Transminases and amnotransferases

Abstract

Thermostable transaminase and aminotransferase enzymes derived from various ammonifex, aquifex and pyrobaculum organisms are disclosed. The enzymes are produced from native or recombinant host cells and can be utilized in the pharmaceutical, agricultural and other industries.

Description

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production and isolation of such polynucleotides and polypeptides. More particularly, the polynucleotides and polypeptides of the present invention have been putatively identified as transaminases and/or aminotransferases. Aminotransferases are enzymes that catalyze the transfer of amino groups from .alpha.-amino to .alpha.-keto acids. They are also called transaminases.

The .alpha.-amino groups of the 20 L-amino acids commonly found in proteins are removed during the oxidative degradation of the amino acids. The removal of the .alpha.-amino groups, the first step in the catabolism of most of the L-amino acids, is promoted by aminotransferases (or transaminases). In these transamination reactions, the .alpha.-amino group is transferred to the .alpha.-carbon atom of .alpha.-ketoglutarate, leaving behind the corresponding .alpha.-keto acid analog of the amino acid. There is no net deamination (i.e., loss of amino groups) in such reactions because the .alpha.-ketoglutarate becomes aminated as the .alpha.-amino acid is deaminated. The effect of transamination reactions is to collect the amino groups from many different amino acids in the form of only one, namely, L-glutamate. The glutamate channels amino groups either into biosynthetic pathways or into a final sequence of reactions by which nitrogenous waste products are formed and then excreted.

Cells contain several different aminotransferases, many specific for .alpha.-ketoglutarate as the amino group acceptor. The aminotransferases differ in their specificity for the other substrate, the L-amino acid that donates the amino group, and are named for the amino group donor. The reactions catalyzed by the aminotransferases are freely reversible, having an equilibrium constant of about 1.0 (.DELTA.G.sup.0' .congruent.0 kJ/mol).

Aminotransferases are classic examples of enzymes catalyzing bimolecular ping-pong reactions. In such reactions the first substrate must leave the active site before the second substrate can bind. Thus the incoming amino acid binds to the active site, donates its amino group to pyridoxal phosphate, and departs in the form of an .alpha.-keto acid. Then the incoming .alpha.-keto acid is bound, accepts the amino group from pyridoxamine phosphate, and departs in the form of an amino acid.

The measurement of alanine aminotransferase and aspartate aminotransferase levels in blood serum is an important diagnostic procedure in medicine, used as an indicator of heart damage and to monitor recovery from the damage.

The polynucleotides and polypeptides of the present invention have been identified as transaminases and/or aminotransferases as a result of their enzymatic activity.

In accordance with one aspect of the present invention, there are provided novel enzymes, as well as active fragments, analogs and derivatives thereof.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the enzymes of the present invention including mRNAs, cDNAs, genomic DNAs as well as active analogs and fragments of such enzymes.

In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence of the present invention, under conditions promoting expression of said enzymes and subsequent recovery of said enzymes.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such enzymes, or polynucleotides encoding such enzymes for transferring an amino group from an .alpha.-amino acid to an .alpha.-keto acid. Most transaminases use L-amino acids as substrates, but as described below, it is also possible to convert the transaminases of the invention to use D-amino acids as substrates, thereby increasing their array of uses to include, for example, manufacture of synthetic pyrethroids and as components of .beta.-lactam antibiotics. The transaminases of the invention are stable at high temperatures and in organic solvents and, thus, are superior for use with L- and/or D-amino acids for production of optically pure chiral compounds used in pharmaceutical, agricultural and other chemical industries.

In accordance with yet a further aspect of the present invention, there are also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to hybridize to a nucleic acid sequence of the present invention.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such enzymes, or polynucleotides encoding such enzymes, for in vitro purposes related to scientific research, for example, to generate probes for identifying similar sequences which might encode similar enzymes from other organisms by using certain regions, i.e., conserved sequence regions, of the nucleotide sequence.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

A coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences ultimately process to produce the desired protein. "Recombinant" enzymes refer to enzymes produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired enzyme. "Synthetic" enzymes are those prepared by chemical synthesis.

A DNA "coding sequence of" or a "nucleotide sequence encoding" a particular enzyme, is a DNA sequence which is transcribed and translated into an enzyme when placed under the control of appropriate regulatory sequences.

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature enzymes having the deduced amino acid sequences of SEQ ID NOS: 17-32, 35,36,39 and 40.

The deposit(s) have been made under the terms of the Budapest Treaty on the International Recognition of the deposit of micro-organisms for purposes of patent procedure. The strains will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit would be required under 35 U.S.C. .sctn.112. The sequences of the polynucleotides contained in the deposited materials, as well as the amino acid sequences of the polypeptides encoded thereby, are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The polynucleotides of this invention were originally recovered from genomic DNA libraries derived from the following organisms:

Aquifex VF5 is a Eubacteria which was isolated in Vulcano, Italy. It is a gram-negative, rod-shaped, strictly chemolithoautotrophic, marine organism which grows optimally at 85-90.degree. C. (T.sub.max =95.degree. C.) at pH 6.8 in a high salt culture medium with O.sub.2 as a substrate, and H.sub.2 /CO.sub.2 +0.5% O.sub.2 in gas phase.

Ammonifex degensii KC4 is a new Eubacterial organism isolated in Java, Indonesia. This Gram negative chemolithoautotroph has three respiration systems. The bacterium can utilize nitrate, sulfate, and sulfur. The organism grows optimally at 70.degree. C., and pH 7.0, in a low salt culture medium with 0.2% nitrate as a substrate and H.sub.2 /CO.sub.2 in gas phase.

Pyrobaculum aerophilium IM2 is a thermophilic sulfur archaea (Crenarchaeota) isolated in Ischia Maronti, Italy. It is a rod-shaped organism that grows optimally at 100.degree. C. at pH 7.0 in a low salt culture medium with nitrate, yeast extract, peptone, and O.sub.2 as substrates and N.sub.2 /CO.sub.2, O.sub.2 in gas phase.

Accordingly, the polynucleotides and enzymes encoded thereby are identified by the organism from which they were isolated, and are sometimes hereinafter referred to as "VF5/ATA" (SEQ ID NOS:17 and 25), "VF5/AAB" (SEQ ID NOS:18 and 26), "VF5/A87A" (SEQ ID NOS:19 and 27), "VF5/AOA" (SEQ ID NOS:20 and 28), "KC4/AA" (SEQ ID NOS:21 and 29), "VF5/GF6PA" (SEQ ID NOS:22 and 30), "VF5/HPA" (SEQ ID NOS:23 and 31) and "IM2/BCA" (SEQ ID NOS:24 and 32) "KC4HPA" (SEQ ID NOS:35 and 36) and "VF5AA" (SEQ ID NOS:39 and 40).

The polynucleotides and polypeptides of the present invention show identity at the nucleotide and protein level to known genes and proteins encoded thereby as shown in Table 1.

TABLE 1______________________________________ Protein Protein DNA Gene w/closest Similarity Identity IdentityEnzyme Homology (Organism) (%) (%) (%)______________________________________VF5/ATA Bacillus subtilis 57.5 38.3 50.1VF5/AAB Sulfolobus solfataricus 62.5 33.0 50.1VF5/A87A Bacillus sphaericus BioA 67.4 42.9 51VF5/AOA Bacillus subtilis argD 70.6 48.7 52.0KC4/AA Bacillus YM-2 aspC 72.6 52.7 52.0VF5/GF6PA Rhizobium 66.3 47.7 51.0 Leguminosarum NodMVF5/HPA Bacillus subtilis 55.7 32.6 45.3 HisH/E. coli HisC (same gene)IM2/BCA E. coli iluE 63.7 43.6 49.7KC4/HPA Bacillus subtilis 65.1 44.1 --VF5/AA Bacillus subtilis 71.6 52.7 --______________________________________ KC4/HPA, Bacillus subtilis, 65.1, 44.1.sub. VF5AA, Bacillis subtilis, 71.6, 52.7,.sub.

All the clones identified in Table 1 encode polypeptides which have transaminase or aminotransferase activity.

One means for isolating the nucleic acid molecules encoding the enzymes of the present invention is to probe a gene library with a natural or artificially designed probe using art recognized procedures (see, for example: Current Protocols in Molecular Biology, Ausubel F. M. et al. (EDS.) Green Publishing Company Assoc. and John Wiley Interscience, New York, 1989, 1992). It is appreciated by one skilled in the art that the polynucleotides of SEQ ID NOS: 17-24,35 and 39 or fragments thereof (comprising at least 12 contiguous nucleotides), are particularly useful probes. Other particularly useful probes for this purpose are hybridizable fragments of the sequences of SEQ ID NOS:1-9 (i.e., comprising at least 12 contiguous nucleotides).

With respect to nucleic acid sequences which hybridize to specific nucleic acid sequences disclosed herein, hybridization may be carried out under conditions of reduced stringency, medium stringency or even stringent conditions. As an example of oligonucleotide hybridization, a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45.degree. C. in a solution consisting of 0.9 M NaCl, 50 mM NaH.sub.2 PO.sub.4, pH 7.0, 5.0 mM Na.sub.2 EDTA, 0.5% SDS, 10X Denhardt's, and 0.5 mg/mL polyriboadenylic acid. Approximately 2.times.10.sup.7 cpm (specific activity 4-9.times.10.sup.8 cpm/ug) of .sup.32 P end-labeled oligonucleotide probe are then added to the solution. After 12-16 hours of incubation, the membrane is washed for 30 minutes at room temperature in 1.times.SET (150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na.sub.2 EDTA) containing 0.5 % SDS, followed by a 30 minute wash in fresh 1.times.SET at Tm -10.degree. C. (Tm is minus 10.degree. C.) for the oligo-nucleotide probe. The membrane is then exposed to auto-radiographic film for detection of hybridization signals.

Stringent conditions means hybridization will occur only if there is at least 90% identity, preferably at least 95% identity and most preferably at least 97% identity between the sequences. See J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory (1989) which is hereby incorporated by reference in its entirety.

As used herein, a first DNA (RNA) sequence is at least 70% and preferably at least 80% identical to another DNA (RNA) sequence if there is at least 70% and preferably at least a 80% or 90% identity, respectively, between the bases of the first sequence and the bases of the another sequence, when properly aligned with each other, for example when aligned by BLASTN.

The present invention relates to polynucleotides which differ from the reference polynucleotide such that the changes are silent changes, for example the change does not or the changes do not alter the amino acid sequence encoded by the polynucleotide. The present invention also relates to nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference polynucleotide. In a preferred aspect of the invention these polypeptides retain the same biological action as the polypeptide encoded by the reference polynucleotide.

The polynucleotides of this invention were recovered from genomic gene libraries from the organisms listed in Table 1. Gene libraries were generated in the Lambda ZAP II cloning vector (Stratagene Cloning Systems). Mass excisions were performed on these libraries to generate libraries in the pBluescript phagemid. Libraries were generated and excisions were performed according to the protocols/methods hereinafter described.

The polynucleotides of the present invention may be in the form of RNA or DNA which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequences which encodes the mature enzymes may be identical to the coding sequences shown in SEQ ID NOS:17-24, 35 and 39 or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature enzymes as the DNA of SEQ ID NOS:17-24, 35 and 39.

The polynucleotide which encodes for the mature enzyme of SEQ ID NOS:25-32, 36 and 40 may include, but is not limited to: only the coding sequence for the mature enzyme; the coding sequence for the mature enzyme and additional coding sequence such as a leader sequence or a proprotein sequence; the coding sequence for the mature enzyme (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature enzyme.

Thus, the term "polynucleotide encoding an enzyme (protein)" encompasses a polynucleotide which includes only coding sequence for the enzyme as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the enzymes having the deduced amino acid sequences of SEQ ID NOS:25-32, 36 and 40. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature enzymes as shown in SEQ ID NOS:17-24, 35 and 39 as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the enzymes of SEQ ID NOS:17-24, 35 and 39. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequences shown in SEQ ID NOS:17-24, 35 and 39. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded enzyme. Also, using directed and other evolution strategies, one may make very minor changes in DNA sequence which can result in major changes in function.

Fragments of the full length gene of the present invention may be used as hybridization probes for a cDNA or a genomic library to isolate the full length DNA and to isolate other DNAs which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 10, preferably at least 15, and even more preferably at least 30 bases and may contain, for example, at least 50 or more bases. The probe may also be used to identify a DNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exons and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary or identical to that of the gene or portion of the gene sequences of the present invention are used to screen a library of genomic DNA to determine which members of the library the probe hybridizes to.

It is also appreciated that such probes can be and are preferably labeled with an analytically detectable reagent to facilitate identification of the probe. Useful reagents include but are not limited to radioactivity, fluorescent dyes or enzymes capable of catalyzing the formation of a detectable product. The probes are thus useful to isolate complementary copies of DNA from other sources or to screen such sources for related sequences.

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode enzymes which either retain substantially the same biological function or activity as the mature enzyme encoded by the DNA of SEQ ID NOS:17-24, 35 and 39.

Alternatively, the polynucleotide may have at least 15 bases, preferably at least 30 bases, and more preferably at least 50 bases which hybridize to any part of a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotides of SEQ ID NOS:17-24, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% identity and more preferably at least a 95% identity to a polynucleotide which encodes the enzymes of SEQ ID NOS:25-32 as well as fragments thereof, which fragments have at least 15 bases, preferably at least 30 bases and most preferably at least 50 bases, which fragments are at least 90% identical, preferably at least 95% identical and most preferably at least 97% identical under stringent conditions to any portion of a polynucleotide of the present invention.

The present invention further relates to enzymes which have the deduced amino acid sequences of SEQ ID NOS:17-24, 35 and 39 as well as fragments, analogs and derivatives of such enzyme.

The terms "fragment," "derivative" and "analog" when referring to the enzymes of SEQ ID NOS:25-32, 36 and 40 means enzymes which retain essentially the same biological function or activity as such enzymes. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature enzyme.

The enzymes of the present invention may be a recombinant enzyme, a natural enzyme or a synthetic enzyme, preferably a recombinant enzyme.

The fragment, derivative or analog of the enzymes of (SEQ ID NOS:25-32, 38 and 40 may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature enzyme is fused with another compound, such as a compound to increase the half-life of the enzyme (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature enzyme, such as a leader or secretory sequence or a sequence which is employed for purification of the mature enzyme or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The enzymes and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or enzyme present in a living animal is not isolated, but the same polynucleotide or enzyme, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or enzymes could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The enzymes of the present invention include the enzymes of SEQ ID NOS:25-32 (in particular the mature enzyme) as well as enzymes which have at least 70% similarity (preferably at least 70% identity) to the enzymes of SEQ ID NOS:25-32 and more preferably at least 90% similarity (more preferably at least 90% identity) to the enzymes of SEQ ID NOS:25-32 and still more preferably at least 95% similarity (still more preferably at least 95 % identity) to the enzymes of SEQ ID NOS:25-32 and also include portions of such enzymes with such portion of the enzyme generally containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two enzymes is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one enzyme to the sequence of a second enzyme.

A variant, i.e. a "fragment", "analog" or "derivative" polypeptide, and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.

Among preferred variants are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gln, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.

Most highly preferred are variants which retain the same biological function and activity as the reference polypeptide from which it varies.

Fragments or portions of the enzymes of the present invention may be employed for producing the corresponding full-length enzyme by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length enzymes. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of enzymes of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector such as an expression vector. The vector may be, for example, in the form of a plasmid, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing enzymes by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing an enzyme. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P.sub.L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Bacillus subtilis; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBluescript II KS, ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene) pSVK3, pBPV, pMSG, pSVL SV40 (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the enzymes of the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the enzymes of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated enzyme. Optionally, the heterologous sequence can encode a fusion enzyme including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM 1 (Promega Biotec, Madison, Wis,, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.

Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The enzyme can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The enzymes of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the enzymes of the present invention may be glycosylated or may be non-glycosylated. Enzymes of the invention may or may not also include an initial methionine amino acid residue.

Transaminases are a group of key enzymes in the metabolism of amino acids and amino sugars and are found in all organisms from microbes to mammals. In the transamination reaction, an amino group is transferred from an amino acid to an .alpha.-keto acid. Pyridoxal phosphate is required as a co-factor to mediate the transfer of the amino group without liberation of ammonia.

Amino acids currently have applications as additives to aminal feed, human nutritional supplements, components in infusion solutions, and synthetic intermediates for manufacture of pharmaceuticals and agricultural products. For example, L-glutamic acid is best known as a flavor enhancer for human food. L-lysine and L-methionine are large volume additives to animal feed and human supplements. L-tryptophan and L-threonine have similar potential applications. L-phenylalanine and L-aspartic acid have very important market potential as key components in the manufacture of the low-calorie sweetener aspartame, and other promising low-calorie sweeteners have compositions containing certain amino acids as well. Infusion solutions require a large range of amino acids including those essential ones in human diets.

Transaminases are highly stereoselective, and most use L-amino acids as substrates. Using the approach disclosed in a commonly assigned, copending provisional application Ser. No. 60/008,316, filed on Dec. 7, 1995 and entitled "Combinatorial Enzyme Development," the disclosure of which is incorporated herein by reference in its entirety, one can convert the transaminases of the invention to use D-amino acids as substrates. Such conversion makes possible a broader array of transaminase applications. For instance, D-valine can be used in the manufacture of synthetic pyrethroids. D-phenylglycine and its derivatives can be useful as components of .beta.-lactam antibiotics. Further, the thermostable transaminases have superior stability at higher temperatures and in organic solvents. Thus, they are better suited to utilize either L- and/or D-amino acids for production of optically pure chiral compounds used in pharmaceutical, agricultural, and other chemical manufactures.

There are a number of reasons to employ transaminases in industrial-scale production of amino acids and their derivatives.

1) Transaminases can catalyze stereoselective synthesis of D- or L-amino acids from their corresponding .alpha.-keto acids. Therefore no L- or D-isomers are produced, and no resolution is required.

2) Transaminases have uniformly high catalytic rates, capable of converting up to 400 .mu.moles of substrates per minute per mg enzyme.

3) Many required .alpha.-keto acids can be conveniently prepared by chemical synthesis at low cost.

4) The capital investment for an immobilized enzyme process using transaminases is much lower than for a large scale fermentation process, and productivity of the bioreactor is often an order of magnitude higher.

5) The technology is generally applicable to a broad range of D- or L-amino acids because transaminases exist with varying specificities. Such broad scope allows a number of different L- or D-amino acids to be produced with the same equipment and often the same biocatalyst.

Antibodies generated against the enzymes corresponding to a sequence of the present invention can be obtained by direct injection of the enzymes into an animal or by administering the enzymes to an animal, preferably a nonhuman. The antibody so obtained will then bind the enzymes itself. In this manner, even a sequence encoding only a fragment of the enzymes can be used to generate antibodies binding the whole native enzymes. Such antibodies can then be used to isolate the enzyme from cells expressing that enzyme.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature, 256:495-497, 1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4:72, 1983), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, 1985).

Techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic enzyme products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic enzyme products of this invention.

Antibodies generated against an enzyme of the present invention may be used in screening for similar enzymes from other organisms and samples. Such screening techniques are known in the art, for example, one such screening assay is described in Sambrook and Maniatis, Molecular Cloning: A Laboratory Manual (2d Ed.), vol. 2:Section 8.49, Cold Spring Harbor Laboratory, 1989, which is hereby incorporated by reference in its entirety.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case "p" preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 .mu.g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 .mu.l of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 .mu.g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37.degree. C. are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel et al., Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as described in Sambrook and Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1989.

EXAMPLE 1

Bacterial Expression and Purification of Transaminases and Aminotransferases

DNA encoding the enzymes of the present invention, SEQ ID NOS:25 through 32, were initially amplified from a pBluescript vector containing the DNA by the PCR technique using the primers noted herein. The amplified sequences were then inserted into the respective PQE vector listed beneath the primer sequences, and the enzyme was expressed according to the protocols set forth herein. The genomic DNA has also been used as a template for the PCR amplification, i.e., once a positive clone has been identified and primer sequences determined using the cDNA, it was then possible to return to the genomic DNA and directly amplify the desired sequence(s) there. The 5' and 3' primer sequences and the vector for the respective genes are as follows:

Aquifex Aspartate Transaminase A aspa501 5' CCGAGAATTCATTAAAGAGGAGAAATTAACTATGATTGAAGACCCTATGGAC (SEQ. ID NO:1) aspa301 3' CGAAGATCTTTAGCACTTCTCTCAGGTTC (SEQ. ID NO:2) vector: pQET1 Aquifex Aspartate Aminotransferase B aspb501 5' CCGAGAATTCATTAAAGAGGAGAAATTAACTATGGACAGGCTTGAAAAAGTA (SEQ ID NO:3) aspb301 3' CGGAAGATCTTCAGCTAAGCTTCTCTAAGAA (SEQ ID NO:4) vector: pQET1 Aquifex Adenosyl-8-amino-7-oxononanoate Aminotransferase ameth501 5' CCGACAATTGATTAAAGAGGAGAAATTAACTATGTGGGAATTAGACCCTAAA (SEQ ID NO:5) ameth301 3' CGGAGGATCCCTACACCTCTTTTTCAAGCT (SEQ ID NO:6) vector: pQET12 Aquifex Acetylornithine Aminotransferase aorn 501 5' CCGACAATTGATTAAAGAGGAGAAATTAACTATGACATACTTAATGAACAAT (SEQ ID NO:7) aorn 301 3' CGGAAGATCTTTATGAGAAGTCCCTTTCAAG (SEQ ID NO:8) vector: pQET12 Ammonifex degensii Aspartate Aminotransferase adasp 501 5' CCGAGAATTCATTAAAGAGGAGAAATTAACTATGCGGAAACTGGCCGAGCGG (SEQ ID NO:9) adasp 301 3' CGGAGGATCCTTAAAGTGCCGCTTCGATCAA (SEQ ID NO:10) vector: pQET12 Aquifex Glucosamine:Fructose-6-phosphate Aminotransferase glut 501 5' CCGACAATTGATTAAAGAGGAGAAATTAACTATGTGCGGGATAGTCGGATAC (SEQ ID NO:11) glut 301 3' CGGAAGATCTTTATTCCACCGTGACCGTTTT (SEQ ID NO:12) vector: pQET1 Aquifex Histadine-phosphate Aminotransferase his 501 5' CCGACAATTGATTAAAGAGGAGAAATTAACTATGATACCCCAGAGGATTAAG (SEQ ID NO:13) his 301 3' CGGAAGATCTTTAAAGAGAGCTTGAAAGGGA (SEQ ID NO:14) vector: pQET1 Pyrobacullum aerophilum Branched Chain Aminotransferase bcat 501 5' CCGAGAATTCATTAAAGAGGAGAAATTAACTATGAAGCCGTACGCTAAATAT (SEQ ID NO:15) bcat 301 3' CGGAAGATCTCTAATACACAGGAGTGATCCA (SEQ ID NO:16) vector: pQET1 Ammonifex degensii hp aminotransferase 5'-CCGAGAATTCATTAAAGAGGAGAAATTAACTATGGCAGTCAAAGTGCGGCCT (SEQ ID NO:33). 3'-CGGAGGATCCTTATCCAAAGCTTCCAGGAAG (SEQ ID NO:34). Homology information: Closest to Bacillus subtilis (reference: Henner D. J., Band L., Flaggs G., Chen E.; Gene 49:147-152(1986). Percent Similarity: 65.084 Percent Identity: 44.134 Aquifex aspartate aminotransferase 5' CCGAGAATTCATTAAAGAGGAGAAATTAACTATGAGAAAAGGACTTGCAAGT (SEQ ID NO:37). 3' CGGAGGATCCTTAGATCTCTTCAAGGGCTTT (SEQ ID NO:38). Closest to Bacillus subtilis (Sorokin, A. V., Azevedo, V., Zumstein, E., Galleron, N., Ehrlich, S. D. and Serror, P. Determination and analysis of the nucleotide sequence of the Bacillus subtilis chromosome region between serA and kdg loci cloned in yeast artificial chromosome Unpublished (1995). Percent Similarity: 71.611 Percent Identity: 52.685

The restriction enzyme sites indicated correspond to the restriction enzyme sites on the bacterial expression vector indicated for the respective gene (Qiagen, Inc. Chatsworth, Calif.). The pQE vector encodes antibiotic resistance (Amp.sup.r), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites.

The pQE vector was digested with the restriction enzymes indicated. The amplified sequences were ligated into the respective pQE vector and inserted in frame with the sequence encoding for the RBS. The ligation mixture was then used to transform the E. coli strain M15/pREP4 (Qiagen, Inc.) by electroporation. M15/pREP4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kan.sup.r). Transformants were identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture was used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation.

The primer sequences set out above may also be employed to isolate the target gene from the deposited material by hybridization techniques described above.

EXAMPLE 2

Isolation of a Selected Clone from the Deposited Genomic Clones

The two oligonucleotide primers corresponding to the gene of interest are used to amplify the gene from the deposited material. A polymerase chain reaction is carried out in 25 .mu.l of reaction mixture with 0.1 .mu.g of the DNA of the gene of interest. The reaction mixture is 1.5-5 mM MgCl.sub.2, 0.01% (w/v) gelatin, 20 .mu.M each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 1.25 Unit of Taq polymerase. Thirty cycles of PCR (denaturation at 94.degree. C. for 1 min; annealing at 55.degree. C. for 1 min; elongation at 72.degree. C. for 1 min) are performed with the Perkin-Elmer Cetus 9600 thermal cycler. The amplified product is analyzed by agarose gel electrophoresis and the DNA band with expected molecular weight is excised and purified. The PCR product is verified to be the gene of interest by subcloning and sequencing the DNA product.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 42- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:#AC 52AAAGAGG AGAAATTAAC TATGATTGAA GACCCTATGG- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 31 CACTT CTCTCAGGTT C- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:#TA 52AAAGAGG AGAAATTAAC TATGGACAGG CTTGAAAAAG- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 31 TAAGC TTCTCTAAGA A- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:#AA 52AAAGAGG AGAAATTAAC TATGTGGGAA TTAGACCCTA- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:# 31 CCTGT TTTTCAAGCT C- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:#AT 52AAAGAGG AGAAATTAAC TATGACATAC TTAATGAACA- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 31 AGAAG TCCCTTTCAA G- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:#GG 52AAAGAGG AGAAATTAAC TATGCGGAAA CTGGCCGAGC- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 31 GTGCC GCTTCGATCA A- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:#AC 52AAAGAGG AGAAATTAAC TATGTGCGGG ATAGTCGGAT- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:# 31 CCACC GTGACCGTTT T- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:#AG 52AAAGAGG AGAAATTAAC TATGATACCC CAGAGGATTA- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 31 GAGAG CTTGAAAGGG A- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:#AT 52AAAGAGG AGAAATTAAC TATGAAGCCG TACGCTAAAT- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 31 ACACA GGAGTGATCC A- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1245 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1242- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:#CCG AGG ATA AAG AGA CTG 48GG GCT TTT#Pro Arg Ile Lys Arg Leu Asp Trp Ala Phe#15#CTC AAG TAC AAG CTA AGG 96TT AAC GAA#Leu Lys Tyr Lys Leu Arg Leu Val Asn Glu# 30#ATG GGC AAT CCT AAC ATG 144AT CTT GGT#Met Gly Asn Pro Asn Met Val Asp Leu Gly# 45#TGC GAA GTG GCT CAA AAG 192AT AAA CTC#Cys Glu Val Ala Gln Lys Ile Asp Lys Leu# 60#GGC ATA CCA AGA CTG AGA 240CG TCA AGG#Gly Ile Pro Arg Leu Arg Ser Ala Ser Arg# 80#TAC GGA GTG AAA CTC GAC 288AA GAA AGG#Tyr Gly Val Lys Leu Asp Tyr Glu Glu Arg#95#GCA AAG GAA GGG TAT TCT 336CA ATC GGT#Ala Lys Glu Gly Tyr Ser Leu Thr Ile Gly# 110#GAT ACG GTA ATA GTT CCT 384CT CCG GGT#Asp Thr Val Ile Val Pro Ile Ser Pro Gly# 125#CCC ATA ATT GCA GGA GGG 432AT TAC GCT#Pro Ile Ile Ala Gly Gly His Tyr Tyr Ala# 140#GAC GAT CAA GAT CAT CAG 480AC TTC TCG#Asp Asp Gln Asp His Gln Leu Asn Phe Ser#160#GTA AAA ACC GCG ATG CCA 528AC GAG ATA#Val Lys Thr Ala Met Pro Leu Tyr Glu Ile# 175#CAC AAT CCA ACG ACC ATA 576GC TTT CCT#His Asn Pro Thr Thr Ile Ile Ser Phe Pro# 190#GTT AAG TTT GCA AAG GAA 624AA GAA ATA#Val Lys Phe Ala Lys Glu Phe Lys Glu Ile# 205#TAT GCG GAT ATA GCC TTT 672AT TTT GCG#Tyr Ala Asp Ile Ala Phe His Asp Phe Ala# 220#ATA GAA GGT GCT AAA GAC 720TA CTC GAA#Ile Glu Gly Ala Lys Asp Ser Ile Leu Glu#240#GGC TTT TCA ATG GCG GGC 768TG TCA AAG#Gly Phe Ser Met Ala Gly Ser Met Ser Lys# 255#ATA CTC ATA AAA AAC CTT 816GA AAC GAA#Ile Leu Ile Lys Asn Leu Val Gly Asn Glu# 270#ATA TTT ACT CCC ATA CAG 864AT TAC GGT#Ile Phe Thr Pro Ile Gln Leu Asp Tyr Gly# 285#TAC GAA ATC GTG GAA AAA 912AG AGC CCC#Tyr Glu Ile Val Glu Lys Leu Glu Ser Pro# 300#GTT CTG GTG GAA GGG TTA 960GA AGA GAC#Val Leu Val Glu Gly Leu Lys Arg Arg Asp#320#AAG GCT ACC ATG TTC GTC 1008AA AAA CCT#Lys Ala Thr Met Phe Val Val Lys Lys Pro# 335#AAC TCT CTG GAC TTT TCC 1056TA AAT ATG#Asn Ser Leu Asp Phe Ser Trp Ile Asn Met# 350#GTA TCC CCG GGT GTG GGC 1104AG GTT GCG#Val Ser Pro Gly Val Gly Ala Lys Val Ala# 365#TTT GCA CTT GTA GAA AAT 1152AC GTA AGG#Phe Ala Leu Val Glu Asn Gly Tyr Val Arg# 380#ATA AGG AAA GCC TTC AGA 1200TA AGG GGA#Ile Arg Lys Ala Phe Arg Ala Ile Arg Gly#400#GAG AGA AGT GCT TAA 1245TT GAA CCT#Glu Arg Ser Ala Glu Arg Lys Leu Glu Pro# 410- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1122 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1119- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:#ATA GTA ATG GAT ATC CTA 48CA CCC TTC#Ile Val Met Asp Ile Leu Val Ser Pro Phe#15#CAC ATG GAG ATA GGA GAG 96AC GTA GTA#His Met Glu Ile Gly Glu Glu Asp Val Val# 30#GAA GCT CTG GAA CGT GCG 144AG GTA ATG#Glu Ala Leu Glu Arg Ala Pro Lys Val Met# 45#GCT CTG GGA CTC TGG GAA 192AC ACC CCT#Ala Leu Gly Leu Trp Glu Phe Tyr Thr Pro# 60#AAA AAG TAC AGC GTT GAA 240TT TAC AGG#Lys Lys Tyr Ser Val Glu Glu Phe Tyr Arg# 80#GGA ACT TCG GGA GCG TTT 288TA ACT ACC#Gly Thr Ser Gly Ala Phe Ile Val Thr Thr#95#GGA GAG AAG ATA ATC CTC 336TA AAT GCG#Gly Glu Lys Ile Ile Leu Thr Leu Asn Ala# 110#TTT GCC TAC CTC TTA GAC 384AC AAA AAC#Phe Ala Tyr Leu Leu Asp Cys Tyr Lys Asn# 125#GAA ACG AAT TAC GAA GTA 432TT GAC AAG#Glu Thr Asn Tyr Glu Val Asn Val Asp Lys# 140#AAA GCC CTT CAC ATT TCC 480TT GAT GCG#Lys Ala Leu His Ile Ser Asp Ile Asp Ala#160#TCA CCT GAA ACC CTG AAG 528CA CTC TAC#Ser Pro Glu Thr Leu Lys Gly Thr Leu Tyr# 175#ATG TAC TTC ATA TCC GAC 576AG AAG GGT#Met Tyr Phe Ile Ser Asp Glu Glu Lys Gly# 190#AGG GAG CAC ACA GCA CTT 624AC GAA GGT#Arg Glu His Thr Ala Leu Val Tyr Glu Gly# 205#GGG TTT TCT AAG TAC TTC 672TC ATA AAC#Gly Phe Ser Lys Tyr Phe Ile Val Ile Asn# 220#ATA GTT CCG GAA GAA CTC 720GG TGG ATG#Ile Val Pro Glu Glu Leu Ile Gly Trp Met#240#GTA TTT ATA TCT GCC CCG 768TT CAG AAC#Val Phe Ile Ser Ala Pro Val Ile Gln Asn# 255#TTT GAT TAC GAG TAT TTG 816TT GAG GCT#Phe Asp Tyr Glu Tyr Leu Ala Leu Glu Ala# 270#AGG AAC TTC CTT TAT GGG 864AA GAG AGG#Arg Asn Phe Leu Tyr Gly Phe Glu Glu Arg# 285#AAA CCT CAG GGA GCT TTT 912TA GAC GCG#Lys Pro Gln Gly Ala Phe Lys Ile Asp Ala# 300#ACA GAT AGC TAC GAA TTT 960AT TAC TCC#Thr Asp Ser Tyr Glu Phe Ser Asp Tyr Ser#320#GCG GTA ACG CCC GGG GTG 1008CG AGG GTG#Ala Val Thr Pro Gly Val Glu Ala Arg Val# 335#ATA AGG TTT GCT TAT ACG 1056AG GAG TAT#Ile Arg Phe Ala Tyr Thr Thr Lys Glu Tyr# 350#GAA AGG ATA AAG AAG TTC 1104AG GGC GTT#Glu Arg Ile Lys Lys Phe Lys Glu Gly Val# 365#1122 AGC TGA Leu Glu Lys Leu Ser 370- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1362 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1359- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:#AAG TGG GAC AAG GAG TAC 48CG CTC GAA#Lys Trp Asp Lys Glu Tyr Lys Thr Leu Glu#15#TAC AGA GAA GAA GAA AAC 96TG AAA GTC#Tyr Arg Glu Glu Glu Asn Gln Met Lys Val# 30#CTG TGG GAC ATA TAC GGC 144GC GTT TAC#Leu Trp Asp Ile Tyr Gly Glu Gly Val Tyr# 45#TGG TGC AAC GTC CAC GGA 192CT TCC CTC#Trp Cys Asn Val His Gly Ile Ser Ser Leu# 60#ATG AAA CAG CTC TGT AAG 240AC GCA GTT#Met Lys Gln Leu Cys Lys Asn Asn Ala Val# 80#AAC GTT CCC GCC ATA CTC 288GA AGT TCC#Asn Val Pro Ala Ile Leu Leu Gly Ser Ser#95#GAA GGA TTA AAC AAG GTC 336TT TCT CCT#Glu Gly Leu Asn Lys Val Glu Ile Ser Pro# 110#GAG ATA GCG ATA AAG ATG 384AA GCA GTA#Glu Ile Ala Ile Lys Met Ala Glu Ala Val# 125#AAA GGG AAA AAC GTT TTC 432AG GGA GTT#Lys Gly Lys Asn Val Phe Asn Lys Gly Val# 140#ACT GTA GGA GCG GTT AGC 480AC GGG GAT#Thr Val Gly Ala Val Ser Tyr His Gly Asp#160#TAT AAA GAT CTC CTT TTC 528AC GGA ACT#Tyr Lys Asp Leu Leu Phe Phe His Gly Thr# 175#TAC TGC AAG GAA AAG TAC 576CT TAC CTG#Tyr Cys Lys Glu Lys Tyr Ser Pro Tyr Leu# 190#TTA TTA AAA CAA CTG GAA 624CG GCA GAT#Leu Leu Lys Gln Leu Glu Cys Thr Ala Asp# 205#GCG GTC ATT ATG GAA GCG 672AT ATC GTT#Ala Val Ile Met Glu Ala Glu Asp Ile Val# 220#TTC CCT CCG GGA TTT TTG 720TG CTC CCC#Phe Pro Pro Gly Phe Leu Gly Met Leu Pro#240#GAC ACT TTA ATG ATA GTT 768AG AAA TAC#Asp Thr Leu Met Ile Val Thr Lys Lys Tyr# 255#GGA ACG ATG TTT TAC TGT 816GC AGG ACG#Gly Thr Met Phe Tyr Cys Phe Gly Arg Thr# 270#TGT CTA GGT AAG GGT ATA 864AC TTT ATG#Cys Leu Gly Lys Gly Ile Pro Asp Phe Met# 285#CTC ACA ACG GAC GAG GTG 912CT GCG ACA#Leu Thr Thr Asp Glu Val Leu Ala Ala Thr# 300#GCA AAG CAC TTT TAC CAC 960TC GGG GAG#Ala Lys His Phe Tyr His Glu Phe Gly Glu#320#TGT TCC GTT GCA CTC GCA 1008AC CTC GCC#Cys Ser Val Ala Leu Ala Asn Asn Leu Ala# 335#TTA GAG AAG CTC CAA CCA 1056AA AGA ACT#Leu Glu Lys Leu Gln Pro Glu Glu Arg Thr# 350#GAG TTC TGG GAA CTC AAG 1104GG CTT CAG#Glu Phe Trp Glu Leu Lys Glu Arg Leu Gln# 365#ATG GCT GGA ATA GAG CTG 1152TA GGT TTT#Met Ala Gly Ile Glu Leu Gln Leu Gly Phe# 380#CCT TAC GGT GAA AGG ACG 1200AA CCT TTC#Pro Tyr Gly Glu Arg Thr Gly Glu Pro Phe#400#AAA GGG GTG TTT TTG AGA 1248GC AGG GAA#Lys Gly Val Phe Leu Arg Lys Cys Arg Glu# 415#CCT CTT GTA ATA GAG GAA 1296TG ATG ATG#Pro Leu Val Ile Glu Glu Val Leu Met Met# 430#AAA TGG GCA ATT AAA GAG 1344AT ACA CTT#Lys Trp Ala Ile Lys Glu Ile Asp Thr Leu# 445#1362 GTG TAG Leu Glu Lys Glu Val 450- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1032 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1029- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:#TTG CCC GTA AAG TTT GTA 48AC GCA AGG#Leu Pro Val Lys Phe Val Asn Tyr Ala Arg#15#GAA GGA AAG GAG TAT CTT 96AC GAT GAG#Glu Gly Lys Glu Tyr Leu Leu Tyr Asp Glu# 30#CTC GGT CAC GCT TAC CCA 144TC AAC TCC#Leu Gly His Ala Tyr Pro Gly Val Asn Ser# 45#GAG AAA CTC CTC CAC GTT 192AA CAG GTT#Glu Lys Leu Leu His Val Lys Glu Gln Val# 60#GAA CTG GCT CAC AAA CTT 240GG CAG GAA#Glu Leu Ala His Lys Leu Pro Trp Gln Glu# 80#TTT TTC GCA AAC AGC GGA 288GG AAG GTA#Phe Phe Ala Asn Ser Gly Glu Gly Lys Val#95#GCA AGG AAG TAC TGG AGG 336TA AAG CTC#Ala Arg Lys Tyr Trp Arg Ala Ile Lys Leu# 110#TCC TTT GAA AAC TCT TTC 384AG TTT ATA#Ser Phe Glu Asn Ser Phe Trp Lys Phe Ile# 125#ACG GGA CAG CCA AAG TTC 432TC TCC GCA#Thr Gly Gln Pro Lys Phe Ser Leu Ser Ala# 140#TTT TCT TAC GCA AAG CTG 480TT CCT GGA#Phe Ser Tyr Ala Lys Leu Leu Val Pro Gly#160#GAC GAG GAA ACC GCG GGG 528AA CTC CTA#Asp Glu Glu Thr Ala Gly Tyr Lys Leu Leu# 175#GGA GTA AAC GAG GCG AGT 576GA GAG GGC#Gly Val Asn Glu Ala Ser Gln Gly Glu Gly# 190#TGT AAA GAA AAA GAT GTG 624AG GAA ATT#Cys Lys Glu Lys Asp Val Leu Gln Glu Ile# 205#ATA GGA AGG ACC GGG GAA 672AA ACG GGA#Ile Gly Arg Thr Gly Glu Val Gln Thr Gly# 220#CCG GAC GTA ATT GCG CTT 720AT CTA AAA#Pro Asp Val Ile Ala Leu Phe Asn Leu Lys#240#GGT GCC ATC CTT GCA AGG 768TG CCA ATA#Gly Ala Ile Leu Ala Arg Gly Val Pro Ile# 255#TCC CAC GGC TCT ACC TTC 816CT CCC GGC#Ser His Gly Ser Thr Phe Phe Thr Pro Gly# 270#ACA GTG GTA GTA GAT GAA 864GG GCG GGA#Thr Val Val Val Asp Glu Cys Arg Ala Gly# 285#GTG GGG AAT TAC TTC AAA 912TA AGG GAA#Val Gly Asn Tyr Phe Lys His Val Arg Glu# 300#GTA AAG GGA AGA GGA TTG 960AA GGA AAG#Val Lys Gly Arg Gly Leu Gly Lys Gly Lys#320#AAA GAT TAC GTT CTC AAG 1008GA GAG TGT#Lys Asp Tyr Val Leu Lys Glu Arg Glu Cys# 335# 1032GAC TTC TCA TAA Ala Leu Glu Arg Asp Phe Ser 340- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1197 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1194- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:#CTG AGC CCC TCT CCC ACC 48CG CAG AAA#Leu Ser Pro Ser Pro Thr Arg Ala Gln Lys#15#TTG CGG CAG GGG GAA AGG 96AG GAG CTT#Leu Arg Gln Gly Glu Arg Ala Lys Glu Leu# 30#TTC GAT ACA CCG GAA CAC 144AG CCG GAC#Phe Asp Thr Pro Glu His Gly Glu Pro Asp# 45#CAG GGC TTC ACC AAG TAC 192CT TTA GAT#Gln Gly Phe Thr Lys Tyr Arg Ala Leu Asp# 60#GAG GCC ATA TGC GAG AAG 240CT CTT CGG#Glu Ala Ile Cys Glu Lys Leu Pro Leu Arg# 80#CCG AAT GAG ATC GTG GTC 288AA TAC AGC#Pro Asn Glu Ile Val Val Leu Glu Tyr Ser#95#GCT CTG CAG GTC CTC CTG 336TT TTC AAC#Ala Leu Gln Val Leu Leu Ser Ile Phe Asn# 110#CCC TAC TGG ACT TCC TAT 384TC CCC GTC#Pro Tyr Trp Thr Ser Tyr Ile Ile Pro Val# 125#CCG GTT TTC GTC CCC ACC 432GA GGG GTG#Pro Val Phe Val Pro Thr Ala Gly Gly Val# 140#GAA GAT CTA CGT GCG GCT 480TC AGG CCG#Glu Asp Leu Arg Ala Ala Lys Leu Arg Pro#160#AAT TCC CCG GCC AAC CCC 528TG ATC CTC#Asn Ser Pro Ala Asn Pro Leu Leu Ile Leu# 175#ATC GGC TTA GCG GAG GTA 576AG GAA CTT#Ile Gly Leu Ala Glu Val Arg Glu Glu Leu# 190#GAC GAG ATC TAC GAA AAG 624TC TTG TCG#Asp Glu Ile Tyr Glu Lys Trp Ile Leu Ser# 205#ATA GCC GCG CTC GAC CCG 672AC GTG AGC#Ile Ala Ala Leu Asp Pro Glu His Val Ser# 220#GGT GTT TCC AAG GCT TAC 720TG GTA AAC#Gly Val Ser Lys Ala Tyr Ile Val Val Asn#240#GCC GCT CCC CGG CCG ATA 768GT TAT GCT#Ala Ala Pro Arg Pro Ile Ile Gly Tyr Ala# 255#AGT ACC TCT AAC CCC ACT 816AA AGC CAC#Ser Thr Ser Asn Pro Thr Leu Gln Ser His# 270#CTG AAG GGG CCA CAA GAG 864TG GCC GCT#Leu Lys Gly Pro Gln Glu Ala Leu Ala Ala# 285#AAG CGG CGG GAT TTC ATC 912CT TTT CAA#Lys Arg Arg Asp Phe Ile Arg Ala Phe Gln# 300#CGC TGC CCC AAA CCT TTA 960CC GGA GTG#Arg Cys Pro Lys Pro Leu Leu Pro Gly Val#320#CGG GCT TTT GGG CCG CCG 1008AA GTT GAG#Arg Ala Phe Gly Pro Pro Pro Glu Val Glu# 335#GAC CTG GCC CTT TTC CTC 1056CC GCT AGC#Asp Leu Ala Leu Phe Leu Thr Thr Ala Ser# 350#GGG GCT GCC TTT GGG GAC 1104CC GTG GCT#Gly Ala Ala Phe Gly Asp Ala Thr Val Ala# 365#CGG CTG GAA GAT ATC GAA 1152AC GCC CTG#Arg Leu Glu Asp Ile Glu Ser Tyr Ala Leu# 380#GAA GCG GCA CTT TAA 1197AA TTG ATC#Glu Ala Ala Leu Arg Phe Lys Glu Leu Ile#395- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1779 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1776- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:#GAT TTA GCC CTT CCT ATA 48TA GGG AGG#Asp Leu Ala Leu Pro Ile Tyr Val Gly Arg#15#AGG GGT TAC GAC TCC GCG 96TC GAA TAC#Arg Gly Tyr Asp Ser Ala Arg Leu Glu Tyr# 30#ATA GTT GAA AAG AAG AAG 144GG AAA CTC#Ile Val Glu Lys Lys Lys Asp Gly Lys Leu# 45#TGG GGA AAG GAT TAC AAG 192AA GCG CTA#Trp Gly Lys Asp Tyr Lys Val Lys Ala Leu# 60#GCA ACC CAC GGA AAG CCC 240CA CGC TGG#Ala Thr His Gly Lys Pro His Thr Arg Trp# 80#GAA AAA GGT GAG TTT GCA 288AC ACC GAC#Glu Lys Gly Glu Phe Ala Pro His Thr Asp#95#TTA GAA CTA AAA GAG GAA 336AA AAC TAC#Leu Glu Leu Lys Glu Glu Ile Glu Asn Tyr# 110#GAA ACA GAC ACA GAA GTT 384TC AGG TCC#Glu Thr Asp Thr Glu Val Lys Phe Arg Ser# 125#GGG GAC TTA CTG GAG GCC 432AC TAC AGG#Gly Asp Leu Leu Glu Ala Lys Asn Tyr Arg# 140#GCT TTT GCC TTT GCG GTT 480TA AAG GGT#Ala Phe Ala Phe Ala Val Lys Leu Lys Gly#160#GGA GTG AAG CAG GGG AGT 528GA CTA ATA#Gly Val Lys Gln Gly Ser Asn Arg Leu Ile# 175#AAC TTC CTC GCT TCA GAT 576AA GGA GAA#Asn Phe Leu Ala Ser Asp Gly Glu Gly Glu# 190#ATT ATT GTT CTT GAT GAC 624CG AAA AAG#Ile Ile Val Leu Asp Asp Tyr Thr Lys Lys# 205#GTG AAC ATT TAC AAC TTT 672CC GAC ACT#Val Asn Ile Tyr Asn Phe Thr Pro Asp Thr# 220#ATT ACG CCC TGG GAT CTT 720AA GTA ATG#Ile Thr Pro Trp Asp Leu Lys Glu Val Met#240#TTC ATG CTA AAA GAG ATA 768TT AAA CAC#Phe Met Leu Lys Glu Ile Gly Phe Lys His# 255#CTC AAG GGT TTC CTC TCA 816AC GAC ACA#Leu Lys Gly Phe Leu Ser Ile Asn Asp Thr# 270#GAC TTC AGA AGG GTT TTA 864AG TTA AAA#Asp Phe Arg Arg Val Leu Phe Lys Leu Lys# 285#GGC TTC GTC GGA AAG TAC 912AC CAC GCG#Gly Phe Val Gly Lys Tyr Ser Tyr His Ala# 300#GAG GTA ATT TAC GCT TCG 960TT CCC ACA#Glu Val Ile Tyr Ala Ser Gly Val Pro Thr#320#GAC AAG GAT ATC GTT ATC 1008CC GTT TCG#Asp Lys Asp Ile Val Ile Val Pro Val Ser# 335#ACA AAG TTT GCC CTT CAG 1056CC GCT GAC#Thr Lys Phe Ala Leu Gln Glu Thr Ala Asp# 350#GGA CTC GTA AAC GTA GTG 1104TT ACC GTG#Gly Leu Val Asn Val Val Ala Phe Thr Val# 365#TCC CTT CAC ACA CAT GCG 1152CG GAC TTT#Ser Leu His Thr His Ala Glu Ser Asp Phe# 380#ACC TTC ACC GCA CAG TTC 1200CT ACA AAG#Thr Phe Thr Ala Gln Phe Ala Ala Thr Lys#400#AGT GAG GAG AGG GAA AAT 1248TA AGG GAA#Ser Glu Glu Arg Glu Asn Ser Val Arg Glu# 415#CTC GTT GAA CAA ACA CTG 1296TT CCA TCA#Leu Val Glu Gln Thr Leu Lys Val Pro Ser# 430#GAA AAG TAC ATG AAA AAG 1344AG GTA GCG#Glu Lys Tyr Met Lys Lys Glu Lys Val Ala# 445#AAT TAC CCC ATA GCG CTG 1392GG TAC TTA#Asn Tyr Pro Ile Ala Leu Gly Arg Tyr Leu# 460#TAC ATA CAC GCG GAA GGT 1440AA ATT TCT#Tyr Ile His Ala Glu Gly Lys Glu Ile Ser#480#ATA GCC CTC ATA GAC GAA 1488AC GGT CCC#Ile Ala Leu Ile Asp Glu Lys His Gly Pro# 495#GAC AGG GTT TAC GAG AAG 1536CA CCG AAA#Asp Arg Val Tyr Glu Lys Ile Ala Pro Lys# 510#AGA AAG GGA AGG GTT ATT 1584TT CTC GCA#Arg Lys Gly Arg Val Ile Glu Val Leu Ala# 525#AAA AGC AAA TCC GAG AGC 1632AA ACT CTC#Lys Ser Lys Ser Glu Ser Asp Glu Thr Leu# 540#ATA ACT CCT TTC TTG ACG 1680AA GAA CCG#Ile Thr Pro Phe Leu Thr Ala Glu Glu Pro#560#ATA GCG AGC AAA CTG GGA 1728CC TAC TTT#Ile Ala Ser Lys Leu Gly Phe Ala Tyr Phe# 575#AAA ACG GTC ACG GTG GAA 1776AT CTC GCC#Lys Thr Val Thr Val Glu Arg Asn Leu Ala# 590# 1779- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1065 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1062- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:#GCT TAC AAG ACG GAG GTC 48AA CTT GAA#Ala Tyr Lys Thr Glu Val Lys Glu Leu Glu#15#GAA TTC CCC TAC GAC TTT 96CC TCT AAC#Glu Phe Pro Tyr Asp Phe Leu Ser Ser Asn# 30#GAA TTA AAA AAG GTT CCC 144CC TTA GAA#Glu Leu Lys Lys Val Pro Arg Ala Leu Glu# 45#GAG TTA AAA GCG GTT CTT 192AA GCG AAA#Glu Leu Lys Ala Val Leu Pro Glu Ala Lys# 60#TTA GTT CTC GGT AAC GGT 240AA GAA AAT#Leu Val Leu Gly Asn Gly Lys Glu Glu Asn# 80#GCT ATA GGT GAA CTT TAC 288TC TCA ATA#Ala Ile Gly Glu Leu Tyr Tyr Leu Ser Ile#95#CCC ATG TAC GAG ATA AGT 336CC ACC TTT#Pro Met Tyr Glu Ile Ser Val Pro Thr Phe# 110#GTT CAA CTG GAC GAA AAC 384TC GTA AAG#Val Gln Leu Asp Glu Asn Pro Leu Val Lys# 125#TTA ATA GAG AAA GAA AAA 432GT ATT GAA#Leu Ile Glu Lys Glu Lys Arg Ser Ile Glu# 140#AAC CCC ACG GGA AAC CTC 480AC CCA AAC#Asn Pro Thr Gly Asn Leu Ala Tyr Pro Asn#160#AAC AGG GGT GTT TTC TGT 528AG ATA AGA#Asn Arg Gly Val Phe Cys Glu Glu Ile Arg# 175#GGA GAA ACC TTT CTG GAA 576AT TAC TCC#Gly Glu Thr Phe Leu Glu Tyr His Tyr Ser# 190#TTG AGG ACA CTT TCA AAA 624CG GTA GTT#Leu Arg Thr Leu Ser Lys Asp Thr Val Val# 205#TTA ATA GGG AAG GGG GAA 672TA GGG ATT#Leu Ile Gly Lys Gly Glu Arg Val Gly Ile# 220#CCC TTC AAC GTG ACC TAC 720TG AGA CTC#Pro Phe Asn Val Thr Tyr Lys Val Arg Leu#240#ACG GAG GGA AGA GAA TTC 768TT CTC CTC#Thr Glu Gly Arg Glu Phe Lys Val Leu Leu# 255#GAG CGA GAA AGG ATG TAC 816TT GTA ACA#Glu Arg Glu Arg Met Tyr Glu Val Val Thr# 270#GTT TTT CCG AGT AAG GCT 864GA GTT GAG#Val Phe Pro Ser Lys Ala Glu Gly Val Glu# 285#GCC CAC GAG GTT TAT CAG 912CT TAC CCC#Ala His Glu Val Tyr Gln Thr Pro Tyr Pro# 300#AAC GTA TCT TAC ATG GAA 960TC GTC AGG#Asn Val Ser Tyr Met Glu Val Leu Val Arg#320#GGG AAA CCG GAA GAA AAC 1008TA AGC GTA#Gly Lys Pro Glu Glu Asn Arg Val Ser Val# 335#ATA AAA TCC CTT TCA AGC 1056AG GAG AGT#Ile Lys Ser Leu Ser Ser Leu Glu Glu Ser# 350# 1065 Ser Leu- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 912 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...909- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:#GAC GGC AGA ATA CTT AAG 48TC TGG CTT#Asp Gly Arg Ile Leu Lys Tyr Ile Trp Leu#15#CAC GCG CTT CAC TAC GGA 96TG TTG ACT#His Ala Leu His Tyr Gly His Val Leu Thr# 30#TGG AAC GGC GAT AAT TTG 144GA GGG TAT#Trp Asn Gly Asp Asn Leu Ile Arg Gly Tyr# 45#CGC ATG TAC AGA TCG GCT 192AC ATC GAC#Arg Met Tyr Arg Ser Ala Glu His Ile Asp# 60#AGA GAG GAA GTC CGC CAA 240CG TAT ACA#Arg Glu Glu Val Arg Gln Ile Pro Tyr Thr# 80#TTC CGA GAG GAT GTC TAC 288CT AAT AAC#Phe Arg Glu Asp Val Tyr Lys Ala Asn Asn#95#ACG GTG ACG CTT GAC ATA 336CC TCG CAG#Thr Val Thr Leu Asp Ile Val Ala Ser Gln# 110#GTA TTC CCA TTT GGC AAA 384CG GTT ATT#Val Phe Pro Phe Gly Lys Leu Ala Val Ile# 125#ATT GTA AGC TGG CGT AGA 432AG GCA ACG#Ile Val Ser Trp Arg Arg Ile Lys Ala Thr# 140#AAA ATC GGC GGT ATA TAT 480TG ATG GCA#Lys Ile Gly Gly Ile Tyr Pro Val Met Ala#160#AGA AGC AGG GGA TTT GAC 528TA GAG GCT#Arg Ser Arg Gly Phe Asp Leu Val Glu Ala# 175#GTT GTT GAG GGT TCT GGA 576AC GGT TAT#Val Val Glu Gly Ser Gly Val Asn Gly Tyr# 190#CTT TTC ACG CCG CCA GTA 624GT GGA AGG#Leu Phe Thr Pro Pro Val Arg Gly Gly Arg# 205#GAT ACG GTA ATA AAG CTC 672TT ACG AGG#Asp Thr Val Ile Lys Leu Gly Ile Thr Arg# 220#AAG CCT ATT ACG AGG GAG 720TG GAG GAA#Lys Pro Ile Thr Arg Glu Arg Val Glu Glu#240#GTA GGA ACC GCC GCA GAG 768TG TTT TTA#Val Gly Thr Ala Ala Glu Glu Val Phe Leu# 255#ACA ATC GGC ACA GGC AAG 816AC GGC AGA#Thr Ile Gly Thr Gly Lys Val Asp Gly Arg# 270#CTG TAC TCA AAC GTC GTG 864TA GCT GAG#Leu Tyr Ser Asn Val Val Lys Ile Ala Glu# 285#ATC ACT CCT GTG TAT TAG 912TA AAT TGG#Ile Thr Pro Val Tyr Lys Tyr Leu Asn Trp# 300- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 414 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:#Pro Arg Ile Lys Arg Leuet Asp Trp Ala Phe#15#Leu Lys Tyr Lys Leu Arger Leu Val Asn Glu# 30#Met Gly Asn Pro Asn Metal Val Asp Leu Gly# 45#Cys Glu Val Ala Gln Lysle Ile Asp Lys Leu# 60#Gly Ile Pro Arg Leu Argyr Ser Ala Ser Arg# 80#Tyr Gly Val Lys Leu Asphe Tyr Glu Glu Arg#95#Ala Lys Glu Gly Tyr Serle Leu Thr Ile Gly# 110#Asp Thr Val Ile Val Proet Ile Ser Pro Gly# 125#Pro Ile Ile Ala Gly Glyle His Tyr Tyr Ala# 140#Asp Asp Gln Asp His Glnro Leu Asn Phe Ser#160#Val Lys Thr Ala Met Prorg Leu Tyr Glu Ile# 175#His Asn Pro Thr Thr Ileal Ile Ser Phe Pro# 190#Val Lys Phe Ala Lys Gluhe Phe Lys Glu Ile# 205#Tyr Ala Asp Ile Ala Phele His Asp Phe Ala# 220#Ile Glu Gly Ala Lys Aspro Ser Ile Leu Glu#240#Gly Phe Ser Met Ala Glyyr Ser Met Ser Lys# 255#Ile Leu Ile Lys Asn Leual Val Gly Asn Glu# 270#Ile Phe Thr Pro Ile Glnyr Leu Asp Tyr Gly# 285#Tyr Glu Ile Val Glu Lysla Leu Glu Ser Pro# 300#Val Leu Val Glu Gly Leuln Lys Arg Arg Asp#320#Lys Ala Thr Met Phe Valys Val Lys Lys Pro# 335#Asn Ser Leu Asp Phe Serlu Trp Ile Asn Met# 350#Val Ser Pro Gly Val Glylu Ala Lys Val Ala# 365#Phe Ala Leu Val Glu Asnlu Gly Tyr Val Arg# 380#Ile Arg Lys Ala Phe Argln Ala Ile Arg Gly#400#Glu Arg Ser Alays Glu Arg Lys Leu Glu Pro# 410- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 373 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:#Ile Val Met Asp Ile Leuys Val Ser Pro Phe#15#His Met Glu Ile Gly Gluyr Glu Asp Val Val# 30#Glu Ala Leu Glu Arg Alaer Pro Lys Val Met# 45#Ala Leu Gly Leu Trp Gluhe Phe Tyr Thr Pro# 60#Lys Lys Tyr Ser Val Gluer Glu Phe Tyr Arg# 80#Gly Thr Ser Gly Ala Pheal Ile Val Thr Thr#95#Gly Glu Lys Ile Ile Leual Thr Leu Asn Ala# 110#Phe Ala Tyr Leu Leu Aspro Cys Tyr Lys Asn# 125#Glu Thr Asn Tyr Glu Valal Asn Val Asp Lys# 140#Lys Ala Leu His Ile Serlu Asp Ile Asp Ala#160#Ser Pro Glu Thr Leu Lyshr Gly Thr Leu Tyr# 175#Met Tyr Phe Ile Ser Aspys Glu Glu Lys Gly# 190#Arg Glu His Thr Ala Leueu Val Tyr Glu Gly# 205#Gly Phe Ser Lys Tyr Phela Ile Val Ile Asn# 220#Ile Val Pro Glu Glu Leurg Ile Gly Trp Met#240#Val Phe Ile Ser Ala Prole Val Ile Gln Asn# 255#Phe Asp Tyr Glu Tyr Leula Ala Leu Glu Ala# 270#Arg Asn Phe Leu Tyr Glyhr Phe Glu Glu Arg# 285#Lys Pro Gln Gly Ala Phehe Lys Ile Asp Ala# 300#Thr Asp Ser Tyr Glu Phele Ser Asp Tyr Ser#320#Ala Val Thr Pro Gly Valrg Glu Ala Arg Val# 335#Ile Arg Phe Ala Tyr Thrys Thr Lys Glu Tyr# 350#Glu Arg Ile Lys Lys Pheeu Lys Glu Gly Val# 365- Leu Glu Lys Leu Ser 370- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 453 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:#Lys Trp Asp Lys Glu Tyrro Lys Thr Leu Glu#15#Tyr Arg Glu Glu Glu Asnhr Gln Met Lys Val# 30#Leu Trp Asp Ile Tyr Glyly Glu Gly Val Tyr# 45#Trp Cys Asn Val His Glyla Ile Ser Ser Leu# 60#Met Lys Gln Leu Cys Lyseu Asn Asn Ala Val# 80#Asn Val Pro Ala Ile Leuhr Leu Gly Ser Ser#95#Glu Gly Leu Asn Lys Valal Glu Ile Ser Pro# 110#Glu Ile Ala Ile Lys Metly Ala Glu Ala Val# 125#Lys Gly Lys Asn Val Pheys Asn Lys Gly Val# 140#Thr Val Gly Ala Val Serla Tyr His Gly Asp#160#Tyr Lys Asp Leu Leu Pheeu Phe His Gly Thr# 175#Tyr Cys Lys Glu Lys Tyrro Ser Pro Tyr Leu# 190#Leu Leu Lys Gln Leu Glulu Cys Thr Ala Asp# 205#Ala Val Ile Met Glu Alarg Glu Asp Ile Val# 220#Phe Pro Pro Gly Phe Leula Gly Met Leu Pro#240#Asp Thr Leu Met Ile Valeu Thr Lys Lys Tyr# 255#Gly Thr Met Phe Tyr Cysly Phe Gly Arg Thr# 270#Cys Leu Gly Lys Gly Ileer Pro Asp Phe Met# 285#Leu Thr Thr Asp Glu Valro Leu Ala Ala Thr# 300#Ala Lys His Phe Tyr Hisly Glu Phe Gly Glu#320#Cys Ser Val Ala Leu Alaly Asn Asn Leu Ala# 335#Leu Glu Lys Leu Gln Prolu Glu Glu Arg Thr# 350#Glu Phe Trp Glu Leu Lysys Glu Arg Leu Gln# 365#Met Ala Gly Ile Glu Leurg Gln Leu Gly Phe# 380#Pro Tyr Gly Glu Arg Thrys Gly Glu Pro Phe#400#Lys Gly Val Phe Leu Argyr Lys Cys Arg Glu# 415#Pro Leu Val Ile Glu Gluet Val Leu Met Met# 430#Lys Trp Ala Ile Lys Glual Ile Asp Thr Leu# 445- Leu Glu Lys Glu Val 450- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 343 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:#Leu Pro Val Lys Phe Valsn Asn Tyr Ala Arg#15#Glu Gly Lys Glu Tyr Leuyr Leu Tyr Asp Glu# 30#Leu Gly His Ala Tyr Prole Gly Val Asn Ser# 45#Glu Lys Leu Leu His Valeu Lys Glu Gln Val# 60#Glu Leu Ala His Lys Leusn Pro Trp Gln Glu# 80#Phe Phe Ala Asn Ser Glyhr Glu Gly Lys Val#95#Ala Arg Lys Tyr Trp Argla Ala Ile Lys Leu# 110#Ser Phe Glu Asn Ser Pheys Trp Lys Phe Ile# 125#Thr Gly Gln Pro Lys Phely Ser Leu Ser Ala# 140#Phe Ser Tyr Ala Lys Leuro Leu Val Pro Gly#160#Asp Glu Glu Thr Ala Glyal Tyr Lys Leu Leu# 175#Gly Val Asn Glu Ala Serle Gln Gly Glu Gly# 190#Cys Lys Glu Lys Asp Valys Leu Gln Glu Ile# 205#Ile Gly Arg Thr Gly Glulu Val Gln Thr Gly# 220#Pro Asp Val Ile Ala Leuis Phe Asn Leu Lys#240#Gly Ala Ile Leu Ala Argly Gly Val Pro Ile# 255#Ser His Gly Ser Thr Pheer Phe Thr Pro Gly# 270#Thr Val Val Val Asp Glula Cys Arg Ala Gly# 285#Val Gly Asn Tyr Phe Lysro His Val Arg Glu# 300#Val Lys Gly Arg Gly Leueu Gly Lys Gly Lys#320#Lys Asp Tyr Val Leu Lyseu Glu Arg Glu Cys# 335- Ala Leu Glu Arg Asp Phe Ser 340- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 398 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:#Leu Ser Pro Ser Pro Thrlu Arg Ala Gln Lys#15#Leu Arg Gln Gly Glu Argys Ala Lys Glu Leu# 30#Phe Asp Thr Pro Glu Hisla Gly Glu Pro Asp# 45#Gln Gly Phe Thr Lys Tyrys Arg Ala Leu Asp# 60#Glu Ala Ile Cys Glu Lysle Leu Pro Leu Arg# 80#Pro Asn Glu Ile Val Valln Leu Glu Tyr Ser#95#Ala Leu Gln Val Leu Leuis Ser Ile Phe Asn# 110#Pro Tyr Trp Thr Ser Tyral Ile Ile Pro Val# 125#Pro Val Phe Val Pro Threu Ala Gly Gly Val# 140#Glu Asp Leu Arg Ala Alahe Lys Leu Arg Pro#160#Asn Ser Pro Ala Asn Prorg Leu Leu Ile Leu# 175#Ile Gly Leu Ala Glu Valrg Arg Glu Glu Leu# 190#Asp Glu Ile Tyr Glu Lyseu Trp Ile Leu Ser# 205#Ile Ala Ala Leu Asp Proet Glu His Val Ser# 220#Gly Val Ser Lys Ala Tyrhr Ile Val Val Asn#240#Ala Ala Pro Arg Pro Ilerg Ile Gly Tyr Ala# 255#Ser Thr Ser Asn Pro Thrsn Leu Gln Ser His# 270#Leu Lys Gly Pro Gln Glula Ala Leu Ala Ala# 285#Lys Arg Arg Asp Phe Ilerg Arg Ala Phe Gln# 300#Arg Cys Pro Lys Pro Leuer Leu Pro Gly Val#320#Arg Ala Phe Gly Pro Prohe Pro Glu Val Glu# 335#Asp Leu Ala Leu Phe Leusn Thr Thr Ala Ser# 350#Gly Ala Ala Phe Gly Aspal Ala Thr Val Ala# 365#Arg Leu Glu Asp Ile Gluhe Ser Tyr Ala Leu# 380#Glu Ala Ala Leuln Arg Phe Lys Glu Leu Ile#395- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 592 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:#Asp Leu Ala Leu Pro Ilely Tyr Val Gly Arg#15#Arg Gly Tyr Asp Ser Alalu Arg Leu Glu Tyr# 30#Ile Val Glu Lys Lys Lyslu Asp Gly Lys Leu# 45#Trp Gly Lys Asp Tyr Lyseu Val Lys Ala Leu# 60#Ala Thr His Gly Lys Proly His Thr Arg Trp# 80#Glu Lys Gly Glu Phe Alais Pro His Thr Asp#95#Leu Glu Leu Lys Glu Glule Ile Glu Asn Tyr# 110#Glu Thr Asp Thr Glu Valal Lys Phe Arg Ser# 125#Gly Asp Leu Leu Glu Alala Lys Asn Tyr Arg# 140#Ala Phe Ala Phe Ala Valys Lys Leu Lys Gly#160#Gly Val Lys Gln Gly Serro Asn Arg Leu Ile# 175#Asn Phe Leu Ala Ser Aspeu Gly Glu Gly Glu# 190#Ile Ile Val Leu Asp Aspro Tyr Thr Lys Lys# 205#Val Asn Ile Tyr Asn Pheeu Thr Pro Asp Thr# 220#Ile Thr Pro Trp Asp Leuer Lys Glu Val Met#240#Phe Met Leu Lys Glu Ilely Gly Phe Lys His# 255#Leu Lys Gly Phe Leu Serla Ile Asn Asp Thr# 270#Asp Phe Arg Arg Val Leuro Phe Lys Leu Lys# 285#Gly Phe Val Gly Lys Tyrhr Ser Tyr His Ala# 300#Glu Val Ile Tyr Ala Serla Gly Val Pro Thr#320#Asp Lys Asp Ile Val Ilesp Val Pro Val Ser# 335#Thr Lys Phe Ala Leu Glnly Glu Thr Ala Asp# 350#Gly Leu Val Asn Val Vally Ala Phe Thr Val# 365#Ser Leu His Thr His Alarg Glu Ser Asp Phe# 380#Thr Phe Thr Ala Gln Pheal Ala Ala Thr Lys#400#Ser Glu Glu Arg Glu Asneu Ser Val Arg Glu# 415#Leu Val Glu Gln Thr Leulu Lys Val Pro Ser# 430#Glu Lys Tyr Met Lys Lysal Glu Lys Val Ala# 445#Asn Tyr Pro Ile Ala Leueu Gly Arg Tyr Leu# 460#Tyr Ile His Ala Glu Glyeu Lys Glu Ile Ser#480#Ile Ala Leu Ile Asp Gluet Lys His Gly Pro# 495#Asp Arg Val Tyr Glu Lysal Ile Ala Pro Lys# 510#Arg Lys Gly Arg Val Ilelu Glu Val Leu Ala# 525#Lys Ser Lys Ser Glu Serly Asp Glu Thr Leu# 540#Ile Thr Pro Phe Leu Thrys Ala Glu Glu Pro#560#Ile Ala Ser Lys Leu Glyeu Phe Ala Tyr Phe# 575#Lys Thr Val Thr Val Gluro Arg Asn Leu Ala# 590- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 354 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:#Ala Tyr Lys Thr Glu Valle Lys Glu Leu Glu#15#Glu Phe Pro Tyr Asp Pherg Leu Ser Ser Asn# 30#Glu Leu Lys Lys Val Proln Arg Ala Leu Glu# 45#Glu Leu Lys Ala Val Leusp Pro Glu Ala Lys# 60#Leu Val Leu Gly Asn Glyal Lys Glu Glu Asn# 80#Ala Ile Gly Glu Leu Tyryr Tyr Leu Ser Ile#95#Pro Met Tyr Glu Ile Serro Val Pro Thr Phe# 110#Val Gln Leu Asp Glu Asnrg Pro Leu Val Lys# 125#Leu Ile Glu Lys Glu Lyslu Arg Ser Ile Glu# 140#Asn Pro Thr Gly Asn Leuhe Ala Tyr Pro Asn#160#Asn Arg Gly Val Phe Cysle Glu Glu Ile Arg# 175#Gly Glu Thr Phe Leu Gluyr Tyr His Tyr Ser# 190#Leu Arg Thr Leu Ser Lyslu Asp Thr Val Val# 205#Leu Ile Gly Lys Gly Glueu Arg Val Gly Ile# 220#Pro Phe Asn Val Thr Tyrsn Lys Val Arg Leu#240#Thr Glu Gly Arg Glu Phela Lys Val Leu Leu# 255#Glu Arg Glu Arg Met Tyrln Glu Val Val Thr# 270#Val Phe Pro Ser Lys Alale Glu Gly Val Glu# 285#Ala His Glu Val Tyr Glnrg Thr Pro Tyr Pro# 300#Asn Val Ser Tyr Met Glusp Val Leu Val Arg#320#Gly Lys Pro Glu Glu Asneu Arg Val Ser Val# 335#Ile Lys Ser Leu Ser Serla Leu Glu Glu Ser# 350- Ser Leu- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 303 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:#Asp Gly Arg Ile Leu Lysys Tyr Ile Trp Leu#15#His Ala Leu His Tyr Glyle His Val Leu Thr# 30#Trp Asn Gly Asp Asn Leuly Ile Arg Gly Tyr# 45#Arg Met Tyr Arg Ser Alalu Glu His Ile Asp# 60#Arg Glu Glu Val Arg Glnsn Ile Pro Tyr Thr# 80#Phe Arg Glu Asp Val Tyrle Lys Ala Asn Asn#95#Thr Val Thr Leu Asp Ilehe Val Ala Ser Gln# 110#Val Phe Pro Phe Gly Lyser Leu Ala Val Ile# 125#Ile Val Ser Trp Arg Argly Ile Lys Ala Thr# 140#Lys Ile Gly Gly Ile Tyreu Pro Val Met Ala#160#Arg Ser Arg Gly Phe Aspla Leu Val Glu Ala# 175#Val Val Glu Gly Ser Glysp Val Asn Gly Tyr# 190#Leu Phe Thr Pro Pro Valal Arg Gly Gly Arg# 205#Asp Thr Val Ile Lys Leulu Gly Ile Thr Arg# 220#Lys Pro Ile Thr Arg Glueu Arg Val Glu Glu#240#Val Gly Thr Ala Ala Glusp Glu Val Phe Leu# 255#Thr Ile Gly Thr Gly Lyslu Val Asp Gly Arg# 270#Leu Tyr Ser Asn Val Valhr Lys Ile Ala Glu# 285#Ile Thr Pro Val Tyrlu Lys Tyr Leu Asn Trp# 300- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- CCGAGAATTC ATTAAAGAGG AGAAATTAAC TATGGCAGTC AAAGTGCGGC CT - # 52- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 nucleoti - #des (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 31 AAAG CTTCCAGGAA G- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1092 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1089- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:#CAG GTG GAG ATC TAC CGT 48AG CTC AGC#Gln Val Glu Ile Tyr Arg Pro Glu Leu Ser#15#GAG CTG GGG CTG GAG GAG 96TA AAG AAG#Glu Leu Gly Leu Glu Glu Glu Val Lys Lys# 30#CTG GGA CCT TCT CCC AAG 144AG AAC CCT#Leu Gly Pro Ser Pro Lys Asn Glu Asn Pro# 45#TGG CAC CTT TAC CCA GAA 192TG GAC CAC#Trp His Leu Tyr Pro Glu Gly Leu Asp His# 60#GGT AAG AAA CTG GAG ATA 240AG GCG CTG#Gly Lys Lys Leu Glu Ile Arg Gln Ala Leu# 80#TCA AGC GAA GTC ATC CAG 288GT TGC GGC#Ser Ser Glu Val Ile Gln Val Gly Cys Gly# 95#GAC GAG GTG GTC ATC CCT 336CG CCC GGC#Asp Glu Val Val Ile Pro Leu Ala Pro Gly# 110#GCA CGG CTC ATG GGG GCT 384AG CCC CTG#Ala Arg Leu Met Gly Ala Tyr Glu Pro Leu# 125#CGC ATC GAT GTG GAG GCA 432AG GAC TAC#Arg Ile Asp Val Glu Ala Leu Lys Asp Tyr# 140#CTG GTC TAC CTA TGC AAC 480GT ACC AAG#Leu Val Tyr Leu Cys Asn Pro Arg Thr Lys#160#CGG GAG GAG GTG GAG TGG 528TC GTC ACC#Arg Glu Glu Val Glu Trp Thr Ile Val Thr# 175#ACC GTG CTG GAC GAG GCC 576GG GTT CTC#Thr Val Leu Asp Glu Ala Glu Gly Val Leu# 190#CCT GAT GGG CTC GAT TTC 624CC GCC TAC#Pro Asp Gly Leu Asp Phe Ser Pro Ala Tyr# 205#CGC ACC TTC TCC AAG ATC 672TG GTG CTG#Arg Thr Phe Ser Lys Ile Val Val Val Leu# 220#GGT GTG GCG GAC AGG GAG 720TA GGG TAC#Gly Val Ala Asp Arg Glu Arg Ile Gly Tyr#240#CCT TTC AAT GTC AGT TCC 768TG CGG GAG#Pro Phe Asn Val Ser Ser Arg Val Arg Glu# 255#GAA GAC GAA GAG TTC GTG 816CC GCC CTG#Glu Asp Glu Glu Phe Val Leu Ala Ala Leu# 270#AAG GTT TTT CTC TAC CGA 864AA GAA GGG#Lys Val Phe Leu Tyr Arg Asn Glu Glu Gly# 285#CCC ACC GAG GCC AAC TTC 912CC TAC GTG#Pro Thr Glu Ala Asn Phe Ile Ala Tyr Val# 300#GAA GTA TTT CGC CGG ATG 960AC GAG CAG#Glu Val Phe Arg Arg Met Arg Asp Glu Gln#320#GTG GGT TAT CCC ACC CAC 1008GG GNC GGG#Val Gly Tyr Pro Thr His Ile Arg Xaa Gly# 335#AAC CAG CGC TTC CTG GAA 1056TG GAA CAG#Asn Gln Arg Phe Leu Glu Thr Leu Glu Gln# 350# 1092 TA GAG CTT AGG GGG#Val Leu Asp Lys Ala Leu Glu Leu Arg Gly# 360- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 363 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:#Gln Val Glu Ile Tyr Argrg Pro Glu Leu Ser#15#Glu Leu Gly Leu Glu Glulu Glu Val Lys Lys# 30#Leu Gly Pro Ser Pro Lyser Asn Glu Asn Pro# 45#Trp His Leu Tyr Pro Glulu Gly Leu Asp His# 60#Gly Lys Lys Leu Glu Ileeu Arg Gln Ala Leu# 80#Ser Ser Glu Val Ile Glnle Val Gly Cys Gly#95#Asp Glu Val Val Ile Proeu Leu Ala Pro Gly# 110#Ala Arg Leu Met Gly Alarg Tyr Glu Pro Leu# 125#Arg Ile Asp Val Glu Alaro Leu Lys Asp Tyr# 140#Leu Val Tyr Leu Cys Asner Pro Arg Thr Lys#160#Arg Glu Glu Val Glu Trply Thr Ile Val Thr# 175#Thr Val Leu Asp Glu Alaly Glu Gly Val Leu# 190#Pro Asp Gly Leu Asp Phehr Ser Pro Ala Tyr# 205#Arg Thr Phe Ser Lys Ilesn Val Val Val Leu# 220#Gly Val Ala Asp Arg Glueu Arg Ile Gly Tyr#240#Pro Phe Asn Val Ser Seris Arg Val Arg Glu# 255#Glu Asp Glu Glu Phe Valla Leu Ala Ala Leu# 270#Lys Val Phe Leu Tyr Argal Asn Glu Glu Gly# 285#Pro Thr Glu Ala Asn Phely Ile Ala Tyr Val# 300#Glu Val Phe Arg Arg Metly Arg Asp Glu Gln#320#Val Gly Tyr Pro Thr Hisle Ile Arg Xaa Gly# 335#Asn Gln Arg Phe Leu Gluly Thr Leu Glu Gln# 350#Valla Leu Asp Lys Ala Leu Glu Leu Arg Gly# 360- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 52 nucleoti - #des (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:- CCGAGAATTC ATTAAAGAGG AGAAATTAAC TATGAGAAAA GGACTTGCAA GT - # 52- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 NUCLEOTI - #DES (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: NUCLEIC ACID- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:# 31 CTCT TCAAGGGCTT T- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1185 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...1182- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:#CAC CTA AAA CCT TCC CCC 48GG GTA AGT#His Leu Lys Pro Ser Pro Ser Arg Val Ser#15#TTA AGG GCT AAA GGA GTG 96CA AAA GAA#Leu Arg Ala Lys Gly Val Lys Ala Lys Glu# 30#GAC TTC GAC ACA CCC GAC 144GA GAA CCT#Asp Phe Asp Thr Pro Asp Ala Gly Glu Pro# 45#AGG GAA GGA AAG ACC AAG 192GG GCT TTA#Arg Glu Gly Lys Thr Lys Ile Arg Ala Leu# 60#AGA GAA GCT ATA GCT GAA 240CA GAG CTC#Arg Glu Ala Ile Ala Glu Ile Pro Glu Leu# 80#AAA CCT TCA GAG ATA GTC 288TT GAG TAC#Lys Pro Ser Glu Ile Val Lys Val Glu Tyr#95#CTC ATA TTC ATG GCT ATA 336TT CTC TTC#Leu Ile Phe Met Ala Ile Met Val Leu Phe# 110#AGC CCT TAC TGG GTA ACT 384TA CTA CCT#Ser Pro Tyr Trp Val Thr Val Leu Leu Pro# 125#GTT CCC GTT GAG GTT CCT 432TC GGA GGG#Val Pro Val Glu Val Pro Phe Phe Gly Gly# 140#CTG GAA GAT GTG AAA GAA 480AA TTA AGT#Leu Glu Asp Val Lys Glu Phe Gln Leu Ser#160#ATA AAC TCT CCG AAC AAC 528CT ATA GTC#Ile Asn Ser Pro Asn Asn Lys Ala Ile Val# 175#CTT AAG AAA ATA GCG GAG 576AG GAG GAA#Leu Lys Lys Ile Ala Glu Glu Glu Glu Glu# 190#TCC GAT GAG TGC TAT GAG 624TC ATA ATT#Ser Asp Glu Cys Tyr Glu Ile Phe Ile Ile# 205#AGC CCT GCC TCT TTC TCG 672AA TTT GTT#Ser Pro Ala Ser Phe Ser Ala Lys Phe Val# 220#AAC GCC TTT TCG AAG AGC 720TC ACG GTA#Asn Ala Phe Ser Lys Ser Thr Phe Thr Val#240#GTA GCG TGC CCC GAA GAG 768TA GGT TAT#Val Ala Cys Pro Glu Glu Arg Ile Gly Tyr# 255#CAG AGT GTT TCC AAC GTC 816TT AAC AGC#Gln Ser Val Ser Asn Val Ser Leu Asn Ser# 270#GCC TTG AAA AAT CCA AAG 864CT CTT GAG#Ala Leu Lys Asn Pro Lys Gly Ala Leu Glu# 285#GCT TTT GAA AGG AGA AGG 912TG AGA AAT#Ala Phe Glu Arg Arg Arg Glu Met Arg Asn# 300#CCA GGT ATG GAT GTG GTA 960CT AAA ATT#Pro Gly Met Asp Val Val Leu Ser Lys Ile#320#GAC TTC TCC GCT TAC GCT 1008TA TTT CCG#Asp Phe Ser Ala Tyr Ala Tyr Ile Phe Pro# 335#GAG TTC CTT CTG GAA AAG 1056AA CTC TCG#Glu Phe Leu Leu Glu Lys Val Lys Leu Ser# 350#TTC GGA GCT CCC GGA TTT 1104GT TCG GCC#Phe Gly Ala Pro Gly Phe Pro Gly Ser Ala# 365#AGA CTC GTT GAG GGT ATA 1152CC GAG GAA#Arg Leu Val Glu Gly Ile Leu Ser Glu Glu# 380# 1185 A GCC CTT GAA GAG ATC Arg Arg Ile Lys Lys Ala Leu Glu Glu Ile#390- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 394 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:#His Leu Lys Pro Ser Prola Ser Arg Val Ser#15#Leu Arg Ala Lys Gly Valla Lys Ala Lys Glu# 30#Asp Phe Asp Thr Pro Asply Ala Gly Glu Pro# 45#Arg Glu Gly Lys Thr Lysys Ile Arg Ala Leu# 60#Arg Glu Ala Ile Ala Gluly Ile Pro Glu Leu# 80#Lys Pro Ser Glu Ile Valsn Lys Val Glu Tyr#95#Leu Ile Phe Met Ala Ileys Met Val Leu Phe# 110#Ser Pro Tyr Trp Val Thrlu Val Leu Leu Pro# 125#Val Pro Val Glu Val Prorg Phe Phe Gly Gly# 140#Leu Glu Asp Val Lys Gluly Phe Gln Leu Ser#160#Ile Asn Ser Pro Asn Asnhr Lys Ala Ile Val# 175#Leu Lys Lys Ile Ala Gluyr Glu Glu Glu Glu# 190#Ser Asp Glu Cys Tyr Gluly Ile Phe Ile Ile# 205#Ser Pro Ala Ser Phe Sersp Ala Lys Phe Val# 220#Asn Ala Phe Ser Lys Serle Thr Phe Thr Val#240#Val Ala Cys Pro Glu Glurp Arg Ile Gly Tyr# 255#Gln Ser Val Ser Asn Valla Ser Leu Asn Ser# 270#Ala Leu Lys Asn Pro Lysyr Gly Ala Leu Glu# 285#Ala Phe Glu Arg Arg Argsn Glu Met Arg Asn# 300#Pro Gly Met Asp Val Vallu Leu Ser Lys Ile#320#Asp Phe Ser Ala Tyr Alahe Tyr Ile Phe Pro# 335#Glu Phe Leu Leu Glu Lyssp Val Lys Leu Ser# 350#Phe Gly Ala Pro Gly Pheal Pro Gly Ser Ala# 365#Arg Leu Val Glu Gly Ilela Leu Ser Glu Glu# 380- Arg Arg Ile Lys Lys Ala Leu Glu Glu Ile#390- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 52 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- CCGAGAATTC ATTAAAGAGG AGAAATTAAC TATGAGAAAA GGACTTGCAA GT - # 52- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 31 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 31 CTCT TCAAGGGCTT T__________________________________________________________________________

Claims

1. An isolated polynucleotide selected from the group consisting of:

a) a polynucleotide encoding SEQ ID NOs: 36 or 40; and

b) a nucleic acid sequence fully complementary to a).

2. The polynucleotide of claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of claim 1 wherein the polynucleotide is RNA.

4. An expression vector comprising the DNA of claim 2.

5. A host cell comprising the vector of claim 4.

6. A process for producing a polypeptide comprising:

a) culturing a host cell of claim 5;

b) expressing from the host cell a polypeptide encoded by said DNA; and

c) optionally isolating the polypeptide.

7. An enzyme selected from the group consisting of an enzyme comprising the amino acid sequence as set forth in SEQ ID NOS: 36 and 40.

8. A method for transferring an amino group from an amino acid to an .alpha.-keto acid comprising:

contacting an amino acid in the presence of an .alpha.-keto acid with an enzyme selected from the group consisting of an enzyme having the amino acid sequence set forth in SEQ ID NOS: 36 and 40.

9. The polynucleotide of claim 2 which encodes an enzyme comprising amino acids 1 to 363 of SEQ ID NO: 36.

10. The polynucleotide of claim 2 which encodes an enzyme comprising amino acids 1 to 394 of SEQ ID NO: 40.