to several days or more under conditions suitable for growth and T-DNA transfer. This step is termed “co-culture”. Following co-culture and T-DNA delivery, the plant cells are treated with bactericidal or bacteriostatic agents to kill the Agrobacterium remaining in contact with the explant and/or in the vessel containing the explant. If this is done in the absence of any selective agents to promote preferential growth of transgenic versus non-transgenic plant cells, then this is typically referred to as the “delay” step. If done in the presence of selective pressure favoring transgenic plant cells, then it is referred to as a “selection” step. When a “delay” is used, it is typically followed by one or more “selection” steps.
With respect to microprojectile bombardment (U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,880; U.S. Pat. No. 5,610,042; and PCT Publication WO 95/06128; each of which is specifically incorporated herein by reference in its entirety), particles are coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold.
An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is the Biolistics Particle Delivery System (BioRad, Hercules, Calif.), which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension.
Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species. Examples of species that have been transformed by microprojectile bombardment include monocot species such as maize (PCT Publication WO 95/06128), barley, wheat (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety), rice, oat, rye, sugarcane, and sorghum; as well as a number of dicots including tobacco, soybean (U.S. Pat. No. 5,322,783, specifically incorporated herein by reference in its entirety), sunflower, peanut, cotton, tomato, and legumes in general (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety).
To select or score for transformed plant cells regardless of transformation methodology, the DNA introduced into the cell contains a gene that functions in a regenerable plant tissue to produce a compound that confers upon the plant tissue resistance to an otherwise toxic compound. Genes of interest for use as a selectable, screenable, or scorable marker would include but are not limited to GUS, green fluorescent protein (GFP), luciferase (LUX), antibiotic or herbicide tolerance genes. Examples of antibiotic resistance genes include the penicillins, kanamycin (and neomycin, G418, bleomycin), methotrexate (and trimethoprim), chloramphenicol, kanamycin, and tetracycline.
The regeneration, development, and cultivation of plants from various transformed explants is well documented in the art. This regeneration and growth process typically includes the steps of selecting transformed cells and culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. Developing plantlets are transferred to soil less plant growth mix, and hardened off, prior to transfer to a greenhouse or growth chamber for maturation.
The present invention can be used with any transformable cell or tissue. By transformable as used herein is meant a cell or tissue that is capable of further propagation to give rise to a plant. Those of skill in the art recognize that a number of plant cells or tissues are transformable in which after insertion of exogenous DNA and appropriate culture conditions the plant cells or tissues can form into a differentiated plant. Tissue suitable for these purposes can include but is not limited to immature embryos, scutellar tissue, suspension cell cultures, immature inflorescence, shoot meristem, nodal explants, callus tissue, hypocotyl tissue, cotyledons, roots, and leaves.
Any suitable plant culture medium can be used. Examples of suitable media would include but are not limited to MS-based media (Murashige and Skoog, Physiol. Plant, 15:473-497, 1962) or N6-based media (Chu et al., Scientia Sinica 18:659, 1975) supplemented with additional plant growth regulators including but not limited to auxins, cytokinins, ABA, and gibberellins. Those of skill in the art are familiar with the variety of tissue culture media, which when supplemented appropriately, support plant tissue growth and development and are suitable for plant transformation and regeneration. These tissue culture media can either be purchased as a commercial preparation, or custom prepared and modified. Those of skill in the art are aware that media and media supplements such as nutrients and growth regulators for use in transformation and regeneration and other culture conditions such as light intensity during incubation, pH, and incubation temperatures that can be optimized for the particular variety of interest.
The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art. See generally, Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Weissbach and Weissbach, In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif. (1988). Plants of the present invention can be part of or generated from a breeding program, and may also be reproduced using apomixis. Methods for the production of apomictic plants are known in the art. See, e.g., U.S. Pat. No. 5,811,636.
The transgenic plant prepared in accordance with the invention may be of any generation, including a fertile or sterile R0 transgenic plant as well as seeds thereof, and hybrid seed wherein the seed comprises a cell cycle regulated promoter operably linked to a cytokinin biosynthetic enzyme, e.g. isopentyl transferase. Also included within the invention are progeny plants of any generation of such a fertile R0 transgenic plant as well as seed of a progeny plant.
Another aspect of the present invention relates to methods for obtaining a nucleic acid molecule comprising a nucleotide sequence of the present invention. One method for obtaining a nucleic acid molecule encoding all or a substantial portion of the amino acid sequence of a protein encoded on the same gene as the sequences described herein would be: (a) probing a cDNA or genomic library with a hybridization probe comprising a nucleotide sequence encoding all or a substantial portion of a DNA, cDNA, or RNA molecule described herein (b) identifying a DNA clone that hybridizes under stringent conditions to the hybridization probe; (c) isolating the DNA clone identified in step (b); and (d) sequencing the cDNA or genomic fragment that comprises the clone isolated in step (c).
The IPT gene (SEQ ID NO: 1 and 2) of 720 bp from Agrobacterium tumefaciens was amplified by PCR from plasmid pMON38210, using two primers that introduced a NcoI site at the 5′ end and an EcoRI site at the 3′ end of the amplified gene. The two primer sequences are CGCGGCCCATGGATCTGCGTCTAATTTTCGGTCCAAC (Seq ID NO: 3) and CGGCGCGAATTCTAATACATTCCGAATGGATGACCTT (Seq ID NO: 4).
The promoter of Arabidopsis CycB1 (Seq ID NO: 5) was cloned by using the upstream DNA polynucleotide sequence of CycB1 from the genomic clone with Genbank number AL035601. Two primers were designed to amplify from the total genomic DNA the 1550 bp fragment immediately upstream from the ATG start codon, introducing a PacI site at the 5′ end and a NcoI site at the 3′ end. The two primer sequences are CGCGGCTTAATTAAGAGCAATAACAGTGTGTGAGGCATT (SEQ ID NO: 6) and CGGCGCCCATGGTCTTAGTGTTCTCTTCTCTTTCTCTC (SEQ ID NO: 7). To clone the promoter of Arabidopsis CycD3 (SEQ ID NO: 8), the upstream sequence of 1500 bp was determined from the genomic contig AL161585 (Genbank), which was then cloned by PCR using two primers that introduced a Pad site at the 5′ end and a NcoI site at the 3′ end. The primer sequences are: CGCGGCTTAATTAAGCATTATGCGGGAGCAAAGGTAAGT (SEQ ID NO: 9) and CGGCGCCCATGGTGGGGGACTAAACTCAAGAATGAGAA (SEQ ID NO: 10). Similarly, to clone the promoter of CDC2a (SEQ ID NO: 11) from Arabidopsis, the corresponding 1400 bp upstream sequence was determined from AL132963 (Genbank number), and amplified from genomic DNA using two primers, introducing a AscI site at the 5′ end and a NcoI site at the 3′ end. The two primer sequences are: CGCGGCGGCGCGCCATATATATTATTATATAAATATAAC (SEQ ID NO: 12) and CGCGGCCCATGGTTTCCTGAATAATAAAGCTGAAG (SEQ ID NO: 13).
To construct the binary vector of IPT driven by the constitutive 35S promoter, the binary vector pMON23450 was linearized with NcoI and EcoRI, followed by ligation with the NcoI-EcoRI IPT fragment. The resulting vector was named pMON66507 (FIG. 8), in which the IPT gene is under the control of an enhanced 35S promoter (e35S). To put the IPT gene under the control of the CycB1 promoter, pMON66507 was digested with PacI and NcoI to release the e35S promoter, which was then replace by the PacI-NcoI P_CycB1 fragment. The resulting vector was named as pMON66508. Similarly, the PacI-NcoI P_CycD3 fragment was used to replace the e35S promoter in pMON66507 to generate the plasmid pMON66509, in which the IPT gene is under the control of the CycD3 promoter. To construct the IPT gene under the control of P_CDC2a, the amplified P_CDC2a fragment was digested with AscI and NcoI and ligated to pMON66507 that had the e35S promoter released by AscI and NcoI. The resulting plasmid was named as pMON66510.
The constructed binary expression vectors from Example 1 were used to transform Arabidopsis thaliana, ecotype Columbia using an Agrobacterium mediated procedure. Transformants were selected on kanamycin MS plates and thirty two independent transformation events were transferred to potted soil in growth chamber and grown to maturity for seed harvest. Expression of the IPT transgene was monitored at the transcript level using Taqman analysis.
Plant Growth
Seeds of the transgenic plants were sowed in potted soil along with wild-type plants (controls), and were vernalized at 4° C. for three days before moving to a growth chamber. The plants were grown under the following conditions: at 22° C., 24 hours constant light with light intensity of 170-200 μm Einstein m−2s−1, and a humidity of 70%. Plants were also grown under short day conditions, with 10 hours of light period. Plants were fertilized twice a week using Peters 20-20-20 fertilizer (in half strength) from Hummert International, Earth City, Mo.).
RT-PCR Analysis
Total RNA was prepared from roots, rosette leaves and flowers of Arabidopsis plants using Trizol reagent from Life Technologies (Gibco BRL, Life Technologies, Gaithersburg, Md. U.S.A.). The RNA was then treated with DNAse and column purified. All samples were adjusted to same concentration based on spectrophotometer readings. 2.4 μg of total RNA was used to synthesize the first strand cDNA in a 20 μl reaction with SuperScript II-RT Kit (Life Technologies, Gaithersburg, Md.) according to the manufacture's procedure. An aliquot of 1 μl of the synthesized cDNA was used as template for PCR reaction (a total volume of 50 μl), using gene-specific primers. The reactions were limited to 20 cycles so the amplifications were still in linear range. The amplified PCR products were resolved on agarose gels and photographed.
Real-Time PCR (Taqman) Analysis
Two hole punches, or a piece of the youngest leaf tip approximately 1-cm long, were sampled from each Arabidopsis thaliana plant. The sampled tissue was placed in 96 well format boxes (1.1 ml micro tubes, VWR, Cat# 20901-027) with 4 mm parylene-coated stir balls (V&P Scientific, Cat#725E-1) on dry ice. Equal volumes of nucleic acid purification lysis solution (ABI, Cat#. 4305895) and Phosphate Buffered Saline (Life Technologies, Cat # 12394-011) were added. 0.40 ml of the Lysis buffer/PBS mixture (1:1 of 2×ABI Nucleic acid purification lysis solution and LifeTech Ca—Mg free 1×PBS) was added to each well, then tightly cap the tubes. The tissue was homogenized by shaking the samples with a Qiagen MixerMill—MM300 (Qiagen, Cat# 85110) for 5 minutes at 30 rev/sec. Particulate matter was removed using a 96 well QiaFilter (Qiagen, Cat# 10020). Genomic DNA was prepared using the Automated Nucleic Acid Workstation from Applied Biosystems (ABI, Cat#6700). 25 μl PCR reactions were prepared using the ABI 2× SYBR-Green PCR Master Mix, (ABI, Cat# 4304437) and 10 μl of template DNA prepared on the ABI6700. Primers used were purchased from Life Technologies and were used at the same concentration in all experiments.
Real-time thermo cycling was performed on the ABI 7700 with standard cycling conditions of: 50° C. for 2 minutes, 95° C. for 10 minutes, and 40 cycles of 95° C. for 20 seconds, 60° C. for 1 minute. Standard data analysis procedures were followed for baseline adjustment then the data was screened for two-fold standard deviation of variance. Results of these analysis are discussed below. IPT was differentially expressed among different promoters in transgenic plants.
Gene Expression Results.
Four promoters were used to drive the expression of IPT in transgenic Arabidopsis plants, CycD3, CycB1, CDC2a, as well as the constitutive e35S promoter. The CycB1 promoter, P_CycB1, is expressed at the G2/M phase. The CycD3 promoter, P_CycD3, is expressed throughout the cell cycle in dividing cells. Both P_CycB1 and P_CycD3 are therefore cell cycle promoters. CDC2a, encoding a cyclin-dependent kinase, is constitutively expressed throughout the cell cycle, and is expressed in certain non-dividing cells. We conducted a semi-quantitative RT-PCR assay on the expression patterns of these genes in wild-type Arabidopsis plants. As is shown in
Transgenic Arabidopsis plants expressing IPT under the direction of the four different promoters were generated. Given the fact that all the promoters are capable of directing at least low levels of gene expression in leaves, we conducted transgene expression assays using the young leaf tissues from the transgenic plants.
Methods
Seed Size Analysis
To determine the seed size of different transgenic plants, about 50 transgenic seeds (V2 and V3) were dispersed evenly in an area of about 0.5 cm in diameter on a flat surface, along with wild-type controls. Magnified Images were then taken and the image size in pixels was determined using the Image-Plus™ software. Four samples for each seed set were used in the analysis, and statistical significance of the seed size variation was determined by T-test.
A high throughput screen was also developed internally to determine the Arabidopsis seed size. The software is a UNIX command line image processing program that automatically segments images containing touching seeds, screens out non-seed subjects, and then measures the areas of seeds on TIF images. Using this program, seeds from about 600 independent transgenic events involving 21 vectors were assayed for seed size compared to wild-type controls. The Arabidopsis with cyclin promoters operably linked to IPT showed increased seed size. Detailed analysis is discussed in the results section of this example.
Canopy Size/Vegetative Growth Rate Determination.
Transgenic plants, along with wild-type controls, were arranged in Latin Square, with 12 plants for each genotype, and grown under uniform conditions. At days 25, 32 and 42, images were taken for each plants, and the canopy size of the one-dimensional image was determined with the Image-Plus software. Statistical significance of size variation was determined using T-test. The growth rate for a given genotype was determined by comparing the percentage of canopy size variation of that genotype to wild-type among different growth stages. The Arabidopsis with cyclin promoters operably linked to IPT showed increased canopy size/growth rate. Detailed analysis is discussed in the results section of this example.
Analysis of Other Plant Seed Weight Components.
When siliques were starting to turn yellow, individual plants were placed within transparent plastic cones to prevent tangling and thus facilitate seed collection. At maturity, both siliques and seeds were harvested and naturally dried for quantitative analysis, including seed weight per plant, silique number per plant and silique length. For silique length, 50 siliques were randomly selected from each plant, and the means were used for comparison. The Arabidopsis with cyclin promoters operably linked to IPT showed increased seed weight. Detailed analysis is discussed in the results section of this example.
Results.
IPT Expression in Non-Dividing Cells LED to Abnormal Plant Growth and Development.
The deleterious effect of non-specific IPT expression was manifested throughout the plant life cycle. When the transgenic seeds were plated on selection medium, seeds transformed with E35S::IPT and P_CDC2a::IPT exhibited much lower shoot regeneration rates when compared to those transformed with P_CycD3::IPT and P_CycB1::IPT. As is shown in
It has been shown previously that transgenic expression of IPT by various promoters resulted in deleterious pleiotropic effects on plant growth and development, the inventors reasoned that such pleiotrophs were likely due to the ectopic expression of IPT and consequently forced division in cells that were not committed to proper patterning after cell mass increase. Several lines of evidence from this study suggested that uncontrolled expression pattern, rather than the level of expression, was indeed a cause of the deleterious effect of the transgene on plant growth and development. First, a survey of the IPT transgene expression levels and the normality of plant growth and development when using the four different promoters showed that the transgenic plants were able to tolerate much higher level of IPT expression when the transgene was driven by the cell cycle-specific promoters P_CycD3 and P_CycB1 than that driven by non-specific promoters 35S and P_CDC2a (Table 1).
Thus while only at very low level of IPT expression that the transgenic plants harboring E35S::IPT could grow and develop normally, they would display normal plant growth and development even at 200 folds increase in IPT expression when driven by the CycD3 promoter, suggesting not only that plant development is very sensitive to uncontrolled pattern of IPT expression, but also that the cells that had been programmed for cell division are a primary natural target of cytokinin for growth regulation, and can tolerate high levels of transgene expression without disrupting the subsequent organ patterning and formation.
Taking together, these results demonstrated that cytokinin expression in non-dividing cells in plants as shown by the IPT expression by P_CDC2a, had a pleiotropic effect, leading to abnormal plant growth and development. In contrast, cell cycle-specific IPT expression, directed by the promoters P_CycB1 and P_CycD3, were able to effectively eliminate the deleterious effects associated with uncontrolled IPT expression, and even at relatively high transgene expression level, the transgenic plants were able to grow and develop much like the wild-type plants.
Cyclin-Dependent IPT Expression led to Accelerated Plant Growth Rate
The inventors further examined the effect of IPT expression from the different promoters used in this study on plant growth rate. The inventors wanted to determine whether amplified cytokinin expression in the natural cyclin-expressing cells would also lead to accelerated plant growth rate. To this end, the inventors conducted an experiment to quantify the morphological variations of transgenic plants compared to wild-type controls in the course of plant life cycle.
It was previously shown that, although the constitutive CycD2 expression could accelerate the growth rate of transgenic tobacco plants, the transgenic plants flowered earlier than the non-transformed plants, resulting in plants that are similar in size and overall productivity as compared to the wild-type controls at maturity. The inventors examined the organ size, organ number and overall plant productivity of transgenic Arabidopsis plants expressing IPT from the cell cycle-specific promoters. In contrast to over-expression of CycD2 by the 35S promoter, cell cycle-specific IPT expression, while accelerating the plant growth rate, did not alter the timing of developmental stages, with the transgenic plants flowering at the same time as the wild-type controls (
The inventors further examine all the transgenic events for the size of seeds, an organ in which CycD3, CycB1 and CDC2a in their native forms all express in wild-type Arabidopsis plants, and the size of which is mainly determined by cell cycle and the resulting cell number. The inventors developed an automated seed size (seed image area in pixels) screen and assayed the seed size of all the 70 independent transgenic lines that had been advanced, including 29 transgenic events of P_CycB1::IPT, 30 of P_CycD3::IPT, 10 of P_CDC2a::IPT, and 1 of E35S::IPT. A power calculation has determined that, at high detection power of 95%, our standard operation protocol would be capable of detecting 9% seed size difference at critically significant level (P<0.01). Using 10% as the cut-off value, the inventors showed (
A GATEWAY™ Destination (Invitrogen Life Technologies, Carlsbad, Calif.) plant expression vector, pMON65154, was constructed for use in preparation of constructs comprising recombinant polynucleotides for corn transformation. The elements of the expression vector are summarized in Table 2 below. Generally, pMON65154 comprises a selectable marker expression cassette comprising a Cauliflower Mosaic Virus 35S promoter operably linked to a gene encoding neomycin phosphotransferase II (nptII). The 3′ region of the selectable marker expression cassette comprises the 3′ region of the Agrobacterium tumefaciense nopaline synthase gene (nos) followed 3′ by the 3′ region of the potato proteinase inhibitor II (pinII) gene. The plasmid pMON 65154 further comprises a plant expression cassette into which a gene of interest may be inserted using GATEWAY™ cloning methods. The GATEWAY™ cloning cassette is flanked 5′ by a rice actin 1 promoter, exon and intron and flanked 3′ by the 3′ region of the potato pinII gene. Using GATEWAY™ methods, the cloning cassette may be replaced with a gene of interest. The vector pMON65154, and derivatives thereof comprising a gene of interest, are particularly useful in methods of plant transformation via direct DNA delivery, such as microprojectile bombardment.
A similar plasmid vector, pMON72472, is constructed for use in Agrobacterium mediated methods of plant transformation. pMON72472 comprises the gene of interest plant expression cassette, GATEWAY™ cloning, and plant selectable marker expression cassettes present in pMON65154. In addition, left and right T-DNA border sequences from Agrobacterium are added to the plasmid (Zambryski et al., (1982). The right border sequence is located 5′ to the rice actin 1 promoter and the left border sequence is located 3′ to the pinII 3′ sequence situated 3′ to the nptII gene. Furthermore, pMON72472 comprises a plasmid backbone to facilitate replication of the plasmid in both E. coli and Agrobacterium tumefaciens. The backbone has an oriV wide host range origin of DNA replication functional in Agrobacterium, a pBR322 origin of replication functional in E. coli, and a spectinomycin/stretptomycin resistance gene for selection in both E. coli and Agrobacterium. In this case the promoter of interest was a cell cycle regulated promoter, and the gene of interest was a gene regulating cytokinin.
Vectors similar to those described above may be constructed for use in Agrobacterium or microprojectile bombardment maize transformation systems where the rice actin 1 promoter in the plant expression cassette portion is replaced with other desirable promoters including, but not limited to a maize globulin 1 promoter, a maize oleosin promoter, a glutelin 1 promoter, an aldolase promoter, a zein Z27 promoter, a pyruvate orthophosphate dikinase (PPDK) promoter, a a soybean 7S alpha promoter, a peroxiredoxin antioxidant (Per1) promoter and a CaMV 35S promoter. Protein coding segments are amplified by PCR prior to insertion into vectors such as described above. Primers for PCR amplification can be designed at or near the start and stop codons of the coding sequence, in order to eliminate most of the 5′ and 3′ untranslated regions. For GATEWAY cloning methods, PCR products are tailed with attB1 and attB2 sequences, purified then recombined into a destination vectors to produce an expression vector for use in transformation. For specifics on the recombinant DNA molecules transformed into crop plants see Table 4.
Constructs for use in transformation of soybean may be prepared by restriction enzyme based cloning into a common expression vector. Elements of an exemplary common expression vector are shown in Table 3 below. Elements that could be cloned into recombinant DNA molecules (i.e. expression vectors)
tumefaciens Ti plasmid
Vectors similar to that described above may be constructed for use in Agrobacterium mediated soybean transformation systems where the enhanced 35S promoter in the plant expression cassette portion is replaced with other desirable promoters including, but not limited to a napin promoter and an Arabidopsis SSU promoter. Protein coding segments are amplified by PCR prior to insertion into vectors such as described above. Primers for PCR amplification can be designed at or near the start and stop codons of the coding sequence, in order to eliminate most of the 5′ and 3′ untranslated regions. In this case the promoter of interest was a cell cycle regulated promoter, and the gene of interest was a gene regulating cytokinin. For specifics on the recombinant DNA molecules transformed into crop plants, see Table 4.
Constructs used in plant transformation of corn and soybean include those in Table 4.
LH59 plants are grown in the greenhouse and ears and ears harvested, when the embryos are 1.5 to 2.0 mm in length. Ears were surface sterilized by spraying or soaking the ears in 80% ethanol, followed by air drying. Immature embryos were isolated from individual kernels on surface sterilized ears. Prior to inoculation of maize cells, Agrobacterium cells are grown overnight at room temperature. Immature maize embryos are inoculated with Agrobacterium shortly after excision, and incubated at room temperature with Agrobacterium for 5-20 minutes. Immature embryos are then co-cultured with Agrobacterium for 1 to 3 days at 23° C. in the dark.
Co-cultured embryos are transferred to selection media and cultured for approximately two weeks to allow embryogenic callus to develop. Embryogenic callus is transferred to culture medium containing 100 mg/L paromomycin and subcultured at about two week intervals. Transformants are recovered 6 to 8 weeks after initiation of selection.
For Agrobacterium mediated transformation of maize callus, immature embryos are cultured for approximately 8-21 days after excision to allow callus to develop. Callus is then incubated for about 30 minutes at room temperature with the Agrobacterium suspension, followed by removal of the liquid by aspiration. The callus and Agrobacterium are co-cultured without selection for 3-6 days followed by selection on paromomycin for approximately 6 weeks, with biweekly transfers to fresh media, and paromomycin resistant callus identified.
For transformation by microprojectile bombardment, immature maize embryos are isolated and cultured 3-4 days prior to bombardment. Prior to microprojectile bombardment, a suspension of gold particles is prepared onto which the desired DNA is precipitated. DNA is introduced into maize cells as described in U.S. Pat. No. 5,015,580 using the electric discharge particle acceleration gene delivery device. For microprojectile bombardment of LH59 pre-cultured immature embryos, 35% to 45% of maximum voltage is preferably used. Following microprojectile bombardment, tissue is cultured in the dark at 27° C.
Fertile transgenic plants are produced from transformed maize cells by transfer of transformed callus to appropriate regeneration media to initiate shoot development. Plantlets are transferred to soil when they are about 3 inches tall and have roots (about four to 6 weeks after transfer to medium). Plants are maintained for two weeks in a growth chamber at 26° C., followed by two weeks on a mist bench in a greenhouse before transplanting to 5 gallon pots for greenhouse growth. Plants are grown in the greenhouse to maturity and reciprocal pollinations made with the inbred LH59. Seed is collected from plants and used for further breeding activities.
Transformation methods and materials for making transgenic plants of this invention, e.g. various media and recipient target cells, transformation of immature embryos and subsequent regeneration of fertile transgenic plants are disclosed in U.S. Pat. Nos. 6,194,636 and 6,232,526 and U.S. patent application Ser. No. 09/757,089, which are incorporated herein by reference.
For Agrobacterium mediated transformation, soybean seeds are germinated overnight and the meristem explants excised. The meristems and the explants are placed in a wounding vessel. Soybean explants and induced Agrobacterium cells from a strain containing plasmid DNA with the gene of interest cassette and a plant selectable marker cassette are mixed no later than 14 hours from the time of initiation of seed germination and wounded using sonication. Following wounding, explants are placed in co-culture for 2-5 days at which point they are transferred to selection media for 6-8 weeks to allow selection and growth of transgenic shoots. Phenotype positive shoots are harvested approximately 6-8 weeks post bombardment and placed into selective rooting media for 2-3 weeks. Shoots producing roots are transferred to the greenhouse and potted in soil. Shoots that remain healthy on selection, but do not produce roots are transferred to non-selective rooting media for an additional two weeks. Roots from any shoots that produce roots off selection are tested for expression of the plant selectable marker before they are transferred to the greenhouse and potted in soil.
Descriptions of media useful for transformation and regeneration of soybean and a method employing microprojectile bombardment are described in U.S. Pat. No. 5,914,451, which is incorporated herein by reference.
This application claims benefit under 35USC §119(e) of U.S. provisional application Ser. No. 60/582,357 filed Jun. 23, 2004.
Number | Date | Country | |
---|---|---|---|
60582357 | Jun 2004 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 11156084 | Jun 2005 | US |
Child | 12688699 | US |