TRC8, a gene related to the hedgehog receptor, patched

Abstract

The present invention provides the sequence for a novel gene called TRC8 which is located on chromosome 8. Various types of alterations in the gene have been shown to be associated with renal and thyroid tumors. One such alteration involves a 3;8 translocation which interrupts TRC8 and results in a fusion with the 3p14 gene, FHIT. Another alteration includes a mutation in the 5′ untranslated region of TRC8. Thus, the invention further provides sequences corresponding to the gene fusions created during the translocation, as well as the sequence of the gene containing the mutation in the 5′ region. The invention further provides methods for detecting alterations in TRC8 which have potential utility in the diagnosis of tumors.

Description

FIELD OF INVENTION

[0003] The present invention relates to alterations in a novel gene which are associated with certain renal and thyroid tumors. As such, the present invention is directed to the field of molecular genetics of tumor formation. One such alteration involves a chromosomal translocation between chromosomes 3 and 8 (typically referred to simply as t(3;8)). The 3;8 translocation results in the fusion of the novel gene TRC8 (Translocation in Renal Cancer from Chromosome 8) with a known gene named FHIT (Fragile Histidine Triad). A mutation in the 5′ untranslated region has also been associated with certain renal cell carcinomas.

BACKGROUND OF THE INVENTION

[0004] The 3;8 chromosomal translocation, t(3;8)(p14.2;q24.1), was described in a family with classical features of hereditary renal cell carcinoma (RCC), i.e., autosomal dominant inheritance, early onset and bilateral disease (see A. J. Cohen, et al., N. Engl. J Med. 301, 592-595 (1979)). The translocation and RCC segregated concordantly and a follow-up analysis reported the occurrence of thyroid cancer in two translocation carriers with kidney cancer (F. P. Li, et al., Ann. Intern. Med 118, 106-111 (1993)). Frequent 3p loss of heterozygosity (LOH) in sporadic clear-cell RCC led to the initial assumption that a critical tumor suppressor gene would be located at 3p14. Identification of the von Hippel-Lindau (VHL) gene at 3p25, frequently mutated in RCCs, provided an alternative explanation for at least some observed 3p LOH and Van den Berg et al. subsequently reported that region p21 may be a primary target for 3p LOH. (A. van den Berg and C. H. Buys, Genes. Chromosomes. Cancer 19, 59-76 (1997)).

[0005] Within 3p14, Ohta et al. identified a putative tumor suppressor gene (TSG), FHIT, which was interrupted in its 5′ untranslated region by the 3;8 translocation (M. Ohta, et al., Cell 84, 587-597 (1996)). The human gene, like its yeast homologue, encodes di-adenosine (5 ′, 5″- p1, P3-triphosphate) hydrolase activity. (L. D. Barnes, et al., Biochemistry 35, 11529-11535 (1996)). Several reports have described FHIT alterations in diverse carcinomas using nested reverse transcriptase-PCR (RT-PCR) (M. Ohta, et al., Cell 84, 587-597 (1996); G. Sozzi, et al., Cell 85, 17-26 (1996); L. Virgilio, et al., Proc. Natl. Acad. Sci. U.S.A. 93, 9770-9775 (1996); M. Negrini, et al., Cancer Res. 56, 3173 (1996); G. Sozzi, et al., Cancer Res. 56, 2472-2474 (1996)). Other results, however, have been contradictory.

[0006] In fact, several lines of evidence make FHIT an unlikely, or at least suspect, causative gene in the hereditary t(3;8) family. For example, the possibility that FHIT functions as a tumor suppressor is at odds with its activity as a di-adenosine hydrolase, an unprecedented tumor suppressor function (Barnes, L. D., et al., Biochemistry 35, 11529-11535 (1996)). The lack of substantial mutations in tumors combined with the fact that most FHIT abnormalities occur in the presence of wild-type transcripts and result from low-abundance splicing alterations, similar to those seen for TSG101, further argues against FHIT acting as a tumor suppressor (S. Thiagalingam, et al., Cancer Res. 56, 2936-2939 (1996); K. M. Fong, et al., Cancer Res. 57, 2256-2267 (1997); S. A. Gayther, et al., Oncogene 15, 2119-2126 (1997); F. Boldog et al., Hum. Mol. Genet. 6, 193-203 (1997); I. Panagopoulos, et al., Genes. Chromosomes. Cancer 19, 215-219 (1997); and A. van den Berg, et al., Genes. Chromosomes. Cancer 19, 220-227 (1997); A. Latil, et al., Oncogene 16, 1863 (1998)).

[0007] Moreover, there is little support for the involvement of FHIT in renal cancers (See, A. van den Berg, et al., Genes Chromosomes Cancer 19, 220-227 (1997); P. Bugert, et al., Genes Chromosomes Cancer 20, 9-15 (1997)). Similarly, the reintroduction of FHIT into tumorigenic cell lines was inconsistent in suppressing tumors, including the fact that a hydrolase “dead” mutant appeared active (Z. Siprashvili, et al., Proc. Natl. Acad. Sci. USA 94, 13771-13776 (1997)). Otterson et al. (J. Natl. Cancer Inst. 90, 426-432 (1998)) introduced FHIT into six carcinoma cell lines and observed no effects on proliferation, morphology, cell-cycle kinetics, or tumorigenesis.

[0008] In earlier work, the present inventors also identified a series of 3p14 deletions, many not involving FHIT exons, which overlapped FRA3B in various carcinoma cell lines (F. Boldog, et al., Hum. Mol. Genet. 6, 193-203 (1997)). However, spontaneous deletions also were observed in nontumor backgrounds. Thus, the close association of FHIT exon 5 with FRA3B suggested that its loss might be primarily related to genomic instability, in contrast to negative selection during tumor development. Although another 3p14 gene might exist, sequence data totaling 160 kb from FRA3B (F. Boldog, et al., Hum. Mol. Genet. 6, 193-203 (1997)) (plus GenBank updates AF023460 and AF023461), together with 135 kb of nonoverlapping sequence from Inoue et al. (Proc. Natl. Acad. Sci. U.S.A. 94, 14584-14589 (1997)), failed to show any additional definitive genes.

[0009] It was also noted that FHIT, in one parotid adenoma, underwent fusion with the high mobility group protein gene (HMGIC), the causative gene in a variety of benign tumors (J. M. Geurts, et al., Cancer Res. 57, 13-17 (1997)). That HMGIC was involved in translocations with other unrelated genes indicated that FHIT could be a bystander in the FHIT/HMGIC fusion.

[0010] Given this evidence arguing against FHIT as the causative gene in the hereditary t(3;8) family, there remained a need to identify the gene or genes involved in the 3;8 translocation that results in the formation of tumors, especially renal and thyroid cancers. Given the correspondence between the 3;8 translocation and certain tumors, identification of the gene involved in the 3;8 translocation could also have value in the diagnosis of other tumors which result from other types of alterations to the gene involved in the 3;8 translocation.

SUMMARY OF THE INVENTION

[0011] The present invention satisfies the need identified above by describing the cloning and sequencing of human DNA sequences which are rearranged in the t(3;8)(p14.2; q24.1) chromosomal translocation which occurs in renal and thyroid carcinomas. This chromosomal translocation or rearrangement was shown to fuse sequences from a novel gene which the present inventors have named TRC8 (short for Translocation in Renal Cancer from Chromosome 8) on chromosome 8 with the FHIT gene on chromosome 3p (the FHIT gene sequence is set forth as SEQ ID NO: 8; the corresponding amino acid sequence is set forth as SEQ ID NO: 9). The sequence of the novel TRC8 gene and the TRC8 protein, as well as the sequence of the t(3;8) fusion genes (5′TRC8/3′ FHIT and 5′FHIT/3′ TRC8) and the fusion proteins encoded by these fused genes are disclosed herein. A summary of certain aspects the present invention has recently been published in the scientific literature (R. M. Gemmill, et al., Prot. Natl. Acad. Sci. 95, 9572-9577 (1998)).

[0012] Identification of this gene is important because various types of alterations or mutations of TRC8 appear to be involved with different types of tumors and cancers. As just noted, the 3;8 translocation is involved in certain renal cancers. As described in greater detail below, a tumor-specific mutation in the 5′ untranslated region is associated with certain renal carcinomas. Additionally, recent work by B. T. Teh and coworkers (Genes Chromosomes Cancer 21, 260-264 (1998)) suggests that another rearrangement involving TRC8 (a (8;9)(q 24.1 ;q 34.3) translocation) may be associated with certain renal oncocytomas. Thus, detection of alterations in TRC8 has utility in the detection of tumor formation.

[0013] More particularly, the present invention provides an isolated polynucleotide molecule encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 2. In one particular aspect, the polynucleotide is the polynucleotide molecule of SEQ ID NO: 1, or variants thereof. In another aspect, the polynucleotide comprises nucleotides 238 to 2229 of SEQ ID NO: 1. The present invention further contemplates fragments of the polynucleotide comprising SEQ ID NO: 1 that are at least 50 nucleotides, at least 100 nucleotides, at least 250 nucleotides, at least 500 nucleotides and at least 1000 nucleotides in length.

[0014] In another aspect, the present invention provides a polynucleotide sequence which hybridizes to the polynucleotide sequence of SEQ ID NO: 1 under stringent conditions. The invention further provides polynucleotide sequences comprising the complement of SEQ ID NO: 1 or variants thereof. Such complementary nucleic acid sequences may include the complement of the entire sequence of SEQ ID NO: 1, or fragments thereof. More particularly, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (b) a ribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 12 consecutive nucleotides capable of hybridizing to nucleotides 238 to 2229 of SEQ ID NO: 1; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d).

[0015] In a yet a further embodiment, the present invention provides an isolated polynucleotide comprising at least a portion of SEQ ID NO: 1 or variants thereof which are contained in a recombinant expression vector. The recombinant vector may be contained within a host cell in another aspect of the present invention. The present invention is not limited by the particular type of host cell that can be utilized. Thus, for example, the host cell may be a human cell, a yeast cell, a bacterial cell, etc.

[0016] The present invention also provides a method for detecting the presence of TRC8 in a biological sample. The method comprises the steps of: (a) selecting a probe from SEQ ID NO: 1 which specifically hybridizes to TRC8; (b) hybridizing the probe with a biological sample; (c) detecting the presence of a hybridization complex formed by the hybridization of the probe with the TRC8 nucleic acid in the sample, wherein the presence of the complex is indicative of the presence of TRC8 nucleic acid in the biological sample.

[0017] In a further embodiment, the present invention provides primers which are specific for TRC8 and which can be used in polymerase chain reaction tests to detect the gene. For example, the present invention provides polynucleotide molecules comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 45, although this is not an exhaustive list of such primers.

[0018] A method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or fragments thereof is also provided for by the present invention. This method generally comprises: (a) culturing a host cell which includes an expression vector containing an isolated polynucleotide encoding at least a fragment of the TRC8 polypeptide under conditions suitable for the expression of the TRC8 polypeptide and (b) recovering the polypeptide from the host cell culture. The present invention further provides a polypeptide product of the expression in a host cell of a DNA according to the method just described.

[0019] An isolated polynucleotide molecule including sequences located in the 5′ flanking region to the coding region of TRC8 (SEQ ID NO: 6) is also provided for by the present invention. More specifically, these sequences include nucleotides in the 5′ untranslated region, exon 1 and a portion of the coding region of TRC8. The present invention also includes isolated nucleic acid molecules which are complementary to the nucleotide sequence of SEQ ID NO: 6 or fragments thereof.

[0020] In another aspect, the invention includes an isolated polynucleotide molecule of SEQ ID NO: 7 which occurs in certain sporadic renal cell carcinomas. More specifically, the present invention includes an isolated polynucleotide molecule comprising nucleotides 153-176 of SEQ ID NO: 7. The present invention further contemplates sequences which are complementary to these sequences found in sporadic renal cell carcinomas.

[0021] In yet a further embodiment, the present invention provides isolated polynucleotides which correspond to the two gene fusions created after the t(3;8)(p14.2;q24.1) translocation event, i.e. the TRC8/FHIT fusion (SEQ ID NO: 10) and the FHIT/TRC8 fusion (SEQ ID NO: 11). As used herein, the TRC8/FHIT fusion or gene refers to the reciprocal fusion wherein the 5′ region of TRC8 is fused to the 3′ region of FHIT; the term FHIT/TRC8 fusion or gene refers to the fusion wherein the 5′ region of FHIT is fused to the 3′ region of TRC8 (see FIG. 1 for pictorial view of the translocation). For each of these two gene fusions, the present invention also provides an isolated polynucleotide sequence selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to the gene fusion, (b) a ribonucleotide sequence complementary to the gene fusion; and a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b).

[0022] Utilizing the sequences of the TRC8/FHIT and FHIT/TRC8 fusion genes, the present invention provides methods of identifying the presence of nucleic acids containing the TRC8/FHIT or FHIT/TRC8 fusions. In particular, the sequences described herein can be used to detect the gene fusions by means well-known in the art such as Southern and Northern blots and the like, fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR) amplification and other nucleic acid hybridization and detection methods.

[0023] Because, as set forth above, various alterations of TRC8 have been shown to be associated with at least certain renal and thyroid carcinomas, the nucleotide sequences described herein can be used as a diagnostic for assessing renal or thyroid tumor formation in humans. In general, such diagnostic methods involve determining whether the TRC8 gene has been rearranged or mutated, a rearranged or mutated TRC8 gene being indicative of a renal or thyroid tumor. A variety of techniques can be utilized to determine whether the TRC8 gene has been altered as would be appreciated by those skilled in the art including PCR analysis, various amplification and hybridization methods, including for example, single-stranded conformational polymorphism (SSCP) analysis.

[0024] An example of one specific diagnostic method involves ascertaining whether there is a breakpoint in the TRC8 gene between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 1. Thus, for example, nucleic acid probes which span the fusion site of the TRC8/FHIT fusion (between bases 418 and 419 of SEQ ID NO: 10) or the fusion site of the FHIT/TRC8 fusion (between bases 252-253 of SEQ ID NO: 11) can be used to detect a 3;8 chromosomal translocation by contacting the nucleic acid probe with a biological sample and then determining whether the probe specifically hybridizes to TRC8/FHIT DNA or to FHIT/TRC8 DNA, respectively. More specifically, a method of the present invention may include: (a) contacting one of the nucleic acid probes which span the fused site of the TRC8/FHIT gene fusion with a sample and (b) determining whether the probe specifically hybridizes with DNA containing the fused site of TRC8/FHIT but not with TRC8 DNA or FHIT DNA. Similar methods can also be used with probes specific for DNA including the FHIT/TRC8 breakpoint.

BRIEF DESCRIPTION OF DRAWINGS

[0025] FIG. 1 illustrates a fusion of FHIT and TRC8 genes by the 3;8 translocation. Normal chromosomes 3 p and 8 q are shown schematically along with FHIT exons 1 through 5 (non-coding regions are shaded; coding regions are black) and TRC8 exons 1 and 2. Both genes are transcribed away from their respective centromeres (dot on left). The 3;8 breakpoint (indicated schematically by the vertical arrow) interrupts FHIT between untranslated exons 3 and 4 to generate the der (8) and der (3) chromosomes. TRC8 is interrupted between the 5′ and 3′ coding exons. Nested primers RI (SEQ ID NO: 12), R2 (SEQ ID NO: 13) and R3 (SEQ ID NO: 15) within FHIT exon 4 were used for 5′ RACE (arrow heads). FHIT exon 4 oligonucleotide R4 (SEQ ID NO: 17) identified bona fide RACE products which were tested with the exon 3 oligonucleotide F4 (SEQ ID NO: 16) to identify putative gene fusions. The other primers indicated were used for RT-PCR and mapping experiments (F1—SEQ ID NO: 18; R-M—SEQ ID NO: 19; F-O—SEQ ID NO: 20; and EMR —SEQ ID NO: 21).

[0026] FIG. 2A is a schematic of TRC8 coding domains. The coding region (bold line) containing 664 amino acids extends from bp 1 to 1992 (numbering of bases in this particular figure begins with the first base of the first codon coding for the first methionine; these bases correspond to bases 238 to 2229 of SEQ ID NO: 1) and is flanked by 5′ and 3′ UTRs (thin lines). Promoters predicted from corresponding genomic sequences are indicated by horizontal arrows. Eleven predicted transmembrane (TM) domains (light gray) and the RING-H2 motif (Ring Finger, dark gray) are indicated along with the putative sterol sensing domain and the patched homology. The 3;8 translocation breakpoint occurs within the second transmembrane segment disrupting the sterol sensing domain (SSD) between amino acids 60 and 61 of SEQ ID NO: 2. The position of a mutation found in the sporadic kidney tumor RCC #1 is indicated.

[0027] FIG. 2B shows the predicted amino acid sequence of TRC8 (SEQ ID NO: 2). The sequence (also listed in GenBank as accession number 3395787) begins with the first methionine present in the isolated cDNAs. The 3:8 translocation breakpoint occurs between amino acids 60 and 61. Predicted TM segments are underlined and three potential glycosylation sites are indicated by asterisks. Two regions showing similarity to patched from Drosophila melanogaster are shaded, including the SSD and a region homologous to the second extracellular loop of patched (PTC). The RING-H2 motif is boxed.

[0028] FIG. 2C depicts the amino acid sequence homology between TRC8 (SEQ ID NO: 2) and Drosophila patched (SEQ ID NO: 3). A portion of the Dm Ptc sequence (amino acids 883-978 of SEQ ID NO: 3; GenBank accession number 552099 (protein), M28999 (gene)) was aligned with a portion of the TRC8 amino acid sequence (residues 344 to 443 of SEQ ID NO: 2) by gapped BLAST. Identical amino acids are indicated by white letters on black while similar amino acids (positive scores in a PAM250 matrix) are shaded. Two TRC8 TM segments within this homology region are underlined.

[0029] FIG. 2D shows the alignment of the amino acid sequence of human TRC8 (SEQ ID NO: 2), human HMG-CoA reductase (SEQ ID NO: 4) and human patched (SEQ ID NO: 5) within the putative sterol-sensing domain (SSD). Human sequences for HMG-CoA reductase (residues 65-221 of SEQ ID NO: 4; GenBank accession number 306865; Swissprot accession number P04035) and Patched (amino acids 440 to 601 of SEQ ID NO: 5; GenBank accession number 1381236) were aligned with TRC8 by gapped BLAST. Identical amino acids are indicated by white letters on black, while similar amino acids (positive scores in a PAM250 matrix) are shaded; TM segments within the putative SSD of TRC8 are underlined.

[0030] FIG. 2E illustrates the ring-finger domain. A portion of TRC8 (amino acids 547 to 585 of SEQ ID NO: 2) is shown compared to the RING-H2 consensus motif (SEQ ID NO: 46).

[0031] FIG. 3A is an analysis of TRC8 expression by a Northern blot analysis. Gel resolved polyadenylated RNA (2 μg) from adult human tissues (Clontech Labs, Palo Alto, Calif.) was hybridized under recommended conditions with a 1.5 kb 3 ′ TRC8 cDNA encompassing most of the TM segments and the ring finger (bp 83 to 1623, where bp 1 is the first base of the coding region; this corresponds to bp 321 to 1861 of SEQ ID NO: 1). A second, largely non-overlapping probe (bp 1446 to 2212, where bp 1 is the first base of the coding region; this corresponds to bp 1684 to 2450 of SEQ ID NO: 1) yielded essentially the same pattern. The filter was exposed for 18 hours at −80° C.

[0032] FIG. 3B is an analysis of TRC8 expression by a dot blot analysis. A Clontech human RNA master dot blot was hybridized with the same probe as in (3A) under recommended conditions and exposed for 15 h. Final wash conditions were 0.1×SSC, 0.5% SDS @ 55° C. for 20 min. Signals were collected on a Molecular Dynamics Phosphorimager. Blank positions included B8, F5-F8 and G8. Central nervous system tissues (A1-A8 and B1-B7) included (in order) whole brain, amygdala, caudate nucleus, cerebellum, cerebral cortex, frontal lobe, hippocampus, medulla oblongata, occipital lobe, putamen, substantia nigra, temporal lobe, thalamus, sub-thalamic nucleus and spinal cord. Musculature and digestive tissues (C1-C8) included heart, aorta, skeletal muscle, colon, bladder, uterus, prostate and stomach. Secretory tissues (D1-D8) included testis, ovary, pancreas, pituitary, adrenal, thyroid, salivary and mammary glands. Miscellaneous tissues (E1-E8 and F1-F4) included kidney, liver, small intestine, spleen, thymus, peripheral leukocytes, lymph node, bone marrow, appendix, lung, trachea and placenta. Fetal tissues (G1-G7) included brain, heart, kidney, liver, spleen, thymus and lung. All control spots (yeast and E. coli RNAs, human Cotl and total human DNAs) were blank (not shown).

[0033] FIG. 4A illustrates the localization of 5′ TRC8 sequences to chromosome 8q. Primers R-M (SEQ ID NO: 19) and F-O (SEQ ID NO: 20) (see FIG. 1 for general location of TRC8 to which primers hybridize) amplify an 82 bp fragment specific for the 5′ portion of TRC8. Templates in lanes 1 through 11 included, respectively, AG4103 (normal human), CHO glyA (hamster), UCTP-2A3 (chromosome 3 only hybrid), 706-B6, clone 17 (chromosome 8 only hybrid), TL12-8 [t(3;8) der(3) hybrid], 3;8/4-1 [t(3;8) der(8) hybrid], YAC 880A9 (chromosome 8-specific YAC spanning 3;8 breakpoint), YAC 850A6 (chromosome 3-specific YAC spanning 3;8 breakpoint), HD-7 (genomic phage clone carrying the 3;8 breakpoint region from chromosome 8), 2A7 (longest 5′ RACE clone), water control. Molecular size standards are indicated in base pairs.

[0034] FIG. 4B is a Southern blot in which the same hybrid and YAC DNAs listed in FIG. 4A were digested with EcoRI and then Southern blotted. The filter was hybridized with a 1.4 kb TRC8 cDNA fragment which derives from the 3′ end. The normal human TRC8 fragment is >15 kb which is reduced to ˜12 kb by the translocation (arrow). The cross-hybridizing fragment in hamster DNA (lanes 2-6) is 8 kb.

[0035] FIG. 5A shows an RT-PCR analysis of fusion product expression. RNAs isolated from the t(3;8) lymphoblastoid cell line TL9944 (R. M. Gemmill, et al., Genomics 4, 28 (1989)) and from a control breast carcinoma cell line HTB 121 were treated with or without reverse transcriptase, as indicated (+ or −) and analyzed for expression of FHIT and TRC8 by PCR. Four primers specific for 5′ and 3′ portions of each gene, Fl (SEQ D NO: 18) and RI (SEQ D NO: 11 for FHIT and R-M (SEQ D NO: 19) and EMR (SEQ ID NO: 21) for TRC8 (see FIG. 1 for general section of gene to which primers hybridize), were used in combination to detect both wild-type and putative chimeric transcripts. The FHIT primer pair generated a product of the expected size (231 bp), as did the TRC8 primer pair (651 bp). Reciprocal chimeric products were amplified using R-M (SEQ ID NO: 19) plus R1 (SEQ ID NO: 12) for 5′ TRC8/3′ FHIT, and F1 (SEQ ID NO: 18) plus EMR (SEQ ID NO: 21) for 5′ FHIT/3′ TRC8. Predicted sizes of the chimeric products are 188 and 694 bp, respectively. Lanes 1-16 are in order from left to right.

[0036] FIG. 5B lists the sequences of 3;8 chimeric transcripts. The RT-PCR amplified cDNAs in lanes 11 and 15, corresponding to the reciprocal chimeric transcripts, were purified and sequenced on both strands. Bases surrounding the boundary between FHIT exons 3 and 4 are shown with FHIT sequences italicized (bases 399 to 438 of SEQ ID NO: 10 (5′TRC8/FHIT3′ fusion) and bases 234 to 272 of SEQ ID NO: 11 (5′FHIT/TRC83′ fusion). The precise position of the fusion on both TRC8 and FHIT transcripts is indicated. (For TRC8, the base numbering in FIG. 5B assumes that the first base in the coding region is base number 1. Thus, bp 180 of TRC8 is bp 418 of SEQ ID NO: 1. For FHIT, bp 137 corresponds to bp 253 of SEQ ID NO: 8.)

[0037] FIG. 6A illustrates the detection of a tumor-specific somatic mutation by Single Stranded Conformational Polymorphism Analysis (SSCP) and heteroduplex analysis. DNA samples were PCR amplified using primers flanking the first coding exon of TRC8 (M. Le Beau, et al. Genes Chromosomes Cancer 21, 281 (1998)). The products were denatured, separated on a non-denaturing MDE gel and detected by silver staining. Samples included matched tumor and normal DNAs from patients 1 and 7 (lanes 5-8, respectively) and an unrelated normal control (AG4103, lane 9). A separate SSCP gel was used to isolate four individual SSCP bands from RCC #1 (lane 5, marked by an arrow or arrow heads). The excised bands A to D corresponded to the indicated bands in lane 5 from top to bottom. These last templates were re-amplified and analyzed by SSCP to determine if they contained mutant or wild-type sequences. Comparison to lane 5 suggested that bands A and C contained primarily mutant DNA, band B was a mixture of mutant and wild-type and band D was wild-type only. The top and bottom panels show the SSCP and heteroduplex results, respectively.

[0038] FIG. 6B illustrates that Renal Cell Carcinoma (RCC)#1 contains a 12 bp duplication in the 5′ UTR. Purified PCR products shown in (A) (lanes 1 through 4) were sequenced. The mutation consisted of a 12 bp direct duplication (underlined) at bp position -73 (as numbered when the first base of the coding region is bp 1; this corresponds to bp 165 of SEQ ID NO: 1.) which was present in the tumor sample but not the corresponding normal DNA. The repeat is from bp 165 to 176 of SEQ ID NO: 7.

[0039] FIG. 7 demonstrates that TRC8 is amplified in a sub-set of variant Small Cell Lung Carcinomas (SCLCs). A Southern blot of EcoRI digested tumor cell line DNAs was prepared with nearly identical amounts of DNA (2 Tg) loaded in each lane, as determined by ethidium bromide fluorescence (bottom panel). The cell lines included 8 cervical carcinomas (ME180, SiHa, HeLa, CC19, Caski, MS751, C33A and C41) and 7 small cell lung carcinomas of the variant sub-type (H82, H196, H211, H360, H433, H437 and H524), as indicated. The filter was hybridized sequentially with probes for TRC8 (top panel), a control locus on 3q (MJ 1536, second panel) and a genomic probe (380j9) which derives from within the cMYC locus (third panel). The autoradiogram generated by TRC8 was densitometrically scanned and band intensities were normalized by comparison to the control (lane 1). TRC8 is amplified 6-fold over normal in line H211 (lane 12).

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0040] The present invention is based upon the identification and characterization of several new nucleic acid sequences: (a) the novel gene TRC8, which encodes a novel TRC8 protein, (b) a sequence including bases in the 5′ flanking region to the TRC8 coding region plus exon 1, (c) a nucleotide sequence for a mutated TRC8 which was found in a sporadic renal cell carcinoma, (d) the 5′ TRC8/3′ FHIT fusion and the related 5′ FHIT/3′ TRC8 fusion, which result from a chromosomal translocation event (specifically the t(3;8)(p14.2;q24.1)), this chromosomal translocation being associated with human renal and thyroid tumors in the 3;8 family.

[0041] TRC8 appears to be a critical gene in the 3;8 translocation and appears to be linked with various tumors and cancers based on the following: (i) its similarity to patched, which in turn is responsible for the hereditary basal cell carcinoma syndrome (H. Hahan, et al., Cell 85, 841-851 (1996); R. L. Johnson, et al., Science 272, 1668-1671 (1996)), (ii) the preservation and expression of FHIT coding sequences in 3;8 translocation containing cells (in contrast to the disruption of TRC8 coding sequences), and (iii) its demonstrated mutation in a sporadic renal carcinoma Furthermore, recent work by other researchers has provided cytogenetic evidence for another set of renal tumors that appear to be associated with alterations in TRC8, including a 8q24.1 breakpoint as in the 3;8 translocation described herein. More specifically, analysis of the lymphocytes of a patient suffering from bilateral multifocal renal oncocytomas and cysts showed a constitutional reciprocal t (8;9) (q24.1; q 34.3) Teh, et al. (Genes Chromosomes Cancer 21, 260-264 (1998)). The fact that several different alterations of TRC8 is associated with various tumors and cancers indicates that the detection of alterations in TRC8 has utility in the diagnosis of certain tumors and cancers. The type of alterations could include translocations such as the t(3;8), as well as substitutions, deletions, insertions, inversions, etc.

[0042] One embodiment of the present invention provides an isolated nucleic acid sequence, TRC8 (SEQ ID NO: 1), which encodes the TRC8 protein (SEQ ID NO: 2). As described in further detail below, TRC8 encodes a predicted 664-aa, multitransmembrane protein with similarity to patched from Drosophila melanogaster. This similarity includes the second extracellular domain of patched, which is involved in binding sonic hedgehog, as well as its putative sterol-sensing domain (SSD). In addition, the first 480 amino acids of TRC8 and amino acids 440-1100 of patched share an organization similarity. This similarity begins with the common SSD, followed by the divergent region that is nonconserved among patched homologues (J. Motoyama, et al., Nat. Genet. 18, 104-106 (1998)), and finally by the conserved second extracellular loop. TRC8 lacks the first extracellular loop of patched and likewise shows no similarity after the second extracellular loop. Therefore, although TRC8 has similarity to patched and is predicted to be a plasma membrane protein by PSORT (K. Nakai, and M. Kanehisa, Genomics 14, 897-911 (1992)), it is not the type of direct homologue as is the Patched 2 gene, for instance (J. Motoyama, et al., Nat. Genet. 18, 104-106 (1998)).

[0043] As those skilled in the art will appreciate, a number of different nucleotide sequences can encode for the TRC8 protein because of the degeneracy of the genetic code. Consequently, the present invention contemplates each and every possible variation of the nucleotide sequence that can be made by selecting from the possible codon choices for a given amino acid in the TRC8 protein sequence. One such sequence is the sequence listed as SEQ ID NO: 1. More particularly, the present invention includes an isolated polynucleotide comprising nucleotides 238 to 2229 of SEQ ID NO: 1 (the coding region of the TRC8 gene; the stop codon includes bases 2230 to 2232 of SEQ ID NO: 1). The present invention also includes the production by synthetic chemistry of DNA sequences, or fragments thereof, which encode for the TRC8 protein and the subsequent insertion of such synthetic sequences into any of the number of currently available expression vectors and cell systems which are known to those skilled in the art.

[0044] In another embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (b) a ribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 12 consecutive nucleotides capable of hybridizing to nucleotides 238 to 2229 of SEQ ID NO: 1; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d).

[0045] By inserting the TRC8 nucleic acid sequence (i.e., SEQ ID NO: 1) into an appropriate vector, it is possible to prepare large quantities of the TRC8 sequence using methods which are well-known to those with skill in the art. Alternatively, the TRC8 nucleic acid sequence can be inserted into an expression vector and the vector placed in a host cell to produce the TRC8 protein (i.e. SEQ ID NO: 2). The TRC8 protein can then be isolated from the host cell culture according to standard purification techniques. A number of host/vector systems are available for the amplification of the TRC8 nucleic acid sequence and/or the protein expressed by the TRC8 gene. Such systems include, but are not limited to, plasmid and viral vectors, and eukaryotic and procaryotic hosts.

[0046] The present invention also provides methods for detecting the presence of TRC8 in a biological sample. One method comprises the steps of: (a) selecting a probe from SEQ ID NO: 1 which specifically hybridizes to TRC8; (b) hybridizing the probe with a biological sample; and (c) detecting the presence of a hybridization complex formed by the hybridization of the probe with the TRC8 nucleic acid in the sample, wherein the presence of the complex is indicative of the presence of TRC8 nucleic acid in the biological sample. Another method includes contacting a nucleic acid probe which is at least 12 continuous nucleotides in length and is specific for binding to human TRC8 gene with the biological sample under conditions which allow the nucleic acid probe to anneal to complementary sequences in the sample and then detecting duplex formation between the nucleic acid probe and the complementary sequences. The nucleic acid probe used may be a subsequence of the entire human TRC8 gene.

[0047] In a further embodiment, the present invention provides primers which are specific for TRC8. These primers can be used to amplify TRC8 and thus detect its presence according to PCR methodologies which are well-known in the art. In particular, the present invention provides polynucleotide molecules comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 45, inclusively.

[0048] A method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or fragments thereof is also provided for by the present invention. This method generally comprises: (a) culturing a host cell which includes an expression vector containing an isolated polynucleotide encoding at least a fragment of the TRC8 polypeptide under conditions suitable for the expression of the TRC8 polypeptide and (b) recovering the polypeptide from the host cell culture. The present invention further provides a polypeptide product in a host cell of a DNA according to the method just described.

[0049] An isolated polynucleotide molecule including sequences located in the 5′ flanking region to the coding region of TRC8 (SEQ ID NO: 6) is also provided for by the present invention. More specifically, these sequences include exon 1 and a portion of the coding region of TRC8. The present invention also includes isolated nucleic acid molecules selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to SEQ ID NO: 6; (b) a ribonucleotide sequence complementary to SEQ ID NO: 6; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 12 consecutive nucleotides capable of hybridizing to nucleotides of SEQ ID NO: 6; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d).

[0050] In another aspect, the invention includes an isolated polynucleotide molecule of SEQ ID NO: 7 which occurs in certain sporadic renal cell carcinomas. More specifically, the present invention includes an isolated polynucleotide molecule comprising nucleotides 153-176 of SEQ ID NO: 7. In this regard, the present invention further provides an isolated nucleic acid molecule selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to nucleotides 153-176 of SEQ ID NO: 7; (b) a ribonucleotide sequence complementary to nucleotides 153-176 of SEQ ID NO: 7; and (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b).

[0051] In another aspect, the present invention provides isolated polynucleotide sequences which correspond to the two gene fusions created after the t(3;8)(p14.2;q24.1) translocation event, i.e. the TRC8/FHIT fusion (SEQ ID NO: 10) and the FHIT/TRC8 fusion (SEQ ID NO: 11). As noted above, the TRC8/FHIT fusion refers to the fusion wherein the 5′ region of TRC8 is fused to the 3′ region of FHIT; the term FHIT/TRC8 fusion refers to the fusion wherein the 5′ region of FHIT is fused to the 3′ region of TRC8. For each of these two gene fusions, the present invention also provides an isolated polynucleotide sequence selected from the group consisting of: (a) a deoxyribonucleotide sequence complementary to the gene fusion, (b) a ribonucleotide sequence complementary to the gene fusion; and (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b).

[0052] The present invention provides nucleic acid probes selected from the group consisting of: (a) a deoxyribonucleotide sequence which is a DNA fragment comprising contiguous nucleotides on the 5′ and 3′ sides of the fused site of either TRC8/FHIT fused DNA or FHIT/TRC8 fused DNA, (b) a ribonucleotide sequence complementary to the deoxyribonucleotide sequence of (a), and a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b), wherein the fused site is between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 0 for the TRC8/FHIT fusion and between bases 252 and 253 of SEQ ID NO: 11 for the FHIT/TRC8 fusion.

[0053] In another embodiment, the present invention provides a pair of oligionucleotides which can be used in PCR analysis for example, wherein one of the oligonucleotides specifically hybridizes with the TRC8-FHIT fused DNA comprising the contiguous nucleotide sequence of SEQ ID NO: 10 on the 3′ side of the fused site and the other oligonucleotide specifically hybridizes with the TRC8-FHIT fused DNA on the 5′ side of the fused site, the fused site being located between bases 418 and 419 of SEQ ID NO: 10. Similarly, the present invention also provides a pair of oligonucleotides wherein one of the oligonucleotides specifically hybridizes with the FHIT/TRC8 fused DNA comprising the contiguous nucleotide sequence of SEQ ID NO: 11 on the 3′ side of a fused site and the other oligonucleotide specifically hybridizes with the FHIT/TRC8 fused DNA on the 5′ side of said fused site, said fused site being located between bases 252 and 253 of SEQ ID NO: 11.

[0054] Because alterations of the TRC8 gene have been implicated with several different renal and thyroid carcinomas, the nucleotide sequences described herein can be used as a diagnostic for assessing renal or thyroid tumor formation in humans. In general, such diagnostic methods involve determining whether the TRC8 gene has been rearranged or mutated, a rearranged or mutated TRC8 gene being indicative of a renal or thyroid tumor. The mutations may be of various types including, for example, deletions, substitutions and inversions

[0055] Various methods which are well known to those skilled in the art can be used to identify alterations in TRC8. One method, for example, involves using paired primer sets to amplify DNA samples. Alterations such as mutations can then be identified using single-stranded conformational polymorphism analysis (SSCP). Examples of the types of primers which could be utilized and additional specifics regarding the SSCP methodology is set forth more fully in Example 5 below.

[0056] Although the 3;8 translocation is but one of what appears to be several alterations to TRC8 which is associated with different tumors and cancers, the following methods illustrate how the 3;8 translocation can be detected. It is important to recognize, however, that similar methods could be used to detect other chances to TRC8.

[0057] One example of an assay method which can be utilized to detect the 3;8 translocation and the formation of the TRC8/FHIT and FHIT/TRC8 fusions involves selective amplification of sequences within a sample which contains the TRC8/FHIT and FHIT/TRC8 polynucleotides (SEQ ID NO: 10 and SEQ ID NO: 11, respectively). The present invention also includes methods which identify nucleic acids containing the TRC8/FHIT and FHIT/TRC8 fusions but which do not require sequence amplification for detection. Such methods include Southern and Northern blot hybridization tests and fluorescence in situ hybridization (FISH) of chromosomal material, using probes derived from the nucleic acids of the present invention.

[0058] As noted above, the nucleic acid probes of the present invention can be DNA or RNA probes. Such probes can be prepared according to methods which are known in the art (see for example, Molecular Cloning, (Sambrook, et al., Eds.), Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)). One with skill in the art can employ the techniques such as described in the preceding reference and the sequences described herein, or fragments thereof, as probes.

[0059] The detection methods of the present invention can be utilized with a variety of sample types. A non-exhaustive list of the type of samples that can be used include cells or tissues, extracts of cells or tissues containing protein, membranes, nucleic acids or combinations thereof, and biological fluids such as blood, serum and plasma. Methods for preparing such extracts are known in the art and can readily be adapted by one skilled in the art to obtain a sample which is appropriate for the type of detection test being conducted (see, for example, K. Budelier et al., Chapter 2, “Preparation and Analysis of DNA,” M. E. Greenberg, et al., Chapter 4, “Preparation and Analysis of RNA,” and M. 5 Moos, et al., Chapter 10, “Analysis of Proteins,” in Current Protocols in Molecular Biology, Wiley Press, Boston, Mass. (1993)).

[0060] More specifically, one diagnostic method involves ascertaining whether there is a breakpoint in the TRC8 gene between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 1. For example, the nucleic acid probes described above which span the fused site of the TRC8/FHIT fusion or the FHIT/TRC8 fusion can be used to detect a 3;8 chromosomal translocation by contacting the nucleic acid probe with a biological sample and then determining whether the probe specifically hybridizes to TRC8/FHIT DNA or to FHIT/TRC8 DNA. Of course probes could also be used to probe for complementary DNA or RNA sequences to the two fused sequences. Thus, for example, a method of the present invention may include: (a) contacting one of the nucleic acid probes which span the breakpoint of the TRC8/FHIT gene fusion with a sample and (b) determining whether the probe specifically hybridizes with DNA containing the fused site of TRC8/FHIT but not with TRC8 DNA or FHIT DNA. Similar methods can also be used with probes specific for DNA including the FHIT/TRC8 breakpoint. A second method would directly detect mutations in TRC8.

[0061] The following specific examples further describe the present invention and further illustrate the features and advantages provided by the present invention.

EXAMPLE 1

Identification and Sequence Analysis of TRC8

[0062] (a) Cell Lines and Genomic Clones

[0063] Tumor cell lines were obtained from American Type Culture Collection (Gaithersburg, Md.), except for somatic cell hybrids which were generated by the present inventors previously and reported by H. A. Drabkin, et al. (Cancer Cells 7, 63 (1989)). The hybrids TL12-8 and 3;8/4-1 contain the der (3) and der (8) chromosomes, respectively, from the t(3;8) lymphoblastoid cell line TL9944 (without either a normal 3 or 8 chromosome). The human lymphoblastoid line AG4103 served as a normal control. Isolation of DNA and RNA was performed using standard methods.

[0064] The HD-7 genomic phage clone carrying the 3;8 translocation breakpoint from the der(8) chromosome was isolated from a library prepared from the TL9944 cell line in λ FHXII (Stratagene, Inc., La Jolla, Calif.). A chromosome 3 probe (λ4040) which maps just distal to the 3;8 breakpoint was used for screening (F. L. Boldog, et al., Proc. Natl. Acad. Sci. USA 90, 8509 (1993)).

[0065] (b) 5′ Race

[0066] RNA was isolated from TL9944 lymphoblastoid cells carrying the 3;8 translocation (see, R. M. Gemmill, et al., Genomics. 4, 28 (1989)), and then subjected to RACE (see, M. A. Frohman, PCR. Methods Appl. 4, S40 (1994)). 5′ RACE was performed essentially as described by M. A. Frohman (Methods. Enzymol 218, 340 (1993)). First strand cDNA synthesis used FHIT exon 4-specific primer R1 (5′-TCAGAAGACTGCTACCTCTTCG-3′—SEQ ID NO: 12) followed by dCTP tailing with terminal deoxynucleotidyl transferase. Primary amplification utilized the AAP 5′-RACE primer from a 5′ RACE Kit sold by Gibco-BRL/Life Technologies, together with R2, a nested FHIT exon 4-specific primer (5′-TCAGTGGCAGGATGCACAG-3′—SEQ ID NO: 13). Second round nested PCR utilized primer AUAP (also from the 5′ RACE Kit sold by Gibco-BRL/Life Technologies) with R3, a second nested FHIT exon 4 - specific primer (5′-GGTCTAAGCAGGCAGGTATTC-3′—SEQ ID NO: 15). Products were cloned into a T-vector (pBluescript II K/S) analyzed by hybridization with additional internal FHIT oligonucleotides F4 (5′-TGGAAGGGAGAGAAAGAG-3′—SEQ ID NO: 16) and R4 (5′-GGTATTCCTAGGATAC-3′—SEQ ID NO: 17) and sequenced.

[0067] Because the t(3;8) breakpoint interrupts FHIT between exons 3 and 4, 5′-RACE products were generated using nested primers within FHIT exon 4 as shown in FIG. 1. Cloned amplification products were identified by hybridization with oligonucleotide R4 (SEQ ID NO: 17). Nearly 80% of R4 positive clones were negative for an exon 3 oligonucleotide (F4) suggesting they might represent a gene fusion. Nine of 12 sequenced clones contained an identical novel sequence spliced exactly to the 5′ end of FHIT exon 4. Mapping studies confirmed that the new sequences were derived from chromosome 8 (see below). As noted earlier, the present inventors refer to this gene as TRC8 for Translocation in Renal Cancer from chromosome 8.

[0068] (c) DNA Sequence Analysis

[0069] The coding region of TRC8 was determined from multiple cDNA clones and PCR products isolated from a human fetal brain library (Stratagene, Inc.) as well as IMAGE clone 331H8 identified from dbEST. Sequencing was performed on an AB1377 through the Colorado Cancer Center DNA Sequencing Core. Analysis for transmembrane segments was performed using five prediction programs, including PHD_htm at EMBL (http://www.emblheidelberg.de/predictprotein/), TMpred at ISREC (http://ulrec3.unil.ch/software/ TMPRED_form.html), SOSUI at Tokyo University (http://www.tuat.ac.jp/˜mitaku/adv_sosui/), DAS at Stockholm University (http://www.biokemi.su.se/˜server/DAS/), and PSORT at Osaka University (http://psort.nibb.ac.jp/). All ten transmembrane segments that are underlined in FIG. 2B were predicted by at least four out of the five programs, although in most cases the programs did not agree on the precise boundaries of the segment.

[0070] The DNA sequence (SEQ ID NO: 1; Genbank AF064801) contains a predicted 1992 bp open reading frame (bases 238 to 2229 of SEQ ID NO: 1, or bases 1 to 1992 if the first base in the coding region is considered the first base) as shown in FIG. 2A. Upstream cDNA as well as corresponding genomic sequences are GC-rich indicative of a CpG-island. Using a promoter prediction program (http://www-hgc.lbI .gov/projects/promoter.html), four transcriptional start sites are located at −622, −55, −36 and −22 bp of the first methionine (the numbering in this instance assumes that the first bp of the coding region is base number 1; this corresponds to bp 238 of SEQ ID NO: 1). The −22 site corresponded precisely to two of the nine sequenced RACE products. Use of the −622 site is suggested by the longest presently available cDNA which extends to position −286 and RT-PCR experiments have confirmed transcription to at least position −547.

[0071] The ORF is predicted to encode a 664 amino acid protein (SEQ ID NO: 2) of 76 kDa (see FIGS. 2A and 2B) with at least ten membrane spanning segments. TRC8 contains two regions of similarity with the gene patched from Drosophila (the amino and sequence encoded by patched is listed as SEQ ID NO: 3), the receptor for Sonic Hedgehog (SHH) (V. Marigo, et al., Nature 384, 176 (1996); and D. M. Stone, et al., Nature 384, 129 (1996)). The region from amino acids 344 to 443 of TRC8 (SEQ ID NO: 2) shows the strongest match with 60% similarity and 23% identity to amino acids 883-979 of patched (residues 883 to 979 of SEQ ID NO: 3) (See FIG. 2C); this region of patched represents most of the second predicted extracellular domain involved in the binding of SHH. A second region of patched similarity involves amino acids 22 to 179 of SEQ ID NO: 2 and encodes a putative sterol sensing domain (SSD). Such domains, identified in HMG-CoA reductase and the sterol regulatory element binding protein (SREBP) cleavage activating protein (SCAP), consist of five membrane spanning segments arranged with a specific spacing pattern (X. Hua, et al., Cell 87, 415 (1996)). Patched contains a putative SSD, of unknown function, from amino acids 440 to 601 of SEQ ID NO: 3 (E. D. Carstea, et al., Sci. 277, 228 (1997)). This region is 53% similar/17% identical to the SSD of HMG-CoA reductase (amino acids 65 to 221 of SEQ ID NO: 4), as reported by D. J. Chin, et al. (Nature 308, 613 (1984)); the corresponding region from TRC8 (amino acids 22 to 179 of SEQ ID No: 2) shows 63% similarity/17% identity (See FIG. 2D). Not wishing to be bound by any particular theory, the present inventors surmise, based upon the multiple transmembrane segments and regions of patched similarity, that TRC8 encodes a membrane bound receptor.

[0072] In addition, a perfect match with a ring-finger motif of the RING-H2 sub-type (SEQ ID NO: 46) (P. S. Freemont, Ann. N. YA cad. Sci. 684, 174 (1993)) was found in TRC8 between amino acids 547 to 585 of SEQ ID NO: 2 as shown in FIG. 2E. The RING-H2 motif in TRC8 differs from the standard RING-finger by replacement of the fourth cysteine with a histidine. Functionally, RING-H2 motifs have been suggested to be protein-protein or protein-lipid interaction domains. That TRC8 is highly conserved, at least among mammals, is evident from two murine ESTs (dbEST clones mu78h12 and v143c01) found to be 93% and 89% identical at the nucleotide level over 971 bp.

EXAMPLE 2

Expression of TRC8

[0073] Hybridization of TRC8 to a Northern blot (CLONETECH) prepared from adult human tissues and placenta identified a message of approximately 3.0 kb (FIG. 3A). Although the longest cDNA clones total 2.5 kb, use of the −622 promoter (numbered as though the first base of the coding region is bp 1, i.e., base 238 of SEQ ID NO: 1), as discussed above, would result in a 2.9-kb message, close to the observed size. Although expression in the lung and kidney appeared reduced, hybridization with a control glyceraldehyde-3-phosphate dehydrogenase probe (data not shown) indicated that there was less RNA present in these samples. A human RNA dot blot revealed TRC8 message in all tissues examined (as shown in FIG. 3B), with the highest levels in testis (D1) and placenta (F4) and adrenal (D5); the lowest level was in thymus (G6). TRC8 is expressed in both fetal (G3) and adult kidney (E1) and in adult thyroid (D6), the suspected target organs for TRC8 aberrations in the 3;8 translocation family.

EXAMPLE3

Mapping of TRC8

[0074] TRC8 sequences were localized to the immediate region of the breakpoint on chromosome 8 by both PCR and Southern blot analysis of hybrids, “YACs” (yeast artificial chromosomes) and phage clones (See FIG. 4). PCR mapping used TRC8 specific primers R-M (5′-GCCCTGCCTTTACATCATCGAC-3′—SEQ ID NO: 19) and F-O (5′-AGATCTGGAGCACGATGCAGAAC-3′—SEQ ID NO: 20) which lie within a GC rich segment. PCR reactions were performed under touch-down annealing conditions with Perkin-Elmer Buffer II and Promega AmpliTaq DNA polymerase. Touch-down annealing temperatures started at 70° C. and ended at 60° C. (ΔT of −0.5° C. per cycle) for 20 cycles, followed by 15 cycles at 60° C. Products generated from 10 to 40 ng of template were separated on a 2.0% agarose gel. cDNA synthesis utilized random hexamer primers along with Superscript II (Life Technologies Inc., Gaithersburg, Md.). Subsequent PCR reactions were performed as above, except touch-down annealing temperatures were adjusted to 65° C.-55° C. The EMR primer, specific for the 3′ portion of TRC8 was 5′-TCTTGTTAGCCAAAAGACTCG-3′ (SEQ ID NO: 21), whereas the F1 primer specific for FHIT exon 1 was 5′-TCCCTCTGCCTTTCATTCC-3′ (SEQ ID NO: 18).

[0075] Primers derived from the 5′ coding portion of TRC8 yielded the expected product in the chromosome 8 only hybrid (lane 4) but not in a chromosome 3 only hybrid (lane 3). The same product was also present on the der(8), but not the der(3) chromosome from the 3;8 translocation (lanes 6 and 5, respectively). Similarly, the 8q24 YAC 880A9 (lane 7) was positive, as was a lambda clone, HD7 (lane 9), which contained both chromosome 8 and 3 material from the breakpoint junction. As noted above, the HD-7 genomic phage clone carrying the 3;8 translocation breakpoint (in particular, the breakpoint region from the der(8) chromosome) was isolated from a library prepared from the TL9944 cell line in λFHXII (Stratagene, Inc., La Jolla, Calif.). A chromosome 3 probe (λ4040) which maps just distal to the 3;8 breakpoint was used for screening. Thus, the 5′ coding region of TRC8 is proximal to the 8q24 breakpoint.

[0076] Southern blot analysis (See FIG. 4B) was used to demonstrate that the remaining 3′ portion was contained on the der(3) chromosome (lane 5). Importantly, the probe hybridized to an altered band (arrow) in the der(3) hybrid consistent with the t(3;8) rearrangement. Together, these data indicate that TRC8 is localized to 8q24, is interrupted by the 3; 8 translocation and that its 5′ to 3′ orientation is centromere to telomere (FIG. 1).

EXAMPLE 4

Expression of Both Reciprocal Products in

(3;8) Lymphoblastoid Cells

[0077] To determine if both reciprocal products were expressed, RT(reverse transcriptase)-PCR analysis was performed on RNA isolated from TL9944 lymphoblastoid cells carrying the 3;8 translocation. Primers which flanked the breakpoint and were specific for the 5′ and 3′ portions of either TRC8 or FHIT (see FIG. 1) were used to demonstrate expression of both wild-type and fusion transcripts in TL9944 cells. As can be seen in FIG. 5, primers specific for wild-type FHIT and TRC8 generated bands of the expected size from both t(3;8) and control RNAs (lanes 1, 3, 5 and 7). In contrast, the primer pair R-M (5′-TRC8; SEQ ID NO: 19) plus RI (3′-FHIT; SEQ ID NO: 12) produced a product only from the translocation cell line (lane 11) as did the primer pair F1 (5′-FHIT; SEQ ID NO: 18) plus EMR (3′-TRC8; SEQ ID NO: 21), lane 15. No products were observed in the absence of reverse transcriptase (even lanes). Sequence analysis (FIG. 5B) confirmed that the product from the der(8), 5′-TRC8/3′-FHIT, contained TRC8 sequences fused to FHIT exon 4. Similarly, the reciprocal product, 5′-FHIT/3′-TRC8, consisted of FHIT exon 3 fused to 3′ TRC8 sequences. Thus, while FHIT is interrupted in its 5′ untranslated region, its coding sequences are contained in the der(8) product. In contrast, TRC8 is interrupted within its coding sequence and, more specifically, within the predicted sterol sensing domain. Of note, a mutation in the sterol-sensing domain of SCAP enhances its activity and renders the molecule non-responsive to regulation by sterols (X. Hua, et al., Cell 87, 415 (1996)).

EXAMPLE 5

Identification of Tumor-Specific Mutation in TRC8

in Sporadic Renal Cell Carcinomas

[0078] Single-stranded conformational polymorphism (SSCP) was performed using twelve primer pairs covering the coding sequence and the 5′ untranslated region in 32 renal carcinomas. The SSCP analysis was performed by the method of Spritz et al. (R. A. Spritz, et al., Am. J Hum. Genet. 51 1058-1065 (1992)). Nine primer sets (sets 1-9) were designed to amplify the entire coding region in segments averaging 325 bp and that also would span any intron-exon boundaries (see Table 1). In addition, three primer sets (Set P1-P3) were designed to amplify the 5′ untranslated region (see Table 1).

TABLE I
PRIMER	PRIMER
SET	NAME	SEQUENCE	SEQ ID NO:
Primers Specific for TRC8 Coding Region
Set 1	Set IF	AGTTGCCCGCCTTAGCC	SEQ ID NO:22
Set 1	Set 1R	CCAAAGACACATACTCGACCC	SEQ ID NO:23
Set 2	Set 2F	CATAACTCTTAGTGGGGAAACATTC	SEQ ID NO:24
Set 2	Set 2R	TGTAACGTATCCAATTCCAAATG	SEQ ID NO:25
Set 3	Set 3F	TGGCACTTATCGTTCTACAGC	SEQ ID NO:26
Set 3	Set 3R	TCTTGTTAGCCAAAAGACTCG	SEQ ID NO:27
Set 4	Set 4F	AGTGTTTGTCCTGGCAGTG	SEQ ID NO:28
Set 4	Set 4R	ACAGTTAGTGTAGAATCGCACCC	SEQ ID NO:29
Set 5	Set 5F	TGGCAAATGAAACTGATTCC	SEQ ID NO:30
Set 5	Set 5R	CATGGATAAAATGCAGGACTG	SEQ ID NO:31
Set 6	Set 6F	AAGACCAGAAGAGAGACTTATTCG	SEQ ID NO:32
Set 6	Set 6R	TGCTGTAACTGCAAACAACC	SEQ ID NO:33
Set 7	Set 7F	TCTTTGGCATCACTATGCAC	SEQ ID NO:34
Set 7	Set 7R	CTTCACAGCAGTCCTACGATTC	SEQ ID NO:35
Set 8	Set 8F	CCAAAAATGGCTGGAAGAC	SEQ ID NO:36
Set 8	Set 8R	TGTCAGATTCAGCAGCAGC	SEQ ID NO:37
Set 9	Set 9F	CCACCCAATGAAACTCCAG	SEQ ID NO:38
Set 9	Set 9R	AGTAGCACATCACAGTAAACGG	SEQ ID NO:39
Primers specific for 5′ Untranslated Region of TRC8:
Set P1	Set P1F	TCCCAGGCAGCTCTGAAC	SEQ ID NO:40
Set P1	Set P1R	ACCATCTTGACCTCGCCC	SEQ ID NO:41
Set P2	Set P2F	GTTCGCTTGACTGACGGC	SEQ ID NO:42
Set P2	Set P2R	ATGAGCCGCTGCCACAC	SEQ ID NO:43
Set P3	Set P3F	CACCGAAACCCAGAGACC	SEQ ID NO:44
Set P3	Set P3R	CCAAAGACACATACTCGACCC	SEQ ID NO:45

[0079] These primers were used to amplify genomic DNA (10 ng) under touch-down conditions. Touch-down annealing temperatures started at 65° C. and ended at 55° C. (-T of −0.5° C. per cycle) for 20 cycles, followed by 15 cycles at 55° C. Because of the high GC content of the template, the PCR reactions contained 2.5 M betaine (W. Henke, et al., Nucleic Acids Res. 25, 3957 (1997)). Reaction products were mixed 50:50 with denaturing dyes (95% formamide, 10 mM NaOH, 20 mM EDTA, 0.02% bromophenol blue and 0.02% xylene cyanole) and heated to 95° C. for 5 min irnmediately before loading. Samples were separated at 8 W for 16 hr on 0.5×MDE (FMC) gels containing 0.6×Tris-borate buffer and 10% glycerol. Bands were visualized by silver staining.

[0080] A duplication of 12 nucleotides in the 5′ UTR was identified in Renal Cell Carcinoma (RCC) #1 (see FIG. 6A, lane 5) which was absent in matched normal DNA and thus tumor-specific. This mutation was verified by multiple separate PCR amplifications, SSCP analyses and sequencing, as well as by the use of an alternative primer set, thus eliminating the possibility of a PCR artifact. In the RCC #1 sample, very little of the wild-type heteroduplex product can be seen. This rearrangement resulted in an insertion of 12 bp in the tumor DNA (see FIG. 6B; bases 165 to 176 of SEQ ID NO: 7), which was not present in the corresponding normal DNA of that patient. This insertion occurs in a consistently predicted stem-loop structure in the 5′ untranslated region (the RNA stem loop structure was predicted by the GCG program MFOLD in both energetically optimal and suboptimal folds). The consequence of this insertion conceivably affects either transcription or translation. Although the frequency of TRC8 mutations in spontaneous tumors appears low, it is possible this finding is reminiscent of -the mutation frequencies observed in BRCA1 and BRCA2 (P. A. Futreal, et al., Science 266, 120-122 (1994); J. M. Lancaster, et al., Nat. Genet. 13, 238-240 (1996)).

[0081] Although this example is described in relation to one specific mutation, it should be appreciated that the general approach set forth could be used to identify other mutations (including, for example, other insertions, or deletions, inversions and the like).

EXAMPLE 6

Amplification of TRC8 in a Sub-set of

Variant Small Cell Lung Carcinomas

[0082] Using Southern blot techniques, it was also shown that TRC8 underwent a significant (6-fold) amplification in 1 of the 7 variant small-cell lung carcinoma cell lines which were tested (see FIG. 7). From available YAC contig data (http://www-genome.wi.mit.edu), it was observed that 3 intervening YACs are required to link TRC8 (880A9) and cMYC (934E1), thus the distance separating these genes must be on the order of 2-3 Mb. To determine if the copy number increase resulted from coamplification of cMYC, the same blot was re-hybridized with the 380j9 probe from this locus (26). While cMYC was amplified in two variant SCLC lines (H82 and H524, lanes 10 and 16, respectively), it was only slightly increased in H211 (lane 12). These results indicate that TRC8 may be amplified independently of MYC and suggest that TRC8 gain of function may be important for tumorigenesis.

EXAMPLE 7

Synthesis of TRC8 Protein

[0083] The TRC8 protein was synthesized using the Promega in vitro transcription/translation (TNT) kit. On ice, 25 ul of the TNT rabbit reticulocyte lysate were mixed with 2 ul of TNT reaction buffer, 1 ul of RNA polymerase (T3 for sense; T7 for control antisense), 1 ul of the amino acid mixture, 2 ul of 35S-methionine (1000 Ci/mMole), 1 ul of RNasin RNAase inhibitor (40 U/ul), 2 ul of the TRC8 cloned template (p45-1) and water to 50 ul total volume. Reactions were placed at 30° C. for 90 minutes. The reaction products were mixed 50:50 with laemmli SDS sample buffer and resolved on 7.0% SDS-polyacrylamide gels. It is critical to NOT heat denature the TRC8 protein as this leads to irreversible aggregation and failure of gel resolution methods. The gels were fixed in 10% acetic acid (30 min), neutralized with 0.1 M NaOH for 10 min, impregnated with 1 M Na-salicylate and dried. Dried gels were exposed to Kodak X-omat AR film without screens for 2 h to overnight.

EXAMPLE8

Diagnostic Applications

[0084] As noted above, evidence that various translocation events and mutations involving TRC8 appear to be associated with different tumors and cancers make the detection of alterations to TRC8 a potentially useful diagnostic tool. Diagnostic methods for identifying alterations could involve several different approaches including, for example, direct mutation detection using TRC8 specific primers (for instance, those set forth as SEQ ID NO: 19-45, inclusively). The SSCP methodology described in Example 5 is also a useful approach.

[0085] Since the present invention is described with specific reference to the 3;8 translocation, methods for detecting their translocation event are described below with regards to this particular translocation. It should be appreciated, however, that these approaches have more general utility in detecting alterations to TRC8.

[0086] Thus, for example, the TRC8FHIT and reciprocal FHIT/TRC8 fusions of the present invention can be used to determine the presence or absence of chromosomal translocations within cells suspected of being tumorous, especially within renal and thyroid cells Thus, the present invention can use PCR and DNA probes such as described above or YACs, cosmids and plasmids harboring the fused site to identify t(3;8) in renal and thyroid cells. PCR has several advantages as a tool for identifying t(3;8). PCR is rapid, sensitive and less affected by the quality of the samples as compared to chromosome methods such as FISH and karyotyping.

[0087] YACs and cosmids, however, can also be used as alternative diagnostic tools and have certain advantages as well. The YACs or cosmids can be quite specific since they preferably contain the fused site associated with the translocation. They may also yield a positive result in rare cases where PCR gives a negative result given that the YACs and cosmids contain a large region of the chromosome. Plasmids containing the DNA from the fused site can be used as probes to detect the translocation by various hybridization methods, such as Southern blots for example.

[0088] PCR analysis of the translocation involves standard methods. RNA is isolated from cells according to standard protocols. cDNA is formed from the RNA template using reverse transcriptase. Using the cDNA and primers specific for the t(3;8) such as described above, PCR is used to amplify the desired sequence. For example, a set of primers in which one primer binds at a point 5′ to the breakpoint and the second primer binds 3′ to the breakpoint could be used to amplify the intervening sequence. The PCR products formed are separated by agarose gel electrophoresis and visualized by well-known methods such as UV illumination after ethidium bromide staining.

[0089] FISH can also be performed according to methods known to those skilled in the art. Typically, YACs or cosmid DNA can be labeled with biotin. Metaphase chromosomes can be prepared from desired cells. The biotin-labeled probes are then allowed to hybridize with the chromosomes in the sample. The location of the hybridized areas can be detected using avidin with fluorescence tags and appropriate antibodies.

[0090] Southern blot hybridization can be performed by first isolating DNA from a patient's cells. The DNA is then digested with restriction endonucleases, the DNA fragments separated by gel electrophoresis and the fragments then transferred to nylon membranes. Various radio-labeled probes such as plasmids which contain the fused site can then be used to hybridize to DNA containing the breakpoint. Hybridization of the probe to DNA within the sample is typically done by autoradiography.

[0091] All the references listed herein, including, but not limited to patents and publications, are hereby incorporated by reference in their entirety.

Claims

1. An isolated nucleic acid molecule encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 2.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 1.

3. The nucleic acid molecule of claim 1, wherein said nucleic acid-molecule comprises nucleotides 238 to 2229 of SEQ ID NO: 1.

4. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) a deoxyribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (b) a ribonucleotide sequence complementary to nucleotides 238 to 2229 of SEQ ID NO: 1; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 12 consecutive nucleotides capable of hybridizing to nucleotides 238 to 2229 of SEQ ID NO: 1; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d).

5. A vector containing the nucleic acid molecule of claim 1.

6. A host cell containing the vector of claim 5.

7. A method for detecting the presence of TRC8 gene in a biological sample, comprising: (a) contacting a nucleic acid probe which is at least 12 continuous nucleotides in length and is specific for binding to human TRC8 gene with said sample under conditions which allow said nucleic acid probe to anneal to complementary sequences in said sample; and (b) detecting duplex formation between said nucleic acid probe and said complementary sequences.

8. A method according to claim 7, wherein said nucleic acid probe used in said contacting step is a subsequence of the entire human TRC8 gene.

9. An isolated DNA molecule comprising a nucleotide sequence selected from the group of SEQ ID NO: 19 to SEQ ID NO: 45, inclusively.

10. A method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or fragments thereof, said method comprising the steps of: (a) culturing said host cell of claim 6 under conditions suitable for the expression of the polypeptide; and (b) recovering the polypeptide from the host cell culture.

11. A polypeptide product of the expression in a host cell of a DNA according to the method of claim 10.

12. An isolated nucleic acid molecule of SEQ ID NO: 6.

13. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) a deoxyribonucleotide sequence complementary to SEQ ID NO: 6; (b) a ribonucleotide sequence complementary to SEQ ID NO: 6; (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b); (d) a nucleotide sequence of at least 12 consecutive nucleotides capable of hybridizing to nucleotides of SEQ ID NO: 6; and (e) a nucleotide sequence capable of hybridizing to a nucleotide sequence of (d).

14. An isolated nucleic acid molecule of SEQ ID NO: 7.

15. The nucleic acid molecule of claim 14, wherein said nucleic acid molecule comprises nucleotides 153 to 176 of SEQ ID NO: 7.

16. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) a deoxyribonucleotide sequence complementary to nucleotides 153 to 176 of SEQ ID NO: 7; (b) a ribonucleotide sequence complementary to nucleotides 153 to 176 of SEQ ID NO: 7; and (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b).

17. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) a deoxyribonucleotide sequence of SEQ ID NO: 10; (b) a deoxyribonucleotide sequence complementary to the deoxyribonucleotide sequence of (a); (c) a ribonucleotide sequence complementary to the deoxyribonucleotide sequence of (a); and (d) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (b) or to the ribonucleotide sequence of (c).

18. A nucleic acid probe selected from the group consisting of (a) a deoxyribonucleotide sequence which is a DNA fragment comprising contiguous nucleotides on the 5′ and 3′ sides of the fused site of TRC8FHIT fused DNA which has the nucleotide sequence of SEQ ID NO: 10 (b) a ribonucleotide sequence complementary to said deoxyribonucleotide sequence of (a); and (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b), wherein the fused site is between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 10.

19. A nucleic acid probe according to claim 18, wherein said probe is a DNA fragment comprising contiguous nucleotides on the 5′ and 3′ sides of the fused site of TRC8/FHIT fused DNA, the fused site being the site between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 10, wherein said DNA fragment specifically hybridizes with the nucleotide sequence of SEQ ID NO: 10 but does not specifically hybridize with TRC8 DNA or FHIT DNA.

20. A pair of oligonucleotides wherein one of the oligonucleotides specifically hybridizes with the TRC8/FHIT fused DNA comprising the contiguous nucleotide sequence of SEQ ID NO: 10 on the 3′ side of a fused site and the other oligonucleotide specifically hybridizes with the TRC8/FHIT fused DNA on the 5′ side of said fused site, said fused site being located between bases 418 and 419 of SEQ ID NO: 10.

21. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) a deoxyribonucleotide sequence of SEQ ID NO: 11; (b) a deoxyribonucleotide sequence complementary to the deoxyribonucleotide sequence of (a); (c) a ribonucleotide sequence complementary to the deoxyribonucleotide sequence of (a); and (d) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (b) or to the ribonucleotide sequence of (c).

22. A nucleic acid probe selected from the group consisting of (a) a deoxyribonucleotide sequence which is a DNA fragment comprising contiguous nucleotides on the 5′ and 3′ sides of the fused site of FHIT/TRC8 fused DNA which has the nucleotide sequence of SEQ ID NO: 11; (b) a ribonucleotide sequence complementary to said deoxyribonucleotide sequence of (a); and (c) a nucleotide sequence complementary to the deoxyribonucleotide sequence of (a) or to the ribonucleotide sequence of (b), wherein the fused site is between bases 252 and 253 of the nucleotide sequence of SEQ ID NO: 11.

23. A nucleic acid probe according to claim 22, wherein said probe is a DNA fragment comprising contiguous nucleotides on the 5′ and 3′ sides of the fused site of FHIT/TRC8 fused DNA, said fused site being the site between bases 252 and 253 of the nucleotide sequence of SEQ ID NO: 11, wherein said DNA fragment specifically hybridizes with the nucleotide sequence of SEQ ID NO: 11, but does not specifically hybridize with TRC8 DNA or FHIT DNA.

24. A pair of oligonucleotides wherein one of the oligonucleotides specifically hybridizes with the FHIT/TRC8 fused DNA comprising the contiguous nucleotide sequence of SEQ ID NO: 11 on the 3′ side of a fused site and the other oligonucleotide specifically hybridizes with the FHIT/TRC8 fused DNA on the 5′ side of said fused site, said fused site being located between bases 252 and 253 of SEQ ID NO: 11.

25. A method of diagnosing or assessing renal or thyroid tumor formation in humans, comprising determining whether a TRC8 gene has been rearranged or mutated, a rearranged or mutated TRC8 gene indicating a renal or thyroid tumor.

26. A method according to claim 25, wherein said determining step involves ascertaining whether there is a breakpoint in the TRC8 gene between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 1.

27. A method for detecting alterations to human TRC8, comprising: (a) amplifying the DNA in a human DNA sample to form amplification products; and (b) screening said amplification products to detect an alteration of TRC8.

28. A method according to claim 27, wherein said amplifying step involves utilization of a primer having a sequence selected from the group of SEQ ID NO: 19-45, inclusively.

29. A method according to claim 27, wherein said screening step includes performing single-stranded conformational polymorphism analysis.

30. A method for detecting a 3;8 human chromosomal translocation, comprising: (a) contacting a nucleic acid probe of claim 18 with a biological sample to be tested; (b) determining whether said nucleic acid probe specifically hybridizes to a nucleic acid molecule of claim 17.

31. A method for detecting a 3;8 human chromosomal translocation, comprising: (a) contacting a nucleic acid probe of claim 22 with a biological sample to be tested; (b) determining whether said nucleic acid probe specifically hybridizes to a nucleic acid molecule of claim 21.

32. A method for detecting fused DNA containing the fused site of TRC8/FHIT fused DNA, said fused site being the site between bases 418 and 419 of the nucleotide sequence of SEQ ID NO: 10, comprising the steps of: (a) contacting said probe of claim 18 with a sample to be tested; and (b) determining whether said probe specifically hybridizes with said fused DNA in said sample but not with TRC8 DNA or FHIT DNA.

33. A method for detecting fused DNA containing the fused site of FHIT/TRC8 fused DNA, said fused site being the site between bases 252 and 253 of the nucleotide sequence of SEQ ID NO: 11, comprising the steps of: (a) contacting said probe of claim 22 with a sample to be tested; and (b) determining whether said probe specifically hybridizes with said fused DNA in said sample but not with TRC8 DNA or FHIT DNA.