TRIAZOLONE COMPOUND, PHARMACEUTICAL USE THEREOF AND PHARMACEUTICAL COMPOSITION

Abstract
The present invention discloses a triazolone compound of formula (I) and pharmaceutical use thereof. Such compounds have a strong agonistic effect on PPARα and PPARδ, so the compounds or the pharmaceutically acceptable salts, the tautomers, the mesomers, the racemates, the stereoisomers, the metabolites, the metabolic precursors, the prodrugs or the solvates thereof can be applied to the preparation of a PPARα/δ dual agonist for preventing or treating diseases mediated by PPARα and/or PPARδ.
Description
TECHNICAL FIELD

The present invention belongs to the field of biomedicines, and particularly relates to a triazolone compound with dual agonistic activity for PPARα/δ and pharmaceutical use thereof as a PPARα/δ dual agonist.


BACKGROUND

Peroxisome proliferator-activated receptors (PPARs) are a class of nuclear receptors that are critical in the regulation of homeostasis in the body. Activation of PPARs is dependent on the regulation of ligands. After PPARs are activated by the ligands, the ligand-activated transcription factors PPARs form heterodimers with a retinol X receptor (RXR) and bind to a specific DNA sequence PPRE to regulate the transcription of a target gene, thereby exerting biological effects (Nat. Rev. Imnunol., 2006, 6, 44). PPARs have three subtypes, i.e., PPARα, PPARδ, and PPARγ, which have different tissue distributions. Activation of PPARs has a potentially positive effect on the improvement of metabolic diseases, cardiovascular and cerebrovascular diseases, inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurological injury diseases, secondary diseases caused by pathogen infections, mitochondrial dysfunction and disorders, or tumors (Nature, 2000, 405, 421; J. Neurochem., 2008, 107, 497; Mol. Cells., 2012, 33, 217; J. Biomed. Sci., 2017, 24, 5; Eur J. Med. Chem., 2019, 166, 502). The development and application of PPAR agonists is a potential therapeutic strategy for intervention in the diseases described above. However, agonism of PPARγ has been shown to have a potential cardiac risk, leaving considerations on safety of its agonists. Therefore, the development of selective PPARα/δ dual agonists may offer new possibilities for the treatment of the diseases described above.


There is currently no PPARα/δ dual agonist on the market. The interim analysis results of an anti-nonalcoholic steatohepatitis (NASH) phase III clinical trial showed that the clinically investigational PPARα/δ dual agonist GFT505 (Elafibranor) was substantially ineffective (NCT02704403). The problems of weak agonistic activity and poor metabolic stability of GFT505 are found after the druggability analysis, which greatly limit the clinical application of GFT505 and may be an important reason that the anti-NASH phase III clinical trial on GFT505 did not achieve the expected effect. NASH, as a complex disease that seriously jeopardizes human health, has become a common cause of end-stage liver diseases and primary liver cancer, and has gradually replaced viral hepatitis as the leading cause of liver transplantation. Unfortunately, to date, there is no specific treatment method for NASH (Nat. Rev. Endocrinol., 2017, 13, 36). The potential effects of agonism of PPARα and PPARδ may counteract the development of NASH in a number of ways (Nat. Rev. Gastroenterol. Hepatol., 2021, 18, 24). Thus, PPARα/δ dual agonists with high activity and stable metabolism may be an important means of treating this disease.


In conclusion, there is an urgent need clinically to develop a novel PPARα/δ dual agonist with high activity and stable metabolism for the treatment of diseases mediated by PPARα and PPARδ, such as metabolic diseases, cardiovascular and cerebrovascular diseases, inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurological injury diseases, secondary diseases caused by pathogen infections, mitochondrial dysfunction and disorder diseases, or tumors; especially diseases with complex pathogenic causes, such as nonalcoholic fatty liver disease, alcoholic fatty liver disease, diabetes and its complications, dyslipidemia, obesity, atherosclerosis, cholestatic liver disease, neurodegenerative disease, and Duchenne muscular dystrophy.


SUMMARY

Objective: in order to solve the problem of lack of effective PPARα/δ dual agonists clinically at present, the present invention provides a novel triazolone compound. The compound of the present invention has potent agonistic effects on PPARα and PPARδ, has good selectivity for PPARγ, and has good pharmacokinetic properties. Therefore, the compound and the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate of the present invention can be used for preparing a PPARα/δ dual agonist.


Another objective of the present invention is to provide pharmaceutical use of the triazolone compound as a PPARα/δ dual agonist. The compound and the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof can be applied to the preparation of a PPARα/δ dual agonist, and can be used for preparing a medicament for preventing or treating diseases mediated by PPARα and/or PPARδ.


In order to achieve the above objectives, the present invention provides the following technical solutions:


The present invention provides a triazolone compound of formula (I) or a pharmaceutically acceptable salt or a solvate thereof:




embedded image




    • R1 is selected from: H, linear or branched C1-C6 alkyl, C3-C6 cycloalkyl, (CH2)pOR14, or (CH2)qNR15; wherein p=any integer from 2 to 6; q=any integer from 2 to 6; R14 and R15 are each independently selected from H, R16, and C(O)R17; wherein R16 and R17 are each independently selected from linear or branched C1-C6 alkyl or C3-C6 cycloalkyl;

    • R2 and R3 are each independently selected from: H or linear or branched C1-C4 alkyl; or R2 and R3, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring;

    • R4, R5, R6, and R7 are each independently selected from: H, halogen, OR13, hydroxy, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, C3-C6 cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, alkynyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, fused aryl, or substituted fused aryl; or at least two substituents of R4, R5, R6, and R7, together with the atoms to which they are attached, may form a substituted or unsubstituted benzene ring, a substituted or unsubstituted heteroaromatic ring, a substituted or unsubstituted cycloalkane ring, a substituted or unsubstituted heterocycloalkane ring, or a substituted or unsubstituted heterocycloalkene ring;

    • R13 is selected from: linear or branched C1-C4 alkyl, C3-C6 cycloalkyl, hydroxyalkyl, alkoxyalkyl, alkoxyalkoxyalkyl, cycloalkyl, or alkynylalkoxyalkyl;

    • X is selected from CH2, O, or S;

    • m is selected from any integer from 0 to 4;

    • R8 is selected from H or C1-C4 alkyl;

    • R9 and R10 are independently selected from: H, hydroxy, halogen, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, alkylsulfonyl, alkoxy, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, alkynyl, phenyl, substituted phenyl, phenoxy, substituted phenyloxy, heteroaryl, substituted heteroaryl, fused aryl, or substituted fused aryl, wherein the substituted phenyl may independently be substituted with 1 to 2 of the following substituents: halogen, hydroxy, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, or alkylsulfonyl; or R9 and R10, together with the atoms to which they are attached, may form a substituted or unsubstituted benzene ring, a substituted or unsubstituted heteroaromatic ring, a substituted or unsubstituted cycloalkane ring, a substituted or unsubstituted heterocycloalkane ring, or a substituted or unsubstituted heterocycloalkene ring;

    • R11 and R12 are each independently selected from: H, C1-C4 linear or branched alkyl, or halogen; or R11 and R12, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring.





In certain preferred embodiments, provided is the triazolone compound of formula (I) or the pharmaceutically acceptable salt or the solvate thereof:

    • R1 is selected from: H, linear or branched C1-C4 alkyl, alkoxyalkyl, or acetamidoethyl;
    • R2 and R3 are each independently selected from: H or linear or branched C1-C4 alkyl; or
    • R2 and R3, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring;
    • R4, R5, R6, and R7 are each independently selected from: H, halogen, trifluoromethyl, trifluoromethoxy, trifluoromethylthio, OR13, or linear or branched C1-C4 alkyl;
    • R13 is selected from: linear or branched C1-C4 alkyl, hydroxyalkyl, alkoxyalkyl, alkoxyalkoxyalkyl, cycloalkyl, or alkynylalkoxyalkyl;
    • X is selected from CH2, O, or S;
    • m is selected from any integer from 0 to 2;
    • R8 is selected from H or linear or branched C1-C4 alkyl;
    • R9 and R10 are each independently selected from: H, halogen, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, alkylsulfonyl, alkoxy, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, alkynyl, phenyl, substituted phenyl, phenoxy, substituted phenyloxy, heteroaryl, substituted heteroaryl, fused aryl, or substituted fused aryl, wherein the substituted phenyl may independently be substituted with 1 to 2 of the following substituents: halogen, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, or alkylsulfonyl;
    • R11 and R12 are each independently selected from: H, deuterium, linear or branched C1-C4 alkyl, or halogen; or R11 and R12, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring.


In certain preferred embodiments, the triazolone compound further includes a pharmaceutically acceptable salt, a tautomer, a mesomer, a racemate, a stereoisomer, a metabolite, a metabolic precursor, a prodrug, or a solvate thereof. The present invention provides a triazolone compound of formula (I) or a pharmaceutically acceptable salt, a tautomer, a mesomer, a racemate, a stereoisomer, a metabolite, a metabolic precursor, a prodrug or a solvate thereof.


In certain more preferred embodiments, the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof of the present invention is any one of the compounds shown in Table 1 below:









TABLE 1







Structures and names of compounds









Compound




No.
Compound structure
Name





 1


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-fluorophenoxy)-2-methyl- propionic acid





 2


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-fluorophenoxy)- ethyl-2-methylpropionate





 3


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-chlorophenoxy)-2-methyl- propionic acid





 4


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-chlorophenoxy)- ethyl-2-methylpropionate





 5


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)-2-methyl- propionic acid





 6


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- ethyl-2-methylpropionate





 7


embedded image


2-(4-(((4-(4-Fluorophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 8


embedded image


Ethyl 2-(4-(((4-(4-fluorophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetate





 9


embedded image


2-(4-(((4-(4-Chlorophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 10


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 11


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetate





 12


embedded image


2-(4-(((4-(4-Iodophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 13


embedded image


Ethyl 2-(4-(((4-(4-iodophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)-methyl)thio)-2-methylphenoxy)- acetate





 14


embedded image


2-(4-(((4-(4-Methoxyphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)thio)-2-methylphenoxy)acetic acid





 15


embedded image


2-(2-Methyl-4-(((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetic acid





 16


embedded image


2-(2-Methyl-4-(((5-oxo-4-(4-(tri- fluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetic acid





 17


embedded image


Ethyl 2-(2-methyl-4-(((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetate





 18


embedded image


2-(2-Methyl-4-(((5-oxo-4-phenyl-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)phenoxy)acetic acid





 19


embedded image


2-(2-Methyl-4-(((5-oxo-4-(4-((tri- fluoromethyl)thio)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)4-meth- yl)thio)phenoxy)acetic acid





 20


embedded image


2-(4-(((4-(4-Ethylphenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 21


embedded image


Ethyl 2-(4-(((4-(4-ethylphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)thio)-2-methylphenoxy)acetate





 22


embedded image


2-(2-Methyl-4-(((4-(4-nitrophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio]phenoxy)acetic acid





 23


embedded image


2-(4-(((4-(4-Ethoxyphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)thio)-2-methylphenoxy)acetic acid





 24


embedded image


Ethyl 2-(4-(((4-(4-ethoxyphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetate





 25


embedded image


2-(2-Methyl-4-(((4-(4-(methylsulfon- yl)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl]thio)phen- oxy)acetate





 26


embedded image


2-(4-(((4-(2-Chlorophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 27


embedded image


Ethyl 2-(4-(((4-(2-chlorophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetate





 28


embedded image


2-(4-(((4-(2-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-methylphenoxy)acetic acid





 29


embedded image


Ethyl 2-(4-((4-(2-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetate





 30


embedded image


2-(2-Methyl-4-(((5-oxo-4-(2-(tri- fluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetic acid





 31


embedded image


Ethyl 2-(2-methyl-4-(((5-oxo-4-(2- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetate





 32


embedded image


2-(4-(((4-(4-Chloro-3-methylphenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetic acid





 33


embedded image


Ethyl 2-(4-(((4-(4-chloro-3-methyl- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)-2-methyl- phenoxy)acetate





 34


embedded image


2-(4-(((4-(2-Bromo-5-fluorophenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetic acid





 35


embedded image


Ethyl 2-(4-(((4-(2-bromo-5-fluoro- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)-2-methyl- phenoxy)acetate





 36


embedded image


2-(4-(((4-(4-Bromo-2-fluorophenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetic acid





 37


embedded image


2-(4-(((4-(3-Chloro-2-fluorophenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)thio)-2-methylphenoxy)- acetic acid





 38


embedded image


Ethyl 2-(4-(((4-(3-chloro-2-fluoro- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)-2-methyl- phenoxy)acetate





 39


embedded image


2-(4-(((4-(2-Bromo-3-chlorophenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)thio)-2-methylphenoxy)- acetic acid





 40


embedded image


Ethyl 2-(4-(((4-(2-bromo-3-chloro- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)-2-methyl- phenoxy)acetate





 41


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)phenoxy)acetic acid





 42


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)phenoxy)acetate





 43


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-fluorophenoxy)acetic acid





 44


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-fluorophenoxy)- acetate





 45


embedded image


2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)thio)-2-chlorophenoxy)acetic acid





 46


embedded image


Ethyl 2-(4-(((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-chlorophenoxy)- acetate





 47


embedded image


2-(2-Bromo-4-(((4-(4-bromophenyl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)phenoxy)acetic acid





 48


embedded image


Ethyl 2-(2-bromo-4-(((4-(4-bromo- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)phenoxy)- acetate





 49


embedded image


2-(4-(((5-Oxo-4-(4-(trifluoromethyl)- phenyl)-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)thio)phenoxy)acetic acid





 50


embedded image


Ethyl 2-(4-(((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)phenoxy)- acetate





 51


embedded image


2-(2-Fluoro-4-(((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)thio)phenoxy)- acetic acid





 52


embedded image


Ethyl 2-(2-fluoro-4-(((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetate





 53


embedded image


2-(2-Chloro-4-(((5-oxo-4-(4-(tri- fluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetic acid





 54


embedded image


Ethyl 2-(2-chloro-4-(((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)acetate





 55


embedded image


2-(4-((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-methyl- propionic acid





 56


embedded image


Ethyl 2-(4-((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





 57


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





 58


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





 59


embedded image


2-(2,6-Dimethyl-4-((4-(3-methyl-4- (trifluoromethyl)phenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionic acid





 60


embedded image


Ethyl 2-(2,6-dimethyl-4-((4-(3-meth- yl-4-(trifluoromethyl)phenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)-2-methylpropionate





 61


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)methyl)- phenoxy)-2-methylpropionic acid





 62


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)methyl)- phenoxy)-2-methylpropionate





 63


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-phenyl- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)-2-methylpropionic acid





 64


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4- phenyl-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)phenoxy)-2-methylpro- pionate





 65


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(p-tol- yl)-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)phenoxy)-2-methylpro- pionic acid





 66


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4- (p-tolyl)-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)phenoxy)-2-methylpro- pionate





 67


embedded image


2-(4-((4-(4-Chlorophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-methyl- propionic acid





 68


embedded image


Ethyl 2-(4-((4-(4-chlorophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





 69


embedded image


2-(4-((4-(4-Ethoxyphenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-methyl- propionic acid





 70


embedded image


Ethyl 2-(4-((4-(4-ethoxyphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





 71


embedded image


2-(4-((4-(3-Fluoro-4-(trifluorometh- yl)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2,6-dimeth- ylphenoxy)-2-methylpropionic acid





 72


embedded image


Ethyl 2-(4-((4-(3-fluoro-4-(trifluoro- methyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2,6- dimethylphenoxy)-2-methylpropionate





 73


embedded image


2-(4-((4-(3-Chloro-4-(trifluorometh- yl)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2,6-dimeth- ylphenoxy)-2-methylpropionic acid





 74


embedded image


Ethyl 2-(4-((4-(3-chloro-4-(trifluoro- methyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2,6- dimethylphenoxy)-2-methylpropionate





 75


embedded image


2-(4-((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2-methylphenoxy)-2-methylpro- pionic acid





 76


embedded image


Ethyl 2-(4-((4-(4-bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2-methylphenoxy)-2- methylpropionate





 77


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)propionic acid





 78


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-(4-(trifluoromethyl)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)propionate





 79


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)methyl)- phenoxy)propionic acid





 80


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-(4-(trifluoromethoxy)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)propionate





 81


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4- phenyl-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)phenoxy)propionic acid





 82


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-phenyl-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)pro- pionate





 83


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4- (p-tolyl)-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)phenoxy)propionate





 84


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-(p-tolyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)-pro- pionate





 85


embedded image


2-(4-((4-(3-Fluoro-4-(trifluorometh- yl)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2-methyl- phenoxy)-2-methylpropionic acid





 86


embedded image


Ethyl 2-(4-((4-(3-fluoro-4-(trifluoro- methyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2- methylphenoxy)-2-methylpropionate





 87


embedded image


2-(4-((4-(3-Chloro-4-(trifluorometh- yl)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2-methyl- phenoxy)-2-methylpropionic acid





 88


embedded image


Ethyl 2-(4-((4-(3-chloro-4-(trifluoro- methyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2- methylphenoxy)-2-methylpropionate





 89


embedded image


2-(4-((4-(4-Ethoxyphenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2-methylphenoxy)-2-methylpro- pionic acid





 90


embedded image


Ethyl 2-(4-((4-(4-ethoxyphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2-methylphenoxy)-2-meth- ylpropionate





 91


embedded image


2-(4-((4-(4-Methoxyphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-2-methylphenoxy)-2-meth- ylpropionic acid





 92


embedded image


Ethyl 2-(4-((4-(4-methoxyphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2-methylphenoxy)-2-meth- ylpropionate





 93


embedded image


2-(4-((4-(4-Flourophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2-methylphenoxy)-2-methylpro- pionic acid





 94


embedded image


Ethyl 2-(4-((4-(4-flourophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2-methylphenoxy)-2-meth- ylpropionate





 95


embedded image


2-(4-((4-(4-Chlorophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2-methylphenoxy)-2-methylpro- pionic acid





 96


embedded image


Ethyl 2-(4-((4-(4-chlorophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2-methylphenoxy)-2-meth- ylpropionate





 97


embedded image


2-(4-((4-(2,3-Dihydrobenzo[b][1,4] dioxin-6-yl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2-methyl- phenoxy)-2-methylpropionic acid





 98


embedded image


Ethyl 2-(4-((4-(2,3-dihydrobenzo[b] [1,4]dioxin-6-yl])-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2- methylphenoxy)-2-methylpropionate





 99


embedded image


2-(4-((4-(2,3-Dihydrobenzo[b][1,4] dioxin-6-yl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2,6-dimeth- ylphenoxy)-2-methylpropionic acid





100


embedded image


Ethyl 2-(4-((4-(2,3-dihydrobenzo[b] [1,4]dioxin-6-yl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2,6- dimethylphenoxy)-2-methylpropionate





101


embedded image


2-(2-Methyl-4-((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxyacetic acid





102


embedded image


Ethyl 2-(2-methyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxyacetate





103


embedded image


2-Methyl-2-(4-((5-oxo-4-(4-(trifluoro- methoxy)phenyl)-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2-(trifluoro- methoxy)phenoxy)propionic acid





104


embedded image


Ethyl 2-methyl-2-(4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)methyl)- 2-(trifluoromethoxy)phenoxy)pro- pionate





105


embedded image


2-(2-Chloro-4-((5-oxo-4-(4-(trifluoro- methoxy)phenyl)-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)phenoxy)-2- methylpropionic acid





106


embedded image


Ethyl 2-(2-chloro-4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)methyl)- phenoxy)-2-methylpropionate





107


embedded image


2-(4-((4-(4-Methoxyphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-2,6-dimethylphenoxy)-2- methylpropionic acid





108


embedded image


Ethyl 2-(4-((4-(4-methoxyphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





109


embedded image


2-(4-((4-(4-Flourophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-methyl- propionic acid





110


embedded image


Ethyl 2-(4-((4-(4-flourophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





111


embedded image


2-(4-((4-(4-Cyanophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-methyl- propionic acid





112


embedded image


Ethyl 2-(4-((4-(4-cyanophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





113


embedded image


2-(2,6-Dimethyl-4-((4-(4-(methyl- sulfonyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





114


embedded image


Ethyl 2-(2,6-dimethyl-4-((4-(methyl- sulfonyl)phenyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





115


embedded image


2-(4-((4-(4-Isopropylphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-2,6-dimethylphenoxy)-2- methylpropionic acid





116


embedded image


Ethyl 2-(4-((4-(4-isopropylphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





117


embedded image


2-(4-((4-([1,1′-Biphenyl]-4-yl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-2,6-dimethylphenoxy)-2- methylpropionic acid





118


embedded image


Ethyl 2-(4-((4-([1,1′-biphenyl]-4-yl)- 5-oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)-2,6-dimethylphenoxy)-2- methylpropionate





119


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(2- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





120


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(2- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





121


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(3- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





122


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(3- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





123


embedded image


2-(2-Fluoro-4-((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)-2-meth- methylpropionic acid





124


embedded image


Ethyl 2-(2-fluoro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





125


embedded image


2-(2-Chloro-4-((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)-2-meth- ylpropionic acid





126


embedded image


Ethyl 2-(2-chloro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





127


embedded image


2-(2,6-Difluoro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





128


embedded image


Ethyl 2-(2,6-difluoro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





129


embedded image


2-(2,6-Dichloro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





130


embedded image


Ethyl 2-(2,6-dichloro-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





131


embedded image


2-(4-((4-(4-Ethylphenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-2,6-dimethylphenoxy)-2-meth- ylpropionic acid





132


embedded image


Ethyl 2-(4-((4-(4-ethylphenyl)-5-oxo- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-2,6-dimethylphenoxy)-2- methylpropionate





133


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)acetic acid





134


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)acetate





135


embedded image


2-(4-((4-(4-Bromophenyl)-5-oxo-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionic acid





136


embedded image


Ethyl 2-(4-((4-(4-Bromophenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)phenoxy)-2-methylpro- pionate





137


embedded image


2-(4-((4-(4-Trifluoromethylphenyl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)phenoxy)-2-methylpro- pionic acid





138


embedded image


Ethyl 2-(4-((4-(4-trifluoromethyl- phenyl)-5-oxo-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)-2-meth- ylpropionate





139


embedded image


2-(2-Methyl-4-((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)phenoxy)acetic acid





140


embedded image


Ethyl 2-(2-methyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)acetate





141


embedded image


2-(2-Trifluoromethoxy-4-((5-oxo-4- (4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)acetic acid





142


embedded image


Ethyl 2-(2-trifluoromethoxy-4-((5- oxo-4-(4-(trifluoromethyl)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)acetate





143


embedded image


2-(2-Chloro-6-methyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





144


embedded image


Ethyl 2-(2-chloro-6-methyl-4-((5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





145


embedded image


2-(2-Chloro-6-methyl-4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-phenoxy)-2-methylpropionic acid





146


embedded image


Ethyl 2-(2-chloro-6-methyl-4-((5-oxo- 4-(4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





147


embedded image


2-Methyl-2-(4-((5-oxo-4-(4-(trifluoro- methyl)phenyl)-4,5-dihydro-1H-1,2,4- triazol-1-yl)methyl)-2-(trifluorometh- yl)phenoxy)propionic acid





148


embedded image


Ethyl 2-methyl-2-(4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-2- (trifluoromethyl)phenoxy)propionate





149


embedded image


2-(2,6-Dichloro-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





150


embedded image


Ethyl 2-(2,6-dichloro-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





151


embedded image


2-(2-Fluoro-4-((5-oxo-4-(4-(trifluoro- methoxy)phenyl)-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)phenoxy)-2- methylpropionic acid





152


embedded image


Ethyl 2-(2-fluoro-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropropioniate





153


embedded image


2-Methyl-2-(4-((5-oxo-4-(4-(trifluoro- methoxy)phenyl)-4,5-dihydro-1H- 1,2,4-triazol-1-l)methyl)phenoxy)pro- pionic acid





154


embedded image


Ethyl 2-methyl-2-(4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)propionate





155


embedded image


2-(2,6-Difluoro-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





156


embedded image


Ethyl 2-(2,6-difluoro-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





157


embedded image


2-Methyl-2-(4-((5-oxo-4-(4-(trifluoro- methoxy)phenyl)-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)-2-(trifluoro- methyl)phenoxy)propionic acid





158


embedded image


Ethyl 2-methyl-2-(4-((5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5- dihydro-1 H-1,2,4-triazol-1-yl)meth- yl)-2-(trifluoromethyl)phenoxy)- propionate





159


embedded image


2-(2-Chloro-6-fluoro-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionic acid





160


embedded image


Ethyl 2-(2-chloro-6-fluoro-4-((5-oxo- 4-(4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-phenoxy)-2-methylpropionate





161


embedded image


2-(2,6-Dibromo-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





162


embedded image


Ethyl 2-(2,6-dibromo-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





163


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)-6-(trifluoromethyl)phenoxy)pro- pionic acid





164


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-(4-(trifluoromethoxy)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-6-(trifluoromethyl)phenoxy)- propionate





165


embedded image


2-Methyl-2-(2-methyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)-6- (trifluoromethyl)phenoxy)propionic acid





166


embedded image


Ethyl 2-methyl-2-(2-methyl-4-((5- oxo-4-(4-(trifluoromethyl)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)-6-(trifluoromethyl)phenoxy)- propionate





167


embedded image


2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)ethyl)- phenoxy)-2-methylpropionic acid





168


embedded image


Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo- 4-(4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)ethyl)- phenoxy)-2-methylpropionate





169


embedded image


2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)ethyl)phenoxy)- 2-methylpropionic acid





170


embedded image


Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)ethyl)- phenoxy)-2-methylpropionate





171


embedded image


2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4- (trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)prop- yl)phenoxy)-2-methylpropionic acid





172


embedded image


Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo- 4-(4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)prop- yl)phenoxy)-2-methylpropionate





173


embedded image


2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)propyl)phen- oxy)-2-methylpropionic acid





174


embedded image


Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)prop- yl)phenoxy)-2-methylpropionate





175


embedded image


2-(2,6-Dimethyl-4-((3-methyl-5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionic acid





176


embedded image


Ethyl 2-(2,6-dimethyl-4-((3-methyl- 5-oxo-4-(4-(trifluoromethyl)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)-2-methylpropionate





177


embedded image


2-Methyl-2-(2-methyl-4-((3-methyl- 5-oxo-4-(4-(trifluoromethyl)phenyl)- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)phenoxy)propionic acid





178


embedded image


Ethyl 2-methyl-2-(2-dimethyl-4-((3- methyl-5-oxo-4-(4-(trifluoromethyl)- phenyl)-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)phenoxy)propionate





179


embedded image


2-(4-(((4-([1,1′-Biphenyl]-4-yl)-5- oxo-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)-2-methylphenoxy)- acetic acid





180


embedded image


Ethyl 2-(4-(((4-([[1,1′-biphenyl]-4-yl]- 5-oxo-4,5-dihydro-1H-1,2,4-triazol- 1-yl)methyl)thio)-2-methylphenoxy)- acetate





181


embedded image


2-(2-Methyl-4-((((5-oxo-4-(4′-(tri- fluoromethyl)-[1,1′-biphenyl]-4-yl]- 4,5-dihydro-1H-1,2,4-triazol-1-yl)- methyl)thio)phenoxy)acetic acid





182


embedded image


Ethyl 2-(2-methyl-4-(((5-oxo-4-(4′- (trifluoromethyl)-[1,1′-biphenyl]-4- yl)-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)phenoxy)acetate





183


embedded image


2-(2-Methyl-4-((((5-oxo-4-(4′-(tri- fluoro-methoxy)-[1,1′-biphenyl]-4- yl]-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)phenoxy)acetic acid





184


embedded image


Ethyl 2-(2-methyl-4-((((5-oxo-4-(4′- (trifluoromethoxy)-[1,1′-biphenyl]-4- yl]-4,5-dihydro-1H-1,2,4-triazol-1- yl)methyl)thio)phenoxy)acetate





185


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl-d2)- phenoxy)-2-methylpropionic acid





186


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl-d2)phenoxy)-2-methylpropionate





187


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl-d2)- phenoxy)-2-methylpropionic acid





188


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl-d2)phen- oxy)-2-methylpropionate





189


embedded image


2-(2,6-Diethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





190


embedded image


Ethyl 2-(2,6-diethyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)-2-methylpropionate





191


embedded image


2-(2,6-Diethyl-4-((5-oxo-4-(4-(tri- fluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid





192


embedded image


Ethyl 2-(2,6-diethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionate





193


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid diiso- propylamine salt





194


embedded image


2-(2,6-Dimethyl-4-(2-(5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)ethyl)phenoxy)- 2-methylpropionic acid





195


embedded image


Ethyl 2-(2,6-dimethyl-4-(2-(5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)ethyl)- phenoxy)-2-methylpropionate





196


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methoxy)phen- oxy)-2-methylpropionic acid





197


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methoxy)phen- oxy)-2-methylpropionate





198


embedded image


2-(2,6-Dimethyl-4-(((5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)thio)- phenoxy)-2-methylpropionic acid





199


embedded image


Ethyl 2-(2,6-dimethyl-4-(((5-oxo-4- (4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-l)methyl)- thio)phenoxy)-2-methylpropionate





200


embedded image


2-(2,6-Dimethyl-4-(3-(5-oxo-4-(4- (trifluoromethyl)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)propyl)phen- oxy)-2-methylpropionic acid





201


embedded image


Ethyl 2-(2,6-dimethyl-4-(3-(5-oxo- 4-(4-(trifluoromethyl)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)prop- yl)phenoxy)-2-methylpropionate





202


embedded image


2-(2,6-Dimethyl-4-((4-(4-(methyl- thio)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)phenoxy)- 2-methylpropionic acid





203


embedded image


Ethyl 2-(2,6-dimethyl-4-((4-(4-(meth- ylthio)phenyl)-5-oxo-4,5-dihydro-1H- 1,2,4-triazol-1-yl)methyl)phenoxy)-2- methylpropionate





204


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)propionic acid





205


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5-di- hydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)propionate





206


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)butyric acid





207


embedded image


Ethyl 2-(2,6-dimethyl-4-((5-oxo-4- (4-(trifluoromethoxy)phenyl)-4,5- dihydro-1H-1,2,4-triazol-1-yl)meth- yl)phenoxy)butyrate





208


embedded image


2-(2,6-Dimethyl-4-((5-oxo-4-(4-(tri- fluoromethoxy)phenyl)-4,5-dihydro- 1H-1,2,4-triazol-1-yl)methyl)phen- oxy)-2-methylpropionic acid ber- berine salt









The triazolone compound of the present invention can be use as a pharmaceutical salt. The salt may be a salt formed by the compound of the present invention with metal (including sodium, potassium, calcium, etc.) ions or pharmaceutically acceptable amines (including ethylenediamine, tromethamine, diisopropylamine, meglumine, berberine, metformin, etc.) or ammonium ions.


Provided is use of the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof described herein in the preparation of a PPARα/δ dual agonist.


The triazolone compound described herein is a novel PPARα/δ dual agonist, so the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof of the present invention can be used for preparing a medicament for preventing or treating diseases mediated by PPARα and/or PPARδ.


Specifically, the compound of the present invention can be used for preparing a medicament for preventing and treating the following diseases mediated by PPARα and/or PPARδ.


The compound of the present invention can be used for preventing and treating metabolic diseases and cardiovascular and cerebrovascular diseases, including: insulin resistance, metabolic syndrome, type 1 or type 2 diabetes, hyperlipidemia, obesity, atherosclerosis, myocardial ischemia, myocardial infarction, arrhythmia, coronary heart disease, hypertension, heart failure, myocardial hypertrophy, myocarditis, diabetic complications (including diabetic cardiomyopathy, diabetic nephropathy, diabetic ulcer, retinopathy, neuropathy, etc.), nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, alcoholic fatty liver disease, liver cirrhosis, hyperuricemia, gout, osteoporosis, polycystic ovary syndrome (PCOS), stroke, cerebral infarction, or the like.


The compound of the present invention can be used for preventing and treating inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurological injury diseases, or secondary diseases caused by pathogen infections, including: primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), liver fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis lung disease, interstitial pneumonia, tuberculosis, inflammatory bowel disease (such as Crohn's disease and ulcerative colitis), Behcet's disease, asthma, chronic obstructive pulmonary disease, chronic bronchitis, emphysema, bronchiolitis obliterans, allergic rhinitis, chronic rhinitis, sinusitis, systemic lupus erythematosus, rheumatoid arthritis, spondyloarthritis, osteoarthritis, synovitis, tendonitis, thromboangiitis obliterans, phlebitis, intermittent claudication, keloid, psoriasis, ichthyosis, bullous pemphigoid, dermatitis, contact dermatitis, pancreatitis, chronic nephritis, cystitis, meningitis, gastritis, septicemia, pyoderma gangrenosum, uveitis, Parkinson's disease, Alzheimer's disease, α-synucleinopathy, depression, multiple sclerosis, amyotrophic lateral sclerosis, fibromyalgia syndrome, neuralgia, Down's syndrome, Hallervorden-Spatz disease, Huntington's chorea, Wilson's disease, or the like.


The compound of the present invention can be used for treating and regulating mitochondrial dysfunction and disorder diseases, including: myasthenia, myoclonus, exercise intolerance, Kearns-Sayre syndrome, chronic fatigue syndrome, Leigh's syndrome, mitochondrial myopathy-encephalopathy-hyperlactacidemia, stroke syndrome or stroke-like episodes, Duchenne muscular dystrophy, Becker muscular dystrophy, Friedreich's ataxia, or the like.


The compound of the present invention can be used for treating tumors, including: bone cancer, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, myeloproliferative disease, multiple myeloma, myelodysplastic syndrome, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hemangioma, granuloma, xanthoma, meningosarcoma, neuroglioma, astrocytoma, medulloblastoma, ependymoma, germ cell tumor (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, fibroneuroma, sarcoma, esophagus cancer, gastric cancer, pancreatic cancer, colorectal cancer, colon cancer, rectal cancer, renal cancer, prostate cancer, lymphatic cancer, testicular cancer, interstitial cell cancer, lung cancer, liver cancer, skin cancer, malignant melanoma, basal cell carcinoma, or the like.


The present invention also provides a pharmaceutical composition for preventing or treating diseases mediated by PPARα and/or PPARδ, which comprises a therapeutically effective amount of the triazolone compound of formula (I) or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof described herein as an active ingredient and a pharmaceutically acceptable carrier. The carrier that can be arbitrarily mixed may vary depending on the dosage form, the administration form, and the like. Examples of carriers include excipients, binders, disintegrants, lubricants, corrigents, flavoring agents, coloring agents, sweetening agents, and the like. The pharmaceutical composition can be in the form of a capsule, a powder, a tablet, a granule, a pill, an injection, a syrup, an oral liquid, an inhalant, an ointment, a suppository, a patch, or other pharmaceutically conventional preparations.


If desired, the compound of the present invention can be used in combination with one or more other types of agents for preventing or treating diseases mediated by PPARα and/or PPARδ, including but not limited to the following combinations.


Other types of prophylactic or therapeutic agents that may be selected for use in combination with the compound of the present invention may be one or more anti-diabetic agents, including metformin, sulfonylurea hypoglycemic agents (e.g., glibenclamide, glimepiride, etc.), glucosidase inhibitors (e.g., acarbose, miglitol, etc.), PPARγ agonists (e.g., pioglitazone and rosiglitazone), PPARα/y dual agonists, dipeptidyl peptidase IV (DPP-IV) inhibitors (e.g., sitagliptin, saxagliptin, alogliptin, linagliptin, etc.), meglitinide hypoglycemic agents (e.g., repaglinide, nateglinide, etc.), SGLT2 inhibitors (e.g., canagliflozin, daragliflozin, empagliflozin, ipragliflozin, luseogliflozin, tofogliflozin, etc.), glucokinase agonists (e.g., HMS5552, etc.), glucose kinase agonists, insulin, glucagon-like peptide-1 (GLP-1) agents (e.g., exenatide, liraglutide, lixisenatide, dulaglutide, benaglutide, albiglutide, etc.), PTP1B inhibitors, glycogen phosphorylase inhibitors, glucose-6-phosphatase inhibitors, AMPK agonists (e.g., berberine), GPR40 agonists, or GPR120 agonists.


Other types of prophylactic or therapeutic agents that may be selected for use in combination with the compound of the present invention may be one or more weight-loss agents, including lorcaserin, orlistat, glucagon-like peptide-1 (GLP-1) agents (e.g., exenatide, liraglutide, lixisenatide, dulaglutide, benaglutide, albiglutide, etc.), and the like.


Other types of prophylactic or therapeutic agents that may be selected for use in combination with the compound of the present invention may be one or more anti-nonalcoholic fatty liver disease agents, including: AMPK agonists (e.g., metformin), Farnesoid X receptor (FXR) agonists (e.g., obeticholic acid, GS-9674, EDP-305, LJN452, etc.), acetyl-CoA carboxylase (ACC) inhibitors (e.g., GS-0976, etc.), apoptosis signal-regulating kinase-1 (ASK1) inhibitors (e.g., Selosertib, etc.), PPAR agonists (e.g., Elafibranor, Saroglitazar, IVA337, MSDC-0602K, etc.), caspase inhibitors (e.g., Emricasan, etc.), stearoyl-CoA desaturase 1 (SCD1) inhibitors (e.g., Aramchol, etc.), long-acting glucagon-like peptide-1 (GLP-1) receptor agonists (e.g., Semaglutide, etc.), apical sodium-dependent bile acid transporter (ASBT) inhibitors (e.g., Volixibat, etc.), vascular adhesion protein 1 (VAP-1) inhibitors (e.g., BI 1467335, etc.), CCR5R blockers (e.g., Cenicriviroc, etc.), thyroid hormone receptorβ (THR-β) agonists (e.g., MGL-3196, etc.), and the like.


Other types of prophylactic or therapeutic agents that may be selected for use in combination with the compound of the present invention may be one or more hypolipidemic agents, including nicotinic acid, statins (e.g., lovastatin, simvastatin, pravastatin, mevastatin, fluvastatin, atorvastatin, cerivastatin, rosuvastatin, and pitavastatin), cholesterol absorption inhibitors (e.g., ezetimibe, etc.), fibrates (e.g., clofibrate, bezafibrate, fenofibrate, etc.), PCSK9 inhibitors (e.g., Evolocumab, Alirocumab, etc.), CETP inhibitors (e.g., anacetrapib, etc.), AMPK agonists, ACC inhibitors (e.g., GS-0976, etc.), and the like.


The amount of the compound of formula (I) or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof of the present invention may be appropriately changed depending on the age, body weight, and symptoms of a patient, the administration route, and the like. For adults, the lower limit of a single dose is 0.1 mg (preferably 1 mg) and the upper limit is 1000 mg (preferably 500 mg) in oral administration; in the case of intravenous administration, the lower limit of a single dose is 0.01 mg (preferably 0.1 mg) and the upper limit is 500 mg (preferably 250 mg). The dose range may also vary depending on the degree of disease and the dosage form.


GFT505 is a PPARα/δ dual agonist in a phase III clinical research, but it has weak agonistic activity for PPARα and PPARδ and poor liver microsome stability. The inventor believes that this may have contributed to the poor interim results of the phase III clinical trial. Considering that the structure of “α,β-unsaturated ketone” in the GFT505 molecule may be the reason for its poor liver microsome stability, the inventor tries to replace the “α,β-unsaturated ketone” fragment in the molecular structure by means of molecular docking simulation, and then designs and synthesizes the triazolone compound of the present invention. By testing the agonistic activity of the triazolone compounds for PPAR, it is surprisingly found that: when the structure of “α,β-unsaturated ketone” is replaced by a “triazolone” fragment, a series of compounds with much stronger agonistic activity for PPARα and PPARδ than GFT505 can be obtained, and the compounds of the present invention have much better liver microsomal stability than GFT505.


Advantages: Compared with the prior art, the present invention has the following advantages:


(1) The present invention provides a novel triazolone compound, which has a strong and activity-balanced agonistic effect on both PPARα and PPARδ. Under the same test system, the activity of the compound is significantly better than that of the PPARα/δ dual agonist reported in the literature, such as the phase III clinical trial drug GFT505 and compound 5c with the optimal activity reported in the literature at present (ACS Med. Chem. Lett., 2019, 10, 1068).


(2) By analyzing the eutectic structure of PPARδ and compound 61, the inventor unexpectedly found that in the present invention, in addition to the key hydrogen bonding interactions between the carboxylic acid group of compound 61 and the three key amino acid residues His287, His413 and Tyr437 of PPARδ, a special “water bridge” hydrogen bonding interaction exists between the triazolone structure of the compound and the amino acid Thr253 of PPARδ. No other types of PPARδ agonists and PPARδ have been reported in the literature to have the special “water bridge” hydrogen bonding interaction, which may be the main reason for the better efficacy and selectivity of the triazolone derivative PPAR agonist of the present invention.


(3) Compared with the phase III clinical trial drug GFT505, the compounds of the present invention have better metabolic stability and good pharmacokinetic properties in vivo. Therefore, the compounds and the pharmaceutically acceptable salts, the tautomers, the mesomers, the racemates, the stereoisomers, the metabolites, the metabolic precursors, the prodrugs or the solvates thereof of the present invention can be used for preparing a PPARα/δ dual agonist, and further can be used for preparing a medicament for preventing or treating diseases mediated by PPARα and/or PPARδ.


(4) The compounds of the present invention show very high selectivity for activating PPARα/PPARδ relative to activating PPARγ, and the selectivity is significantly better than that of GFT505 and compound 5c. However, it is well known that activation of PPARγ leads to the risk of weight gain, bone fracture and heart failure (Toxicol.sci., 2006, 90, 269). Therefore, the compounds of the present invention have potential advantages in terms of safety. In addition, the compounds of the present invention have no significant agonistic activity for other various nuclear receptors, showing high selectivity for PPARα/δ.


(5) In various experiments on NASH model mice, the compounds (such as compound 61) of the present invention have better anti-NASH efficacy than clinically investigational PPAR agonists GFT505 and IVA337 at the same dose.


(6) The triazolone compounds of the present invention are ingenious in design, simple in structure, cheap and easily available in starting materials, safe and environment-friendly in synthesis process, and easy for large-scale production.





DESCRIPTION OF DRAWINGS


FIG. 1 shows the effect of compound 57 on the lipid metabolism-associated gene expression of HepG2 cells (n=3, vs. blank control group, *p<0.05, **p<0.01, *** p<0.001);



FIG. 2 shows the effect of compound 61 on the lipid metabolism-associated gene expression of HepG2 cells (n=3, vs. blank control group, *p<0.05, **p<0.01, *** p<0.001);



FIG. 3 shows the effect of compound 57 on LPS-induced inflammation-associated gene expression of THP1 cells (n=3, vs. LPS group, *p<0.05, **p<0.01, *** p<0.001);



FIG. 4 shows the effect of compound 61 on serum alanine transaminase (ALT) in NASH model mice (n=9-10, vs. MCS group, ###p<0.001; vs. CDAA group, *p<0.05, ***p<0.001; vs. compound 61 medium dose group, $$$p<0.001);



FIG. 5 shows the effect of compound 61 on serum aspartate transaminase (AST) in NASH model mice (n=9-10, vs. MCS group, ###p<0.001; vs. CDAA group, *p<0.05, ***p<0.001; vs. compound 61 medium dose group, $$$p<0.001);



FIG. 6 shows the effect of compound 61 on liver inflammation-associated genes of NASH model mice (n=9-10, vs. MCS group, #p<0.05, ##p<0.01, ###p<0.001; vs. CDAA group, *p<0.05, **p<0.01, ***p<0.001; vs. compound 61 medium dose group, $p<0.05, $$p<0.01);



FIG. 7 shows the effect of compound 61 on liver fibrosis-associated genes of NASH model mice (n=9-10, vs. MCS group, #p<0.05, ###p<0.001; vs. CDAA group, *p<0.05, **p<0.01, ***p<0.001; vs. compound 61 medium dose group, $$$p<0.01);



FIG. 8 shows HE staining diagrams of liver sections for the therapeutic effect of compound 61 on NASH model mice;



FIG. 9 shows sirius red staining diagrams of liver sections for the therapeutic effect of compound 61 on NASH model mice;



FIG. 10 shows oil red staining diagrams of liver sections for the therapeutic effect of compound 61 on NASH model mice;



FIG. 11 shows the effect of compound 61 on hepatic hydroxyproline content in liver fibrosis model mice (n=10, vs. Oil group, ###p<0.001; vs. CCl4 group, ***p<0.001; vs. compound 61 medium dose group, $$$p<0.001);



FIG. 12 shows graphs of Western-Blot results and grayscale scan for the effect of compound 61 on the expression of αSMA and Collal proteins in the liver of liver fibrosis model mice (n=10, vs. Oil group, ##p<0.01, ###p<0.001; vs. CCl4 group, *p<0.05);



FIG. 13 shows HE staining diagrams of liver sections for the therapeutic effect of compound 61 on liver fibrosis model mice;



FIG. 14 shows sirius red staining diagrams of liver sections for the therapeutic effect of compound 61 on liver fibrosis model mice;



FIG. 15 shows heat maps for the effect of compound 61 on the target gene expression of PPARα/δ in mouse liver and skeletal muscle tissues;



FIG. 16 shows a heat map for the selectivity of compound 61 for various nuclear receptors;



FIG. 17 shows a diagram of the eutectic structure of compound 61 with a PPARδ protein.





DETAILED DESCRIPTION

The content of the present invention will be specifically described below through examples. In the present invention, the following examples are given for better illustrating the present invention and are not intended to limit the scope of the present invention. Various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.


Example 1
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-flu orophenoxy)ethyl-2-methylpropionic acid (Compound 1)



embedded image


embedded image


Synthesis of Intermediate I-1

p-Bromoaniline (3.44 g, 20 mmol) was dissolved in ethyl acetate (EA) (25 mL), pyridine (Py) (1.74 g, 22 mmol) was added, and phenyl chloroformate (3.44 g, 22 mmol) was slowly added under an ice bath. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was washed with water (50 mL×3). The organic phase was washed with saturated brine (20 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate I-1, which was directly used in the next step without further purification.


Synthesis of Intermediate I-2

All the residues obtained from the post-processing of the previous step containing intermediate I-1 (i.e., the crude product of I-1) were dissolved in glycol dimethyl ether (25 mL), and 98% hydrazine hydrate (2.67 mL) was added. The mixture was stirred at room temperature for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent, and EA (6 mL) was added to the residue. The mixture was stirred at room temperature for 12 h, and filtered under reduced pressure to give intermediate I-2 (white solid, 3.79 g).


Synthesis of Intermediate I-3

Intermediate I-2 (3.79 g, 16 mmol) was dissolved in acetonitrile (20 mL), and formamidine acetate (6.60 g, 64 mmol) was added. The mixture was stirred at room temperature for 30 min, and acetic acid (4.8 mL) was added. The system was transferred to an oil bath and reacted at 80° C. for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (50 mL) was added to the residue, and the resulting mixture was extracted with ethyl acetate (25 mL×3). The organic phase was washed with saturated brine (20 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. A mixed solution of petroleum ether (5 mL) and ethyl acetate (1 mL) was added to the residue. The mixture was stirred at room temperature for 2 h and filtered under reduced pressure to give intermediate I-3 (orange solid, 2.05 g).


Synthesis of Intermediate I-4

Intermediate I-3 (2.05 g, 8.5 mmol) was dissolved in acetonitrile (15 mL), and paraformaldehyde (PFA) (1.275 g, 42.5 mmol) and acetic acid (60 mg, 1 mmol) were added. The system was transferred to an oil bath and reacted at 60° C. for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=2:1) to give intermediate I-4 (white solid, 1.59 g).


Synthesis of Intermediate I-5

o-Fluorophenol (6.72 g, 60 mmol) was dissolved in acetonitrile (150 mL), and ethyl 2-bromoisobutyrate (34.8 g, 180 mmol) and cesium carbonate (48.9 g, 150 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 12 h. After the reaction was completed, the reaction liquid was filtered under reduced pressure through a Buchner funnel. The filtrate was diluted with water (500 mL), extracted with ethyl acetate (200 mL×6), washed with 1 N sodium hydroxide (200 mL×3), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a residue of intermediate I-5, which was directly used in the next step without further purification.


Synthesis of Intermediate I-6

Chlorosulfonic acid (18.0 mL, 270 mmol) was slowly added to all the residues obtained from the post-processing of the previous step containing intermediate I-5 at −20° C. The reaction system was warmed to −13° C. and reacted for 1 h. After the reaction was completed, the reaction system was poured into 200 mL of ice water, stirred for 30 min, extracted with ethyl acetate (200 mL×3), washed with saturated brine (150 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a residue of intermediate I-6, which was directly used in the next step without further purification.


Synthesis of Intermediate I-7

All the residues obtained from the post-processing of the previous step containing intermediate I-6 were dissolved in absolute ethanol (10 mL), and a saturated hydrogen chloride-ethanol (HCl-EtOH) solution (25 mL) and tin (Sn) powder (2.98 g, 25 mL) were added. The system was transferred to an oil bath and reacted at 80° C. for 24 h. After the reaction was completed, the reaction liquid was filtered under reduced pressure through a Buchner funnel, and the filtrate was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (50 mL), extracted with ethyl acetate (25 mL×3), washed with saturated brine (25 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=80:1) to give intermediate I-7 (yellow liquid, 1.86 g).


Synthesis of Compound 2

Intermediate I-4 (358.6 mg, 1.3 mmol) was dissolved in 5 mL of anhydrous dichloromethane (DCM), and triethylamine (262.6 mg, 2.6 mmol) and methylsufonyl chloride (MsCl) (229.2 mg, 2 mmol) were added. The mixture was stirred at room temperature for 2 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (20 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (20 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was dissolved in acetonitrile (10 mL), and intermediate I-7 (508 mg, 2 mmol) and cesium carbonate (1.07 g, 3.3 mmol) were added. The mixture was stirred at room temperature for 3 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=5:1) to give compound 2 (colorless liquid, 519.8 mg).


Synthesis of Compound 1

Compound 2 (80 mg, 0.16 mmol) was dissolved in methanol (3 mL), and a 1 N NaOH solution (0.78 mL) was added. The reaction system was transferred to an oil bath and reacted at 80° C. for 4 h. After the reaction was completed, a 1 N HCl solution was added to adjust pH to 4, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (10 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (10 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 1 (white solid, 28.8 mg): 1H NMR (300 MHz, DMSO-d6) δ 13.54-12.77 (s, 1H), 8.54 (s, 1H), 7.66 (dd, J=30.8, 8.9 Hz, 4H), 7.45 (dd, J=11.5, 2.1 Hz, 1H), 7.17 (d, J=8.2 Hz, 1H), 6.93 (d, J=8.7 Hz, 1H), 5.26 (s, 2H), 1.47 (s, 6H). HRMS (ESI) calcd. for C19H17BrFN3O4S [M+H]+ 482.0185, found 482.0185.


Example 2
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-fluoropheno xy)ethyl-2-methylpropionate (Compound 2)



embedded image


Compound 2 was prepared without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.62 (d, J=8.7 Hz, 2H), 7.42 (d, J=8.7 Hz, 2H), 7.32 (d, J=2.2 Hz, 1H), 7.20 (d, J=8.6 Hz, 1H), 6.92 (t, J=8.5 Hz, 1H), 5.20 (s, 2H), 4.24 (d, J=7.1 Hz, 2H), 1.58 (s, 6H), 1.28 (t, J=7.1 Hz, 3H). MS (ESI): m/z 532.3 [M+Na]+.


Example 3
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-chl orophenoxy)-2-methylpropionic acid (Compound 3)



embedded image


Compound 3 was prepared by replacing o-fluorophenol in Example 1 with o-chlorophenol according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.54 (s, 1H), 7.70 (s, 2H), 7.61 (d, J=9.1 Hz, 3H), 7.34 (dd, J=8.6, 2.3 Hz, 1H), 6.86 (d, J=8.6 Hz, 1H), 5.24 (s, 2H), 1.51 (s, 6H). HRMS (ESI) calcd. for C19H17BrClN3O4S [M+H]+ 497.9890, found 497.9881.


Example 4
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-chloropheno xy)ethyl-2-methylpropionate (Compound 4)



embedded image


Compound 4 was prepared by replacing o-fluorophenol in Example 1 with o-chlorophenol without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.62 (d, J=8.8 Hz, 2H), 7.54 (d, J=2.2 Hz, 1H), 7.41 (d, J=8.8 Hz, 2H), 7.33 (dd, J=8.6, 2.3 Hz, 1H), 6.83 (d, J=8.6 Hz, 1H), 5.17 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.61 (s, 6H), 1.26 (t, J=3.5 Hz, 3H). MS (ESI): m/z 548.2 [M+Na]+.


Example 5
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)-2-methylpropionic acid (Compound 5)



embedded image


Compound 5 was prepared by replacing o-fluorophenol in Example 1 with o-cresol according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.01 (s, 1H), 8.52 (s, 1H), 7.66 (dd, J=31.7, 8.8 Hz, 4H), 7.21 (d, J=23.9 Hz, 2H), 6.63 (d, J=8.5 Hz, 1H), 5.14 (s, 2H), 2.09 (s, 3H), 1.48 (s, 6H). HRMS (ESI) calcd. for C20H20BrN3O4S [M+H]+478.0436, found 478.0432.


Example 6
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylpheno xy)ethyl-2-methylpropionate (Compound 6)



embedded image


Compound 6 was prepared by replacing o-fluorophenol in Example 1 with o-cresol without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.70 (s, 1H), 7.61 (d, J=8.8 Hz, 2H), 7.40 (d, J=8.8 Hz, 2H), 7.31 (d, J=1.8 Hz, 1H), 7.21 (dd, J=8.5, 2.2 Hz, 1H), 6.59 (d, J=8.5 Hz, 1H), 5.14 (s, 2H), 4.22 (q, J=7.1 Hz, 2H), 2.19 (s, 3H), 1.59 (s, 6H), 1.24 (t, J=7.1 Hz, 3H). MS (ESI): m/z 528.3 [M+Na]+.


Example 7
2-(4-(((4-(4-Fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 7)



embedded image


Compound 7 was prepared by replacing p-bromoaniline in Example 1 with p-fluoroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.48 (s, 1H), 7.65 (dd, J=8.9, 4.8 Hz, 2H), 7.37 (t, J=8.8 Hz, 2H), 7.30-7.16 (m, 2H), 6.78 (d, J=8.7 Hz, 1H), 5.15 (s, 2H), 4.68 (s, 2H), 2.13 (s, 3H). ESI-MS: m/z 388.1 [M−H]−.


Example 8
Ethyl 2-(4-(((4-(4-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylpheno xy)acetate (Compound 8)



embedded image


Compound 8 was prepared by replacing p-bromoaniline in Example 1 with p-fluoroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.67 (s, 1H), 7.51-7.42 (m, 2H), 7.33 (d, J=7.3 Hz, 2H), 7.18 (t, J=8.5 Hz, 2H), 6.65 (d, J=8.8 Hz, 1H), 5.16 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.31 (t, J=7.1 Hz, 3H). MS (ESI): m/z 440.1 [M+Na]+.


Example 9
2-(4-(((4-(4-Chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 9)



embedded image


Compound 9 was prepared by replacing p-bromoaniline in Example 1 with p-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.99 (s, 1H), 8.52 (s, 1H), 7.67 (d, J=8.5 Hz, 2H), 7.58 (d, J=8.5 Hz, 2H), 7.34-7.07 (m, 2H), 6.79 (d, J=8.6 Hz, 1H), 5.14 (s, 2H), 4.68 (s, 2H), 2.13 (s, 3H). ESI-MS: m/z 404.1 [M−H]−.


Example 10
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 10)



embedded image


Compound 10 was prepared by replacing o-fluorophenol in Example 1 with o-cresol and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.53 (s, 1H), 7.72 (d, J=8.8 Hz, 2H), 7.61 (d, J=8.8 Hz, 2H), 7.26-7.14 (m, 2H), 6.72 (d, J=9.2 Hz, 1H), 5.12 (s, 2H), 4.48 (s, 2H), 2.11 (s, 3H). ESI-MS: m/z 448.0 [M−H]−.


Example 11
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylpheno xy)acetate (Compound 11)



embedded image


Compound 11 was prepared by replacing o-fluorophenol in Example 1 with o-cresol and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.70 (s, 1H), 7.61 (d, J=8.7 Hz, 2H), 7.40 (d, J=8.7 Hz, 2H), 7.32 (d, J=7.1 Hz, 2H), 6.65 (d, J=8.9 Hz, 1H), 5.15 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.31 (t, J=7.2 Hz, 3H). MS (ESI): m/z 500.1 [M+Na]+.


Example 12
2-(4-(((4-(4-Iodophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-meth ylphenoxy)acetic acid (Compound 12)



embedded image


Compound 12 was prepared by replacing p-bromoaniline in Example 1 with p-iodoaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.50 (s, 1H), 7.85 (d, J=8.6 Hz, 2H), 7.44 (d, J=8.6 Hz, 2H), 7.29-7.18 (m, 2H), 6.77 (d, J=9.1 Hz, 1H), 5.12 (s, 2H), 4.67 (s, 2H), 2.11 (s, 3H). HRMS (ESI) calcd. for C18H16IKN3O4S [M+K]+535.95433, found 535.95587.


Example 13
Ethyl 2-(4-(((4-(4-iodophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphenox y)acetate (Compound 13)



embedded image


Compound 13 was prepared by replacing p-bromoaniline in Example 1 with p-iodoaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.81 (d, J=8.7 Hz, 2H), 7.70 (s, 1H), 7.32 (d, J=7.0 Hz, 2H), 7.27 (d, J=4.6 Hz, 2H), 6.65 (d, J=9.0 Hz, 1H), 5.15 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.31 (t, J=7.1 Hz, 3H). MS (ESI): m/z 548.1 [M+Na]+.


Example 14
2-(4-(((4-(4-Methoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphenoxy)acetic acid (Compound 14)



embedded image


Compound 14 was prepare by replacing p-bromoamine in Example 1 with p-methoxyaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.00 (s, 1H), 8.38 (s, 1H), 7.48 (d, J=9.0 Hz, 2H), 7.30-7.22 (m, 2H), 7.06 (d, J=9.0 Hz, 2H), 6.79 (d, J=9.2 Hz, 1H), 5.14 (s, 2H), 4.68 (s, 2H), 3.79 (s, 3H), 2.14 (s, 3H). ESI-MS: m/z 400.2 [M−H].


Example 15
2-(2-Methyl-4-(((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetic acid (Compound 15)



embedded image


Compound 15 was prepared by replacing p-bromoaniline in Example 1 with p-trifluoromethoxyaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.00 (s, 1H), 8.54 (s, 1H), 7.77 (d, J=9.0 Hz, 2H), 7.54 (d, J=8.6 Hz, 2H), 7.30-7.21 (m, 2H), 6.79 (d, J=9.2 Hz, 1H), 5.15 (s, 2H), 4.69 (s, 2H), 2.13 (s, 3H). ESI-MS: m/z 454.2 [M−H].


Example 16
2-(2-Methyl-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-y l)methyl)thio)phenoxy)acetic acid (Compound 16)



embedded image


Compound 16 was prepared by replacing p-bromoaniline in Example 1 with p-trifluoromethylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.06 (s, 1H), 8.64 (s, 1H), 7.96-7.84 (m, 4H), 7.30-7.21 (m, 2H), 6.79 (d, J=9.1 Hz, 1H), 5.16 (s, 2H), 4.68 (s, 2H), 2.12 (s, 3H). ESI-MS: m/z 438.2 [M−H].


Example 17
Ethyl 2-(2-methyl-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetate (Compound 17)



embedded image


Compound 17 was prepared by replacing p-bromoaniline in Example 1 with p-trifluoromethylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.77 (d, J=10.1 Hz, 2H), 7.69 (d, J=8.6 Hz, 2H), 7.33 (d, J=6.1 Hz, 2H), 6.68-6.63 (m, 1H), 5.17 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.31 (t, J=7.1 Hz, 3H). ESI-MS: m/z 490.1 [M+Na]+.


Example 18
2-(2-Methyl-4-(((5-oxo-4-phenyl-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)pheno xy)acetic acid (Compound 18)



embedded image


Compound 18 was prepared by replacing p-bromoaniline in Example 1 with aniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.99 (s, 1H), 8.50 (s, 1H), 7.62 (d, J=8.2 Hz, 2H), 7.52 (t, J=7.8 Hz, 2H), 7.38 (t, J=7.3 Hz, 1H), 7.29-7.21 (m, 2H), 6.80 (d, J=9.2 Hz, 1H), 5.16 (s, 2H), 4.69 (s, 2H), 2.14 (s, 3H). HRMS (ESI) calcd. for C18H17N3O4S [M+Na]+394.08375, found 394.08348.


Example 19
2-(2-Methyl-4-(((5-oxo-4-(4-((trifluoromethyl)thio)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)4-methyl)thio)phenoxy)acetic acid (Compound 19)



embedded image


Compound 19 was prepared by replacing p-bromoaniline in Example 1 with p-trifluoromethioaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.98 (s, 1H), 8.60 (s, 1H), 7.84 (q, J=8.9 Hz, 4H), 7.23 (d, J=5.1 Hz, 2H), 6.76 (d, J=9.1 Hz, 1H), 5.14 (s, 2H), 4.67 (s, 2H), 2.10 (s, 3H). HRMS (ESI) calcd. for C19H16F3N3O4S2 [M+H]+ 472.0613, found 472.0613.


Example 20
2-(4-(((4-(4-Ethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphenoxy)acetic acid (Compound 20)



embedded image


Compound 20 was prepared by replacing p-bromoaniline in Example 1 with p-ethylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.98 (s, 1H), 8.45 (s, 1H), 7.50 (d, J=8.3 Hz, 2H), 7.34 (d, J=8.3 Hz, 2H), 7.29-7.22 (m, 2H), 6.79 (d, J=9.1 Hz, 1H), 5.15 (s, 2H), 4.69 (s, 2H), 2.64 (q, J=7.6 Hz, 2H), 2.14 (s, 3H), 1.19 (t, J=7.6 Hz, 3H). HRMS (ESI) calcd. for C20H22N3O4S [M+H]+ 400.13310, found 400.13260.


Example 21
Ethyl 2-(4-(((4-(4-ethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphenox y)acetate (Compound 21)



embedded image


Compound 21 was prepared by replacing p-bromoaniline in Example 1 with p-ethylaniline, o-fluorophenol with o-cresol and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.68 (s, 1H), 7.38 (d, J=8.4 Hz, 2H), 7.34 (d, J=7.3 Hz, 2H), 7.28 (s, 2H), 6.65 (d, J=9.1 Hz, 1H), 5.16 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.2 Hz, 2H), 2.70 (q, J=7.6 Hz, 2H), 2.26 (s, 3H), 1.31 (t, J=5.8 Hz, 3H), 1.26 (t, J=6.2 Hz, 3H). MS (ESI): m/z 450.2 [M+Na]+.


Example 22
2-(2-Methyl-4-(((4-(4-nitrophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thi o]phenoxy)acetic acid (Compound 22)



embedded image


Compound 22 was prepared by replacing p-bromoaniline in Example 1 with p-nitroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.99 (s, 1H), 8.73 (s, 1H), 8.39 (d, J=9.0 Hz, 2H), 8.01 (d, J=9.0 Hz, 2H), 7.29-7.21 (m, 2H), 6.79 (d, J=9.0 Hz, 1H), 5.18 (s, 2H), 4.69 (s, 2H), 2.12 (s, 3H). HRMS (ESI) calcd. for CisHi6N4NaO6S [M+Na]+439.06882, found 439.06834.


Example 23
2-(4-(((4-(4-Ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 23)



embedded image


Compound 23 was prepared by replacing p-bromoaniline in Example 1 with p-ethoxyaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.99 (s, 1H), 8.38 (s, 1H), 7.46 (d, J=8.9 Hz, 2H), 7.32-7.21 (m, 2H), 7.03 (d, J=9.0 Hz, 2H), 6.79 (d, J=9.2 Hz, 1H), 5.13 (s, 2H), 4.68 (s, 2H), 4.06 (q, J=6.9 Hz, 2H), 2.14 (s, 3H), 1.33 (t, J=7.0 Hz, 3H). HRMS (ESI) calcd. for C20H22N3O5S [M+H]+416.12802, found 416.12760.


Example 24
Ethyl 2-(4-(((4-(4-ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphen oxy)acetate (Compound 24)



embedded image


Compound 24 was prepared by replacing p-bromoaniline in Example 1 with p-ethoxyaniline, o-fluorophenol with o-cresol and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.63 (s, 1H), 7.38-7.35 (m, 2H), 7.33 (d, J=3.1 Hz, 2H), 6.97 (d, J=8.9 Hz, 2H), 6.65 (d, J=8.5 Hz, 1H), 5.16 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 4.07 (q, J=7.0 Hz, 2H), 2.26 (s, 3H), 1.45 (t, J=7.0 Hz, 3H), 1.31 (t, J=7.1 Hz, 3H). MS (ESI): m/z 466.2 [M+Na]+.


Example 25
2-(2-Methyl-4-(((4-(4-(methylsulfonyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl]thio)phenoxy)acetate(Compound 25)



embedded image


Compound 25 was prepared by replacing p-bromoaniline in Example 1 with p-methylsulfonylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 13.00 (s, 1H), 8.67 (s, 1H), 8.07 (d, J=8.6 Hz, 2H), 7.96 (d, J=8.7 Hz, 2H), 7.29-7.22 (m, 2H), 6.79 (d, J=9.1 Hz, 1H), 5.17 (s, 2H), 4.69 (s, 2H), 3.26 (s, 3H), 2.13 (s, 3H). HRMS (ESI) calcd. for C19H19N3NaO6S2 [M+Na]+472.06130, found 472.06069.


Example 26
2-(4-(((4-(2-Chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 26)



embedded image


Compound 26 was prepared by replacing p-bromoaniline in Example 1 with o-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.25 (s, 1H), 7.73-7.65 (m, 1H), 7.58-7.49 (m, 3H), 7.31-7.23 (m, 2H), 6.80 (d, J=8.3 Hz, 1H), 5.14 (s, 2H), 4.69 (s, 2H), 2.15 (s, 3H). HRMS (ESI) calcd. for C18H17ClN3O4S [M+H]+ 406.06283, found 406.06248.


Example 27
Ethyl 2-(4-(((4-(2-chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylpheno xy)acetate (Compound 27)



embedded image


Compound 27 was prepared by replacing p-bromoaniline in Example 1 with o-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.61 (s, 1H), 7.58-7.52 (m, 1H), 7.42 (d, J=5.7 Hz, 1H), 7.39 (d, J=3.0 Hz, 2H), 7.34 (d, J=6.4 Hz, 2H), 6.65 (d, J=9.1 Hz, 1H), 5.16 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 456.1 [M+Na]+.


Example 28
2-(4-(((4-(2-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetic acid (Compound 28)



embedded image


Compound 28 was prepared by replacing p-bromoaniline in Example 1 with o-bromoaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.24 (s, 1H), 7.89-7.80 (m, 1H), 7.59-7.43 (m, 3H), 7.30 (d, J=1.6 Hz, 1H), 7.26 (dd, J=8.5, 2.0 Hz, 1H), 6.81 (d, J=8.5 Hz, 1H), 5.14 (s, 2H), 4.69 (s, 2H), 2.16 (s, 3H). HRMS (ESI) calcd. for C18H17BrN3O4S [M+H]+ 452.01027, found 452.01044.


Example 29
Ethyl 2-(4-((4-(2-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylpheno xy)acetate (Compound 29)



embedded image


Compound 29 was prepared by replacing p-bromoaniline in Example 1 with o-bromoaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.72 (d, J=7.7 Hz, 1H), 7.59 (s, 1H), 7.46 (t, J=7.6 Hz, 1H), 7.37 (d, J=2.7 Hz, 2H), 7.33 (d, J=8.0 Hz, 2H), 6.65 (d, J=9.0 Hz, 1H), 5.17 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.2 Hz, 3H). MS (ESI): m/z 500.1 [M+Na]+.


Example 30
2-(2-Methyl-4-(((5-oxo-4-(2-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-l-y l)methyl)thio)phenoxy)acetic acid (Compound 30)



embedded image


Compound 30 was prepared by replacing p-bromoaniline in Example 1 with o-trifluoromethylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.20 (s, 1H), 7.95 (d, J=7.9 Hz, 1H), 7.88 (t, J=7.5 Hz, 1H), 7.77 (t, J=7.7 Hz, 1H), 7.57 (d, J=7.8 Hz, 1H), 7.30-7.22 (m, 2H), 6.81 (d, J=8.3 Hz, 1H), 5.12 (s, 2H), 4.70 (s, 2H), 2.16 (s, 3H). HRMS (ESI) calcd. for C19H17F3N3O4S [M+H]+ 440.08919, found 440.08896.


Example 31
Ethyl 2-(2-methyl-4-(((5-oxo-4-(2-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetate (Compound 31)



embedded image


Compound 31 was prepared by replacing p-bromoaniline in Example 1 with o-trifluoromethylaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.83 (d, J=7.9 Hz, 1H), 7.73 (t, 1H), 7.62 (t, 1H), 7.49 (s, 1H), 7.39 (d, J=8.1 Hz, 1H), 7.34 (d, J=8.5 Hz, 2H), 6.66 (d, J=8.1 Hz, 1H), 5.14 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=14.2, 7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 490.1 [M+Na]+.


Example 32
2-(4-(((4-(4-Chloro-3-methylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)t hio)-2-methylphenoxy)actic acid (Compound 32)



embedded image


Compound 32 was prepared by replacing p-bromoaniline in Example 1 with 3-methyl-4-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.51 (s, 1H), 7.74 (d, J=2.1 Hz, 1H), 7.55-7.43 (m, 2H), 7.30-7.16 (m, 2H), 6.77 (d, J=9.1 Hz, 1H), 5.12 (s, 2H), 4.66 (s, 2H), 2.34 (s, 3H), 2.11 (s, 3H). HRMS (ESI) calcd. for C19H19ClN3O4S [M+H]+ 420.07848, found 420.07738.


Example 33
Ethyl 2-(4-(((4-(4-chloro-3-methylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-me thylphenoxy)acetate (Compound 33)



embedded image


Compound 33 was prepare by replacing p-bromoaniline in Example 1 with 3-methyl-4-chloroaniline, o-fluorophenol with o-cresol and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.68 (s, 1H), 7.52 (s, 1H), 7.32 (s, 4H), 6.65 (d, J=9.0 Hz, 1H), 5.15 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.42 (s, 3H), 2.26 (s, 3H), 1.31 (t, J=7.1 Hz, 3H). MS (ESI): m/z 470.1 [M+Na]+.


Example 34
2-(4-(((4-(2-Bromo-5-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)th io)-2-methylphenoxy)acetic acid (Compound 34)



embedded image


Compound 34 was prepared by replacing p-bromoaniline in Example 1 with 2-bromo-5-fluoroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 8.24 (s, 1H), 7.89 (dd, J=8.9, 5.6 Hz, 1H), 7.57 (dd, J=9.0, 3.0 Hz, 1H), 7.44-7.36 (m, 1H), 7.32-7.24 (m, 2H), 6.80 (d, J=8.4 Hz, 1H), 5.14 (s, 2H), 4.66 (s, 2H), 2.16 (s, 3H). HRMS (ESI) calcd. for C18H16BrFN3O4S [M+H]+ 470.00085, found 469.99949.


Example 35
Ethyl 2-(4-(((4-(2-bromo-5-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-met hylphenoxy)acetate (Compound 35)



embedded image


Compound 35 was prepared by replacing p-bromoaniline in Example 1 with 2-bromo-5-fluoroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.68 (dd, J=8.9, 5.5 Hz, 1H), 7.62 (s, 1H), 7.34 (d, J=7.8 Hz, 2H), 7.19-7.02 (m, 2H), 6.66 (d, J=8.3 Hz, 1H), 5.16 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 518.1 [M+Na]+.


Example 36
2-(4-(((4-(4-Bromo-2-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)th io)-2-methylphenoxy)acetic acid (Compound 36)



embedded image


Compound 36 was prepared by replacing p-bromoaniline in Example 1 with 2-fluoro-4-bromoaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.98 (s, 1H), 8.29 (d, J=1.2 Hz, 1H), 7.86 (dd, J=10.0, 1.9 Hz, 1H), 7.60 (dd, J=9.1, 1.5 Hz, 1H), 7.52 (t, J=8.3 Hz, 1H), 7.29-7.20 (m, 2H), 6.79 (d, J=9.0 Hz, 1H), 5.14 (s, 2H), 4.69 (s, 2H), 2.14 (s, 3H). HRMS (ESI) calcd. for C18H15BrFN3NaO4S [M+Na]+491.98279, found 491.98201.


Example 37
2-(4-(((4-(3-Chloro-2-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)th io)-2-methylphenoxy)acetic acid (Compound 37)



embedded image


Compound 37 was prepared by replacing p-bromoaniline in Example 1 with 2-fluoro-3-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.33 (d, J=1.5 Hz, 1H), 7.77-7.68 (m, 1H), 7.58-7.51 (m, 1H), 7.43-7.36 (m, 1H), 7.28-7.22 (m, 2H), 6.80 (d, J=9.1 Hz, 1H), 5.14 (s, 2H), 4.69 (s, 2H), 2.15 (s, 3H). HRMS (ESI) calcd. for C18H15ClFN3NaO4S [M+Na]+446.03535, found 446.03464.


Example 38
Ethyl 2-(4-(((4-(3-chloro-2-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-met hylphenoxy)acetate (Compound 38)



embedded image


Compound 38 was prepared by replacing p-bromoaniline in Example 1 with 2-fluoro-3-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.69 (d, J=2.8 Hz, 1H), 7.52 (t, J=7.4 Hz, 1H), 7.46 (t, J=7.5 Hz, 1H), 7.33 (d, J=6.2 Hz, 2H), 7.23 (t, J=8.1 Hz, 1H), 6.66 (d, J=9.1 Hz, 1H), 5.15 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.26 (s, 3H), 1.31 (t, J=7.1 Hz, 3H). MS (ESI): m/z 474.1 [M+Na]+.


Example 39
2-(4-(((4-(2-Bromo-3-chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)t hio)-2-methylphenoxy)acetic acid (Compound 39)



embedded image


Compound 39 was prepared by replacing p-bromoaniline in Example 1 with 2-bromo-3-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 1: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.33 (d, J=1.5 Hz, 1H), 7.77-7.68 (m, 1H), 7.58-7.51 (m, 1H), 7.43-7.36 (m, 1H), 7.28-7.22 (m, 2H), 6.80 (d, J=9.1 Hz, 1H), 5.14 (s, 2H), 4.69 (s, 2H), 2.15 (s, 3H). HRMS (ESI) calcd. for C18H16BrClN3O4S [M+H]+485.97130, found 485.97167.


Example 40
Ethyl 2-(4-(((4-(2-bromo-3-chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-met hylphenoxy)acetate (Compound 40)



embedded image


Compound 40 was prepared by replacing p-bromoaniline in Example 1 with 2-bromo-3-chloroaniline, o-fluorophenol with o-cresol, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 1: 1H NMR (300 MHz, CDCl3) δ 7.58 (d, J=7.9 Hz, 2H), 7.42 (d, J=8.0 Hz, 1H), 7.36 (t, J=5.4 Hz, 2H), 7.28 (d, J=2.7 Hz, 1H), 6.65 (d, J=9.1 Hz, 1H), 5.16 (s, 2H), 4.64 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.31 (t, J=7.2 Hz, 3H). MS (ESI): m/z 534.0 [M+Na]+.


Example 41
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)pheno xy)acetic acid (Compound 41)



embedded image


embedded image


Synthesis of Intermediate O-1

Phenol (1.88 g, 20 mmol) was dissolved in acetonitrile (30 mL), and ethyl bromoacetate (2.66 mL, 24 mmol) and cesium carbonate (13.0 g, 40 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 24 h. After the reaction was completed, the reaction liquid was filtered under reduced pressure through a Buchner funnel.


The filtrate was diluted with water (200 mL), extracted with ethyl acetate (150 mL×3), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate O-1, which was directly used in the next step without further purification.


Synthesis of Intermediate O-2

Chlorosulfonic acid (6.2 mL, 100 mmol) was slowly added to the crude product of intermediate O-1 obtained from the previous step under an ice bath. The mixture was stirred for 2 h. After the reaction was completed, the reaction system was poured into ice water (200 mL) and filtered under reduced pressure to give a crude product of intermediate O-2, which was directly used in the next step without further purification.


Synthesis of Intermediate O-3

The crude product of intermediate O-2 obtained from the previous step was dissolved in absolute ethanol (10 mL), and a saturated hydrogen chloride-ethanol solution (25 mL) and tin powder (3.3 g, 28 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 24 h. After the reaction was completed, the reaction liquid was cooled to room temperature and filtered under reduced pressure. The filtrate was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (50 mL) and extracted with ethyl acetate (25 mL×3). The organic phase was washed with saturated brine (20 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=80:1) to give intermediate O-3 (yellow liquid, 634 mg).


Synthesis of Compound 42

Intermediate I-4 (162 mg, 0.6 mmol) was dissolved in anhydrous dichloromethane (5 mL), and triethylamine (0.17 mL, 1.2 mmol) and methylsufonyl chloride (0.07 mL, 0.9 mmol) were added. The mixture was stirred at room temperature for 2 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (10 mL) and extracted with ethyl acetate (15 mL×3). The organic phase was washed with saturated brine (15 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was directly used in the next step without further purification.


The residue of the previous step was dissolved in acetonitrile (5 mL), and intermediate 0-3 (489 mg, 1.5 mmol) and cesium carbonate (210 mg, 0.9 mmol) were added. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=5:1) to give compound 42 (white solid, 269.0 mg).


Compound 41

Compound 42 (150 mg, 0.32 mmol) was dissolved in methanol (4 mL), and a 1 N NaOH solution (1.6 mL) was added. The mixture was stirred at room temperature for 24 h. After the reaction was completed, the reaction liquid was adjusted to pH 4 with a 1 N HCl solution, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (15 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (15 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 41 (white solid, 112 mg): 1H NMR (300 MHz, DMSO-d6) δ 13.02 (s, 1H), 8.53 (s, 1H), 7.72 (d, J=8.8 Hz, 2H), 7.61 (d, J=8.8 Hz, 2H), 7.40 (d, J=8.7 Hz, 2H), 6.88 (d, J=8.7 Hz, 2H), 5.17 (s, 2H), 4.67 (s, 2H). HRMS (ESI) calcd. for C17H14BrN3O4S [M+H]+ 435.9967, found 435.9963.


Example 42
Ethyl 2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetat e (Compound 42)



embedded image


Compound 42 was prepared without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.53 (s, 1H), 7.67 (dd, J=30.3, 8.8 Hz, 4H), 7.40 (d, J=8.7 Hz, 2H), 6.90 (d, J=8.7 Hz, 2H), 5.17 (s, 2H), 4.77 (s, 2H), 4.16 (q, J=7.1 Hz, 2H), 1.20 (t, J=7.1 Hz, 3H). MS (ESI): m/z 486.1 [M+Na]+.


Example 43
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-flu orophenoxy)acetic acid (Compound 43)



embedded image


Compound 43 was prepared by replacing phenol in Example 41 with o-fluorophenol according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 13.06 (s, 1H), 8.53 (s, 1H), 7.72 (d, J=8.9 Hz, 2H), 7.62 (d, J=8.9 Hz, 2H), 7.45 (dd, J=11.7, 2.1 Hz, 1H), 7.21 (d, J=8.6 Hz, 1H), 7.04 (t, J=8.8 Hz, 1H), 5.25 (s, 2H), 4.77 (s, 2H). HRMS (ESI) calcd. for C17H13BrFN3O4S [M+H]+ 453.9872, found 453.9875.


Example 44
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-fluoropheno xy)acetate (Compound 44)



embedded image


Compound 44 was prepared by replacing phenol in Example 41 with o-fluorophenol without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.54 (s, 1H), 7.72 (d, J=8.8 Hz, 2H), 7.62 (d, J=8.7 Hz, 2H), 7.46 (d, J=11.7 Hz, 1H), 7.21 (d, J=8.6 Hz, 1H), 7.06 (t, 1H), 5.25 (s, 2H), 4.87 (s, 2H), 4.16 (q, J=7.1 Hz, 2H), 1.20 (t, J=7.1 Hz, 3H). MS (ESI): m/z 504.1 [M+Na]+.


Example 45
2-(4-(((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-chl orophenoxy)acetic acid (Compound 45)



embedded image


Compound 45 was prepared by replacing phenol in Example 41 with o-chlorophenol according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.55 (s, 1H), 7.73 (d, J=8.7 Hz, 2H), 7.62 (d, J=8.7 Hz, 2H), 7.55 (d, J=1.9 Hz, 1H), 7.35 (d, J=8.7 Hz, 1H), 6.92 (d, J=8.6 Hz, 1H), 5.21 (s, 2H), 4.60 (s, 2H). HRMS (ESI) calcd. for C17H13BrFN3O4S [M+H]+469.9577, found 469.9575.


Example 46
Ethyl 2-(4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-chloropheno xy)acetate (Compound 46)



embedded image


Compound 46 was prepared by replacing phenol in Example 41 with o-chlorophenol without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.55 (s, 1H), 7.72 (d, J=8.9 Hz, 2H), 7.63-7.49 (m, 3H), 7.36 (dd, 1H), 7.02 (d, J=8.7 Hz, 1H), 5.24 (s, 2H), 4.91 (s, 2H), 4.16 (q, J=7.1 Hz, 2H), 1.20 (t, J=7.1 Hz, 3H). MS (ESI): m/z 520.0 [M+Na]+.


Example 47
2-(2-Bromo-4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)t hio)phenoxy)acetic acid (Compound 47)



embedded image


Compound 47 was prepared by replacing phenol in Example 41 with o-bromophenol according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 13.08 (s, 1H), 8.55 (s, 1H), 7.73 (d, J=8.9 Hz, 3H), 7.62 (d, J=8.8 Hz, 2H), 7.42 (d, J=8.6 Hz, 1H), 6.96 (d, J=8.6 Hz, 1H), 5.22 (s, 2H), 4.80 (s, 2H). HRMS (ESI) calcd. for C17H13Br2N3O4S [M+H]+513.9072, found 513.9072.


Example 48
Ethyl 2-(2-bromo-4-(((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)pheno xy)acetate (Compound 48)



embedded image


Compound 48 was prepared by replacing phenol in Example 41 with o-bromophenol without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.56 (s, 1H), 7.72 (d, J=8.8 Hz, 3H), 7.62 (d, J=8.9 Hz, 2H), 7.42 (dd, J=8.6, 2.2 Hz, 1H), 6.99 (d, J=8.7 Hz, 1H), 5.23 (s, 2H), 4.90 (s, 2H), 4.16 (q, J=7.1 Hz, 2H), 1.20 (t, J=7.2 Hz, 3H). MS (ESI): m/z 564.0 [M+Na]+.


Example 49
2-(4-(((5-Oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetic acid (Compound 49)



embedded image


Synthesis of Intermediate A-1



embedded image


Intermediate A-1 was prepared by replacing p-bromoaniline with trifluoromethylaniline according to the method for intermediate 1-4 of Example 1.


Compound 49

Compound 49 was prepared by replacing intermediate 1-4 in Example 41 with intermediate A-1 according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 13.16-11.57 (s, 1H), 8.64 (s, 1H), 7.91 (s, 4H), 7.41 (d, J=8.7 Hz, 2H), 6.88 (d, J=8.7 Hz, 2H), 5.18 (s, 2H), 4.65 (s, 2H). HRMS (ESI) calcd. for C18H14F3N3O4S [M+H]+ 426.0735, found 426.0739.


Example 50
Ethyl 2-(4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phen oxy)acetate (Compound 50)



embedded image


Compound 50 was prepared by replacing intermediate I-4 in Example 41 with intermediate A-1 without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.65 (s, 1H), 7.91 (s, 3H), 7.41 (d, J=8.4 Hz, 2H), 6.90 (d, J=8.4 Hz, 2H), 5.19 (s, 2H), 4.77 (s, 2H), 4.15 (q, J=7.1 Hz, 2H), 1.20 (t, J=7.1 Hz, 3H). MS (ESI): m/z 476.2 [M+Na]+.


Example 51
2-(2-Fluoro-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl )methyl)thio)phenoxy)acetic acid (Compound 51)



embedded image


Compound 51 was prepared by replacing intermediate I-4 in Example 41 with intermediate A-1 and phenol with o-fluorophenol according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 13.18 (s, 1H), 8.66 (s, 1H), 7.92 (s, 4H), 7.46 (dd, J=11.7, 2.0 Hz, 1H), 7.21 (d, J=8.4 Hz, 1H), 7.04 (t, J=8.8 Hz, 1H), 5.27 (s, 2H), 4.75 (s, 2H). HRMS (ESI) calcd. for C18H13F4N3O4S [M+H]+ 444.0641, found 444.0640.


Example 52
Ethyl 2-(2-fluoro-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)t hio)phenoxy)acetate (Compound 52)



embedded image


Compound 52 was prepared by replacing intermediate I-4 in Example 41 with intermediate A-1 and phenol with o-fluorophenol without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.66 (s, 1H), 7.92 (s, 4H), 7.47 (dd, J=11.7, 2.1 Hz, 1H), 7.21 (d, J=8.9 Hz, 1H), 7.06 (d, J=8.8 Hz, 1H), 5.28 (s, 2H), 4.87 (s, 2H), 4.16 (q, J 25=7.1 Hz, 2H), 1.20 (t, J=7.1 Hz, 3H). MS (ESI): m/z 472.09 [M+Na]+.


Example 53
2-(2-Chloro-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-y l)methyl)thio)phenoxy)acetic acid (Compound 53)



embedded image


Compound 53 was prepared by replacing intermediate I-4 in Example 41 with intermediate A-1 and phenol with o-chlorophenol according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 13.47-12.49 (s, 1H), 8.66 (s, 1H), 7.92 (s, 4H), 7.59 (d, J=2.2 Hz, 1H), 7.38 (dd, J=8.6, 2.2 Hz, 1H), 7.00 (d, J=8.7 Hz, 1H), 5.25 (s, 2H), 4.79 (s, 2H). HRMS (ESI) calcd. for C18H13ClF3N3O4S [M+H]+460.0346, found 460.0336.


Example 54
Ethyl 2-(2-chloro-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)t hio)phenoxy)acetate (Compound 54)



embedded image


Compound 54 was prepared by replacing intermediate 1-4 in Example 41 with intermediate A-1 and phenol with o-chlorophenol without hydrolysis according to the method of Example 41: 1H NMR (300 MHz, DMSO-d6) δ 8.66 (s, 1H), 7.91 (s, 4H), 7.60 (d, J=2.2 Hz, 1H), 7.37 (dd, J=8.6, 2.2 Hz, 1H), 7.02 (d, J=8.7 Hz, 1H), 5.25 (s, 2H), 4.90 (s, 2H), 4.15 (q, J=7.1 Hz, 2H), 1.19 (t, J=7.1 Hz, 3H). MS (ESI): m/z 510.04 [M+Na]+.


Example 55
2-(4-((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimeth ylphenoxy)-2-methylpropionic acid (Compound 55)



embedded image


embedded image


Synthesis of Intermediate K-1

3,5-Dimethyl-4-hydroxybenzaldehyde (21 g, 140 mmol) was dissolved in acetonitrile (200 mL), and ethyl 2-bromoisobutyrate (100.5 g, 520 mmol), cesium carbonate (45.6 g, 140 mmol), potassium carbonate (38.6 g, 280 mmol), and potassium iodide (1.66 g, 10 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 36 h. After the reaction was completed, the reaction liquid was cooled to room temperature and filtered under reduced pressure. The filtrate was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (200 mL) and extracted with ethyl acetate (200 mL×3). The organic phases were combined, washed with 1 N sodium hydroxide (200 mL×3) and saturated brine (200 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=200:1) to give intermediate K-1 (yellow liquid, 16.3 g).


Synthesis of Intermediate K-2

Intermediate K-1 (3.66 g, 13.85 mmol) was dissolved in ethanol (20 mL), and sodium borohydride (280 mg, 7.5 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and reacted for 4 h. After the reaction was completed, water was added to the reaction liquid to quench the reaction (20 mL). The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with 30 mL of water and extracted with ethyl acetate (20 mL×3). The organic phases were combined, washed with saturated brine (30 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate K-2, which was directly used in the next step without further purification.


Synthesis of Intermediate K-3

The crude product of compound K-2 obtained from the previous step was dissolved in DCM (20 mL), carbon tetrabromide (13.6 g, 41 mmol) was added, and triphenylphosphine (9.9 g, 37.8 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and reacted for 8 h. The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=20:1) to give intermediate K-3 (yellow liquid, 3.54 g).


Synthesis of Compound 56

Intermediate I-3 (95.6 mg, 0.4 mmol) was dissolved in acetonitrile (5 mL), and intermediate K-3 (180 mg, 0.6 mmol) and cesium carbonate (326 mg, 1 mmol) were added. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=10:1) to give compound 56 (white solid, 125.4 mg).


Synthesis of Compound 55

Compound 56 (110 mg, 0.23 mmol) was dissolved in methanol (4 mL), and a 1 N NaOH solution (1.2 mL) was added. The mixture was stirred at room temperature for 24 h. After the reaction was completed, the reaction liquid was adjusted to pH 4 with a 1 N HCl solution, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (15 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (15 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 55 (white solid, 99 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.81 (s, 1H), 8.52 (s, 1H), 7.73 (s, 4H), 6.68 (s, 2H), 4.83 (s, 2H), 2.15 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C21H22BrN3O4 [M+H]+ 460.0872, found 460.0871.


Example 56
Ethyl 2-(4-((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenox y)-2-methylpropionate (Compound 56)



embedded image


Compound 56 was prepared without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.52 (s, 1H), 7.72 (s, 4H), 6.96 (s, 2H), 4.83 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.11 (s, 6H), 1.37 (s, 6H), 1.24 (t, J=7.1 Hz, 3H). MS (ESI): m/z 510.2 [M+Na]+.


Example 57
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 57)



embedded image


Synthesis of Intermediate D-1



embedded image


Intermediate D-1 was prepared by replacing p-bromoaniline in Example 1 with trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 57

Compound 57 was prepared by replacing intermediate I-3 with intermediate D-1 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 8.64 (s, 1H), 8.04 (d, J=8.5 Hz, 2H), 7.91 (d, J=8.4 Hz, 2H), 6.96 (s, 2H), 4.85 (s, 2H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H22F3N3O4[M+H]+ 450.1641, found 450.1641.


Example 58
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropionate (Compound 58)



embedded image


Compound 58 was prepared by replacing intermediate I-3 with intermediate D-1 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.91-7.66 (m, 5H), 7.04 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 500.2 [M+Na]+.


Example 59
2-(2,6-Dimethyl-4-((4-(3-methyl-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 59)



embedded image


Synthesis of Intermediate D-2



embedded image


Intermediate D-2 was prepared by replacing p-bromoaniline in Example 1 with 3-methyl-4-trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 59

Compound 59 was prepared by replacing intermediate I-3 with intermediate D-2 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 8.61 (s, 1H), 7.86 (d, J=15.4 Hz, 3H), 6.96 (s, 2H), 4.84 (s, 2H), 2.50 (s, 3H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C23H24F3N3O4[M+H]+ 464.1797, found 464.1802.


Example 60
Ethyl 2-(2,6-dimethyl-4-((4-(3-methyl-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionate (Compound 60)



embedded image


Compound 60 was prepared by replacing intermediate I-3 with intermediate D-2 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.75 (d, J=4.0 Hz, 1H), 7.71 (s, 1H), 7.63 (s, 1H), 7.52 (d, J=8.3 Hz, 1H), 7.03 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.56 (s, 3H), 2.21 (s, 6H), 1.59 (s, 3H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 514.3 [M+Na]+.


Example 61
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 61)



embedded image


Synthesis of Intermediate L-1

p-Trifluoromethoxyaniline (3.54 g, 20 mmol) was dissolved in ethyl acetate (EA) (25 mL), pyridine (Py) (1.74 g, 22 mmol) was added, and phenyl chloroformate (3.44 g, 22 mmol) was slowly added under an ice bath. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was washed with water (50 mL×3). The organic phase was washed with saturated brine (20 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate L-1, which was directly used in the next step without further purification.


Synthesis of Intermediate L-2

The crude product of intermediate L-1 obtained from the previous step was dissolved in glycol dimethyl ether (25 mL), and 98% hydrazine hydrate (2.67 mL) was added. The mixture was stirred at room temperature for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent, and EA (6 mL) was added to the residue. The mixture was stirred at room temperature for 12 h, and filtered under reduced pressure to give intermediate L-2 (white solid, 3.79 g).


Synthesis of Intermediate D-3

Intermediate L-2 (3.76 g, 16 mmol) was dissolved in acetonitrile (20 mL), and formamidine acetate (6.60 g, 64 mmol) was added. The mixture was stirred at room temperature for 30 min, and acetic acid (4.8 mL) was added. The system was transferred to an oil bath and reacted at 80° C. for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature and concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (50 mL) was added to the residue, and the resulting mixture was extracted with ethyl acetate (25 mL×3). The organic phase was washed with saturated brine (20 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. A mixed solution of petroleum ether (5 mL) and ethyl acetate (1 mL) was added to the residue. The mixture was stirred at room temperature for 2 h and filtered under reduced pressure to give intermediate D-3 (orange solid, 2.15 g).


Synthesis of Compound 61

Compound 61 was prepared by replacing intermediate I-3 with intermediate D-3 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.53 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.55 (d, J=8.7 Hz, 2H), 6.95 (s, 2H), 4.83 (s, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C22H22F3N3O5 [M+H]+ 466.1590, found 466.1590.


Example 62
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)me thyl)phenoxy)-2-methylpropionate (Compound 62)



embedded image


Compound 62 was prepared by replacing intermediate I-3 with intermediate D-3 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.65 (d, J=9.0 Hz, 2H), 7.35 (d, J=8.6 Hz, 2H), 7.03 (s, 2H), 4.91 (s, 2H), 4.29 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 516.2 [M+Na]+.


Example 63
2-(2,6-Dimethyl-4-((5-oxo-4-phenyl-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenox y)-2-methylpropionic acid (Compound 63)



embedded image


Synthesis of Intermediate D-4



embedded image


Intermediate D-4 was prepared by replacing p-bromoaniline in Example 1 with aniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 63

Compound 63 was prepared by replacing intermediate I-3 with intermediate D-4 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.49 (s, 1H), 7.72 (d, J=8.1 Hz, 2H), 7.52 (t, J=7.7 Hz, 2H), 7.38 (t, J=7.0 Hz, 1H), 6.95 (s, 1H), 4.83 (s, 2H), 2.15 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C21H23N3O4 [M+H]+ 382.1767, found 382.1763.


Example 64
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-phenyl-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-meth ylpropionate (Compound 64)



embedded image


Compound 64 was prepared by replacing intermediate I-3 with intermediate D-4 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.48 (s, 1H), 7.72 (d, 2H), 7.52 (t, J=7.9 Hz, 2H), 7.38 (t, J=7.4 Hz, 1H), 6.96 (s, 2H), 4.76 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.11 (s, 6H), 1.37 (s, 6H), 1.24 (t, J=7.1 Hz, 3H). MS (ESI): m/z 432.2 [M+Na]+.


Example 65
2-(2,6-Dimethyl-4-((5-oxo-4-(p-tolyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)pheno xy)-2-methylpropionic acid (Compound 65)



embedded image


Synthesis of Intermediate D-5



embedded image


Intermediate D-5 was prepared by replacing p-bromoaniline in Example 1 with p-methylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 65

Compound 65 was prepared by replacing intermediate I-3 with intermediate D-5 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.43 (s, 1H), 7.58 (d, J=8.3 Hz, 2H), 7.30 (s, 2H), 6.94 (s, 2H), 4.82 (s, 2H), 2.34 (s, 3H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C22H25N3O4 [M+H]+396.1923, found 396.1920.


Example 66
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(p-tolyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-met hylpropionate (Compound 66)



embedded image


Compound 66 was prepared by replacing intermediate I-3 with intermediate D-5 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.67 (s, 1H), 7.45 (d, J=7.4 Hz, 3H), 7.29 (d, J=2.8 Hz, 2H), 7.03 (s, 3H), 4.90 (s, 3H), 4.29 (q, J=7.1 Hz, 3H), 2.39 (s, 5H), 2.20 (s, 10H), 1.47 (s, 9H), 1.35 (t, J=7.6, 6.7 Hz, 6H). MS (ESI): m/z 446.3 [M+Na]+.


Example 67
2-(4-((4-(4-Chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimeth ylphenoxy)-2-methylpropionic acid (Compound 67)



embedded image


Synthesis of Intermediate D-6



embedded image


Intermediate D-6 was prepared by replacing p-bromoaniline in Example 1 with p-chloroaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 67

Compound 67 was prepared by replacing intermediate I-3 with intermediate D-6 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 8.51 (s, 1H), 7.78 (d, J=8.8 Hz, 2H), 7.59 (d, J=8.8 Hz, 2H), 6.95 (s, 2H), 4.82 (s, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C21H22ClN3O4[M+H]+ 416.1377, found 416.1374.


Example 68
Ethyl 2-(4-((4-(4-chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenox y)-2-methylpropionate (Compound 68)



embedded image


Compound 68 was prepared by replacing intermediate I-3 with intermediate D-6 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.52 (s, 1H), 7.79 (d, J=8.8 Hz, 2H), 7.60 (d, J=8.8 Hz, 2H), 6.96 (s, 2H), 4.83 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.11 (s, 6H), 1.37 (s, 6H), 1.24 (t, J=7.1 Hz, 3H). MS (ESI): m/z 466.3 [M+Na]+.


Example 69
2-(4-((4-(4-Ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimet hylphenoxy)-2-methylpropionic acid (Compound 69)



embedded image


Synthesis of Intermediate D-7



embedded image


Intermediate D-7 was prepared by replacing p-bromoaniline in Example 1 with p-ethoxyaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 69

Compound 69 was prepared by replacing intermediate I-3 with intermediate D-7 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.80 (s, 1H), 8.36 (s, 1H), 7.57 (d, J=8.9 Hz, 2H), 7.04 (d, J=9.0 Hz, 2H), 6.94 (s, 2H), 4.81 (s, 2H), 4.06 (q, J=6.9 Hz, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C23H27N3O5 [M+H]+ 426.2029, found 426.2021.


Example 70
Ethyl 2-(4-((4-(4-ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenox y)-2-methylpropionate (Compound 70)



embedded image


Compound 70 was prepared by replacing intermediate I-3 with intermediate D-7 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.63 (s, 1H), 7.45 (d, J=8.9 Hz, 2H), 7.28 (s, 1H), 6.98 (d, J=8.9 Hz, 3H), 4.91 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 4.07 (q, J=7.0 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.45 (t, 3H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 476.3 [M+Na]+.


Example 71
2-(4-((4-(3-Fluoro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionic acid (Compound 71)



embedded image


Synthesis of Intermediate D-8



embedded image


Intermediate D-8 was prepared by replacing p-bromoaniline in Example 1 with 3-fluoro-4-trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 71

Compound 71 was prepared by replacing intermediate I-3 with intermediate D-8 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 8.68 (d, J=5.0 Hz, 1H), 8.06 (d, J=12.4 Hz, 1H), 7.96 (d, J=6.6 Hz, 1H), 7.81-7.53 (m, 1H), 6.96 (s, 2H), 4.84 (s, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C22H21F4N3O4[M+H]+468.1546, found 468.1545.


Example 72
Ethyl 2-(4-((4-(3-fluoro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 72)



embedded image


Compound 72 was prepared by replacing intermediate 1-3 with intermediate D-8 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.79 (s, 1H), 7.73 (dd, 2H), 7.53 (d, J=8.5 Hz, 1H), 7.03 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 518.2 [M+Na]+.


Example 73
2-(4-((4-(3-Chloro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy-2-methylpropionic acid (Compound 73)



embedded image


Synthesis of Intermediate D-9



embedded image


Intermediate D-9 was prepared by replacing p-bromoaniline in Example 1 with 3-chloro-4-trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Compound 73

Compound 73 was prepared by replacing intermediate I-3 with intermediate D-9 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 8.71 (s, 1H), 8.25 (s, 1H), 8.11-7.92 (dd, 2H), 6.96 (s, 2H), 4.85 (s, 2H), 2.15 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H21ClF3N3O4 [M+H]+ 484.1251, found 484.1246.


Example 74
Ethyl 2-(4-((4-(3-chloro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 74)



embedded image


Compound 74 was prepared by replacing intermediate I-3 with intermediate D-9 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.93 (s, 1H), 7.80 (d, 2H), 7.69 (d, J=8.4 Hz, 11H), 7.03 (s, 2H), 4.91 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 534.3 [M+Na]+.


Example 75
2-(4-((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylp henoxy)-2-methylpropionic acid (Compound 75)



embedded image


Compound 75 was prepared by replacing 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.50 (s, 1H), 7.72 (s, 4H), 7.12 (s, 1H), 7.04 (d, J=9.5 Hz, 1H), 6.65 (d, J=8.4 Hz, 1H), 4.83 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C20H20BrN3O4 [M+H]+ 446.0715, found 446.0708.


Example 76
Ethyl 2-(4-((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 76)



embedded image


Compound 76 was prepared by replacing 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.67 (s, 1H), 7.62 (d, J=8.9 Hz, 2H), 7.49 (d, J=8.9 Hz, 2H), 7.28 (s, 1H), 7.12 (d, J=8.4 Hz, 1H), 6.63 (d, J=8.4 Hz, 1H), 4.92 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.60 (s, 6H), 1.28 (t, 3H). MS (ESI): m/z 496.1 [M+Na]+.


Example 77
2-Methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-tr iazol-1-yl)methyl)phenoxy)propionic acid (Compound 77)



embedded image


Compound 77 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.62 (s, 1H), 8.02 (d, J=8.5 Hz, 2H), 7.91 (d, J=8.6 Hz, 2H), 7.14 (s, 1H), 7.06 (d, J=8.4 Hz, 1H), 6.66 (d, J=8.3 Hz, 1H), 4.85 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C21H20F3N3O4[M+H]+ 436.1484, found 436.1475.


Example 78
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)propionate (Compound 78)



embedded image


Compound 78 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 4H), 7.76 (s, 1H), 7.23 (s, 1H), 7.12 (d, J=8.3 Hz, 1H), 6.64 (d, J=8.3 Hz, 1H), 4.94 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.60 (s, 6H), 1.26 (t, J=7.1 Hz, 3H). MS (ESI): m/z 486.2 [M+Na]+.


Example 79
2-Methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)propionic acid (Compound 79)



embedded image


Compound 79 was prepared by replacing intermediate 1-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.04 (s, 1H), 8.51 (s, 1H), 7.86 (d, J=8.9 Hz, 2H), 7.54 (d, J=8.7 Hz, 2H), 7.13 (s, 1H), 7.05 (d, J=8.4 Hz, 1H), 6.66 (d, J=8.3 Hz, 1H), 4.84 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C21H20F3N3O5[M+H]+ 452.1433, found 452.1428.


Example 80
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)propionate (Compound 80)



embedded image


Compound 80 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.69 (s, 1H), 7.64 (d, J=9.0 Hz, 2H), 7.35 (d, J=8.6 Hz, 2H), 7.22 (s, 1H), 7.12 (d, J=8.3 Hz, 1H), 6.63 (d, J=8.3 Hz, 1H), 4.93 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.60 (s, 6H), 1.27 (t, 3H). MS (ESI): m/z 502.2 [M+Na]+.


Example 81
2-Methyl-2-(2-methyl-4-((5-oxo-4-phenyl-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)ph enoxy)propionic acid (Compound 81)



embedded image


Compound 81 was prepared by replacing intermediate I-3 with intermediate D-4 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.47 (s, 1H), 7.71 (d, J=7.9 Hz, 2H), 7.52 (t, J=7.8 Hz, 2H), 7.38 (t, J=7.4 Hz, 1H), 7.13 (s, 1H), 7.05 (d, J=8.4 Hz, 1H), 6.66 (d, J=8.3 Hz, 1H), 4.83 (s, 2H), 2.14 (s, 3H), 1.51 (s, 6H). HRMS (ESI) calcd. for C20H21N3O4 [M+H]+ 368.1610, found 368.1610.


Example 82
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-phenyl-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)phenoxy)pr opionate (Compound 82)



embedded image


Compound 82 was prepared by replacing intermediate I-3 with intermediate D-4 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.69 (s, 1H), 7.58 (d, J=8.1 Hz, 2H), 7.49 (t, J=7.8 Hz, 2H), 7.38 (d, J=7.4 Hz, 1H), 7.23 (s, 1H), 7.12 (d, J=6.5 Hz, 1H), 6.64 (d, J=8.3 Hz, 1H), 4.93 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.59 (s, 6H), 1.28 (t, J=3.5 Hz, 3H). MS (ESI): m/z 418.2 [M+Na]+.


Example 83
2-Methyl-2-(2-methyl-4-((5-oxo-4-(p-tolyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl) phenoxypropionic acid (Compound 83)



embedded image


Compound 83 was prepared by replacing intermediate I-3 with intermediate D-5 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.02 (s, 1H), 8.41 (s, 1H), 7.57 (d, J=8.2 Hz, 2H), 7.31 (d, J=8.1 Hz, 2H), 7.12 (s, 1H), 7.04 (d, J=8.1 Hz, 1H), 6.66 (d, J=8.3 Hz, 1H), 4.82 (s, 2H), 2.34 (s, 3H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C21H23N3O4 [M+H]+ 382.1767, found 382.1760.


Example 84
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(p-tolyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)p ropionate (Compound 84)



embedded image


Compound 84 was prepared by replacing intermediate I-3 with intermediate D-5 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.65 (s, 1H), 7.44 (d, J=8.3 Hz, 2H), 7.29 (d, J=4.0 Hz, 2H), 7.22 (s, 1H), 7.12 (d, J=8.4 Hz, 1H), 6.63 (d, J=8.4 Hz, 1H), 4.92 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.40 (s, 3H), 2.24 (s, 3H), 1.60 (s, 6H), 1.26 (t, J=5.5 Hz, 3H). MS (ESI): m/z 432.2 [M+Na]+.


Example 85
2-(4-((4-(3-Fluoro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionic acid (Compound 85)



embedded image


Compound 85 was prepared by replacing intermediate I-3 with intermediate D-8 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.67 (d, J=5.7 Hz, 1H), 8.05 (d, J=12.3 Hz, 1H), 7.90 (dd, J=34.7, 24.7 Hz, 1H), 7.62 (dd, J=48.4, 16.1 Hz, 1H), 7.13 (s, 1H), 7.05 (d, J=8.7 Hz, 1H), 6.66 (d, J=8.4 Hz, 1H), 4.85 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C21H19F4N3O4[M+H]+ 454.1390, found 454.1392.


Example 86
Ethyl 2-(4-((4-(3-fluoro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 86)



embedded image


Compound 86 was prepared by replacing intermediate I-3 with intermediate D-8 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 1H), 7.74 (d, J=7.9 Hz, 1H), 7.70 (s, 1H), 7.50 (d, J=8.2 Hz, 1H), 7.21 (s, 1H), 7.11 (dd, J=8.3, 2.0 Hz, 1H), 6.63 (d, J=8.3 Hz, 1H), 4.92 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.60 (s, 6H), 1.26 (t, J=5.6 Hz, 6H). MS (ESI): m/z 504.3 [M+Na]+.


Example 87
2-(4-((4-(3-Chloro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy) 2-methylpropionic acid (Compound 87)



embedded image


Compound 87 was prepared by replacing intermediate I-3 with intermediate D-9 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.69 (s, 1H), 8.24 (s, 1H), 8.03 (s, 2H), 7.13 (s, 1H), 7.05 (d, J=8.1 Hz, 1H), 6.65 (d, J=8.4 Hz, 1H), 4.84 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C21H19ClF3N3O4 [M+H]+ 470.1094, found 470.1096.


Example 88
Ethyl 2-(4-((4-(3-chloro-4-(trifluoromethyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 88)



embedded image


Compound 88 was prepared by replacing intermediate I-3 with intermediate D-9 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.69 (s, 1H), 8.24 (s, 1H), 8.03 (s, 2H), 7.14 (s, 1H), 7.05 (dd, J=21.8, 11.7 Hz, 1H), 6.58 (d, J=8.3 Hz, 1H), 4.85 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.15 (s, 3H), 1.51 (d, J=3.6 Hz, 6H), 1.16 (t, J=7.1 Hz, 3H). MS (ESI): m/z 520.2 [M+Na]+.


Example 89
2-(4-((4-(4-Ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylp henoxy)-2-methylpropionic acid (Compound 89)



embedded image


Compound 89 was prepared by replacing intermediate I-3 with intermediate D-7 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO) δ 13.00 (s, 1H), 8.33 (s, 1H), 7.54 (d, J=8.9 Hz, 2H), 7.10 (s, 1H), 7.02 (d, J=8.9 Hz, 3H), 6.64 (d, J=8.4 Hz, 1H), 4.80 (s, 2H), 4.04 (q, J=7.0 Hz, 2H), 2.12 (s, 3H), 1.49 (s, 6H), 1.32 (t, J=7.0 Hz, 3H). HRMS (ESI) calcd. for C22H25N3O5 [M+H]+ 412.1872, found 412.1870.


Example 90
Ethyl 2-(4-((4-(4-ethoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 90)



embedded image


Compound 90 was prepared by replacing intermediate I-3 with intermediate D-7 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.35 (s, 1H), 7.56 (d, J=8.9 Hz, 2H), 7.13 (s, 1H), 7.04 (d, J=9.0 Hz, 3H), 6.58 (d, J=8.4 Hz, 1H), 4.82 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 4.06 (q, J=6.9 Hz, 2H), 2.15 (s, 3H), 1.52 (s, 6H), 1.34 (t, J=6.9 Hz, 3H), 1.16 (t, J=7.1 Hz, 3H). MS (ESI): m/z 462.3 [M+Na]+.


Example 91
2-(4-((4-(4-Methoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methy lphenoxy)-2-methylpropionic acid (Compound 91)



embedded image


Synthesis of Intermediate D-10



embedded image


Intermediate D-10 was prepared by replacing p-bromoaniline in Example 1 with p-methoxyaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 91

Compound 91 was prepared by replacing intermediate I-3 with intermediate D-10 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.01 (s, 1H), 8.35 (s, 1H), 7.57 (d, J=8.9 Hz, 2H), 7.12 (s, 1H), 7.05 (t, J=7.2 Hz, 3H), 6.66 (d, J=8.4 Hz, 1H), 4.81 (s, 2H), 3.79 (s, 3H), 2.14 (s, 3H), 1.51 (s, 6H). HRMS (ESI) calcd. for C21H23N3O5 [M+H]+ 398.1710, found 398.1717.


Example 92
Ethyl 2-(4-((4-(4-methoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 92)



embedded image


Compound 92 was prepared by replacing intermediate I-3 with intermediate D-10 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.36 (s, 1H), 7.57 (d, J=8.8 Hz, 2H), 7.13 (s, 1H), 7.04 (t, J=8.9 Hz, 3H), 6.58 (d, J=8.3 Hz, 1H), 4.82 (s, 2H), 4.17 (q, J=7.0 Hz, 2H), 3.79 (s, 3H), 2.15 (s, 3H), 1.51 (s, 6H), 1.16 (t, J=7.1 Hz, 3H). MS (ESI): m/z 448.2 [M+Na]+.


Example 93
2-(4-((4-(4-Fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylp henoxy)-2-methylpropionic acid (Compound 93)



embedded image


Synthesis of Intermediate D-11



embedded image


Intermediate D-11 was prepared by replacing p-bromoaniline in Example 1 with p-fluoroaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 93

Compound 93 was prepared by replacing intermediate I-3 with intermediate D-11 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO) δ 13.00 (s, 1H), 8.42 (s, 1H), 7.73 (dd, J=9.0, 4.8 Hz, 2H), 7.35 (t, J=8.8 Hz, 2H), 7.11 (s, 1H), 7.03 (d, J=8.4 Hz, 1H), 6.64 (d, J=8.4 Hz, 1H), 4.81 (s, 2H), 2.12 (s, 3H), 1.49 (s, 6H). HRMS (ESI) calcd. for C20H20FN3O4[M+H]+ 386.1511, found 386.1512.


Example 94
Ethyl 2-(4-((4-(4-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 94)



embedded image


Compound 94 was prepared by replacing intermediate I-3 with intermediate D-11 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.45 (s, 1H), 7.85-7.69 (m, 2H), 7.38 (t, J=8.8 Hz, 2H), 7.14 (s, 1H), 7.04 (d, J=8.2 Hz, 1H), 6.59 (d, J=8.3 Hz, 1H), 4.84 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.15 (s, 3H), 1.52 (s, 6H), 1.17 (t, J=7.1 Hz, 3H). MS (ESI): m/z 436.2 [M+Na]+.


Example 95
2-(4-((4-(4-Chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylp henoxy)-2-methylpropionic acid (Compound 95)



embedded image


Compound 95 was prepared by replacing intermediate I-3 with intermediate D-6 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.02 (s, 1H), 8.50 (s, 1H), 7.77 (d, J=8.8 Hz, 2H), 7.59 (d, J=8.8 Hz, 2H), 7.12 (s, 1H), 7.04 (d, J=8.7 Hz, 1H), 6.65 (d, J=8.4 Hz, 1H), 4.83 (s, 2H), 2.14 (s, 3H), 1.50 (s, 3H). HRMS (ESI) calcd. for C20H20ClN3O4 [M+H]+402.1215, found 402.1220.


Example 96
Ethyl 2-(4-((4-(4-chlorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 96)



embedded image


Compound 96 was prepared by replacing intermediate I-3 with intermediate D-6 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.51 (s, 1H), 7.78 (d, J=8.6 Hz, 2H), 7.60 (d, J=8.7 Hz, 2H), 7.14 (s, 1H), 7.03 (d, J=8.4 Hz, 1H), 6.58 (d, J=8.2 Hz, 1H), 4.84 (s, 2H), 4.17 (q, J=7.0 Hz, 2H), 2.15 (s, 3H), 1.52 (s, 6H), 1.17 (t, J=7.0 Hz, 3H). MS (ESI): m/z 452.2 [M+Na]+.


Example 97
2-(4-((4-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionic acid (Compound 97)



embedded image


Synthesis of Intermediate D-12



embedded image


Intermediate D-12 was prepared by replacing p-bromoaniline in Example 1 with 6-amino-1,4-benzodioxane according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 97

Compound 97 was prepared by replacing intermediate I-3 with intermediate D-12 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO) δ 13.00 (s, 1H), 8.33 (s, 1H), 7.22 (d, J=2.4 Hz, 1H), 7.15-7.08 (m, 2H), 7.01 (dd, J=8.3, 1.4 Hz, 1H), 6.95 (d, J=8.7 Hz, 1H), 6.64 (d, J=8.4 Hz, 1H), 4.79 (s, 2H), 4.26 (s, 4H), 2.12 (s, 3H), 1.49 (s, 6H). HRMS (ESI) calcd. for C22H23N3O6 [M+H]+ 426.1660, found 426.1661.


Example 98
Ethyl 2-(4-((4-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl])-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-methylphenoxy)-2-methylpropionate (Compound 98)



embedded image


Compound 98 was prepared by replacing intermediate I-3 with intermediate D-12 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.36 (s, 1H), 7.24 (d, J=2.4 Hz, 1H), 7.18-7.10 (m, 2H), 7.02 (dd, J=8.4, 1.8 Hz, 1H), 6.97 (d, J=8.7 Hz, 1H), 6.58 (d, J=8.3 Hz, 1H), 4.81 (s, 2H), 4.28 (s, 4H), 4.17 (q, J=7.1 Hz, 2H), 2.15 (s, 3H), 1.52 (s, 6H), 1.16 (t, J=7.1 Hz, 3H). MS (ESI): m/z 476.2 [M+Na]+.


Example 99
2-(4-((4-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl])-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionic acid (Compound 99)



embedded image


Compound 99 was prepare by replacing intermediate I-3 with intermediate D-12 according to the method of Example 55: H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 8.35 (s, 1H), 7.23 (d, J=2.4 Hz, 1H), 7.13 (dd, J=8.7, 2.4 Hz, 1H), 6.97 (s, 1H), 6.93 (d, J=7.5 Hz, 2H), 4.78 (s, 2H), 4.25 (s, 4H), 2.13 (s, 6H), 1.32 (s, 6H). HRMS (ESI) calcd. for C23H25N3O6 [M+H]+ 440.1816, found 440.1812.


Example 100
Ethyl 2-(4-((4-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl])-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 100)



embedded image


Compound 100 was prepared by replacing intermediate I-3 with intermediate D-12 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.60 (s, 1H), 7.10 (d, J=2.3 Hz, 1H), 7.02 (s, 2H), 6.98 (d, J=2.4 Hz, 1H), 6.93 (d, J=8.7 Hz, 1H), 4.89 (s, 2H), 4.49-4.22 (m, 6H), 2.20 (s, 6H), 1.47 (s, 6H), 1.35 (t, J=7.1 Hz, 3H). m/z 490.3 [M+Na]+.


Example 101
2-(2-Methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)phenoxyacetic acid (Compound 101)



embedded image


Compound 101 was prepared by replacing intermediate I-3 with intermediate D-1, 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde, and ethyl 2-bromoisobutyrate with ethyl bromoacetate according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6)) δ 13.02 (s, 1H), 8.62 (s, 1H), 8.02 (d, J=8.3 Hz, 2H), 7.91 (d, J=8.2 Hz, 2H), 7.14 (s, 1H), 7.10 (d, J=8.6 Hz, 1H), 6.79 (d, J=8.1 Hz, 1H), 4.86 (s, 2H), 4.68 (s, 2H), 2.18 (s, 3H). MS (ESI): m/z 430.2 [M+Na]+.


Example 102
Ethyl 2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)p henoxyacetate (Compound 102)



embedded image


Compound 102 was obtained by replacing intermediate I-3 with intermediate D-1, 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde, and ethyl 2-bromoisobutyrate with ethyl bromoacetate without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.76 (d, J=4.4 Hz, 4H), 7.28 (s, 2H), 7.23 (d, J=8.5 Hz, 1H), 6.69 (d, J=8.2 Hz, 1H), 4.95 (s, 2H), 4.64 (s, 2H), 4.28 (q, J=7.1 Hz, 2H), 2.31 (s, 3H), 1.32 (t, 3H). MS (ESI): m/z 458.2 [M+Na]+.


Example 103
2-Methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-(trifluoromethoxy)phenoxy)propionic acid (Compound 103)



embedded image


Compound 103 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-fluoromethoxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.23 (s, 1H), 8.55 (s, 1H), 7.86 (d, J=9.0 Hz, 2H), 7.55 (d, J=8.6 Hz, 2H), 7.35 (s, 1H), 7.26 (d, J=8.6 Hz, 1H), 6.93 (d, J=8.5 Hz, 1H), 4.94 (s, 2H), 1.52 (s, 6H). HRMS (ESI) calcd. for C21H17F6N3O6[M+H]+ 522.1100, found 522.1097.


Example 104
Ethyl 2-methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-(trifluoromethoxy)phenoxy)propionate (Compound 104)



embedded image


Compound 104 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethoxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.64 (d, J=8.9 Hz, 2H), 7.37 (s, 1H), 7.33 (d, J=6.1 Hz, 2H), 7.23 (dd, J=8.5, 1.9 Hz, 1H), 6.88 (d, J=8.5 Hz, 1H), 4.97 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.61 (s, 6H), 1.26 (t, J=7.1 Hz, 3H). MS (ESI): m/z 572.1 [M+Na]+.


Example 105
2-Methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionic acid (Compound 105)



embedded image


Compound 105 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chlorobenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.22 (s, 1H), 8.54 (s, 1H), 7.85 (s, 1H), 7.55 (d, J=8.6 Hz, 2H), 7.42 (d, J=1.8 Hz, 2H), 7.21 (d, J=8.6 Hz, 1H), 6.90 (d, J=8.5 Hz, 1H), 4.90 (s, 2H), 1.53 (s, 6H). HRMS (ESI) calcd. for C20H17ClF3N3O5 [M+H]+ 472.0087, found 472.0891.


Example 106
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionate (Compound 106)



embedded image


Compound 106 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chlorobenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.64 (d, J=8.9 Hz, 2H), 7.46 (d, J=1.9 Hz, 1H), 7.36 (d, J=8.7 Hz, 2H), 7.20 (dd, J=8.5, 1.8 Hz, 1H), 6.87 (d, J=8.4 Hz, 1H), 4.95 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 1.63 (s, 6H), 1.28 (t, J=7.1 Hz, 3H). MS (ESI): m/z 522.1 [M+Na]+.


Example 107
2-(4-((4-(4-Methoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dime thylphenoxy)-2-methylpropionic acid (Compound 107)



embedded image


Compound 107 was prepared by replacing intermediate I-3 with intermediate D-10 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.81 (s, 1H), 8.35 (s, 1H), 7.57 (d, J=9.0 Hz, 2H), 7.04 (d, J=9.0 Hz, 2H), 6.92 (s, 2H), 4.79 (s, 2H), 3.77 (s, 3H), 2.13 (s, 6H), 1.32 (s, 6H). HRMS (ESI) calcd. for C22H25N3O5 [M+H]+ 412.1867, found 412.1868.


Example 108
Ethyl 2-(4-((4-(4-methoxyphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphen oxy)-2-methylpropionate (Compound 108)



embedded image


Compound 108 was prepared by replacing intermediate I-3 with intermediate D-10 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.63 (s, 1H), 7.46 (d, J=8.9 Hz, 2H), 7.12-6.94 (m, 4H), 4.90 (s, 2H), 4.29 (q, J=7.1 Hz, 2H), 3.85 (s, 3H), 2.20 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 462.3 [M+Na]+.


Example 109
2-(4-((4-(4-Fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimeth ylphenoxy)-2-methylpropionic acid (Compound 109)



embedded image


Compound 109 was prepared by replacing intermediate I-3 with intermediate D-11 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.80 (s, 1H), 8.44 (s, 1H), 7.74 (dd, J=8.9, 4.8 Hz, 2H), 7.35 (t, J=8.8 Hz, 2H), 6.93 (s, 2H), 4.81 (s, 2H), 2.13 (s, 6H), 1.33 (s, 6H). HRMS (ESI) calcd. for C21H22FN3O4[M+H]+ 400.1667, found 400.1675.


Example 110
Ethyl 2-(4-((4-(4-fluorophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenox y)-2-methylpropionate (Compound 110)



embedded image


Compound 110 was prepared by replacing intermediate I-3 with intermediate D-11 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 8.46 (s, 1H), 7.76 (dd, J=9.0, 4.8 Hz, 2H), 7.38 (t, J=8.8 Hz, 2H), 6.96 (s, 2H), 4.83 (s, 2H), 4.17 (q, J=7.1 Hz, 2H), 2.11 (s, 6H), 1.37 (s, 6H), 1.24 (t, J=7.1 Hz, 3H). MS (ESI): m/z 450.2 [M+Na]+.


Example 111
2-(4-((4-(4-Cyanophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimeth ylphenoxy)-2-methylpropionic acid (Compound 111)



embedded image


Synthesis of Intermediate D-13



embedded image


Intermediate D-13 was prepared by replacing p-bromoaniline in Example 1 with p-cyanoaniline according to the method for intermediate I-3 of Example 1.


Compound 111

Compound 111 was prepared by replacing intermediate I-3 with intermediate D-13 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.99 (s, 1H), 8.62 (s, 1H), 8.07 (d, J=8.5 Hz, 2H), 7.92 (d, J=8.5 Hz, 2H), 6.96 (s, 2H), 4.85 (s, 2H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H22N4O4 [M+H]+407.1719, found 407.1719.


Example 112
Ethyl 2-(4-((4-(4-cyanophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 112)



embedded image


Compound 112 was prepared by replacing intermediate I-3 with intermediate D-13 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.84 (d, J=8.8 Hz, 2H), 7.81 (d, J=3.8 Hz, 2H), 7.29 (s, 1H), 7.03 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.48 (s, 6H), 1.37 (t, J=7.1 Hz, 3H). MS (ESI): m/z 457.2 [M+Na]+.


Example 113
2-(2,6-Dimethyl-4-((4-(4-(methylsulfonyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 113)



embedded image


Synthesis of Intermediate D-14



embedded image


Intermediate D-14 was prepared by replacing p-bromoaniline in Example 1 with p-methylsulfonylaniline according to the method for intermediate I-3 of Example 1.


Compound 113

Compound 113 was prepared by replacing intermediate I-3 with intermediate D-14 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.67 (s, 1H), 8.08 (d, J=1.2 Hz, 4H), 6.96 (s, 2H), 4.85 (s, 2H), 3.27 (s, 3H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H25N3O6S [M+H]+460.1542, found 460.1538.


Example 114
Ethyl 2-(2,6-dimethyl-4-((4-(methylsulfonyl)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl) phenoxy)-2-methylpropionate (Compound 114)



embedded image


Compound 114 was prepared by replacing intermediate I-3 with intermediate D-14 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 8.07 (d, J=8.6 Hz, 2H), 7.88 (d, J=8.6 Hz, 2H), 7.80 (s, 1H), 7.01 (s, 2H), 4.90 (s, 2H), 4.28 (q, J=7.1 Hz, 2H), 3.07 (s, 3H), 2.19 (s, 6H), 1.45 (s, 6H), 1.34 (t, J=7.1 Hz, 3H). MS (ESI): m/z 510.2 [M+Na]+.


Example 115
2-(4-((4-(4-Isopropylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dim ethylphenoxy)-2-methylpropionic acid (Compound 115)



embedded image


Synthesis of Intermediate D-15



embedded image


Intermediate D-15 was prepared by replacing p-bromoaniline in Example 1 with p-isopropylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 115

Compound 115 was prepared by replacing intermediate I-3 with intermediate D-15 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.86 (s, 1H), 8.43 (s, 1H), 7.60 (d, J=8.2 Hz, 2H), 7.39 (d, J=8.3 Hz, 2H), 6.95 (s, 2H), 4.83 (s, 2H), 3.09-2.84 (m, 1H), 2.15 (s, 6H), 1.35 (s, 6H), 1.22 (d, J=6.9 Hz, 6H). HRMS (ESI) calcd. for C24H29N3O4 [M+H]+424.2236, found 424.2241.


Example 116
Ethyl 2-(4-((4-(4-Isopropylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphen oxy)-2-methylpropionate (Compound 116)



embedded image


Compound 116 was prepared by replacing intermediate I-3 with intermediate D-15 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.65 (s, 1H), 7.46 (d, J=8.5 Hz, 2H), 7.32 (d, J=8.4 Hz, 2H), 7.01 (s, 2H), 4.89 (s, 2H), 4.28 (q, J=7.1 Hz, 2H), 2.94 (dt, J=13.9, 6.9 Hz, 1H), 2.18 (s, 6H), 1.45 (s, 6H), 1.34 (t, J=7.1 Hz, 3H), 1.25 (d, J=6.9 Hz, 6H). MS (ESI): m/z 474.2 [M+Na]+.


Example 117
2-(4-((4-([1,1′-Biphenyl]-4-yl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-di methylphenoxy)-2-methylpropionic acid (Compound 117)



embedded image


Synthesis of Intermediate D-16



embedded image


Intermediate D-16 was prepared by replacing p-bromoaniline in Example 1 with 4-phenylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 117

Compound 117 was prepared by replacing intermediate I-3 with intermediate D-16 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 8.56 (s, 1H), 7.83 (s, 4H), 7.66 (t, J=32.4 Hz, 2H), 7.50 (t, J=7.4 Hz, 2H), 7.41 (d, J=7.2 Hz, 1H), 6.97 (s, 2H), 4.85 (s, 2H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C27H27N3O4 [M+H]+ 458.2080, found 458.2080.


Example 118
Ethyl 2-(4-((4-([1,1′-biphenyl]-4-yl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphe noxy)-2-methylpropionate (Compound 118)



embedded image


Compound 118 was prepared by replacing intermediate I-3 with intermediate D-16 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.76 (s, 1H), 7.72 (d, J=8.9 Hz, 4H), 7.68 (d, J=8.1 Hz, 2H), 7.62 (d, J=7.0 Hz, 2H), 7.49 (t, J=7.3 Hz, 2H), 7.42 (d, J=6.7 Hz, 1H), 7.06 (s, 2H), 4.94 (s, 2H), 4.31 (q, J=13.4, 6.6 Hz, 2H), 2.22 (s, 6H), 1.48 (s, 6H), 1.37 (t, J=6.8 Hz, 3H). MS (ESI): m/z 508.4 [M+Na]+.


Example 119
2-(2,6-Dimethyl-4-((5-oxo-4-(2-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 119)



embedded image


Synthesis of Intermediate D-17



embedded image


Intermediate D-17 was prepared by replacing p-bromoaniline in Example 1 with o-trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 119

Compound 119 was prepared by replacing intermediate I-3 with intermediate D-17 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.21 (s, 1H), 7.97 (d, J=7.5 Hz, 1H), 7.90 (t, J=7.4 Hz, 1H), 7.80 (d, J=7.7 Hz, 1H), 7.74 (t, J=7.3 Hz, 1H), 6.89 (s, 2H), 4.84 (s, 2H), 2.16 (s, 6H), 1.36 (s, 6H). HRMS (ESI) calcd. for C22H22F3N3O4[M+H]+ 458.2080, found 458.2080.


Example 120
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(2-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropionate (Compound 120)



embedded image


Compound 120 was prepared by replacing intermediate I-3 with intermediate D-17 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.86 (d, J=7.7 Hz, 1H), 7.74 (t, J=7.7 Hz, 1H), 7.64 (t, J=7.5 Hz, 1H), 7.53 (d, J=7.6 Hz, 1H), 7.49 (s, 1H), 6.99 (s, 2H), 4.94 (s, 2H), 4.31 (q, J=7.1 Hz, 2H), 2.22 (s, 6H), 1.49 (s, 6H), 1.37 (t, J=7.1 Hz, 3H). MS (ESI): m/z 500.4 [M+Na]+.


Example 121
2-(2,6-Dimethyl-4-((5-oxo-4-(3-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 121)



embedded image


Synthesis of Intermediate D-18



embedded image


Intermediate D-18 was prepared by replacing p-bromoaniline in Example 1 with m-trifluoromethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 121

Compound 121 was prepared by replacing intermediate I-3 with intermediate D-18 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.64 (s, 1H), 8.20 (s, 1H), 8.08 (d, J=7.1 Hz, 1H), 7.83-7.65 (m, 2H), 6.96 (s, 2H), 4.85 (s, 2H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H22F3N3O4[M+H]+458.2080, found 458.2080.


Example 122
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(3-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropionate (Compound 122)



embedded image


Compound 122 was prepared by replacing intermediate I-3 with intermediate D-18 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.91 (s, 1H), 7.85 (s, 1H), 7.77 (s, 1H), 7.64 (d, J=4.8 Hz, 2H), 7.04 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.48 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 500.2 [M+Na]+.


Example 123
2-(2-Fluoro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 123)



embedded image


Compound 123 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-fluorobenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.12 (s, 1H), 8.65 (s, 1H), 8.02 (d, J=8.5 Hz, 2H), 7.91 (d, J=8.6 Hz, 2H), 7.20 (d, J=12.0 Hz, 1H), 7.06 (d, J=7.9 Hz, 1H), 6.97 (t, J=8.3 Hz, 1H), 4.93 (s, 2H), 1.50 (s, 6H). HRMS (ESI) calcd. for C20H17F4N3O4 [M+H]+440.1233, found 440.1299.


Example 124
Ethyl 2-(2-fluoro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)p henoxy)-2-methylpropionate (Compound 124)



embedded image


Compound 124 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-fluorobenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.76 (d, J=2.5 Hz, 4H), 7.26 (s, 1H), 7.15 (dd, J=11.3, 1.9 Hz, 1H), 7.06 (d, J=8.8 Hz, 1H), 6.95 (t, J=8.2 Hz, 1H), 4.95 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.58 (s, 6H), 1.28 (t, J=7.1 Hz, 3H). MS (ESI): m/z 490.2 [M+Na]+.


Example 125
2-(2-Chloro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 125)



embedded image


Compound 125 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chlorobenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.22 (s, 1H), 8.65 (s, 1H), 8.02 (d, J=8.6 Hz, 2H), 7.91 (d, J=8.7 Hz, 2H), 7.43 (d, J=1.7 Hz, 1H), 7.22 (d, J=8.4 Hz, 1H), 6.90 (d, J=8.5 Hz, 1H), 4.92 (s, 2H), 1.53 (s, 6H). HRMS (ESI) calcd. for C20H17ClF3N3O4 [M+H]+ 456.0938, found 456.0938.


Example 126
Ethyl 2-(2-chloro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)p henoxy)-2-methylpropionate (Compound 126)



embedded image


Compound 126 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chlorobenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.76 (s, 5H), 7.44 (d, J=2.0 Hz, 1H), 7.18 (dd, J=8.4, 2.0 Hz, 1H), 6.86 (d, J=8.4 Hz, 1H), 4.94 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.56 (s, 6H), 1.26 (t, J=7.1 Hz, 3H). MS (ESI): m/z 506.3 [M+Na]+.


Example 127
2-(2,6-Difluoro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 127)



embedded image


Compound 127 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-difluorobenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.68 (s, 1H), 8.03 (d, J=8.5 Hz, 2H), 7.92 (d, J=8.6 Hz, 2H), 7.11 (d, J=8.8 Hz, 2H), 4.98 (s, 2H), 1.44 (s, 6H). HRMS (ESI) calcd. for C20H16F5N3O4[M+H]+ 458.1139, found 458.1140.


Example 128
Ethyl 2-(2,6-difluoro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methy 1)phenoxy)-2-methylpropionat (Compound 128)



embedded image


Compound 128 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-difluorobenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.79 (d, J=7.5 Hz, 1H), 7.28 (s, 1H), 6.97 (d, J=7.9 Hz, 1H), 4.96 (s, 1H), 4.26 (q, J=7.1 Hz, 1H), 1.57 (s, 2H), 1.32 (t, J=7.1 Hz, 1H). MS (ESI): m/z 508.1 [M+Na]+.


Example 129
2-(2,6-Dichloro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 129)



embedded image


Compound 129 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-dichlorobenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.91 (s, 1H), 8.68 (s, 1H), 8.03 (d, J=8.5 Hz, 2H), 7.92 (d, J=8.7 Hz, 2H), 7.45 (s, 2H), 4.98 (s, 2H), 1.46 (s, 3H). HRMS (ESI) calcd. for C20H16C12F3N3O4[M+H]+ 490.0548, found 490.0545.


Example 130
Ethyl 2-(2,6-dichloro-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropionate (Compound 130)



embedded image


Compound 130 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-dichlorobenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.80 (d, J=7.5 Hz, 4H), 7.35 (s, 1H), 7.28 (s, 2H), 4.95 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 1.60 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 540.1 [M+Na]+.


Example 131
2-(4-((4-(4-Ethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethy lphenoxy)-2-methylpropionic acid (Compound 131)



embedded image


Synthesis of Intermediate D-19



embedded image


Intermediate D-19 was prepared by replacing p-bromoaniline in Example 1 with p-ethylaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 131

Compound 131 was prepared by replacing intermediate I-3 with intermediate D-19 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.44 (s, 1H), 7.61 (d, J=8.3 Hz, 2H), 7.35 (d, J=8.3 Hz, 2H), 6.95 (s, 2H), 4.83 (s, 2H), 2.65 (q, J=7.6 Hz, 2H), 2.15 (s, 6H), 1.35 (s, 6H), 1.20 (t, J=7.6 Hz, 3H). HRMS (ESI) calcd. for C23H27N3O4 [M+H]+410.2080, found 410.2080.


Example 132
Ethyl 2-(4-((4-(4-Ethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 132)



embedded image


Compound 132 was prepared by replacing intermediate I-3 in Example 55 with intermediate D-19 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.68 (s, 1H), 7.48 (d, J=8.4 Hz, 2H), 7.31 (d, J=8.4 Hz, 2H), 7.04 (s, 2H), 4.92 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.70 (q, J=7.6 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H), 1.28 (t, 3H). MS(ESI): m/z 460.2 [M+Na]+.


Example 133
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)acetic acid (Compound 133)



embedded image


Compound 133 was prepared by replacing intermediate I-3 with intermediate D-1 and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.61 (s, 1H), 8.01 (d, J=8.5 Hz, 2H), 7.89 (d, J=8.7 Hz, 2H), 6.97 (s, 2H), 4.83 (s, 2H), 4.33 (s, 2H), 2.20 (s, 6H). HRMS (ESI) calcd. for C20H18F3N3O4[M+H]+422.1322, found 422.1327.


Example 134
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)acetate (Compound 134)



embedded image


Compound 134 was prepared by replacing intermediate I-3 with intermediate D-1 and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.78 (s, 4H), 7.08 (s, 2H), 4.93 (s, 2H), 4.39 (s, 2H), 4.31 (q, J=7.0 Hz, 2H), 2.31 (s, 6H), 1.34 (t, J=7.1 Hz, 3H). HRMS (ESI) calcd. for C22H22F3N3O4[M+H]+450.1635, found 450.1644.


Example 135
2-(4-((4-(4-Bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 135)



embedded image


Compound 135 was prepared by replacing 4-hydroxy-3,5-dimethylbenzaldehyde in Example 55 with 4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.07 (s, 1H), 8.51 (s, 1H), 7.72 (s, 4H), 7.22 (d, J=8.5 Hz, 2H), 6.80 (d, J=8.5 Hz, 2H), 4.88 (s, 2H), 1.50 (s, 6H). MS (ESI): m/z 454.1 [M+Na]+.


Example 136
Ethyl 2-(4-((4-(4-bromophenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpr opionate (Compound 136)



embedded image


Compound 136 was prepared by replacing 4-hydroxy-3,5-dimethylbenzaldehyde in Example 55 with 4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.68 (s, 1H), 7.62 (d, J=8.8 Hz, 2H), 7.48 (d, J=8.8 Hz, 2H), 7.31 (d, J=8.6 Hz, 2H), 6.83 (d, J=8.6 Hz, 2H), 4.96 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.27 (s, 6H), 0.87 (t, 3H). MS (ESI): m/z 482.1 [M+Na]+.


Example 137
2-(4-((4-(4-Trifluoromethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)ph enoxy)-2-methylpropionic acid (Compound 137)



embedded image


Compound 137 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.06 (s, 1H), 8.64 (s, 1H), 8.02 (d, J=8.5 Hz, 2H), 7.91 (d, J=8.6 Hz, 2H), 7.24 (d, J=8.6 Hz, 2H), 6.80 (d, J=8.6 Hz, 2H), 4.90 (s, 2H), 1.50 (s, 6H). MS (ESI): m/z 444.2 [M+Na]+.


Example 138
Ethyl 2-(4-((4-(4-trifluoromethylphenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionate (Compound 138)



embedded image


Compound 138 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 4H), 7.32 (d, J=8.5 Hz, 2H), 6.84 (d, J=8.5 Hz, 2H), 4.97 (s, 2H), 4.24 (q, J=7.1 Hz, 2H), 1.60 (s, 6H), 1.26 (t, J=7.1 Hz, 3H). MS (ESI): m/z 472.2 [M+Na]+.


Example 139
2-(2-Methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)acetic acid (Compound 139)



embedded image


Compound 139 was prepared by replacing intermediate I-3 with intermediate D-1, 4-hydroxy-3,5-dimethylbenzaldehyde with 3-methyl-4-hydroxybenzaldehyde, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.02 (s, 1H), 8.62 (s, 1H), 8.02 (d, J=8.3 Hz, 2H), 7.91 (d, J=8.2 Hz, 2H), 7.14 (s, 1H), 7.10 (d, J=8.6 Hz, 1H), 6.79 (d, J=8.1 Hz, 1H), 4.86 (s, 2H), 4.68 (s, 2H), 2.18 (s, 3H). MS (ESI): m/z 430.2 [M+Na]+.


Example 140
Ethyl 2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)p henoxy)acetate (Compound 140)



embedded image


Compound 140 was prepared by replacing intermediate I-3 with intermediate D-1, 4-hydroxy-3,5-dimethylbenzaldehyde with 3-methyl-4-hydroxybenzaldehyde, and ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.76 (d, J=4.4 Hz, 4H), 7.28 (s, 2H), 7.23 (d, J=8.5 Hz, 1H), 6.69 (d, J=8.2 Hz, 1H), 4.95 (s, 2H), 4.64 (s, 2H), 4.28 (q, J=7.1 Hz, 2H), 2.31 (s, 3H), 1.32 (t, 3H). MS (ESI): m/z 458.2 [M+Na]+.


Example 141
2-(2-Trifluoromethoxy-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-t riazol-1-yl)methyl)phenoxy)acetic acid (Compound 141)



embedded image


Compound 141 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethoxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.23 (s, 1H), 8.66 (s, 1H), 8.02 (d, J=8.5 Hz, 2H), 7.91 (d, J=8.6 Hz, 2H), 7.36 (s, 1H), 7.27 (d, J=8.5 Hz, 1H), 6.94 (d, J=8.5 Hz, 1H), 4.95 (s, 2H), 1.52 (s, 6H). HRMS (ESI) calcd. for C21H17F6N305 [M+H]+ 506.1151, found 506.1152.


Example 142
Ethyl 2-(2-trifluoromethoxy-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-l-y l)methyl)phenoxy)acetate (Compound 142)



embedded image


Compound 142 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethoxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 4H), 7.33 (s, 1H), 7.28 (s, 1H), 7.24 (d, J=8.7 Hz, 1H), 6.88 (d, J=8.4 Hz, 1H), 4.98 (s, 2H), 4.24 (q, J=7.0 Hz, 2H), 1.61 (s, 6H), 1.26 (t, J=7.0 Hz, 3H). MS (ESI): m/z 556.1 [M+Na]+.


Example 143
2-(2-Chloro-6-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-tr iazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 143)



embedded image


Compound 143 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-4-hydroxy-5-methylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 8.67 (s, 1H), 8.03 (d, J=8.5 Hz, 2H), 7.92 (d, J=8.5 Hz, 2H), 7.25 (s, 1H), 7.13 (s, 1H), 4.91 (s, 2H), 2.21 (s, 3H), 1.41 (s, 6H). HRMS (ESI) calcd. for C21H19ClF3N3O4 [M+H]+ 470.1094, found 470.1091.


Example 144
Ethyl 2-(2-chloro-6-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)phenoxy)-2-methylpropionate (Compound 144)



embedded image


Compound 144 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-4-hydroxy-5-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.73 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.36 (d, J=8.6 Hz, 2H), 7.26 (s, 1H), 7.11 (s, 1H), 4.93 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.54 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 520.1 [M+Na]+.


Example 145
2-(2-Chloro-6-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 145)



embedded image


Compound 145 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-4-hydroxy-5-methylbenzaldehyde according to the method of Example 55: H NMR (300 MHz, DMSO-d6) δ 12.89 (s, 1H), 8.56 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.4 Hz, 2H), 7.24 (s, 1H), 7.12 (s, 1H), 4.90 (s, 2H), 2.21 (s, 3H), 1.41 (s, 6H). HRMS (ESI) calcd. for C21H19ClF3N3O5 [M+H]+ 486.1044, found 486.1047.


Example 146
Ethyl 2-(2-chloro-6-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionate (Compound 146)



embedded image


Compound 146 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-4-hydroxy-5-methylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.73 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.36 (d, J=8.6 Hz, 2H), 7.26 (s, 1H), 7.11 (s, 1H), 4.93 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.25 (s, 3H), 1.54 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 536.1 [M+Na]+.


Example 147
2-(2-Trifluoromethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-tri azol-1-yl)methyl)phenoxy)acetic acid (Compound 147)



embedded image


Compound 147 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.34 (s, 1H), 8.65 (s, 1H), 8.01 (d, J=8.6 Hz, 2H), 7.91 (d, J=8.6 Hz, 2H), 7.63 (s, 1H), 7.53 (d, J=8.7 Hz, 1H), 6.91 (d, J=8.6 Hz, 1H), 4.98 (s, 2H), 1.54 (s, 6H). HRMS (ESI) calcd. for C21H17F6N3O4[M+H]+ 490.1202, found 490.1204.


Example 148
Ethyl 2-(2-trifluoromethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)phenoxy)acetate (Compound 148)



embedded image


Compound 148 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.78 (d, J=3.0 Hz, 5H), 7.65 (s, 1H), 7.53-7.42 (m, 1H), 6.81 (d, J=8.6 Hz, 1H), 5.00 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 1.63 (s, 6H), 1.26 (t, J=7.1 Hz, 3H). MS (ESI): m/z 540.1 [M+Na]+.


Example 149
2-(2,6-Dichloro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 149)



embedded image


Compound 149 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-dichloro-4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.92 (s, 1H), 8.58 (s, 1H), 7.88 (d, J=8.9 Hz, 2H), 7.56 (d, J=8.7 Hz, 2H), 7.44 (s, 2H), 4.98 (s, 2H), 1.47 (s, 6H). HRMS (ESI) calcd. for C20H16C12F3N3O5[M+H]+ 506.0497, found 506.0503.


Example 150
Ethyl 2-(2,6-dichloro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)met hyl)phenoxy)-2-methylpropionate (Compound 150)



embedded image


Compound 150 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-dichloro-4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.74 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.38 (s, 1H), 7.35 (s, 2H), 7.28 (s, 1H), 4.95 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 1.60 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 556.1 [M+Na]+.


Example 151
2-(2-Fluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 151)



embedded image


Compound 151 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-fluoro-4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.16 (s, 1H), 8.55 (s, 1H), 7.87 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.6 Hz, 2H), 7.20 (d, J=10.7 Hz, 1H), 7.06 (d, J=8.5 Hz, 1H), 6.97 (t, J=8.4 Hz, 1H), 4.92 (s, 2H), 1.50 (s, 6H). HRMS (ESI) calcd. for C20H17F4N3O5 [M+H]+ 456.1183, found 456.1182.


Example 152
Ethyl 2-(2-fluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl) phenoxy)-2-methylpropionate (Compound 152)



embedded image


Compound 152 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-fluoro-4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.64 (d, J=8.9 Hz, 2H), 7.36 (d, J=8.7 Hz, 2H), 7.16 (d, J=11.2 Hz, 1H), 7.07 (d, J=8.7 Hz, 1H), 6.97 (t, J=8.3 Hz, 1H), 4.97 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 1.59 (s, 6H), 1.30 (t, J=7.0 Hz, 3H). MS (ESI): m/z 506.1 [M+Na]+.


Example 153
2-Methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)propionic acid (Compound 153)



embedded image


Compound 153 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with p-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.09 (s, 1H), 8.52 (s, 1H), 7.87 (d, J=8.9 Hz, 2H), 7.55 (d, J=8.4 Hz, 2H), 7.23 (d, J=8.4 Hz, 2H), 6.80 (d, J=8.5 Hz, 2H), 4.88 (s, 2H), 1.50 (s, 6H). HRMS (ESI) calcd. for C20H18F3N3O5 [M+H]+ 438.1277, found 438.1267.


Example 154
Ethyl 2-methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)propionate (Compound 154)



embedded image


Compound 154 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with p-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.69 (s, 1H), 7.64 (d, J=9.0 Hz, 2H), 7.37 (s, 1H), 7.33 (d, J=3.0 Hz, 2H), 7.30 (s, 1H), 6.83 (d, J=8.6 Hz, 2H), 4.97 (s, 2H), 4.25 (q, J=7.1 Hz, 2H), 1.60 (s, 6H), 1.28 (t, 3H). MS (ESI): m/z 488.1 [M+Na]+.


Example 155
2-(2,6-Difluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 155)



embedded image


Compound 155 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-fluoro-4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.58 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.5 Hz, 2H), 7.10 (d, J=8.8 Hz, 2H), 4.97 (s, 2H), 1.44 (s, 6H). HRMS (ESI) calcd. for C20H16F5N3O5 [M+H]+ 474.1088, found 474.1087.


Example 156
Ethyl 2-(2,6-difluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)met hyl)phenoxy)-2-methylpropionate (Compound 156)



embedded image


Compound 156 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-fluoro-4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.74 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.37 (d, J=8.7 Hz, 2H), 6.96 (d, J=8.1 Hz, 2H), 4.96 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 1.57 (s, 6H), 1.33 (t, J=7.1 Hz, 3H). MS (ESI): m/z 524.1 [M+Na]+.


Example 157
2-Methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-(trifluoromethyl)phenoxy)propionic acid (Compound 157)



embedded image


Compound 157 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.35 (s, 1H), 8.53 (s, 1H), 7.86 (d, J=9.0 Hz, 2H), 7.62 (s, 1H), 7.55 (d, J=8.7 Hz, 2H), 7.50 (s, 1H), 6.92 (d, J=8.6 Hz, 1H), 4.97 (s, 2H), 1.54 (s, 6H). HRMS (ESI) calcd. for C21H17F6N3O5[M+H]+ 506.1151, found 506.1154.


Example 158
Ethyl 2-methyl-2-(4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-2-(trifluoromethyl)phenoxy)propionate (Compound 158)



embedded image


Compound 158 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-trifluoromethylbenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.64 (d, J=8.7 Hz, 3H), 7.47 (d, J=8.5 Hz, 1H), 7.36 (d, J=8.5 Hz, 2H), 6.81 (d, J=8.6 Hz, 1H), 4.99 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 1.64 (s, 6H), 1.26 (t, 3H). MS (ESI): m/z 556.1 [M+Na]+.


Example 159
2-(2-Chloro-6-fluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-t riazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 159)



embedded image


Compound 159 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-5-fluoro-4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.94 (s, 1H), 8.58 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.57 (d, J=8.6 Hz, 2H), 7.31 (s, 1H), 7.23 (d, J=11.5 Hz, 1H), 4.97 (s, 2H), 1.46 (s, 6H). HRMS (ESI) calcd. for C20H16ClF4N3O5 [M+H]+490.0793, found 490.0795.


Example 160
Ethyl 2-(2-chloro-6-fluoro-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-y l)methyl)phenoxy)-2-methylpropionate (Compound 160)



embedded image


Compound 160 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-5-fluoro-4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.74 (s, 1H), 7.64 (d, J=9.0 Hz, 2H), 7.37 (d, J=8.6 Hz, 2H), 7.24 (s, 1H), 7.06 (dd, J=10.7, 1.9 Hz, 1H), 4.95 (s, 2H), 4.28 (q, J=7.1 Hz, 2H), 1.58 (s, 6H), 1.33 (t, J=7.1 Hz, 3H). MS (ESI): m/z 540.1 [M+Na]+.


Example 161
2-(2,6-Dibromo-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 161)



embedded image


Compound 161 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-dibromo-4-hydroxybenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.89 (s, 1H), 8.58 (s, 1H), 7.88 (d, J=7.7 Hz, 2H), 7.63 (s, 2H), 7.57 (d, J=8.3 Hz, 2H), 4.98 (s, 2H), 1.51 (s, 6H). HRMS (ESI) calcd. for C20H16Br2F3N3O5 [M+H]+593.9487, found 593.9483.


Example 162
Ethyl 2-(2,6-dibromo-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)met hyl)phenoxy)-2-methylpropionate (Compound 162)



embedded image


Compound 162 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 3,5-dibromo-4-hydroxybenzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.74 (s, 1H), 7.65 (d, J=8.8 Hz, 2H), 7.57 (s, 2H), 7.37 (d, J=8.5 Hz, 2H), 4.94 (s, 2H), 4.31 (q, J=7.0 Hz, 2H), 1.64 (s, 6), 1.38 (t, J=7.1 Hz, 3H). MS (ESI): m/z 644.0 [M+Na]+.


Example 163
2-Methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionic acid (Compound 163)



embedded image


Compound 163 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methyl-5-(trifluoromethyl)benzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.04 (s, 1H), 8.56 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.5 Hz, 2H), 7.47 (d, J=14.8 Hz, 2H), 4.98 (s, 2H), 2.22 (s, 3H), 1.37 (s, 6H). HRMS (ESI) calcd. for C22H19F6N3O5[M+H]+520.1307, found 520.1305.


Example 164
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionate (Compound 164)



embedded image


Compound 164 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methyl-5-(trifluoromethyl)benzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.73 (s, 1H), 7.65 (d, J=9.0 Hz, 2H), 7.50 (s, 1H), 7.36 (d, J=8.6 Hz, 3H), 4.99 (s, 2H), 4.31 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.50 (s, 6H), 1.37 (t, J=7.1 Hz, 3H). MS (ESI): m/z 570.1 [M+Na]+.


Example 165
2-Methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-tr iazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionic acid (Compound 165)



embedded image


Compound 165 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methyl-5-(trifluoromethyl)benzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 13.03 (s, 1H), 8.67 (s, 1H), 8.03 (d, J=8.6 Hz, 2H), 7.92 (d, J=8.7 Hz, 2H), 7.48 (d, J=14.2 Hz, 2H), 5.00 (s, 2H), 2.22 (s, 3H), 1.37 (s, 6H). HRMS (ESI) calcd. for C22H19F6N3O4[M+H]+ 504.1358, found 504.1359.


Example 166
Ethyl 2-methyl-2-(2-methyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)-6-(trifluoromethyl)phenoxy)propionate (Compound 166)



embedded image


Compound 166 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methyl-5-(trifluoromethyl)benzaldehyde without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.80 (s, 1H), 7.78 (s, 3H), 7.50 (s, 1H), 7.40 (s, 1H), 7.28 (s, 1H), 5.00 (s, 2H), 4.31 (q, J=7.1 Hz, 2H), 2.24 (s, 3H), 1.50 (s, 6H), 1.37 (t, J=7.1 Hz, 3H). MS (ESI): m/z 554.2 [M+Na]+.


Example 167
2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-tria zol-1-yl)ethyl)phenoxy)-2-methylpropionic acid (Compound 167)



embedded image


embedded image


Synthesis of Intermediate L-3

Intermediate K-1 (13.2 g, 50 mmol) was dissolved in 100 mL of THF, and a solution of methylmagnesium bromide (11.4 mL, 100 mmol) in THF was slowly added at −78° C. under argon atmosphere. The mixture was reacted at −78° C. for 3 h. After the reaction was completed, 50 mL of a saturated ammonium chloride solution was added. The mixture was stirred at room temperature for 30 min. The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (100 mL) and extracted with ethyl acetate (100 mL×3). The organic phases were combined, washed with saturated brine (200 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=10:1) to give intermediate L-3 (colorless liquid, 7.3 g).


Synthesis of Compound 168

Intermediate L-3 (361.4 mg, 1.3 mmol) was dissolved in 5 mL of anhydrous dichloromethane (DCM), and triethylamine (262.6 mg, 2.6 mmol) and methylsufonyl chloride (MsCl) (229.2 mg, 2 mmol) were added. The mixture was stirred at room temperature for 2 h.


After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (20 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (20 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was dissolved in acetonitrile (10 mL), and intermediate D-3 (318.5 mg, 1.3 mmol) and cesium carbonate (1.07 g, 3.3 mmol) were added. The mixture was stirred at room temperature for 3 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=10:1) to give compound 168 (colorless liquid, 519.8 mg).


Synthesis of Compound 167

Compound 168 (80 mg, 0.16 mmol) was dissolved in methanol (3 mL), and a 1 N NaOH solution (0.78 mL) was added. The reaction system was transferred to an oil bath and reacted at 80° C. for 4 h. After the reaction was completed, the reaction liquid was cooled to room temperature. A 1 N HCl solution was added to adjust pH to 4, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (10 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (10 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 167 (white solid, 33.7 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.54 (s, 1H), 7.87 (d, J=8.9 Hz, 2H), 7.54 (d, J=8.8 Hz, 2H), 7.01 (s, 2H), 5.33 (q, J=6.9 Hz, 1H), 2.16 (s, 6H), 1.66 (d, J=7.0 Hz, 3H), 1.34 (s, 6H). HRMS (ESI) calcd. for C23H24F3N3O5[M+H]+ 480.1746, found 480.1746.


Example 168
Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)e thyl)phenoxy)-2-methylpropionate (Compound 168)



embedded image


Compound 168 was prepared without hydrolysis according to the method of Example 167: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.64 (d, J=9.0 Hz, 2H), 7.34 (d, J=8.4 Hz, 2H), 7.06 (s, 2H), 5.47 (q, J=7.1 Hz, 1H), 4.29 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.78 (d, J=7.1 Hz, 3H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 530.2 [M+Na]+.


Example 169
2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)ethyl)phenoxy)-2-methylpropionic acid (Compound 169)



embedded image


Compound 169 was prepared by replacing intermediate D-3 in Example 167 with D-1 according to the method of Example 167: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.65 (s, 1H), 8.03 (d, J=8.4 Hz, 2H), 7.91 (d, J=8.5 Hz, 2H), 7.02 (s, 2H), 5.35 (q, J=6.9 Hz, 1H), 2.16 (s, 6H), 1.67 (d, J=7.0 Hz, 3H), 1.35 (s, 6H). HRMS (ESI) calcd. for C23H24F3N3O4 [M+H]+ 464.1797, found 464.1797.


Example 170
Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)eth yl)phenoxy)-2-methylpropionate (Compound 170)



embedded image


Compound 170 was prepared by replacing D-3 n Example 167 with D-1 without hydrolysis according to the method of Example 167: 1H NMR (300 MHz, CDCl3) δ 7.79 (d, J=8.8 Hz, 2H), 7.75 (d, J=9.2 Hz, 2H), 7.28 (s, 1H), 7.07 (s, 2H), 5.47 (q, J=7.1 Hz, 1H), 4.29 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.79 (d, J=7.1 Hz, 3H), 1.48 (d, J=3.3 Hz, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 514.2 [M+Na]+.


Example 171
2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-tria zol-1-yl)propyl)phenoxy)-2-methylpropionic acid (Compound 171)



embedded image


Compound 171 was prepared by replacing methylmagnesium bromide in Example 167 with ethylmagnesium bromide according to the method of Example 167: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.56 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.54 (d, J=8.7 Hz, 2H), 7.05 (s, 2H), 5.03 (q, J=9.7, 5.8 Hz, 1H), 2.16 (s, 6H), 2.12-1.91 (m, 2H), 1.35 (s, 6H), 0.83 (t, J=7.2 Hz, 3H). HRMS (ESI) calcd. for C24H26F3N3O5[M+H]+ 494.1903, found 494.1902.


Example 172
Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)p ropyl)phenoxy)-2-methylpropionate (Compound 172)



embedded image


Compound 172 was prepared by replacing methylmagnesium bromide in Example 167 with ethylmagnesium bromide without hydrolysis according to the method of Example 167: 1H NMR (300 MHz, CDCl3) δ 7.72 (s, 1H), 7.65 (d, J=9.0 Hz, 2H), 7.34 (d, J=8.4 Hz, 2H), 7.08 (s, 2H), 5.13 (t, 1H), 4.29 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 2.17-2.02 (m, 2H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H), 0.94 (t, J=7.3 Hz, 3H). MS (ESI): m/z 544.2 [M+Na]+.


Example 173
2-(2,6-Dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)propyl)phenoxy)-2-methylpropionic acid (Compound 173)



embedded image


Compound 173 was prepared by replacing D-3 in Example 167 with D-1 and methylmagnesium bromide with ethylmagnesium bromide according to the method of Example 167: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.66 (s, 1H), 8.03 (d, J=8.5 Hz, 2H), 7.90 (d, J=8.7 Hz, 2H), 7.05 (s, 2H), 5.04 (q, J=9.5, 5.8 Hz, 1H), 2.16 (s, 6H), 2.14-1.88 (m, 2H), 1.35 (s, 6H), 0.84 (t, J=7.2 Hz, 3H). HRMS (ESI) calcd. for C24H26F3N3O4[M+H]+ 478.1954, found 478.1957.


Example 174
Ethyl 2-(2,6-dimethyl-4-(1-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)pro pyl)phenoxy)-2-methylpropionate (Compound 174)



embedded image


Compound 174 was prepared by replacing D-3 in Example 167 with D-1 and methylmagnesium bromide with ethylmagnesium bromide without hydrolysis according to the method of Example 167: 1H NMR (300 MHz, CDCl3) δ 7.80 (d, J=5.2 Hz, 2H), 7.78 (s, 1H), 7.75 (d, J=9.0 Hz, 2H), 7.08 (s, 2H), 5.13 (t, 1H), 4.29 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 2.18-1.92 (m, 2H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H), 0.94 (t, J=7.3 Hz, 3H). MS (ESI): m/z 528.2 [M+Na]+.


Example 175
2-(2,6-Dimethyl-4-((3-methyl-5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 175)



embedded image


embedded image


Synthesis of Intermediate F-1

p-Trifluoromethylaniline (1.24 mL, 10 mmol) was dissolved in ethyl acetate (EA) (25 mL), and pyridine (Py) (0.885 mL, 11 mmol) was added. Phenyl chloroformate (1.38 mL, 11 mmol) was slowly added under an ice bath. The mixture was stirred at room temperature and reacted for 4 h. After the reaction was completed, the reaction liquid was washed with water (50 mL×3). The organic phase was washed with saturated brine (20 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate F-1 (brown solid, 3.116 g).


Synthesis of Intermediate F-2

Intermediate F-1 (1.687 g, 6 mmol) was dissolved in glycol dimethyl ether (20 mL), and 98% hydrazine hydrate (1 mL) was added. The mixture was stirred at room temperature for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate F-2 (yellow solid, 1.12 g).


Synthesis of Intermediate F-3

Intermediate F-2 (438 mg, 2 mmol) was dissolved in DCM (20 mL), and triethyl orthoacetate (5 mL, 27 mmol) and formic acid (20 μL, 0.52 mmol) were added under an ice bath. The mixture was slowly warmed to room temperature and reacted for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent to 5 mL. Petroleum ether (20 mL) was added to the residue, and the mixture was filtered under reduced pressure to give intermediate F-3 (white solid, 370 mg).


Synthesis of Intermediate F-4

Intermediate F-3 (289 mg, 1 mmol) was added to hexamethyldisilazane (12 mL), and ammonium sulfate (6 mg, 0.045 mmol) was added. The mixture was purged with argon three times. The system was transferred to an oil bath and reacted at 130° C. for 16 h. After the reaction was completed, the reaction liquid was cooled to room temperature and concentrated by rotary evaporation under reduced pressure to remove the solvent, and toluene (8 mL×2) was added. The mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (20 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (20 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent to give intermediate F-4 (white solid, 172 mg).


Synthesis of Compound 176

Intermediate F-4 (97 mg, 0.4 mmol) was dissolved in acetonitrile (5 mL), and compound K-3 (170 mg, 0.52 mmol) and cesium carbonate (326 mg, 1 mmol) were added. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=2:1) to give compound 176 (colorless liquid, 160 mg).


Synthesis of Compound 175

Compound 176 (150 mg, 0.305 mmol) was dissolved in methanol (3 mL), and a 1 N NaOH solution (1.5 mL) was added. The reaction system was transferred to an oil bath and reacted at 80° C. for 4 h. After the reaction was completed, the reaction liquid was cooled to room temperature. A 1 N HCl solution was added to adjust pH to 4, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (10 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (10 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=80:1) to give compound 131 (white solid, 37 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 7.93 (d, J=8.4 Hz, 2H), 7.75 (d, J=8.3 Hz, 2H), 6.98 (s, 2H), 4.79 (s, 2H), 2.17 (s, 6H), 2.15 (s, 3H), 1.36 (s, 6H). HRMS (ESI) calcd. for C19H19N3O4S [M+H]+ 464.1792, found 464.1799.


Example 176
Ethyl 2-(2,6-dimethyl-4-((3-methyl-5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionate (Compound 176)



embedded image


Compound 176 was prepared without hydrolysis according to the method of Example 175: 1H NMR (300 MHz, DMSO-d6) δ 7.93 (d, J=8.5 Hz, 2H), 7.75 (d, J=8.3 Hz, 2H), 6.98 (s, 2H), 4.79 (s, 2H), 4.18 (q, J=7.1 Hz, 2H), 2.15 (s, 3H), 2.13 (s, 6H), 1.38 (s, 6H), 1.25 (t, J=7.1 Hz, 3H). MS (ESI): m/z 514.3 [M+Na]+.


Example 177
2-Methyl-2-(2-methyl-4-((3-methyl-5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1 H-1,2,4-triazol-1-yl)methyl)phenoxy)propionic acid (Compound 177)



embedded image


Synthesis of Intermediate G-1



embedded image


Intermediate G-1 was prepared by replacing 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-methylbenzaldehyde according to the method for intermediate K-3 of Example 55.


Synthesis of Compound 177

Compound 177 was prepared by replacing K-3 in Example 175 with G-1 according to the method of Example 175: 1H NMR (300 MHz, DMSO-d6) δ 13.04 (s, 1H), 7.93 (d, J=8.4 Hz, 2H), 7.74 (d, J=8.3 Hz, 2H), 7.14 (s, 1H), 7.06 (d, J=8.3 Hz, 1H), 6.66 (d, J=8.3 Hz, 1H), 4.79 (s, 2H), 2.15 (s, 3H), 2.13 (s, 3H), 1.51 (s, 6H). HRMS (ESI) calcd. for C22H22F3N3O4 [M+H]+450.1635, found 450.1641.


Example 178
Ethyl 2-methyl-2-(2-methyl-4-((3-methyl-5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-tr iazol-1-yl)methyl)phenoxy)propionate (Compound 178)



embedded image


Compound 178 was prepared by replacing K-3 in Example 175 with G-5 without hydrolysis according to the method of Example 175: 1H NMR (300 MHz, DMSO-d6) δ 7.93 (d, J=8.4 Hz, 2H), 7.74 (d, J=8.3 Hz, 2H), 7.16 (s, 1H), 7.06 (d, J=8.2 Hz, 1H), 6.59 (d, J=8.3 Hz, 1H), 4.80 (s, 2H), 4.18 (q, J=7.1 Hz, 2H), 2.16 (s, 3H), 2.14 (s, 3H), 1.53 (s, 6H), 1.20 (dd, J=16.1, 9.1 Hz, 3H). MS (ESI): m/z 500.3 [M+Na]+


Example 179
2-(4-(((4-([1,1′-Biphenyl]-4-yl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)-2-methylphenoxy)acetic acid (Compound 179)



embedded image


Synthesis of Compound 180

Compound 11 (102 mg, 0.2 mmol) prepared in Example 11, pinacol phenylboronate (70.5 mg, 0.3 mmol), [1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (Pd(dppf)C12) (43.9 mg, 0.06 mmol), and sodium carbonate (Na2CO3) (32 mg, 0.3 mmol) were added to a reaction flask and purged with argon three times, and toluene (PhMe) (4 mL) and water (0.4 mL) were added. The reaction system was transferred to an oil bath and reacted at 80° C. for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=1:1) to give compound 180 (white solid, 93.1 mg).


Synthesis of Compound 179

Compound 180 (93.1 mg, 0.2 mmol) was dissolved in methanol (4 mL), and a 1 N NaOH solution (98 mg, 0.2 mmol) was added. The mixture was stirred at room temperature for 24 h. After the reaction was completed, the reaction liquid was adjusted to pH 4 with a 1 N HCl solution, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (15 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (15 mL×1) and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 179 (white solid, 24.8 mg): 1H NMR (300 MHz, DMSO-d6) δ 7.68-7.56 (m, 4H), 7.45 (t, J=7.5 Hz, 2H), 7.40-7.31 (m, 3H), 6.90 (s, 2H), 3.50 (s, 2H), 3.34 (s, 2H), 2.47-2.27 (m, 8H), 2.14 (s, 6H), 1.33 (s, 6H). MS(ESI): m/z 473.3 [M+H]+.


Example 180
Ethyl 2-(4-(((4-([[1,1′-biphenyl]-4-yl]-5-oxo-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)thio)-2-methyl phenoxy)acetate (Compound 180)



embedded image


Compound 180 was prepared without hydrolysis according to the method of Example 179: 1H NMR (300 MHz, CDCl3) δ 7.76 (s, 1H), 7.71 (d, J=8.5 Hz, 2H), 7.59 (t, J=8.2 Hz, 4H), 7.48 (t, J=7.4 Hz, 2H), 7.41 (d, J=7.2 Hz, 1H), 7.35 (d, J=6.5 Hz, 2H), 6.66 (d, J=9.1 Hz, 1H), 5.19 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.2 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 498.1 [M+Na]+.


Example 181
2-(2-Methyl-4-((((5-oxo-4-(4′-(trifluoromethyl)-[1, 1′-biphenyl]-4-yl]-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetic acid (Compound 181)



embedded image


Compound 181 was prepared by replacing pinacol phenylboronate with pinacol p-trifluoromethylphenylboronate according to the method of Example 179: 1H NMR (300 MHz, DMSO-d6) δ 12.97 (s, 1H), 8.59 (s, 1H), 7.93 (dd, J=13.9, 8.4 Hz, 4H), 7.81 (dd, J=15.5, 8.5 Hz, 4H), 7.27 (d, J=6.4 Hz, 2H), 6.80 (d, J=9.2 Hz, 1H), 5.18 (s, 2H), 4.69 (s, 2H), 2.14 (s, 3H). MS (ESI): m/z 538.1 [M+Na]+.


Example 182
Ethyl 2-(2-methyl-4-(((5-oxo-4-(4′-(trifluoromethyl)-[1,1′-biphenyl]-4-yl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)thio)phenoxy)acetate (Compound 182)



embedded image


Compound 182 was prepared by replacing pinacol phenylboronate with pinacol p-trifluoromethylphenylboronate without hydrolysis according to the method of Example 179: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 1H), 7.74 (d, J=8.6 Hz, 3H), 7.72-7.68 (m, 3H), 7.63 (d, J=8.7 Hz, 2H), 7.35 (d, J=6.8 Hz, 2H), 6.66 (d, J=9.1 Hz, 1H), 5.18 (s, 2H), 4.63 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 566.1 [M+Na]+.


Example 183
2-(2-Methyl-4-((((5-oxo-4-(4′-(trifluoromethoxy)-[1,1′-biphenyl]-4-yl]-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)acetic acid (Compound 183)



embedded image


Compound 183 was prepared by replacing pinacol phenylboronate with pinacol p-trifluoromethoxyphenylboronate according to the method of Example 179: 1H NMR (300 MHz, DMSO-d6) δ 13.07 (s, 1H), 8.57 (s, 1H), 7.84 (d, J=8.8 Hz, 4H), 7.75 (d, J=8.7 Hz, 2H), 7.48 (d, J=8.1 Hz, 2H), 7.27 (d, J=6.5 Hz, 2H), 6.80 (d, J=9.2 Hz, 1H), 5.17 (s, 2H), 4.69 (s, 2H), 2.14 (s, 3H). MS (ESI): m/z 554.1 [M+Na]+.


Example 184
Ethyl 2-(2-methyl-4-((((5-oxo-4-(4′-(trifluoromethoxy)-[1,1′-biphenyl]-4-yl]-4,5-dihydro-1H-1,2,4-tria zol-1-yl)methyl)thio)phenoxy)acetate (Compound 184)



embedded image


Compound 184 was prepared by replacing pinacol phenylboronate with pinacol p-trifluoromethoxyphenylboronate without hydrolysis according to the method of Example 179: 1H NMR (300 MHz, CDCl3) δ 7.76 (s, 1H), 7.67 (d, J=8.6 Hz, 2H), 7.60 (m, 4H), 7.34 (t, J=7.2 Hz, 4H), 6.66 (d, J=9.1 Hz, 1H), 5.18 (s, 2H), 4.63 (s, 2H), 4.26 (q, J=7.1 Hz, 2H), 2.27 (s, 3H), 1.30 (t, J=7.1 Hz, 3H). MS (ESI): m/z 582.1 [M+Na]+.


Example 185
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl-d2)phenoxy)-2-methylpropionic acid (Compound 185)



embedded image


embedded image


Synthesis of Intermediate M-1

Methyl 4-hydroxy-3,5-dimethylbenzoate (180 mg, 1 mmol) was dissolved in anhydrous tetrahydrofuran (5 mL), and deuterated lithium aluminum hydride (76 mg, 2 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and stirred overnight. The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (20 mL) and extracted with ethyl acetate (20 mL×3). The organic phases were combined, washed with saturated brine (20 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate M-1, which was directly used in the next step without further purification.


Synthesis of Intermediate M-2

The crude product of M-1 obtained from the previous step was dissolved in acetonitrile (10 mL), and ethyl 2-bromoisobutyrate (433 μL, 3 mmol), cesium carbonate (326 mg, 1 mmol), potassium carbonate (276 mg, 2 mmol), and potassium iodide (12 mg, 0.07 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 36 h. After the reaction was completed, the reaction liquid was cooled to room temperature and filtered under reduced pressure. The filtrate was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (20 mL) and extracted with ethyl acetate (20 mL×3). The organic phases were combined, washed with 1 N sodium hydroxide (20 mL×3) and saturated brine (20 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=200:1) to give intermediate M-2 (yellow liquid, 150 mg).


Synthesis of Intermediate M-3

M-2 (150 mg, 0.56 mmol) was dissolved in DCM (5 mL), carbon tetrabromide (278 mg, 0.84 mmol) was added, and triphenylphosphine (205 mg, 0.78 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and reacted for 8 h. The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=20:1) to give compound M-3 (yellow liquid, 148 mg).


Synthesis of Compound 186

Intermediate D-3 (73.5 mg, 0.3 mmol) was dissolved in acetonitrile (3 mL), and M-3 (148.5 mg, 0.45 mmol) and cesium carbonate (244.5 mg, 0.75 mmol) were added. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=10:1) to give compound 186 (white solid, 105.7 mg).


Synthesis of Compound 185

Compound 186 (15 mg, 0.03 mmol) was dissolved in methanol (2 mL), and a 1 N NaOH solution (0.15 mL) was added. The mixture was stirred at room temperature for 24 h. After the reaction was completed, the reaction liquid was adjusted to pH 4 with a 1 N HCl solution, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (5 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (10 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 185 (white solid, 11.8 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.86 (s, 1H), 8.43 (s, 1H), 7.60 (d, J=8.2 Hz, 2H), 7.39 (d, J=8.3 Hz, 2H), 6.95 (s, 2H), 4.83 (s, 2H), 3.09-2.84 (m, 1H), 2.15 (s, 6H), 1.35 (s, 6H), 1.22 (d, J=6.9 Hz, 6H). HRMS (ESI) calcd. for C22H20D2F3N3O5[M+H]+ 468.1715, found 468.1715.


Example 186
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)me thyl-d2)phenoxy)-2-methylpropionate (Compound 186)



embedded image


Compound 186 was prepared without hydrolysis according to the method of Example 185: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.35 (d, J=8.7 Hz, 2H), 7.03 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 518.0 [M+Na]+.


Example 187
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl-d2)phenoxy)-2-methylpropionic acid (Compound 187)



embedded image


Compound 187 was prepared by replacing intermediate with intermediate D-1 according to the method of Example 185: 1H NMR (300 MHz, DMSO) δ 12.85 (s, 1H), 8.64 (s, 1H), 8.04 (d, J=8.5 Hz, 2H), 7.92 (d, J=8.5 Hz, 2H), 6.97 (s, 2H), 2.16 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C22H20D2F3N3O4[M+H]+ 451.1688, found 451.1688.


Example 188
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl-d2)phenoxy)-2-methylpropionate (Compound 188)



embedded image


Compound 188 was prepare without hydrolysis according to the method of Example 187: 1H NMR (300 MHz, CDCl3) δ 7.87-7.68 (m, 5H), 7.04 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.21 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 502.2 [M+Na]+.


Example 189
2-(2,6-Diethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 189)



embedded image


Compound 189 was prepared by replacing intermediate I-3 with intermediate D-3 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-diethylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.54 (s, 1H), 7.88 (d, J=8.9 Hz, 2H), 7.56 (d, J=8.6 Hz, 2H), 7.00 (s, 2H), 4.88 (s, 2H), 2.57 (q, 4H), 1.35 (s, 6H), 1.12 (t, J=7.4 Hz, 6H). HRMS (ESI) calcd. for C24H26F3N3O5[M+H]+ 494.1903, found 494.1903.


Example 190
Ethyl 2-(2,6-diethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropropionate (Compound 190)



embedded image


Compound 190 was prepared without hydrolysis according to the method of Example 189: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.66 (d, J=9.0 Hz, 2H), 7.36 (d, J=8.5 Hz, 2H), 7.08 (s, 2H), 4.96 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.59 (q, J=7.5 Hz, 4H), 1.47 (s, 6H), 1.37 (t, J=7.1 Hz, 3H), 1.20 (t, J=7.5 Hz, 6H). MS (ESI): m/z 544.2 [M+Na]+.


Example 191
2-(2,6-Diethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 191)



embedded image


Compound 191 was prepared by replacing intermediate I-3 with intermediate D-1 and 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-diethylbenzaldehyde according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.65 (s, 1H), 8.04 (d, J=7.9 Hz, 2H), 7.92 (d, J=8.2 Hz, 2H), 7.01 (s, 2H), 4.90 (s, 2H), 2.58 (q, J=6.9 Hz, 4H), 1.35 (s, 6H), 1.12 (t, J=6.7 Hz, 6H). HRMS (ESI) calcd. for C24H26F3N3O4[M+H]+ 478.1954, found 478.1954.


Example 192
Ethyl 2-(2,6-diethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth yl)phenoxy)-2-methylpropropionate (Compound 192)



embedded image


Compound 192 was prepared without hydrolysis according to the method of Example 191: 1H NMR (300 MHz, CDCl3) δ 8.04-7.60 (m, 5H), 7.08 (s, 2H), 4.97 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 2.59 (q, J=7.5 Hz, 4H), 1.47 (s, 6H), 1.37 (t, J=7.1 Hz, 3H), 1.20 (t, J=7.5 Hz, 6H). MS (ESI): m/z 528.2 [M+Na]+.


Example 193
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)phenoxy)-2-methylpropionic acid diisopropylamine salt (Compound 193)



embedded image


Compound 61 (80 mg, 0.17 mmol) prepared in Example 61 was dissolved in DCM (2 mL), and diisopropylamine (29 mL, 0.20 mmol) was added. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was dispersed in n-hexane (2 mL), and DCM (5 drops) was added. The mixture was stirred at room temperature for half an hour. The reaction liquid was filtered under reduced pressure to give compound 193 (white solid, 83 mg): 1H NMR (300 MHz, DMSO-d6) δ 8.52 (s, 1H), 7.88 (d, J=8.9 Hz, 2H), 7.55 (d, J=8.6 Hz, 2H), 6.90 (s, 2H), 4.82 (s, 2H), 3.12 (dt, J=12.6, 6.3 Hz, 2H), 2.17 (s, 6H), 1.29 (s, 6H), 1.12 (d, J=6.3 Hz, 12H).


Example 194
2-(2,6-Dimethyl-4-(2-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)ethyl)phenoxy)-2-methylpropionic acid (Compound 194)



embedded image


Synthesis of Intermediate J-1

2,6-Dimethylphenol (1.2 g, 10 mmol) was dissolved in acetonitrile (15 mL), and ethyl 2-bromoisobutyrate (3.4 mL, 30 mmol) and cesium carbonate (8.1 g, 25 mmol) were added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (20 mL) was added to the residue. The mixture was extracted with EA (50 mL×3). The organic phase was washed with 1 N NaOH (20 mL×3) and saturated brine (20 mL), dried over anhydrous MgSO4, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue, i.e., the crude product of J-1, was directly used in the next step.


Synthesis of Intermediate J-2

DCM (20 mL) and bromoacetyl bromide (2.1 mL, 24 mmol) were added to AlCl3 (3.2 g, 24 mmol) under argon atmosphere and an ice bath. The mixture was stirred at room temperature for 1 h. J-1 (1.9 g, 8 mmol) was added to the mixture under an ice bath. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (20 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue, i.e., the crude product of J-2, was directly used in the next step.


Synthesis of Intermediate J-3

Intermediate J-2 (1.8 g, 5 mmol) was dissolved in trifluoroacetic acid (15 mL), and triethylsilane (1.0 mL, 7.5 mmol) was added. The reaction system was warmed to 70° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature, and diluted with water (20 mL) under an ice bath. The mixture was stirred at room temperature for 10 min, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was extracted with EA (20 mL×3). The organic phase was washed with saturated sodium bicarbonate (20 mL) and saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue, i.e., the crude product of J-3, was directly used in the next step.


Synthesis of Compound 195

Intermediate D-1 (91.2 mg, 0.4 mmol) was dissolved in acetonitrile (3 mL), and J-3 (180 mg, 0.6 mmol) and cesium carbonate (130 mg, 1 mmol) were added. The reaction mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:5) to give compound 195 (white solid, 125 mg).


Synthesis of Compound 194

Compound 195 (125 mg, 0.26 mmol) was dissolved in MeOH (3 mL), and 1 N NaOH (1.3 mL, 1.3 mmol) was added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature. 1 N HCl (1.3 mL) was added, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (10 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (DCM/MeOH=100:1) to give compound 194 (white solid, 78.9 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.81 (s, 1H), 8.63 (s, 1H), 7.95 (d, J=8.9 Hz, 2H), 7.90 (d, J=8.8 Hz, 2H), 6.82 (s, 2H), 3.94 (t, J=7.0 Hz, 2H), 2.87 (t, J=7.2 Hz, 2H), 2.10 (s, 6H), 1.29 (s, 6H). HRMS (ESI): exact mass calculated for C23H24F3N3O4[M+H]+ 464.1797, found 464.1793.


Example 195
Ethyl 2-(2,6-dimethyl-4-(2-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)eth yl)phenoxy)-2-methylpropionate (Compound 195)



embedded image


Compound 195 was prepared without hydrolysis according to the method of Example 194: 1H NMR (300 MHz, CDCl3) δ 7.84-7.69 (m, 4H), 7.28 (s, 1H), 6.86 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 4.07 (t, 2H), 3.00 (t, 2H), 2.18 (s, 6H), 1.46 (s, 6H), 1.37 (t, J=7.1 Hz, 3H). MS (ESI): m/z 514.2 [M+Na]+.


Example 196
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methoxy)phenoxy)-2-methylpropionic acid (Compound 196)



embedded image


Synthesis of Intermediate K-4

Intermediate K-1 (1.4 g, 10 mmol) was dissolved in DCM (15 mL), and 3-chloroperbenzoic acid (3.5 g, 20 mmol) and p-toluenesulfonic acid (172 mg, 1 mmol) were added. The reaction mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was filtered under reduced pressure. Water (50 mL) was added to the filtrate, and the resulting mixture was extracted with EA (50 mL×3). The organic phase was washed with saturated sodium bicarbonate (50 mL×3) and saturated brine (30 mL), dried over anhydrous MgSO4, and concentrated by rotary evaporation under reduced pressure to remove the solvent. EtOH (20 mL) and a solution of sodium ethoxide (0.8 g, 11 mmol) in EtOH (10 mL) were added to the residue under nitrogen atmosphere. The reaction mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was adjusted to pH=3 with 1 N HCl (11 mL), and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (10 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:3) to give intermediate K-4.


Synthesis of Intermediate K-5

Intermediate D-1 (2.1 g, 8.5 mmol) was dissolved in acetonitrile (15 mL), and paraformaldehyde (1.3 g, 42.5 mmol) and acetic acid (60 mg, 1 mmol) were added. The reaction system was warmed to 60° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:2) to give intermediate K-5.


Synthesis of Compound 197

K-5 (77 mg, 0.3 mmol) was dissolved in DCM (3 mL), and triethylamine (60.6 mg, 0.6 mmol) and methylsufonyl chloride (51.5 mg, 0.45 mmol) were added dropwise. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The above residue was dissolved in acetonitrile (3 mL) at room temperature, and cesium carbonate (244.5 mg, 0.75 mmol) and K-4 (113.5 mg, 0.45 mmol) were added. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:5) to give compound 197 (white solid, 59.1 mg).


Synthesis of Compound 196

Compound 197 (59.1 mg, 0.12 mmol) was dissolved in MeOH (3 mL), and 1 N NaOH (0.3 mL, 0.6 mmol) was added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature. 1 N HCl (0.5 mL) was added, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (10 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (DCM/MeOH=100:1) to give compound 196 (white solid, 42.7 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.75 (s, 1H), 8.72 (s, 1H), 7.99 (d, J=8.7 Hz, 2H), 7.93 (d, J=8.8 Hz, 2H), 6.79 (s, 2H), 5.67 (s, 2H), 2.14 (s, 6H), 1.33 (s, 6H). HRMS (ESI): exact mass calculated for C22H22F3N3O5[M+H]+ 466.1590, found 466.1590.


Example 197
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)meth oxy)phenoxy)-2-methylpropionate (Compound 197)



embedded image


Compound 195 was prepared without hydrolysis according to the method of Example 196: 1H NMR (300 MHz, CDCl3) δ 7.84 (s, 1H), 7.77 (q, J=8.9 Hz, 4H), 6.79 (s, 2H), 5.73 (s, 2H), 4.30 (q, J=6.8 Hz, 2H), 2.20 (s, 67H), 1.47 (s, 6H), 1.37 (t, J=7.2 Hz, 3H). MS (ESI): m/z 516.2 [M+Na]+.


Example 198
2-(2,6-Dimethyl-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)thio)phenoxy)-2-methylpropionic acid (Compound 198)



embedded image


Synthesis of Intermediate K-6

2,6-Dimethylphenol (1.2 g, 10 mmol) was dissolved in DCM (25 mL), and ammonium thiocyanate (1.1 g, 15 mmol) and potassium persulfate (5.4 g, 20 mmol) were added. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent, and the residue, i.e., the crude product of intermediate K-6, was directly used in the next step.


Synthesis of Intermediate K-7

Compound K-6 (1.4 g, 8 mmol) was dissolved in acetonitrile (15 mL), and ethyl 2-bromoisobutyrate (2.7 mL, 24 mmol) and cesium carbonate (6.5 g, 20 mmol) were added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (20 mL) was added to the residue, and the resulting mixture was extracted with EA (25 mL×3). The organic phase was washed with 1 N NaOH (20 mL×3) and saturated brine (25 mL), dried over anhydrous MgSO4, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue, i.e., the crude product of intermediate K-7, was directly used in the next step.


Synthesis of Intermediate K-8

Compound K-7 (1.4 g, 5 mmol) was dissolved in absolute ethanol (15 mL), and 6 N HCl (1.25 mL, 7.5 mmol) and zinc powder (1.6 g, 25 mmol) were added. The reaction system was warmed to 75° C. and stirred for 8 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:20) to give K-8.


Synthesis of Compound 199

K-5 (77 mg, 0.3 mmol) was dissolved in DCM (3 mL), and triethylamine (60.6 mg, 0.6 mmol) and methylsufonyl chloride (51.5 mg, 0.45 mmol) were added dropwise. The reaction mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The above residue was dissolved in an acetonitrile solution (3 mL) at room temperature, and cesium carbonate (244.5 mg, 0.75 mmol) and K-8 (113.5 mg, 0.45 mmol) were added. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:5) to give compound 199 (59.1 mg).


Synthesis of Compound 198

Compound 199 (59.1 mg, 0.12 mmol) was dissolved in MeOH (3 mL), and 1 N NaOH (0.3 mL, 0.6 mmol) was added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature. 1 N HCl (0.5 mL) was added, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (10 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (DCM/MeOH=100:1) to give compound 198 (white solid, 67.2 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.69 (s, 1H), 7.92 (s, 4H), 7.11 (s, 2H), 5.21 (s, 2H), 2.09 (s, 6H), 1.29 (s, 6H). HRMS (ESI): exact mass calculated for C22H22F3N3O4S [M+H]+ 482.1361, found 482.1362.


Example 199
Ethyl 2-(2,6-dimethyl-4-(((5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)met hyl)thio)phenoxy)-2-methylpropionate (Compound 199)



embedded image


Compound 199 was prepared without hydrolysis according to the method of Example 198: 1H NMR (300 MHz, CDCl3) δ 7.78 (s, 1H), 7.77 (d, J=9.2 Hz, 2H), 7.70 (d, J=8.6 Hz, 2H), 7.16 (s, 2H), 5.20 (s, 2H), 4.29 (q, J=7.1 Hz, 2H), 2.17 (s, 6H), 1.45 (s, 6H), 1.36 (t, J=7.1 Hz, 3H).


Example 200
2-(2,6-Dimethyl-4-(3-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)propyl)phenoxy)-2-methylpropionic acid (Compound 200)



embedded image


Synthesis of Intermediate K-9

Intermediate K-1 (0.5 g, 2.25 mmol) was dissolved in DMF (5 mL), and 2,2-dimethyl-1,3-dioxane-4,6-dione (0.5 g, 3.38 mmol) and triethylamine (0.4 mL, 2.7 mmol) were added. Formic acid (189 μL, 5 mmol) was added to the mixture under an ice bath, and the resulting mixture was stirred for 5 min. The reaction system was warmed to 100° C., and stirred overnight. After the reaction was completed, the reaction liquid was cooled to room temperature. Water (20 mL) was added, and the resulting mixture was extracted with EA (50 mL×3). The organic phase was washed with saturated brine (20 mL), dried over anhydrous MgSO4, and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a residue, i.e., the crude product of intermediate K-9.


Synthesis of Intermediate K-10

Intermediate K-9 (0.5 g, 1.5 mmol) was dissolved in tetrahydrofuran (5 mL). Borane-tetrahydrofuran complex (1 mL, 1 mmol) was added under an ice bath. The mixture was stirred overnight. After the reaction was completed, water (10 mL) was added, and the resulting mixture was stirred for 30 min. The mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a residue, i.e., the crude product of intermediate K-10.


Synthesis of Intermediate K-11

Intermediate K-10 (0.2 g, 1 mmol) was dissolved in DCM (5 mL). Carbon tetrabromide (0.5 g, 1.5 mmol) and triphenylphosphine (0.5 g, 1.4 mmol) were added under an ice bath. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:20) to give intermediate K-11.


Synthesis of Compound 201

Intermediate D-1 (91.2 mg, 0.4 mmol) was dissolved in acetonitrile (3 mL), and intermediate K-11 (180 mg, 0.6 mmol) and cesium carbonate (130 mg, 1 mmol) were added. The mixture was stirred at room temperature overnight. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (EA/PE=1:5) to give compound 201 (125 mg).


Synthesis of Compound 200

Compound 201 (125 mg, 0.26 mmol) was dissolved in MeOH (3 mL), and 1 N NaOH (1.3 mL, 1.3 mmol) was added. The reaction system was warmed to 80° C. and stirred for 12 h. After the reaction was completed, the reaction liquid was cooled to room temperature. 1 N HCl (1.3 mL) was added, and the resulting mixture was concentrated by rotary evaporation under reduced pressure to remove the solvent. Water (10 mL) was added to the residue, and the resulting mixture was extracted with EA (20 mL×3). The organic phase was washed with saturated brine (20 mL), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (DCM/MeOH=100:1) to give compound 200 (white solid, 78.9 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.75 (s, 1H), 8.62 (s, 1H), 8.01 (d, J=8.4 Hz, 2H), 7.91 (d, J=8.4 Hz, 2H), 6.84 (s, 2H), 3.76 (t, J=6.4 Hz, 2H), 3.32 (t, 2H), 2.12 (s, 6H), 2.05-1.75 (m, 2H), 1.32 (s, 6H). HRMS (ESI): exact mass calculated for C24H26F3N3O4[M+H]+ 478.1954, found 478.1950.


Example 201
2-(2,6-Dimethyl-4-(3-(5-oxo-4-(4-(trifluoromethyl)phenyl)-4,5-dihydro-1H-1,2,4-triaz ol-1-yl)propyl)phenoxy)-2-methylpropionic acid (Compound 201)



embedded image


Compound 201 was prepared without hydrolysis according to the method of Example 200: 1H NMR (300 MHz, CDCl3) δ 7.77 (s, 4H), 7.28 (s, 1H), 6.82 (s, 2H), 4.30 (q, J=7.1 Hz, 2H), 3.91 (t, J=7.0 Hz, 2H), 2.61 (t, J=7.7 Hz, 2H), 2.17 (s, 6H), 2.16-2.03 (m, 2H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 528.2 [M+Na]+.


Example 202
2-(2,6-Dimethyl-4-((4-(4-(methylthio)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-l-yl)methyl)phenoxy)-2-methylpropionic acid (Compound 202)



embedded image


Synthesis of Intermediate D-20

Intermediate D-20 was prepared by replacing p-bromoaniline in Example 1 with p-methylthioaniline according to the method for intermediate I-3 of Example 1.


Synthesis of Compound 202

Compound 202 was prepared by replacing intermediate I-3 with intermediate D-20 according to the method of Example 55: 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 8.45 (s, 1H), 7.66 (d, J=8.4 Hz, 2H), 7.39 (d, J=8.5 Hz, 2H), 6.94 (s, 2H), 4.82 (s, 2H), 2.50 (s, 3H), 2.15 (s, 6H), 1.34 (s, 6H). MS (ESI): m/z 450.1 [M+Na]+.


Example 203
Ethyl 2-(2,6-dimethyl-4-((4-(4-(methylthio)phenyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-1-yl)methyl)p henoxy)-2-methylpropionate (Compound 203)



embedded image


Compound 203 was prepared by replacing intermediate I-3 with intermediate D-20 without hydrolysis according to the method of Example 55: 1H NMR (300 MHz, CDCl3) δ 7.67 (s, 1H), 7.51 (d, J=8.4 Hz, 2H), 7.35 (d, J=8.3 Hz, 2H), 7.03 (s, 2H), 4.91 (s, 2H), 4.29 (q, J=7.1 Hz, 2H), 2.52 (s, 3H), 2.20 (s, 6H), 1.47 (s, 6H), 1.36 (t, J=7.1 Hz, 3H). MS (ESI): m/z 478.2 [M+Na]+.


Example 204
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-tr iazol-1-yl)methyl)phenoxy)propionic acid (Compound 204)



embedded image


embedded image


Synthesis of Intermediate P-1

3,5-Dimethyl-4-hydroxybenzaldehyde (21.0 g, 140 mmol) was dissolved in acetonitrile (200 mL), and ethyl 2-bromopropionate (94.1 g, 520 mmol), cesium carbonate (45.6 g, 140 mmol), potassium carbonate (38.6 g, 280 mmol), and potassium iodide (1.66 g, 10 mmol) were added. The system was transferred to an oil bath and reacted at 80° C. for 36 h. After the reaction was completed, the reaction liquid was cooled to room temperature and filtered under reduced pressure. The filtrate was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (200 mL) and extracted with ethyl acetate (200 mL×3). The organic phases were combined, washed with 1 N sodium hydroxide (200 mL×3) and saturated brine (200 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=200:1) to give intermediate P-1 (yellow liquid, 16.3 g).


Synthesis of Intermediate P-2

Intermediate P-1 (3.46 g, 13.85 mmol) was dissolved in ethanol (20 mL), and sodium borohydride (280 mg, 7.5 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and reacted for 4 h. After the reaction was completed, water was added to the reaction liquid to quench the reaction (20 mL). The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with 30 mL of water and extracted with ethyl acetate (20 mL×3). The organic phases were combined, washed with saturated brine (30 mL×1), dried over anhydrous sodium sulfate, and concentrated by rotary evaporation under reduced pressure to remove the solvent to give a crude product of intermediate P-2, which was directly used in the next step without further purification.


Synthesis of Intermediate P-3

The crude product of compound P-2 obtained from the previous step was dissolved in DCM (20 mL), carbon tetrabromide (13.6 g, 41 mmol) was added, and triphenylphosphine (9.9 g, 37.8 mmol) was slowly added under an ice bath. After the addition, the reaction system was slowly warmed to room temperature and reacted for 8 h. The reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=20:1) to give intermediate P-3 (yellow liquid, 3.6 g).


Synthesis of Compound 205

Intermediate D-3 (229.1 mg, 0.5 mmol) was dissolved in acetonitrile (5 mL), and intermediate P-3 (235.5 mg, 0.75 mmol) and cesium carbonate (326 mg, 1 mmol) were added. The mixture was stirred at room temperature for 4 h. After the reaction was completed, the reaction liquid was concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (petroleum ether/ethyl acetate=10:1) to give compound 205 (white solid, 302 mg).


Synthesis of Compound 204

Compound 205 (302 mg, 0.63 mmol) was dissolved in methanol (5 mL), and a 1 N NaOH solution (3.5 mL) was added. The mixture was stirred at room temperature for 24 h. After the reaction was completed, the reaction liquid was adjusted to pH 4 with a 1 N HCl solution, and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was diluted with water (15 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated brine (15 mL×1), and concentrated by rotary evaporation under reduced pressure to remove the solvent. The residue was purified by column chromatography (dichloromethane/methanol=100:1) to give compound 204 (white solid, 150 mg): 1H NMR (300 MHz, DMSO-d6) δ 12.87 (s, 1H), 8.53 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.5 Hz, 2H), 6.98 (s, 2H), 4.84 (s, 2H), 4.40 (q, J=6.5 Hz, 1H), 2.21 (s, 6H), 1.41 (d, J=6.6 Hz, 3H). MS (ESI): m/z 474.2 [M+Na]+.


Example 205
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)me thyl)phenoxy)propionate (Compound 205)



embedded image


Compound 205 was prepared without hydrolysis according to the method of Example 204: 1H NMR (300 MHz, CDCl3) δ 7.71 (s, 1H), 7.65 (d, J=8.9 Hz, 2H), 7.36 (d, J=8.6 Hz, 2H), 7.06 (s, 2H), 4.92 (s, 2H), 4.48 (q, J=6.7 Hz, 1H), 4.24 (q, J=7.1 Hz, 2H), 2.29 (s, 6H), 1.55 (t, J=6.7H, 3H), 1.29 (t, J=7.0 Hz, 3H). MS (ESI): m/z 502.2 [M+Na]+.


Example 206
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo l-1-yl)methyl)phenoxy)butyric acid (Compound 206)



embedded image


Synthesis of Intermediate P-4

Intermediate P-4 was prepared by replacing ethyl 2-bromopropionate in Example 204 with ethyl 2-bromobutyrate according to the method for intermediate P-3 of Example 204.


Synthesis of Compound 206

Compound 206 was prepared by replacing intermediate P-3 with intermediate P-4 according to the method of Example 204: 1H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 8.53 (s, 1H), 7.88 (d, J=9.0 Hz, 2H), 7.56 (d, J=8.4 Hz, 2H), 6.97 (s, 2H), 4.83 (s, 2H), 4.31 (t, J=5.9 Hz, 1H), 2.22 (s, 6H), 1.86 (dt, 2H), 0.96 (t, J=7.3 Hz, 3H). MS (ESI): m/z 488.2 [M+Na]+.


Example 207
Ethyl 2-(2,6-dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazol-1-yl)me thyl)phenoxy)butyrate (Compound 207)



embedded image


Compound 207 was prepared without hydrolysis according to the method of Example 206: 1H NMR (300 MHz, CDCl3) δ 7.70 (s, 1H), 7.64 (d, J=8.9 Hz, 2H), 7.35 (d, J=8.7 Hz, 2H), 7.05 (s, 2H), 4.91 (s, 2H), 4.37 (t, J=6.1 Hz, 1H), 4.21 (q, J=14.2, 7.1 Hz, 2H), 2.29 (s, 6H), 1.98 (dt, 2H), 1.26 (t, J=7.1 Hz, 3H), 1.03 (t, J=7.4 Hz, 3H). MS (ESI): m/z 516.2 [M+Na]+.


Example 208
2-(2,6-Dimethyl-4-((5-oxo-4-(4-(trifluoromethoxy)phenyl)-4,5-dihydro-1H-1,2,4-triazo 1-1-yl)methyl)phenoxy)-2-methylpropionic acid berberine salt (Compound 208)



embedded image


Berberine chloride (185.9 mg, 0.5 mmol) was dissolved in hot water (7.5 mL). The mixture was adjusted to pH 8-9 with a saturated sodium carbonate solution, and stirred and reacted for 1 h. An ethanol solution (4 mL) of compound 61 (232.6 mg, 0.5 mmol) was added. The reaction system was heated to 100° C. and stirred for 2 h. The reaction liquid was cooled for crystallization, filtered under reduced pressure, washed with cold water, and dried under infrared ray irradiation to give compound 208 (yellow solid, 40 mg): 1H NMR (300 MHz, DMSO-d6) δ 9.90 (s, 1H), 8.95 (s, 1H), 8.53 (s, 1H), 8.21 (d, J=9.1 Hz, 1H), 8.00 (d, J=8.9 Hz, 1H), 7.88 (d, J=8.9 Hz, 2H), 7.80 (s, 2H), 7.55 (d, J=8.8 Hz, 2H), 7.09 (s, 1H), 6.92 (s, 1H), 6.18 (s, 2H), 4.94 (t, 2H), 4.82 (s, 2H), 4.10 (s, 3H), 4.07 (s, 3H), 3.21 (t, 2H), 2.15 (s, 6H), 1.30 (s, 6H).


Example 209
Assay on Agonistic Activity of Compounds for PPARα/PPARδ/PPARγ

Cos-7 cells (African green monkey kidney fibroblasts, commonly used tool cells) were cultured in a 10 cm cell culture dish in a DMEM complete medium containing 10% fetal bovine serum. When the cells grew to a density of about 70%, the medium was replaced with a fresh medium for later transfection. The procedures for preparing the plasmid working fluid were as follows: 15 μg of pBIND-Gal4-PPARα (LBD) plasmid or pBIND-Gal4-PPARδ (LBD) plasmid or pBIND-Gal4-PPARγ (LBD) plasmid (J. Chem. Inf Model., 2020, 60, 1717), 15 μg of pGL4.35-9×Gal4 UAS plasmid (purchased from Promega (Beijing) Biotech Co., Ltd.), and 60 μL of transfection reagent (HighGene, purchased from Wuhan ABclonal Technology Co., Ltd.) were added to 2 mL of Opti-MEM, and the mixture was left to stand at room temperature for 15 min to obtain a working solution. The plasmid working solution was then added to the cell culture dish for cell transfection. After 4 h of transfection, the cells were washed with PBS, digested with trypsin, seeded into a 96-well plate with 20,000-30,000 cells in each well, and subjected to adherent culture for 24 h. Test compounds were prepared into appropriate test concentrations with a complete medium and then added to the 96-well plate. Meanwhile, the PPARα agonistic activity was defined as 100% for GW7647 (purchased from MCE) at a final concentration of 10 nM, the PPARδ agonistic activity was defined as 100% for GW501516 (purchased from MCE) at a final concentration of 10 nM, and the PPARγ agonistic activity was defined as 100% for Rosiglitazone (purchased from Adamas) at a final concentration of 1 μM. After 16 h of drug action, the medium was discarded, and 100 μL of reporter gene lysis buffer (purchased from Shanghai Beyotime Biological Tech. Co., Ltd.) was added to lyse the cells for 15 min. 10 μL of lysate was pipetted into a white opaque 384-well plate, and then 10 μL of reporter gene assay buffer (purchased from Shanghai Beyotime Biological Tech. Co., Ltd.) was added. The bioluminescence was detected by using a multimode microplate reader, and the corresponding half maximal effective concentration (EC50) value was calculated according to the detection value. In addition to assaying the compounds of the present invention, the PPARα/δ agonist GFT505 in the clinical trial and the most potent PPARα/δ agonist 5c reported in the literature at present (ACS Med Chem. Lett., 2019, 10, 1068) were also assayed. The experimental results are shown in Table 2.









TABLE 2







Agonistic activity of compounds for PPARα/PPARδ/PPARγ













PPARα
PPARδ
PPARγ



Compound No.
EC50 (nM)
EC50 (nM)
EC50 (nM)
















1
2236
1001
>10 μM 



3
4588
343
>10 μM 



5
4782
286
>10 μM 



55
62
22
1779



57
26
2
1429



59
31
6
454



61
7
8
1316



63
1027
647
8650



65
180
248
955



67
167
47
1832



69
33
481
>5 μM



71
3
5
1251



73
5
6
903



75
454
203
4259



77
103
132
1796



79
341
620
1885



81
1096
8546
7878



83
1768
1480
1087



85
332
90
>5 μM



87
238
77
4131



89
415
916
2919



91
987
3368
5212



93
2932
5448
1807



95
1052
136
9083



97
696
2315
>5 μM



99
116
375
1145



101
2933
8663
>5 μM



103
215
278
4679



105
172
323
4920



107
144
278
2020



109
645
389
1511



115
8
175
1761



117
9
135
1784



121
72
39
2526



123
394
664
>5 μM



125
162
229
2779



127
419
586
>5 μM



129
23
87
4906



131
14
67
1180



137
1866
1519
>5 μM



141
382
124
1447



143
9
15
1795



145
8
29
>5 μM



147
387
81
1796



149
7
225
>5 μM



151
220
914
>5 μM



153
498
1675
>5 μM



155
351
1367
>5 μM



157
273
91
1655



163
35
6
1688



165
7
1
812



167
39
23
4332



169
16
12
2305



171
21
2
2223



173
56
1
1363



175
309
685
932



179
17260
1736
>10 μM 



181
21360
453
>10 μM 



183
15620
188
>10 μM 



185
13
24
3042



187
10
7
2015



189
59
42
2190



191
44
42
3090



194
80
38
2024



196
86
56
>5 μM



198
289
181
2846



200
134
212
>5 μM



202
81
75
>5 μM



204
312
219
>5 μM



206
126
82
>5 μM



GFT505
820
843
1844



5c
65
24
2753










The experimental results (Table 2) showed that the compounds of the present invention had significant agonistic activity for PPARα and PPARδ. For example, EC50 values for agonistic activity of compounds 55, 57, 59, 61, 71, 73, 129, 131, 143, 145, 163, 165, 167, 169, 171, 173, 185, 187, 189, 191, 194, and the like for PPARα and PPARδ were all at nanomolar levels. EC50 values for agonistic activity of compounds 61 (PPARα: EC50=7 nM; PPARδ: EC50=8 nM), 71 (PPARα: EC50=3 nM; PPARδ: EC50=5 nM), 73 (PPARα: EC50=5 nM; PPARδ: EC50=6 nM), and 165 (PPARα: EC50=7 nM; PPARδ: EC50=1 nM) for PPARα and PPARδ were all at single-digit nanomolar levels, and under the same test system, these compounds had significantly better activity than the phase III clinical trial drug GFT505 (PPARα: EC50=760 nM; PPARδ: EC50=730 nM) and compound 5c with optimal activity reported in the literature at present (ACS Med. Chem. Lett., 2019, 10, 1068) (PPARα: EC50=65 nM; PPARδ: EC50=24 nM). In addition, the compounds of the present invention showed very high selectivity for activating PPARα/PPARδ relative to activating PPARγ. For example, the agonistic activity of compound 71 for PPARα (EC50=3 nM) was 417 times higher than that of the compound for PPARγ (EC50=1251 nM), the agonistic activity of compound 71 for PPARδ (EC50=5 nM) was 250 times higher than that of the compound for PPARγ, and the selectivity of compound 71 was significantly better than that of GFT505 (PPARα/PPARγ selectivity: 3.67 times, PPARδ/PPARγ selectivity: 3.82 times) and compound 5c (PPARα/PPARγ selectivity: 42.35 times; PPARδ/PPARγ selectivity: 114.7 times). The above results suggest that the compounds of the present invention are potent and highly selective PPARα/PPARδ dual agonists.


Example 210
Evaluation of Metabolic Stability of Compounds in Human Liver Microsomes

A 500 μM solution of the compound in acetonitrile was prepared and diluted to obtain a 1.5 μM drug working solution with a 0.1 M potassium phosphate solution. The drug working solution was co-incubated with a human liver microsome working solution at a final concentration of 0.75 mg/mL and an NADPH solution (final concentration: 550 μM), and the incubation was terminated by adding an acetonitrile solution at 0 min, 15 min, 30 min, 45 min, and 60 min. The residual amount of the compound that remained in the system at each time point was detected by using LC/MS. The absolute value k of the slope was determined by plotting the natural logarithm of the percentage of the residual amount of the compound with the time, and the calculation was performed according to the formula: T1/2 (half-life)=ln2/k=0.693/k. The experimental results are shown in Table 3.









TABLE 3







Results for metabolic stability of the


compounds in human liver microsomes












Compound No.
T1/2 (min)
Compound No.
T1/2 (min)
















16
>120
131
>120



55
>120
129
>120



61
>120
143
>120



57
>120
165
>120



163
>120
GFT505
15










The experimental results (Table 3) showed that compounds 16, 55, 57, 61, 129, 131, 143, and 165 had very good metabolic stability in human liver microsomes, which was much better than that of GFT505 under the same test conditions. Some other compounds of the present invention also had good metabolic stability in human liver microsomes.


Example 211
Pharmacokinetic Evaluation of Compound 57 in Mice

Animals: 6 male C57BL/6J mice, SPF grade, sourced from the animal repository of Shanghai Medicilon research institution.


Grouping: Mice were divided into 2 groups of 3 mice each, one group was an oral administration group and the other group was an intravenous injection administration group. The dose in the oral administration group was 10 mpk, and the dose in the intravenous injection group was 2 mpk.


Experimental method: After the intravenous injection administration group was subjected to administration by injection via the tail vein, approximately 0.03 mL of blood was collected via the orbit at 0.083 h, 0.25 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, and 24 h, and an ethylenediaminetetraacetic acid dipotassium salt was quickly added for anticoagulation and the blood was placed on ice after the blood collection. The mice in the oral administration group were fasted for 12 h before administration and fed 4 h after administration; after oral administration, approximately 0.03 mL of blood was collected via the orbit at 0.25 h, 0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, and 24 h, and an ethylenediaminetetraacetic acid dipotassium salt was quickly added for anticoagulation and the blood was placed on ice after the blood collection. All samples were centrifuged at 18,000 g for 7 min in a low-temperature centrifuge, and plasma was isolated. The content of the compound in the plasma was determined by LC-MS/MS-18, and relevant pharmacokinetic parameters were calculated from the plasma concentration data at different time points. The experimental results are shown in Table 4.









TABLE 4







Pharmacokinetic parameters for intravenous injection


and oral administration of compound 57 in mice









Route of administration










Intravenous injection
Oral administration













Half-life T1/2 (h)
9.53 ± 3.29
7.41 ± 2.05


Time-to-peak Tmax (h)
0.08 ± 0.00
0.25 ± 0.00


Peak concentration
7235.29 ± 268.62 
14031.80 ± 2050.90 


Cmax (ng/mL)


Area under the curve
4363.20 ± 521.90 
18607.73 ± 2757.53 


AUC(0-∞) (h*ng/mL)


Bioavailability F (%)

87.30 ± 17.34









The experimental results (Table 4) showed that the oral half-life of compound 57 was 7.41±2.05 h, and the bioavailability of the compound was 87.30%±17.34%. This indicates that compound 57 has good pharmacokinetic properties.


Example 212
Pharmacokinetic Evaluation of Compound 61 in Rats

Animals: 6 male SD rats, SPF grade, sourced from the animal repository of Shanghai Medicilon research institution.


Grouping: Rats were divided into 2 groups of 3 mice each, one group was an oral administration group and the other group was an intravenous injection administration group. The dose in the oral administration group was 10 mpk, and the dose in the intravenous injection group was 2 mpk.


Experimental method: After the intravenous injection administration group was subjected to administration by injection via the tail vein, approximately 0.2 mL of blood was collected via the orbit at 0.083 h, 0.25 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, and 24 h, and an ethylenediaminetetraacetic acid dipotassium salt was quickly added for anticoagulation and the blood was placed on ice after the blood collection. The rats in the oral administration group were fasted for 12 h before administration and fed 4 h after administration; after oral administration, approximately 0.2 mL of blood was collected via the orbit at 0.25 h, 0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, and 24 h, and an ethylenediaminetetraacetic acid dipotassium salt was quickly added for anticoagulation and the blood was placed on ice after the blood collection. All samples were centrifuged at 18,000 g for 7 min in a low-temperature centrifuge, and plasma was isolated. The content of the compound in the plasma was determined by LC-MS/MS-18, and relevant pharmacokinetic parameters were calculated from the plasma concentration data at different time points. The experimental results are shown in Table 5.









TABLE 5







Pharmacokinetic parameters for intravenous injection


and oral administration of compound 61 in rats









Route of administration










Intravenous injection
Oral administration













Half-life T1/2 (h)
6.78 ± 0.60
5.11 ± 0.31


Time-to-peak Tmax (h)
0.08 ± 0.00
1.42 ± 1.01


Peak concentration
10786.91 ± 1390.41 
5094.15 ± 1667.95


Cmax (ng/mL)


Area under the curve
9126.43 ± 975.60 
39148.16 ± 7788.06 


AUC(0-∞) (h*ng/mL)


Bioavailability F (%)

86.35 ± 17.83









The experimental results (Table 5) showed that the oral half-life of compound 61 was 5.11±0.31 h, and the bioavailability of the compound was 86.35%±17.83%. This indicates that compound 61 has good pharmacokinetic properties.


Example 213
Pharmacokinetic Evaluation of Compound 163 in Rats

Reference was made to Example 212 for the experimental procedures. The experimental results are shown in Table 6.









TABLE 6







Pharmacokinetic parameters for intravenous injection


and oral administration of compound 163 in rats









Route of administration










Intravenous injection
Oral administration













Half-life T1/2 (h)
12.71 ± 8.67 
6.86 ± 0.34


Time-to-peak Tmax (h)
0.08 ± 0.00
0.25 ± 0.00


Peak concentration
10864.30 ± 719.85 
5474.28 ± 1232.94


Cmax (ng/mL)


Area under the curve
15851.97 ± 3557.93 
39483.83 ± 5363.60 


AUC(0-∞) (h*ng/mL)


Bioavailability F (%)

53.24 ± 6.87 









The experimental results (Table 6) showed that the oral half-life of compound 163 was 6.86±0.34 h, and the bioavailability of the compound was 53.24%±6.87%. This indicates that compound 163 has relatively good pharmacokinetic properties.


The above results indicate that compounds 57, 61, and 163 of the present invention have good pharmacokinetic properties. Some other compounds of the present invention also have similarly good pharmacokinetic properties.


Example 214

Effect of Compounds on Lipid Metabolism-Associated Gene Expression of HepG2 Cells


HepG2 cells (human hepatoma cells) were cultured in a 6-well cell culture plate and subjected to adherent culture overnight. Compound 57 or compound 61 was prepared into 8 nM, nM, and 200 nM drug-containing media with a complete medium. The old medium was discarded and replaced with drug-containing medium of different concentrations (complete medium without the compound for the blank control group). After dosing, the cells were incubated for 12 h. The medium was discarded and total RNA was extracted by the phenol-chloroform method. After reverse transcription, the real-time quantitative fluorescent PCR experiment (RNA extraction, reverse transcription, quantitative PCR reagents were all purchased from Nanjing Vazyme Biotech Co., Ltd.) was performed using ACTB as an internal reference, and the expression of PDK4, ACADVL, and CPT1A, which are important genes in oxidative metabolism of lipids, was detected according to the steps in the product instructions (the primer sequences are shown in Table 7). The original data were processed by the AACt method and analyzed by plotting using the relevant software, and it was found that compound 57 and compound 61 could improve the expression of PDK4, ACADVL, and CPT1A in a dose-dependent manner with significance (shown in FIGS. 1 and 2). This indicates that compounds 57 and 61 have the ability to increase the oxidative metabolism of liver lipids, which can reduce liver fat accumulation. Some other compounds of the present invention also have similar activity.









TABLE 7







Primer sequences for genes








Primer name
Primer sequence





Homo_PDK4_Forward_
GGAAGCATTGATCCTAACTGTGA


Primer






Homo_PDK4_Reverse_
GGTGAGAAGGAACATACACGATG


Primer






Homo_ACADVL_Forward_
ACAGATCAGGTGTTCCCATACC


Primer






Homo_ACADVL_Reverse_
CTTGGCGGGATCGTTCACTT


Primer






Homo_CPT1A_Forward_
ATCAATCGGACTCTGGAAACGG


Primer






Homo_CPT1A_Reverse_
TCAGGGAGTAGCGCATGGT


Primer






Homo_ACTB_Forward_
CATGTACGTTGCTATCCAGGC


Primer






Homo_ACTB_Reverse_
CTCCTTAATGTCACGCACGAT


Primer









Example 215
Effect of Compound 57 on Lipopolysaccharide (LPS)-Induced Inflammation-Associated Gene Expression of THP1 Cells

THP1 cells (human monocytes) were cultured in a 6-well cell culture plate in a medium containing 100 ng/mL phorbol ester (purchased from MCE) and stimulated for differentiation for 48 h. The medium was replaced with a fresh complete medium for further culture for 24 h, and the adherent monocyte-derived macrophages were obtained, which were used for an anti-inflammatory assay on compound 57.


The medium was replaced with a fresh complete medium for the blank control group, the medium was replaced with a complete medium containing 1 mg/mL LPS for the LPS group, and the medium was replaced with 8, 40, and 200 nM drug-containing media prepared with a complete medium containing 1 mg/mL LPS for the administration group. After 6 h of treatment, the medium was discarded. Quantitative PCR was performed according to the procedures in Example 207 to detect the expression of IL6 and IL12B, which are inflammatory factors playing an important role in inflammatory response (the primer sequences are shown in Table 8). The experimental results showed that the compound 57 could resist LPS-induced up-regulation of IL6 and IL12B of macrophages. This indicates that compound 57 has a certain anti-inflammatory effect (as shown in FIG. 3). Some other compounds of the present invention also have similar anti-inflammatory activity.









TABLE 8







Primer sequences for genes










Primer name
Primer sequence







Homo_IL-6_Forward_
ACTCACCTCTTC



Primer
AGAACGAATTG







Homo_IL-6_Reverse_
CCATCTTTGGAA



Primer
GGTTCAGGTTG







Homo_IL-12B_Forward_
TGCCCATTGAGG



Primer
TCATGGTG







Homo_IL-12B_Reverse_
CTTGGGTGGGTC



Primer
AGGTTTGA










Example 216
Protective Effect of Compound 61 on Choline-Deficient, L-Amino Acid-Defined Diet (CDAA)-Induced NASH Mouse Model

Animals: 70 male C57 mice, SPF grade, 8 weeks old, weighing about 20 g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All animals were kept on a 12-h alternating circadian rhythm and were fed ad libitum.


Instrument: weighing scale for animals; microtome; automatic biochemical analyzer; inverted microscope


Reagent: compound 61, positive drug GFT505 (PPARα/δ dual agonist, currently in an anti-NASH phase III clinical trial), and positive drug IVA337 (Pan-PPAR agonist, currently in an anti-NASH phase II clinical trial), which were prepared according to the method in the literature (CN100548960C and J Med. Chem., 2018, 61, 2246); the control feed was purchased from Nantong Trophic (TP36225 MCS); the modeling feed was purchased from Nantong Trophic (TP36225 MCD).


Experimental Procedures:
1. Animal Grouping and Modeling

After 1 week of adaptive feeding of mice, the mice were randomly divided into 7 groups by weight: a control group (MCS), a model group (CDAA), a positive drug GFT505 (10 mg/kg) group (CDAA+GFT505), a positive drug IVA337 (10 mg/kg) group (CDAA+IVA337), a compound 61 low dose (3 mg/kg) group (CDAA+61 low dose), a compound 61 medium dose (10 mg/kg) group (CDAA+61 medium dose), and a compound 61 high dose (30 mg/kg) group (CDAA+61 high dose). The control group was fed the control feed (TP36225 MCS); the other groups were given the modeling feed (TP36225 MCD). The mice were all fed water normally and subjected to modeling for 3 weeks.


2. Administration

After 3 weeks of modeling, the MCS and CDAA groups were given a 0.5% CMC-Na solution by intragastric administration every day (the administration volume was 10 mL/kg), the CDAA+GFT505 group was given a 0.5% CMC-Na solution of GFT505 by intragastric administration every day (GFT505 was administered at 10 mg/kg, and the administration volume was 10 mL/kg), the CDAA+IVA337 group was given a 0.5% CMC-Na solution of IVA337 by intragastric administration every day (IVA337 was administered at 10 mg/kg, and the administration volume was 10 mL/kg), the CDAA+61 low dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (Compound 61 was administered at 3 mg/kg, and the administration volume was 10 mL/kg), the CDAA+61 medium dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (Compound 61 was administered at 10 mg/kg, and the administration volume was 10 mL/kg), and the CDAA+61 high dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (Compound 61 was administered at 30 mg/kg, and the administration volume was 10 mL/kg). The administration was performed for 6 weeks, during which time the MCS group was given the control feed and the other groups were given the modeling feed, and the mice were all fed water normally. The mice in each group were weighed daily, and their body weight, hair, feces, and activity were carefully observed and recorded.


3. Sampling

Mice were fasted but given free access to water for 12 h in advance, blood was taken from the orbit in the morning the next day, and then the liver was taken after the mice were sacrificed. The right lobular tissue of liver was fixed with 4% paraformaldehyde and used for HE staining of sections. Part of liver tissues were divided into 3 parts and were quickly frozen in liquid nitrogen for subsequent detection of other indexes.


4. Determination of Biochemical Indexes

The whole blood was left to stand at room temperature for 2 h and centrifuged at 3000 rpm for 15 min, and serum was collected. The levels of aspartate transaminase (AST) and alanine aminotransferase (ALT) in serum were determined by an automatic biochemical analyzer of ServiceBio Biotechnology Co., Ltd.


5. Liver Tissue Section

The pretreated tissues were sent to ServiceBio Biotechnology Co., Ltd. to make HE stained sections, Sirius red stained sections, and oil red stained sections.


6. Extraction and Western Blot (WB) Detection of Liver Tissue Protein

The liver tissue stored at −80° C. was taken out and placed in liquid nitrogen, about 10 mg of liver tissue was rapidly cut off, homogenized with a homogenizer after about 500 μL of precooled tissue lysis buffer was added, and then lysed on ice for 30 min. The lysate was centrifuged at 12,000 rpm for 15 min at 4° C., and 170 μL of supernatant was added to a clean EP tube, from which 10 μL of supernatant was taken for BCA protein quantification. 40 μL of 5*loading buffer was added to the rest of protein supernatant for boiling for denaturation, followed by SDS-PAGE electrophoresis, and the protein was transferred onto a PVDF membrane for incubation and elution of related antibodies. Finally, imaging analysis was performed by using a chemiluminescence apparatus.


7. Extraction and q-PCR Detection of Liver Tissue RNA


The liver tissue stored at −80° C. was taken out and placed in liquid nitrogen, about 10 mg of liver tissue was rapidly cut off, homogenized with a homogenizer after about 500 μL of precooled RNA extraction reagent was added, and then lysed on ice for 15 min. The lysate was shaken vigorously for 15 s after 100 μL of chloroform was added, left to stand on ice for 10 min, and centrifuged at 12,000 rpm for 15 min at 4° C. The upper aqueous phase was transferred to a clean 1.5 mL EP tube, and 200 μL of isopropanol was added to precipitate RNA. After being left to stand on ice for 10 min, the mixture was centrifuged at 12,000 rpm for 10 min at 4° C. The supernatant was discarded, the precipitate was washed once with 75% ethanol and centrifuged to remove the supernatant, and the water-soluble RNA precipitate was treated with 40 μL of DEPC. The RNA concentration was quantified using Nano, a reverse transcription reagent from Takara was added according to the instructions, and mRNA was reverse-transcribed into cDNA using a common PCR instrument. Finally, the upstream and downstream primers for the target gene, q-PCR reagent (SYBR Green), and cDNA were added to a 96-well plate dedicated to q-PCR, and amplification and quantification were performed using a q-PCR instrument. The ΔΔCt value was selected to characterize differences in gene expression, and relevant software was adopted to perform data processing and statistical test.


8. Experimental Results

The results in FIGS. 4 and 5 showed that compound 61 could down-regulate the levels of ALT and AST in serum of NASH model mice in a dose-dependent manner. Notably, compound 61 had a stronger liver enzyme-lowering effect than GFT505 and IVA337 at the same dose. This indicates that compound 61 has a stronger protective effect on the liver than GFT55 and MVA337 in the NASH model.


To further detect the effect of compound 61 on reducing liver inflammation and fibrosis in NASH model mice, mRNA expression of the relevant inflammatory factors and fibrosis-associated cytokines in liver tissue was determined (primer sequences for genes are shown in Table 9). The experimental results are shown in FIGS. 6 and 7.









TABLE 9







Primer sequences for genes










Primer name
Primer sequence







Mus_Tnf_Forward_
CCCTCACACTCAGATCA



Primer
TCTTCT







Mus_Tnf_Reverse_
GCTACGACGTGGGCTAC



Primer
AG







Mus_Il1b_Forward_
TGCCCATTGAGGTCATG



Primer
GTG







Mus_Il1b_Reverse_
CTTGGGTGGGTCAGGTT



Primer
TGA







Mus_Ccl4_Forward_
TTCCTGCTGTTTCTCTT



Primer
ACACCT







Mus_Ccl4_Reverse_
CTGTCTGCCTCTTTTGG



Primer
TCAG







Mus_Adgre1_Forward_
CCCCAGTGTCCTTACAG



Primer
AGTG







Mus_Adgre1_Reverse_
GTGCCCAGAGTGGATGT



Primer
CT







Mus_Acta2_Forward_
GTCCCAGACATCAGGGA



Primer
GTAA







Mus_Acta2_Reverse_
TCGGATACTTCAGCGTC



Primer
AGGA







Mus_tgfb1_Forward_
CTCCCGTGGCTTCTAGT



Primer
GC







Mus_tgfb1_Reverse_
GCCTTAGTTTGGACAGG



Primer
ATCTG







Mus_Col1a1_Forward_
GCTCCTCTTAGGGGCCA



Primer
CT







Mus_Col1a1_Reverse_
CCACGTCTCACCATTGG



Primer
GG







Mus_Col3a1_Forward_
CTGTAACATGGAAACTG



Primer
GGGAAA







Mus_Col3al_Reverse_
CCATAGCTGAACTGAAA



Primer
ACCACC










The results in FIG. 6 showed that compound 61 could inhibit the increase of mRNA expression levels of Tnf, IIIb, Ccl4, and Adgre1 due to modeling in a dose-dependent manner, and that compound 61 had a better effect than GFT505 and IVA337 at the same dose. This indicates that compound 61 has a stronger effect in resisting liver inflammation than GFT505 and IVA337 in the NASH model. The results in FIG. 7 showed that compound 61 could significantly inhibit the increase of mRNA expression levels of Acta2, Tgfb1, Collal, and Col3a1 due to modeling, and that compound 61 had a better effect than GFT505 and IVA337 at the same dose. This indicates that compound 61 has a stronger effect in resisting liver fibrosis than GFT505 and IVA337 in the NASH model.


In addition, the anti-NASH effect of compound 61 was evaluated by means of pathological studies. HE staining results (FIG. 8) showed that compound 61 could reduce the infiltration of inflammatory cells in the portal area due to modeling in a dose-dependent manner, and that compound 61 had a better effect than GFT505 and IVA337 at the same dose. Sirius red staining results (FIG. 9) showed that compound 61 could reduce collagen deposition due to modeling in a dose-dependent manner, and resist liver fibrosis during NASH, and that compound 61 had a better effect than GFT505 and IVA337 at the same dose. Oil red staining results (FIG. 10) showed that compound 61 could reduce lipid accumulation due to modeling in a dose-dependent manner.


The above results showed that compound 61 could reduce the aminotransferase level in serum of NASH model mice in a dose-dependent manner, and inhibit the liver inflammatory response and liver fibrosis, and had better efficacy than positive control drugs GFT505 and IVA337 at the same dose. This suggests that compound 61 can be used for the prevention and treatment of chronic liver diseases such as fatty liver disease (particularly, nonalcoholic steatohepatitis), chronic hepatitis, liver fibrosis, and the like. Some other compounds of the present invention also have similar effects.


Example 217
Protective Effect of Compound 61 on Carbon Tetrachloride-Induced Liver Fibrosis Mouse Model

Animals: 60 male C57 mice, SPF grade, 8 weeks old, weighing about 20 g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All animals were kept on a 12-h alternating circadian rhythm and were fed ad libitum.


Instrument: weighing scale for animals; microtome; automatic biochemical analyzer; inverted microscope


Reagent: positive drug IVA337 (Pan-PPAR agonist, currently in an anti-NASH phase II clinical trial), which was prepared according to the method in the literature (J. Med. Chem., 2018, 61, 2246); carbon tetrachloride (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.), and sunflower seed oil (purchased from Shanghai Yuanye Biotech Co., Ltd.).


Experimental Procedures:
1. Animal Grouping and Modeling

After 1 week of adaptive feeding of mice, the mice were randomly divided into 6 groups by weight: a control group (Oil), a model group (CCl4), a positive drug IVA337 (10 mg/kg) group (CCl4+IVA337), a compound 61 low dose (3 mg/kg) group (CCl4+61 low dose), a compound 61 medium dose (10 mg/kg) group (CCl4+61 medium dose), and a compound 61 high dose (30 mg/kg) group (CCl4+61 high dose). Mice were given food and water normally and subjected to modeling for 3 weeks. The model group and the administration groups were each injected twice a week with a 25% CCl4 oil solution at a dose of 2 mL/kg, and the control group was injected with an oil solvent at the same volume.


2. Administration

The administration was started at the same time as the modeling, the control group and the model group were given a 0.5% CMC-Na solution by intragastric administration every day (the administration volume was 10 mL/kg), the CCl4+IVA337 group was given a 0.5% CMC-Na solution of IVA337 by intragastric administration every day (IVA337 was administered at 10 mg/kg, and the administration volume was 10 mL/kg), the CCl4+61 low dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (compound 61 was administered at 3 mg/kg, and the administration volume was 10 mL/kg), the CCl4+61 medium dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (Compound 61 was administered at 10 mg/kg, and the administration volume was 10 mL/kg), and the CCl4+61 high dose group was given a 0.5% CMC-Na solution of compound 61 by intragastric administration every day (Compound 61 was administered at 30 mg/kg, and the administration volume was 10 mL/kg). The administration was performed for 3 weeks, and the mice were given food and water normally. The mice in each group were weighed daily, and their body weight, hair, feces, and activity were carefully observed and recorded.


3. Sampling

At 30 h after the sixth injection of CCl4, the mice were dissected for the samples. Blood was taken from the orbit, and then the liver was taken after the mice were sacrificed. The right lobular tissue of liver was fixed with 4% paraformaldehyde and used for HE staining of sections. Part of liver tissues were divided into 3 parts and were quickly frozen in liquid nitrogen for subsequent detection of other indexes.


4. Liver Tissue Section

The pretreated tissues were sent to ServiceBio Biotechnology Co., Ltd. to make HE stained sections and Sirius red stained sections.


5. Extraction and Western Blot (WB) Detection of Liver Tissue Protein

The liver tissue stored at −80° C. was taken out and placed in liquid nitrogen, about 10 mg of liver tissue was rapidly cut off, homogenized with a homogenizer after about 500 μL of precooled tissue lysis buffer was added, and then lysed on ice for 30 min. The lysate was centrifuged at 12,000 rpm for 15 min at 4° C., and 170 μL of supernatant was added to a clean EP tube, from which 10 μL of supernatant was taken for BCA protein quantification. 40 μL of 5*loading buffer was added to the rest of protein supernatant for boiling for denaturation, followed by SDS-PAGE electrophoresis, and the protein was transferred onto a PVDF membrane for incubation and elution of related antibodies. Finally, imaging analysis was performed by using a chemiluminescence apparatus.


6. Detection of Hydroxyproline in Liver Tissue.

The liver tissue stored at −80° C. was taken out and placed in liquid nitrogen, about 200 mg of the liver tissue was rapidly cut off, and hydroxyproline in the liver tissue was detected according to the method in the product instructions (Beijing Solarbio Science & Technology Co., Ltd., BC0255).


7. Experimental Results

The results in FIG. 11 showed that compound 61 could down-regulate the hepatic hydroxyproline level of liver fibrosis model mice in a dose-dependent manner. Notably, compound 61 had a stronger effect than IVA337 at the same dose. This indicates that compound 61 has a stronger antifibrotic effect than IVA337 in the liver fibrosis model.


To further detect the effect of compound 61 on reducing liver fibrosis in liver fibrosis model mice, the expression of fibrosis-associated proteins in liver tissue was determined. The results in FIG. 12 showed that compound 61 could inhibit the increase of αSMA and Collal protein levels due to modeling in a dose-dependent manner, and that compound 61 had a better effect than IVA337 at the same dose. This indicates that compound 61 had a stronger effect in resisting liver fibrosis than IVA337 in the NASH model.


In addition, the anti-liver fibrosis effect of compound 61 was evaluated by pathology. HE staining results (FIG. 13) showed that compound 61 could reduce the infiltration of inflammatory cells in the portal area due to modeling in a dose-dependent manner, and that compound 61 had a better effect than IVA337 at the same dose. Sirius red staining results (FIG. 14) showed that compound 61 could reduce collagen deposition due to modeling in a dose-dependent manner, and resist liver fibrosis, and that compound 61 had a better effect than IVA337 at the same dose.


The above results showed that compound 61 could reduce the hepatic hydroxyproline level of liver fibrosis model mice in a dose-dependent manner, reduce the levels of fibrosis-associated proteins αSMA and Collal, and inhibit the liver inflammatory response and liver fibrosis, and had better efficacy than a positive control drug IVA337 at the same dose. This suggests that compound 61 can be used for the prevention and treatment of chronic liver diseases such as liver fibrosis. Some other compounds of the present invention also have similar effects.


Example 218
Regulation of PPARα/δ Downstream Target Gene in Mouse Liver and Skeletal Muscles by Compound 61

C57 mice were divided into two groups of a control group and an administration group, with 6 mice in each group. The administration group was given compound 61 (10 mg/kg) by intragastric administration for four consecutive days, and the control group was given the same volume of solvent control. After the fourth day of administration, the mice were euthanized and dissected for the samples. The liver and skeletal muscles were quickly frozen in liquid nitrogen for subsequent experiments. RNA from liver and skeletal muscles was extracted and then libraries were constructed for transcriptome sequencing. The results (FIG. 15) showed that 50 target genes were significantly upregulated in the liver and 16 target genes were significantly upregulated in the skeletal muscle. This suggests that compound 61 can have a dual agonistic effect on PPARα/δ in vivo.


Example 219
Study on Selectivity of Compound 61 for Nuclear Receptors

The ligand binding domains of part of human nuclear receptor proteins were each cloned into a pBIND vector to construct Gal4 hybridized reporter gene plasmids for compound selectivity study.


Plasmid construction: the LBD region sequences (hPPARα (279aa-580aa); hPPARβ (274aa-576aa); hPPARγ (281aa-554aa); hRARα (177aa-462aa); hRARγ (179aa-454aa); hRARβ (177aa-455aa); hFXR (193aa-486aa); hRXRα (225aa-462aa); hRXRγ (229aa-463aa); hRXRβ (294aa-533aa); hVDR (119aa-427aa); hLXRα (187aa-447aa); hLXRβ (199aa-461aa); hTHβ (202aa-461aa); hPXR (138aa-434aa); hCAR (48aa-324aa)) of corresponding nuclear receptors were each cloned into a pBIND vector to construct corresponding expression plasmids (pBIND-Gal4-PPARα(LBD); pBIND-Gal4-PPARδ(LBD); pBIND-Gal4-PPARγ(LBD); pBIND-Gal4-RARα(LBD); pBIND-Gal4-RARγ(LBD); pBIND-Gal4-RARβ(LBD); pBIND-Gal4-FXR(LBD); pBIND-Gal4-RXRα(LBD); pBIND-Gal4-RXRγ(LBD); pBIND-Gal4-RXRβ(LBD); pBIND-Gal4-VDR(LBD); pBIND-Gal4-LXRα(LBD); pBIND-Gal4-LXRβ(LBD); pBIND-Gal4-THβ(LBD); pBIND-Gal4-PXR(LBD); pBIND-Gal4-CAR(LBD)) for fusion proteins of Gal4 and nuclear receptor LBD regions. pGL4.35-9×Gal4 UAS plasmid (purchased from Promega (Beijing) Biotech Co., Ltd.).


Cos-7 cells (African green monkey kidney fibroblasts, commonly used tool cells) were cultured in a 10 cm cell culture dish in a DMEM complete medium containing 10% fetal bovine serum. When the cells grew to a density of about 70%, the medium was replaced with a fresh medium for later transfection. The procedures for preparing the plasmid working fluid were as follows: 15 μg of pBIND-Gal4-PPARα(LBD) plasmid or pBIND-Gal4-PPARδ(LBD) plasmid or pBIND-Gal4-PPARγ(LBD) plasmid or pBIND-Gal4-RARα(LBD) plasmid or pBIND-Gal4-RARγ(LBD) plasmid or pBIND-Gal4-RAR((LBD) plasmid or pBIND-Gal4-FXR(LBD) plasmid or pBIND-Gal4-RXRα(LBD) plasmid or pBIND-Gal4-RXRγ(LBD) plasmid or pBIND-Gal4-RXR((LBD) plasmid or pBIND-Gal4-VDR(LBD) plasmid or pBIND-Gal4-LXRα(LBD) plasmid or pBIND-Gal4-LXR((LBD) plasmid or pBIND-Gal4-TH((LBD) plasmid or pBIND-Gal4-PXR(LBD) plasmid or pBIND-Gal4-CAR(LBD) plasmid, 15 μg of pGL4.35-9×Gal4 UAS plasmid (purchased from Promega (Beijing) Biotech Co., Ltd.), and 60 μL of transfection reagent (HighGene, purchased from Wuhan ABclonal Technology Co., Ltd.) were added to 2 mL of Opti-MEM, and the mixture was left to stand at room temperature for 15 min to obtain a working solution. The plasmid working solution was then added to the cell culture dish for cell transfection. After 4 h of transfection, the cells were washed with PBS, digested with trypsin, seeded into a 96-well plate with 20,000-30,000 cells in each well, and subjected to adherent culture for 24 h. Compound 61 was prepared into the appropriate test concentration with a complete medium and then added to the 96-well plate. Meanwhile, the PPARα agonistic activity was defined as 100% for GW7647 (purchased from MCE) at a final concentration of 10 nM, the PPARδ agonistic activity was defined as 100% for GW501516 (purchased from MCE) at a final concentration of 10 nM, the PPARγ agonistic activity was defined as 100% for Rosiglitazone (purchased from Adamas) at a final concentration of 1 μM, the RARs agonistic activity was defined as 100% for Tretinoin (purchased from MCE) at a final concentration of 1 μM, the RXRs agonistic activity was defined as 100% for Bexarotene (purchased from MCE) at a final concentration of 1 μM, the FXR agonistic activity was defined as 100% for GW4064 (purchased from Beyotime) at a final concentration of 1 μM, the VDR agonistic activity was defined as 100% for Doxercalciferol (purchased from MCE) at a final concentration of 1 μM, the LXRs agonistic activity was defined as 100% for T0901317 (purchased from MCE) at a final concentration of 1 μM, the Thβ agonistic activity was defined as 100% for T3 (purchased from MCE) at a final concentration of 1 μM, the PXR agonistic activity was defined as 100% for SR12813 (purchased from MCE) at a final concentration of 1 μM, and the CAR agonistic activity was defined as 100% for CITCO (purchased from Glpbio) at a final concentration of 1 μM. After 16 h of drug action, the medium was discarded, and 100 μL of reporter gene lysis buffer (purchased from Shanghai Beyotime Biological Tech. Co., Ltd.) was added to lyse the cells for 15 min. 10 μL of lysate was pipetted into a white opaque 384-well plate, and then 10 μL reporter gene assay buffer (purchased from Shanghai Beyotime Biological Tech. Co., Ltd.) was added. The bioluminescence was detected by using a multimode microplate reader, and the corresponding relative agonistic rate was calculated according to the detection value. The experimental results are shown in FIG. 16. Compound 61 had no significant agonistic effect on nuclear receptors other than PPAR and also had a relatively weak agonistic effect on PPARγ under the condition of 1 μM, so it was considered that compound 61 had high selectivity for the nuclear receptor PPARα/δ. The other compounds of the present invention also have similar effects.


Example 220

Eutectic Structure of Complex of Compound 61 with hPPARδ-LBD


The protein required for crystallization was first expressed. The vector containing the human PPARδ ligand binding domain (amino acid residues 173-441) was transformed into BL21 cells to express the protein. After purification using nickel and anion columns, the recombinant protein was dissolved in a solution of 20 mM Tris, pH 8.0, 150 mM NaCl, and 10% glycerol. Subsequently, compound 61 at 2 mM was added to the above purified protein (hPPARδ-LBD) at 7 mg/mL. The eutectic crystal of the complex of compound 61 with hPPARδ-LBD grew at 16° C., and the crystallization solvent was a mixture of 0.5 M sodium citrate, pH 5.5, 19% PEG3350, and 20% glycerol. The crystal was quickly frozen in liquid nitrogen for data collection. X-ray diffraction data were collected on beam line BL02U at the Shanghai Synchrotron Radiation Facility with the help of the X-ray crystallography facility platform at the National Protein Research Facility Base (Tsinghua University). Data were processed with HKL2000. The structure was solved by molecular replacement using the Phenix program, and the search model was PDB code 3SP950. This model was constructed using coot and refined using the program PHENIX. The experimental results are shown in FIG. 17. The binding pocket was surrounded by some residues including Trp228, Phe246, Thr253, His287, Phe291, His413, and Tyr437. Compound 61 showed the classic binding conformation of the PPARδ agonist in the pocket. By mimicking endogenous fatty acids, key hydrogen bonding interactions between the carboxylic acid group of compound 61 and the three key amino acid residues His287, His413, and Tyr437 were observed. In contrast to the crystal binding patterns of other PPARδ agonists, a “water bridge” was formed between the carbonyl O atoms of triazolone and Thr253. This unique PPARδ-agonist interaction is probably the main reason for the better potency and selectivity of compound 61 for PPARδ.


Example 221
Tablet

Compound 61 (50 g) obtained in Example 61, hydroxypropylmethylcellulose E (150 g), starch (200 g), an appropriate amount of povidone K30, and magnesium stearate (1 g) were mixed, granulated, and tableted.


In addition, the compounds prepared in Examples 1-208 can be prepared into capsules, powders, granules, pills, injections, syrups, oral liquids, inhalants, ointments, suppositories, patches, or the like, with various pharmaceutical excipients according to the conventional preparation method of Chinese Pharmacopoeia 2015.

Claims
  • 1. A triazolone compound of formula (I) or a pharmaceutically acceptable salt or a solvate thereof:
  • 2. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 1, wherein, R1 is selected from: H, linear or branched C1-C4 alkyl, alkoxyalkyl, or acetamidoethyl;R2 and R3 are each independently selected from: H or linear or branched C1-C4 alkyl; or R2 and R3, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring;R4, R5, R6, and R7 are each independently selected from: H, halogen, trifluoromethyl, trifluoromethoxy, trifluoromethylthio, OR13, or linear or branched C1-C4 alkyl;R13 is selected from: linear or branched C1-C4 alkyl, hydroxyalkyl, alkoxyalkyl, alkoxyalkoxyalkyl, cycloalkyl, or alkynylalkoxyalkyl;X is selected from CH2, O, or S;m is selected from any integer from 0 to 2;R8 is selected from H or linear or branched C1-C4 alkyl;R9 and R10 are each independently selected from: H, halogen, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, alkylsulfonyl, alkoxy, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, alkynyl, phenyl, substituted phenyl, phenoxy, substituted phenyloxy, heteroaryl, substituted heteroaryl, fused aryl, or substituted fused aryl, wherein the substituted phenyl may independently be substituted with 1 to 2 of the following substituents: halogen, cyano, linear or branched C1-C4 alkyl, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, or alkylsulfonyl;R11 and R12 are each independently selected from: H, deuterium, linear or branched C1-C4 alkyl, or halogen; or R11 and R12, together with the carbon atoms to which they are bonded, form a 3- to 6-membered cycloalkyl ring.
  • 3. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 1, wherein, the triazolone compound further comprises a pharmaceutically acceptable salt, a tautomer, a mesomer, a racemate, a stereoisomer, a metabolite, a metabolic precursor, a prodrug or a solvate thereof.
  • 4. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 3, wherein the compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof is any one of the following compounds:
  • 5. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 1, wherein the pharmaceutically acceptable salt of the triazolone compound comprises a salt formed by the triazolone compound and metal ions or pharmaceutically acceptable amine or ammonium ions.
  • 6. Use of the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof according to claim 3 in the preparation of a PPARα/δ dual agonist.
  • 7. Use of the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof according to claim 3 as a PPARα/dual agonist in the preparation of a medicament for preventing or treating diseases mediated by PPARα and/or PPARδ.
  • 8. The use according to claim 7, wherein the diseases mediated by PPARα and/or PPARδ comprise metabolic diseases, cardiovascular and cerebrovascular diseases, inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurological injury diseases, secondary diseases caused by pathogen infections, mitochondrial dysfunction and disorder diseases, or tumors.
  • 9. A pharmaceutical composition for preventing or treating diseases mediated by PPARα and/or PPARδ, comprising the triazolone compound or the pharmaceutically acceptable salt, the tautomer, the mesomer, the racemate, the stereoisomer, the metabolite, the metabolic precursor, the prodrug or the solvate thereof according to claim 3 as an active ingredient and a pharmaceutically acceptable carrier.
  • 10. The pharmaceutical composition according to claim 9, wherein the pharmaceutical composition is a capsule, a powder, a tablet, a granule, a pill, an injection, a syrup, an oral liquid, an inhalant, an ointment, a suppository, or a patch.
  • 11. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 2, wherein the pharmaceutically acceptable salt of the triazolone compound comprises a salt formed by the triazolone compound and metal ions or pharmaceutically acceptable amine or ammonium ions.
  • 12. The triazolone compound or the pharmaceutically acceptable salt or the solvate thereof according to claim 3, wherein the pharmaceutically acceptable salt of the triazolone compound comprises a salt formed by the triazolone compound and metal ions or pharmaceutically acceptable amine or ammonium ions.
Priority Claims (2)
Number Date Country Kind
202110970497.X Aug 2021 CN national
202210004501.1 Jan 2022 CN national
PCT Information
Filing Document Filing Date Country Kind
PCT/CN2022/072221 1/17/2022 WO