Patent Application
20130261066
The present invention provides methods and compositions for treating inflammatory bowel diseases, including ulcerative colitis and Crohn's disease.
Inflammatory Bowel Diseases (IBDs) are common and increasing in prevalence. IBDs are a set of complex, life-long and for many patients devastating diseases, the etiologies of which are not completely understood, and for which there are no satisfactory treatments. The two major, clinically distinct forms of IBD are ulcerative colitis (UC) and Crohn's disease, which differ in the location and nature of the associated inflammation. Ulcerative colitis is characterized by ulcerations limited to the large intestine, colon and rectum. Crohn's disease commonly affects the terminal ileum of the small intestine and parts of the large intestine. Less common forms of inflammatory colitis include collagenous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, Behçet's syndrome, and indeterminate colitis.
Inflammatory bowel disease is also a substantial risk condition for colorectal cancer (CRC). The risk of CRC is primarily related to chronic inflammation and increases with the duration and extent of the inflammation. Further, earlier onset of symptoms is correlated with increased risk of malignancy and drugs that reduce inflammation are associated with reduced risk of CRC.
Treatment of IBD has been based on anti-inflammatory medications, with steroids having been the mainstay of treatment for years. The primary limitations of these treatments are variable efficacy and their side effects which, in the case of steroids, can limit dosing or duration of treatment or can force physicians to altogether discontinue them. Newer biological agents have also similar limitations, as well as high cost. It is clear that there is a pressing need for new agents for the control of the clinical manifestations of IBD.
The invention provides annexin-1 peptides and conjugates of such peptides, including tripeptides, based on the structure of annexin A1 (“ANXA1”). The peptides suppress NF-κB activation and block inflammation associated with an inflammatory bowel disease. The invention further provides annexin A1-based peptides that are modified for increased efficacy. In certain embodiments, the peptides are conjugated for increased lipophilicity, increased drug availability in the blood, and/or increased stability against enzyme degradation. In an embodiment of the invention, an annexin-1 peptide is conjugated to a saturated or unsaturated fatty acid, including but not limited to stearic acid, oleic acid, linoleic acid, and other oleochemicals such as fatty acid methyl esters, fatty alcohols, fatty amines and glycerols, and intermediate chemical substances produced from oleochemicals, including alcohol ethoxylates, alcohol sulfates, alcohol ether sulfates, quaternary ammonium salts, monoacylglycerols, diacylglycerols, structured triacylglycerols and sugar esters. In an embodiment of the invention, the annexin-1 peptide is conjugated to stearic acid. In an embodiment of the invention, the annexin-1 peptide is acetylated. According to the invention, an annexin-1 peptide contains the amino acid sequence Gln-Ala-Trp. The size of the peptide is from 3 to about 50 amino acids. More preferably, the peptide is from 3 to about 20 amino acids or from 3 to about 10 amino acids. In one embodiment, the peptide is a tripeptide. The invention further provides pharmaceutical compositions of such peptides.
The effectiveness of annexin-1 peptides in preventing or reversing ulcerative colitis and Crohn's disease is demonstrated herein using the dextran sodium sulfate (DSS) and TNBS mouse models. The peptides reverse, in a dose-dependent manner, the inflammatory reaction of the colon and prevent the development of ulcerations. Further, no apparent side effects have been observed from the administration of annexin-1 tripeptides to mice.
Thus, the invention also provides a method of blocking inflammation associated with an inflammatory bowel disease (IBD). In one embodiment, the IBD is ulcerative colitis. In another embodiment, the IBD is Crohn's disease. In another embodiment, the IBD is collagenous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, Behçet's syndrome, or indeterminate colitis.
The invention provides a method of treating or reducing an inflammatory bowel disease in a mammal in need thereof, which comprises administering to the mammal a therapeutically effective amount of an annexin-1 peptide or conjugate. The invention also provides a method of treating or reducing ulcerative colitis in a mammal in need thereof, which comprises administering to the mammal a therapeutically effective amount of an annexin-1 peptide or conjugate. The invention further provides a method of treating or reducing Crohn's disease in a mammal in need thereof, which comprises administering to the mammal a therapeutically effective amount of an annexin-1 peptide or conjugate. There are several animal models of ulcerative colitis and Crohn's disease. The invention applies to all such animal models. In an embodiment of the invention, an annexin-1 peptide is conjugated to a moiety that increases lipophilicity of the conjugate. In one such embodiment, the annexin-1 peptide is conjugated to a fatty acid, such as, but not limited to stearic acid, oleic acid, or linoleic acid. In an embodiment of the invention, the mammal is a human.
A key regulator of inflammation is NF-κB, a transcription factor that is normally sequestered in the cytoplasm. When activated, it translocates into the nucleus where it regulates the expression of a multitude of genes related to inflammation. The invention provides peptides which have potent anti-inflammatory properties. Using two models of colitis, the peptides of the invention are shown to inhibit or reverse inflammation associated with IBDs.
In an embodiment of the invention, the annexin-1 peptide is a fragment of annexin A1 and contains the amino acid sequence Gln-Ala-Trp (SEQ ID NO:1). Various sizes of annexin-1 fragments can be used according to the invention. The size of the peptide can be from 3 to about 50 amino acids, or from 3 to about 20 amino acids, or from 3 to about 10 amino acids. In an embodiment of the invention, the annexin-1 peptide is a tripeptide. The following are non-limiting examples of the invention: Ac-Gln-Ala-Trp (SEQ ID NO:2), Ac-Phe-Gln-Ala-Trp (SEQ ID NO:4), Ac-Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:6), Gln-Ala-Trp (SEQ ID NO:1), Phe-Gln-Ala-Trp (SEQ ID NO:3), Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:5), Ac-Ala-Met-Val-Ser-Glu-Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:8), Ala-Met-Val-Ser-Glu-Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:7), or other fragments of annexin A1, that inhibit NF-κB activity.
With respect to fragments of annexin A1, one skilled in the art would understand that useful annexin-1 peptides include fragments of annexin A1 consisting of or containing the amino acid sequence Gln-Ala-Trp (SEQ ID NO:1), as well as peptides that contain the amino acid sequence Gln-Ala-Trp (SEQ ID NO:1), but otherwise vary in sequence relative to annexin A1. For example, as in certain of the peptides above, sequence variation, such as substitutions, insertions, or deletions, can be introduced at positions other than the Gln-Ala-Trp sequence. Such homologous fragments have sufficient sequence similarity with annexin A1 so as to have similar effects on a cell, and consequently on inflammation, as annexin A1. With respect to variants, one skilled in the art would appreciate that conservative mutations would more likely preserve the ability of the annexin A1 fragment or homolog to reduce inflammation and/or inhibit NF-κB activity. One assessment of NF-κB inhibitory activity is the ability of the variant or homologue to associate with the NF-κB dimer, thus limiting its ability to bind to the KB binding site on DNA. For example, nucleotide substitutions leading to amino acid substitutions at “non-essential” amino acid residues can be made in the sequence. A “non-essential” amino acid residue is a residue that can be altered from the wild-type sequence of annexin A1 in an annexin-1 peptide without significantly altering the biological activity, whereas an “essential” amino acid residue is required for biological activity.
As indicated, the peptides may be unmodified or modified, for example, acetylated at the N-terminus. In certain embodiments, the peptides are modified by conjugation to moieties which increase lipophilicity. Such conjugates are particularly suited for use in the GI tract. Examples of such moieties include, but are not limited to, stearic acid, oleic acid, and linoleic acid. In certain embodiments of the invention, the peptide is amidated at the C-terminus. One non-limiting example of a peptide of the invention is the tripeptide st-Gln-Ala-Trp (SEQ ID NO:11) with a stearic acid moiety at the N-terminus (designated stMC12 elsewhere herein):
In an embodiment of the invention, the annexin-1 peptide contains D amino acids. Non-limiting examples include Ac-dGln-dAla-dTrp (SEQ ID NO:9), wherein, e.g., dGln represents D-glutamine), Ac-dPhe-dLeu-d-Lys-dGln-dAla-dTrp (SEQ ID NO:10). In certain embodiments, all of the amino acids are “D” amino acids. In other embodiments, the peptide contains D and L amino acids.
In certain embodiments of the invention, the annexin-1 peptides are cyclic. In one non-limiting embodiment, the cyclic peptide has head to tail cyclization. In another non-limiting embodiment, the cyclic peptide has side-chain to side-chain cyclization. Such side-chain to side-chain cyclization can involve formation of disulfide bonds between cysteine residues. Another side-chain cyclization involves amide bond formation between side chains. For example, suitably protected lysine and glutamic acid residues are assembled into a linear precursor, deprotected, and reacted. For a review of peptide cyclization methods, see, e.g., Davies, 2003, J. Peptide Sci. 9, 471-501, which is incorporated by reference. In certain embodiments, cyclic peptides of the invention incorporate L amino acids, D amino acids, or mixtures of both. In another embodiment, retro-inverso peptides are used. Retro-inverso peptides are made up of D-amino acids in a reversed sequence. The side chains assume a topology similar to that of the parent molecule made of L-amino acids, but with inverted amide peptide bonds. A non-limiting example of a cyclic annexin-1 peptide is Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:5), cyclized head to tail.
The amount of annexin-1 peptide or conjugate of the invention administered to a human is in the range from about 0.01 to about 50 mg/kg, or from about 0.02 to about 25 mg/kg, or from about 0.05 to about 2.5 mg/kg. Effective doses for administration to a human subject include, without limitation, 0.1, or 0.2, or 0.3, or 0.4, or 0.5, or 1.0, or 1.5, or 2.0 mg/kg body weight. Administration may be by injection, preferably subcutaneous or intramuscular. Total daily doses include without limitation, 5, 10, 15, 20, 25, 50, 75, 100, 150, or 200 mg. When administered orally, the dosages of the active peptides may be increased 2-10 fold or higher. The amounts may be administered in single or divided doses. The exact dose to be administered is determined by the attending clinician and may depend on the severity of inflammation, as well as upon the age, weight and condition of the individual. Administration should begin at the first sign of symptoms or shortly after diagnosis of the IBD.
Animal studies can be used in formulating a range of dosages for use in humans in accordance with the invention. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For example, the amount of a peptide of the invention administered to a mouse is normally in the range from about 1 to about 25 mg/kg. Thus, useful daily doses administered to a mouse include, without limitation 50 μg, or 100 μg, or 300 μg, or 500 μg. For a 20 gm mouse, these amounts correspond to 2.5, 5, 15, or 25 mg/kg body weight. Levels in plasma may be measured, for example, by high-performance liquid chromatography.
One of skill in the art would understand that equivalent dosage amounts for humans vs. other mammals can be extrapolated, for example, by normalization to body surface area (BSA). See, e.g., Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers, 2002, Center for Drug Evaluation and Research, U.S. Department of Health and Human Services, Food and Drug Administration. The following table provides Km factors for various animals and humans. To convert from an animal to a human, multiply the animal dose by its Km factor and divide by the human Km factor.
As used herein, the term “effective amount” in the context of administering a therapy to a subject refers to the amount of a therapy which is sufficient to achieve one or more of the following effects: (i) reduce or ameliorate the severity of inflammation or a symptom associated therewith; (ii) reduce the duration of inflammation or a symptom associated therewith; (iii) prevent the progression of inflammation or a symptom associated therewith; (iv) cause regression of inflammation or a symptom associated therewith; (v) prevent the development or onset of inflammation or a symptom associated therewith; (vi) prevent the recurrence of inflammation or a symptom associated therewith; (vii) reduce hospitalization of a subject; (viii) reduce hospitalization length; and/or (ix) enhance or improve the prophylactic or therapeutic effect(s) of another therapy.
Pharmaceutical compositions may be prepared as medicaments to be administered by any route. Non-limiting examples are oral, parenteral (including subcutaneous, intramuscular, and intravenous), rectal, or transdermal administration. A suitable administration route may best be determined by a medical practitioner for each patient. Pharmaceutically acceptable carriers and their formulations are described in standard formulation treatises, e.g., Remington's Pharmaceutical Sciences by E. W. Martin.
In an embodiment of the invention, compounds of the invention are administered orally. For example, as exemplified herein, the compounds may be dissolved in corn oil or another such dietary substance and directly ingested. In an embodiment of the invention, an annexin-1 peptide or conjugate is dissolved in an acceptable carrier and encapsulated. In another embodiment, an annexin-1 peptide or conjugate is dissolved in an acceptable carrier and consumed directly, for example as a syrup or taken with or mixed into food. In a preferred embodiment, an annexin-1 peptide or conjugate of the invention is in a dosage form adapted for localized delivery to the large or small intestine, or both.
The compositions and single unit dosage forms can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Such compositions and dosage forms will contain a prophylactically or therapeutically effective amount of a peptide preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration. In a preferred embodiment, the compositions or single unit dosage forms are sterile and in suitable form for administration to a subject, preferably a mammalian subject, and more preferably a human subject.
Excipients such as diluents increase the bulk of a solid pharmaceutical composition, and may make a pharmaceutical dosage form containing the composition easier for the patient and care giver to handle. Diluents for solid compositions include, but are not limited to, microcrystalline cellulose (e.g., AVICEL®), microfine cellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, sugar, dextrates, dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylates (e.g., EUDRAGIT®), potassium chloride, powdered cellulose, sodium chloride, sorbitol, or talc.
Solid pharmaceutical compositions that are compacted into a dosage form, such as a tablet, may include, but are not limited to, excipients whose functions include, but are not limited to, helping to bind the active ingredient and other excipients together after compression, such as binders. Binders for solid pharmaceutical compositions include, but are not limited to, acacia, alginic acid, carbomer (e.g., CARBOPOL®), carboxymethylcellulose sodium, dextrin, ethyl cellulose, gelatin, guar gum, hydrogenated vegetable oil, hydroxyethyl cellulose, hydroxypropyl cellulose (e.g., KLUCEL®), hydroxypropyl methyl cellulose (e.g., METHOCEL®), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylates, povidone (e.g., KOLLIDON®, PLASDONE®), pregelatinized starch, sodium alginate, or starch.
The dissolution rate of a compacted solid pharmaceutical composition in the patient's stomach may be increased by the addition of a disintegrant to the composition. Excipients which function as disintegrants include, but are not limited to, alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (e.g., AC-DI-SOL®, PRIMELLOSE®), colloidal silicon dioxide, croscarmellose sodium, crospovidone (e.g., KOLLIDON®, POLYPLASDONE®), guar gum, magnesium aluminum silicate, methyl cellulose, microcrystalline cellulose, polacrilin potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (e.g., EXPLOTAB®), or starch.
Glidants can be added to improve the flowability of a non-compacted solid composition and to improve the accuracy of dosing. Excipients that may function as glidants include, but are not limited to, colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc, or tribasic calcium phosphate.
When a dosage form such as a tablet is made by the compaction of a powdered composition, the composition is subjected to pressure from a punch and die. Some excipients and active ingredients have a tendency to adhere to the surfaces of the punch and die, which can cause the product to have pitting and other surface irregularities. A lubricant can be added to the composition to reduce adhesion and ease the release of the product from the die. Excipients that function as lubricants include, but are not limited to, magnesium stearate, calcium stearate, glyceryl monostearate, glyceryl palmitostearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl fumarate, stearic acid, talc, or zinc stearate.
Flavoring agents and flavor enhancers make the dosage form more palatable to the patient. Common flavoring agents and flavor enhancers for pharmaceutical products that may be included in the composition of the invention include, but are not limited to, maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol, and tartaric acid.
Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and/or facilitate patient identification of the product and unit dosage level.
In liquid pharmaceutical compositions of the invention, the active ingredient and any other solid excipients are suspended in a liquid carrier such as water, vegetable oil, alcohol, polyethylene glycol, propylene glycol, or glycerin. As used herein, “active ingredient” means annexin-1 peptides or conjugates of the invention.
Liquid pharmaceutical compositions may contain emulsifying agents to disperse uniformly throughout the composition an active ingredient or other excipient that is not soluble in the liquid carrier. Emulsifying agents that may be useful in liquid compositions of the invention include, but are not limited to, gelatin, egg yolk, casein, cholesterol, acacia, tragacanth, chondrus, pectin, methyl cellulose, carbomer, cetostearyl alcohol, or cetyl alcohol.
Liquid pharmaceutical compositions of the invention may also contain a viscosity enhancing agent to improve the mouth-feel of the product and/or coat the lining of the gastrointestinal tract. Such agents include, but are not limited to, acacia, alginic acid, bentonite, carbomer, carboxymethylcellulose calcium or sodium, cetostearyl alcohol, methyl cellulose, ethylcellulose, gelatin guar gum, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, maltodextrin, polyvinyl alcohol, povidone, propylene carbonate, propylene glycol alginate, sodium alginate, sodium starch glycolate, starch tragacanth, or xanthan gum.
Sweetening agents such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol, or invert sugar may be added to improve the taste.
Preservatives and chelating agents such as alcohol, sodium benzoate, butylated hydroxy toluene, butylated hydroxyanisole, or ethylenediamine tetraacetic acid may be added at levels safe for ingestion to improve storage stability.
According to the invention, a liquid composition may also contain a buffer such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate, or sodium acetate.
Generally, an effective amount of the agents described above will be determined by the age, weight and condition or severity of disease of the recipient. Dosing may be one or more times daily, or less frequently, and may be in conjunction with other compositions as described herein. It should be noted that the present invention is not limited to the dosages recited herein.
Peptides and conjugates of the invention may be coadministered with other therapies used for treatment of colitis. Such therapies include aminosalicylates, drugs that contain 5-aminosalicyclic acid (5-ASA), and help control inflammation. Sulfasalazine is a combination of sulfapyridine and 5-ASA. The sulfapyridine component carries the anti-inflammatory 5-ASA to the intestine. However, sulfapyridine may lead to side effects such as nausea, vomiting, heartburn, diarrhea, and headache. Other 5-ASA agents, such as olsalazine, mesalamine, and balsalazide, have a different carrier, fewer side effects, and may be used by people who cannot take sulfasalazine. 5-ASAs are given orally, through an enema, or in a suppository, depending on the location of the inflammation in the colon. Most people with mild or moderate ulcerative colitis are treated with this group of drugs first. This class of drugs is also used in cases of relapse.
The anti-inflammatory agent may be a corticosteroid (e.g., prednisone, methylprednisone, and hydrocortisone), a glucocorticosteroic, or dexamethasone. Such agents can be given orally, intravenously, through an enema, or in a suppository, depending on the location of the inflammation. These drugs can cause side effects such as weight gain, acne, facial hair, hypertension, diabetes, mood swings, bone mass loss, and an increased risk of infection. For this reason, they are not recommended for long-term use, although they are considered very effective when prescribed for short-term use.
Immunomodulators such as azathioprine and 6-mercapto-purine (6-MP) reduce inflammation by affecting the immune system. These drugs are used for patients who have not responded to 5-ASAs or corticosteroids or who are dependent on corticosteroids. Immunomodulators are administered orally, however, they are slow-acting and it may take up to 6 months before the full benefit. Patients taking these drugs are monitored for complications including pancreatitis, hepatitis, a reduced white blood cell count, and an increased risk of infection. Cyclosporine A may be used with 6-MP or azathioprine to treat active, severe ulcerative colitis in people who do not respond to intravenous corticosteroids.
The peptides of the invention may be coadministered with naturopathic agents. Such agents include, but are not limited to, supplements of omega 3/6 fish oils, probiotics, L-glutamine and N-Acetylglucosamine. The peptides can also be coadministered with diet related therapies. For example therapies for colitis frequently involves avoidance of certain foods (roughage, seeds, dairy, gluten, seedy fruits, broccoli, beets and meats).
The above-described administration schedules are provided for illustrative purposes only and should not be considered limiting. A person of ordinary skill in the art will readily understand that all doses are within the scope of the invention.
It is to be understood and expected that variations in the principles of invention herein disclosed may be made by one skilled in the art and it is intended that such modifications are to be included within the scope of the present invention.
Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains. The following examples further illustrate the invention, but should not be construed to limit the scope of the invention in any way.
Female C57BL/6 and SJL/J mice (Taconic, Hudson, N.Y.), 7-9 weeks old, were kept under controlled temperature (25° C.) with a 12/12-hour light-dark cycle and free access to standard diet and drinking water. The mice were allowed to acclimate for 7 days before the start of experiments.
The mice received 2% dextran sulfate sodium (DSS, MW 36,000 to 50,000, MP Biomedicals, Solon, Ohio) in drinking water for 7 days; control mice received regular drinking water. During the period when DSS was administered, treated mice were given MC12 40 or 80 μg/mouse intraperitoneally (i.p.) whereas the control group was given saline i.p. The mice were weighed and monitored for rectal bleeding or prolapse daily. All mice were euthanized at the end of the study. Blood samples were collected and colons were dissected and their length was measured. The middle part of colon was fixed in 4% neutralized formalin and the rest was frozen for molecular analyses.
Paraffin-embedded tissue sections were stained with hematoxylin and eosin (H&E). In these sections, the histological score was determined based on epithelial denudation, loss of crypts, ulceration, edema and leukocyte infiltration using criteria that have been described previously (see Perretti, F. et al., 2009, Nat Rev Immunol 9:62-70)
As expected, DSS induced colitis in these mice. As shown in
To further assess the effect of MC12 on the inflammatory changes associated with DSS induced colitis, myeloperoxidase (MPO) activity and cytosolic phospholipase A2 (cPLA2) in tissue samples was determined.
MPO activity is an indicator of the degree of acute inflammation in a given tissue. MPO activity was measured using a commercial kit and following the instructions of the manufacturer (Invitrogen, Eugene, Oreg.). Briefly, a portion of colon tissue was homogenized in PBS and centrifuged at 10,000×g for 15 min and 50 μl of supernatant from each sample were added into a 96-well microplate. 50 μl of 2×APF working solution was added to all sample and standard wells and the plate was incubated at room temperature for 30 min. The reaction was stopped by adding 10 μl of 10× chlorination inhibitor. The fluorescence intensity was measured using a Multiplate Reader (Molecular Devices) at excitation at 485 nm, emission at 530 nm.
As shown in
cPLA2 enzymes release fatty acids from the second carbon group of glycerol. This particular phospholipase specifically recognizes the sn-2 acyl bond of phospholipids and catalytically hydrolyzes the bond releasing a lysopospholipid and arachidonic acid; the latter is then modified by cyclooxygenases into active compounds called eicosanoids by cyclooxygenases. Eicosanoids include prostaglandins and leukotrienes which are categorized as inflammatory mediators. As shown in
NF-κB is the master regulator of inflammation, controlling the transcription of many genes related to this complex process. It is also the molecular target of the activity of MC 12. Therefore, we determined by immunohistochemistry the level of NF-κB activation in the colonic mucosa of our four study groups of mice. There was minimum or known activation of NF-κB in the colon of control animals (
Female C57BL/6 and SJL/J mice (Taconic, Hudson, N.Y.), 7-9 weeks old, were kept under controlled temperature (25° C.) with a 12/12-hour light-dark cycle and free access to standard diet and drinking water. The mice were allowed to acclimate for 7 days before the start of experiments.
The mice received 2% dextran sulfate sodium (DSS, MW 36,000 to 50,000, MP Biomedicals, Solon, Ohio) in drinking water for 8 days; control mice received regular drinking water. During the period when DSS was administered, treated mice were given MC-12 at 5 or 25 mg/kg intraperitoneally (ip) whereas the control group was given saline ip. As above, the mice were weighed and monitored for rectal bleeding or prolapse daily. All mice were euthanized at the end of the study period. Blood samples were collected and colons were dissected and their length was measured. The middle part of colon was fixed in 4% neutralized formalin and the rest was frozen for molecular analyses. Paraffin-embedded tissue sections were stained and scored as above.
By day 8, mice receiving DSS lost on average 8.4% of their baseline weight (
As expected, DSS induced colitis in these mice. The histological sections shown in
TNBS (2,4,6-trinitro benzene sulfonic acid) induces a form of colitis in SJL/J mice that recapitulates Crohn's disease. The optimal dose of TNBS was determined to be 100 μl of a 2.5% ethanolic solution instilled intracolonically. SJL mice received 2.5% TNBS solution in 50% ethanol by intra-colonic instillation using a 3.5 F catheter, which was inserted 4 cm into the colon under mild ketamine/xylazine anesthesia. Mice received MC-12 25 mg/kg or vehicle ip twice a day for two days. Body weight was monitored daily and mice were euthanized on the third day when blood and colon tissues were collected as described above for further analysis.
The fixed colon was cut into six equal fragments, dehydrated and embedded into paraffin. The tissue sections were stained with hematoxylin and eosin (H&E). The histological score was determined by two pathologists as described, based on the degree (0-3) and extent (0-3) of inflammation, crypt damage (0-4) and the area involved (0-4). The scores of each of the first three parameters were multiplied by the fourth and the sum of these three multiples was the final score (ranging from 0 to 40).
As expected, TNBS induced severe crypt destruction and massive infiltration of inflammatory cells in the entire colonic wall (
To assess the effect of MC-12 on the inflammatory changes associated with DSS-induced colitis, myeloperoxidase activity in tissue samples was determined as above.
As shown in
We also determined the activity of cytosolic phospholipase A2 (cPLA2) in colonic tissues from study mice. cPLA2s are enzymes that release fatty acids from the second carbon group of glycerol. This particular phospholipid specifically recognizes the sn-2 acyl bond of phospholipids and catalytically hydrolyzes the bond releasing arachidonic acid and lysophospholipids, which are then modified into active compounds called eicosanoids by cyclooxygenases. Eicosanoids include prostaglandins and leukotrienes which are categorized as inflammatory mediators.
A cPLA2 assay kit (Cayman, Ann Arbor, Mich.) was used to determine cPLA2 activity following the instructions of the manufacturer. Briefly, a portion of colon tissue was homogenized in cold PBS and centrifuged at 10,000×g for 15 minutes and 10 μl of supernatant from each sample and 5 μl assay buffer were added into a 96-well microplate. The reaction was initialized by adding 200 μl substrate solutions to all wells and incubating for 5 min at room temperature. The fluorescence intensity was measured using a Multiplate Reader (Molecular Devices) at excitation at 485 nm, emission at 530 nm.
As shown in
Expression of inflammatory cytokines TNF-α, IFN-γ, IL-1β, IL-6 and IL-10 in the colon was determined by measuring corresponding mRNA levels using real-time PCR. About 100 mg colon tissue were placed in 1 ml of cold Trizol (Invitrogen Life Technologies, Carlsbad, Calif.), immediately homogenized with a rotor power homogenizer, and RNA was extracted according to the manufacturer's instructions. Total RNA was retrotranscribed with M-MLV reverse transcriptase (Invitrogen Life Technologies, Carlsbad, Calif.) using random primers. Real-time quantitative PCR was performed in a CFD-3200 Opticon detector (BioRad, Hercules, Calif., USA) using QuantiTect SYBR Green PCR Kits (Qiagen, Valencia Calif., USA). The PCR cycling conditions were: 40 cycles of 60 seconds at 94° C., 30 seconds at 51.4° C. and 30 seconds at 72° C. PCR primers (forward and reverse primers) were designed based on published sequences: TNF-α: AGGCTGCCCCGACTACGT (SEQ ID NO:12) and GACTTTCTCCTGGTATGAGATAGCAAA (SEQ ID NO:13); IFN-γ: CAGCAACAGCAAGGCGAAA (SEQ ID NO:14) and CTGGACCT GTGGGTTGTTGAC (SEQ ID NO:15); IL-1β: TCGCTCAGGGTCACAAGAAA (SEQ ID NO:16) and CATCAGAGGCAAGGAGGAAAAC (SEQ ID NO:17); IL-6: ACAAGTCGGAGGCTTAATTACACAT (SEQ ID NO:18) and ATGTGTAATTAAGCCTCCGACTTGT (SEQ ID NO:19); IL-1β: ATGCTGCCTGCTCTTACTGACTG (SEQ ID NO:20) and TTGCCATTGCACAACTCTTTTC (SEQ ID NO:21); β-actin: AGATTACTGCTCTGGCTCCTA (SEQ ID NO:20) and CAAAGAAAGGGTGTAAAACG (SEQ ID NO:21). Relative expression levels of mRNA were normalized to β-actin.
As shown in
The level of NF-κB activation in the colonic mucosa was determined by immunohistochemistry (
There was minimal baseline activation of NF-κB in the colon of control animals. DSS, as expected, activated NF-κB in both colonic crypts and stromal cells. MC-12 markedly decreased this effect of DSS in a clear dose-dependent manner, essentially normalizing it at the highest dose (25 mg/kg). The route of administration did not seem to make a difference with respect to this effect. This inhibitory effect of MC-12 was also detected in cultured NCM 460 cells (normal colon epithelial cells), in which DSS significantly increased NF-κB-DNA binding activity. MC-12 at concentrations of 30 μM and 300 μM essentially eliminated NF-κB activation.
MC-12 was modified by adding it to it stearic acid, generating the stearate-MC12 (StMC12), whose chemical formula is shown in
As shown in
The following acetylated peptides, composed of D amino acids, were synthesized and tested for inhibition of NF-kB: 1) Ac-dGln-dALa-dTrp (SEQ ID NO:9); and 2) Ac-dPhe-dLeu-dLys-dGln-dALa-dTrp (SEQ ID NO:10). Both peptides demonstrated effective inhibition of NF-kB and can be used to treat inflammatory bowel diseases. The following acetylated peptide, cyclized through its N- and C-terminals, was synthesized and tested for inhibition of NF-kB: Ac-Phe-Leu-Lys-Gln-Ala-Trp (SEQ ID NO:6). The acetylated cyclized peptide demonstrated effective inhibition of NF-kB and can be used to treat inflammatory bowel diseases.
This application claims priority to U.S. Application No. 61/378,708 filed Aug. 31, 2010, which is incorporated herein by reference in its entirety. This application is related to PCT/US2008/058759, filed Mar. 28, 2008, which is incorporated herein by reference in its entirety.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US11/50065 | 8/31/2011 | WO | 00 | 6/4/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61378708 | Aug 2010 | US |
