Patent Application
20220306719
The invention generally relates to immunotherapy using immune cells such as chimeric antigen receptor (CAR)-engineered T cells. In particular, the invention relates to immunotherapy using chimeric antigen receptor (CAR)-engineered T cells that carry a novel, IgG3-Hinge-based spacer domain, allowing a finely modulated response to target antigens. In addition, the invention relates to the introduction of one or more IgG3-Hinge-based multi-function sites (MFS) into CARs and other immunoreceptors, allowing purification, stimulation, expansion and depletion of CAR T cells. The invention includes also the sequence of an antibody targeting this motif, allowing the execution of the before-mentioned functions.
Chimeric antigen receptors (CARs) are synthetic immune receptors that have been developed with the intention to redirect T cells to recognize surface antigens on tumor cells. In their most basic format, CARs comprise the variable heavy and variable light chain (in cis, i.e. as a single chain variable fragment, scFv) of a monoclonal antibody fused to a transmembrane domain and the signaling domain of CD3ζ1. A step to improving this basic CAR design was the inclusion of a spacer domain located between the scFv and the transmembrane domain to provide reach and flexibility in order to promote antigen binding by the CAR2. In the sequel, several spacer domains were used in CAR constructs including Fc regions and immunoglobulin-like domains derived from IgG1 and IgG4, IgD, CD4, CD7, CD8α and CD283-6.
The conventional approach in the field is to use a single spacer design for all CAR constructs, even though they may recognize distinct epitopes in a given antigen, or distinct antigens (‘one CAR has to fit all’). However, because CARs bind to surface antigens on tumor cells, the spatial requirements that allow optimal antigen binding, and optimal interaction between CAR-modified T cell and tumor cell may differ depending on the epitope and target antigen. Therefore, the conventional approach of using a single spacer design for all epitopes and antigens seems naïve and suboptimal. If there is suboptimal CAR binding and/or suboptimal interaction between CAR-modified T cell and tumor cell, the ensuing CAR-T cell stimulation and anti-tumor response may also be suboptimal3,7. To increase the chance of achieving a more optimized CAR-target molecule interaction, the inventors have previously investigated variants of IgG4-derived spacers that differ in length and composition. The paradigm that emerged was that there is a correlation between spacer length and efficacy whereby membrane-proximal epitopes on target cells are reached better by CARs containing longer spacer, and membrane-distal epitopes by CARs containing a shorter one7. Based on the architecture of the IgG4 molecule, three IgG4-Hinge based spacer variants are available that differ in size in increments>100 aa (IgG4_short: IgG4 Hinge, 12 aa; IgG4_intermediate: IgG4 Hinge+CH3, 119 aa; IgG4_long: IgG4 Hinge+CH2+CH3, 228 aa)7.
Of all human IgG molecules, IgG3 shows the highest Fab-Fab folding flexibility and Fab Fc folding flexibility. The architecture of IgG3 is unique, as the hinge of IgG3, in contrast to all other immunoglobulins, incorporates 3 copies of a 15 aa motif caused by exon multiplication8-11. Naturally occurring variants of IgG3 bearing only one or two copies of this motif in their hinge region show a much smaller distance between Fab and Fc (45 Å and 65 Å compared to 105 Å)8. These graduated differences and the opportunity of prolonging and shortening a spacer region by addition or removal of one or more copies of this 15 aa motif led in the present invention to the construction of an IgG3 Hinge library, using that, the length of the spacer can be fine-tuned to an optimal setting for every target. In addition, the inventors identified a monoclonal antibody that is specific to the IgG3 middle hinge motifs, allowing exploitation for additional, antigen-independent though CAR-specific functions, including purification, stimulation, expansion and depletion of CART cells.
The invention generally relates to immunotherapy using immune cells such as chimeric antigen receptor (CAR)-engineered T cells. In particular, the invention relates to immunotherapy using chimeric antigen receptor (CAR)-engineered T cells that carry a novel, IgG3-Hinge-based spacer domain, allowing a finely modulated response to target antigens. In addition, the invention relates to the introduction of one or more IgG3-Hinge-based multi-function sites (MFS) into CARs and other immunoreceptors, allowing purification, stimulation, expansion and depletion of CAR T cells. The invention includes also the sequence of an antibody targeting this motif, allowing the execution of the before-mentioned functions.
The present invention provides and is characterized by, inter alio, the following items.
ID NO: 30 and the light chain variable domain has the amino acid sequence of SEQ ID NO: 29;
Binding an antigen-binding protein, streptamer or aptamer to cells expressing the immunoreceptor or CAR as defined in any one of items 1 to 19, preferably wherein the binding is binding specifically to the IgG3 middle hinge repeat domain comprised in said immunoreceptor or CAR, and/or wherein the antigen-binding protein, streptamer or aptamer is an antigen-binding protein, streptamer or aptamer as defined in any one of items 25 to 29.
During the past decades, the design of chimeric antigen receptors (CARs), previously also termed T-Bodies, evolved from rather simple constructs to more complex molecules assembled from domains of distinct proteins. In their most simple form, nowadays also termed first-generation CARs, they consisted of the scFv of a monoclonal antibody fused to the signaling domains of the CD3ζ subunit1. Subsequently, it turned out that most CAR constructs require a spacer between scFv and transmembrane domain to induce full T cell effector functions2. While from the mid-1990s until now, Fc regions or immunoglobulin-like domains derived from different proteins (including CD4, CD7, CD8α, CD28, IgD, IgG1 and IgG4, with the CD8α Hinge being the most commonly used and best examined one3-6), most researchers in the field are using only one spacer format for all their CAR constructs. This led to effective results, even though the CAR designs used may not necessarily be the most functional ones; different antibodies bind distinct epitopes on their target molecules and the inventors have shown in previous work that a spacer adjusted in composition and length to optimally fit the target epitope leads to maximum anti-tumor function7.
The present invention provides novel variants of the Hinge domain of human IgG3 for incorporation into genetically engineered immunoreceptors, such as incorporation as a spacer domain in CAR constructs.
The inventors generated a library of CARs with IgG3-derived spacers, in which scFv and transmembrane domain are connected by variants of the human IgG3 Hinge domain. This naturally consists of upper hinge (12 aa, ELKTPLGDTTHT, SEQ ID NO: 2), middle hinge (50 aa, CPRCP, SEQ ID NO: 59+3 repeats of the 15 aa motif EPKSCDTPPPCPRCP, SEQ ID NO: 1) and lower hinge (8 aa, APELLGGP, SEQ ID NO: 60), leading to a total spacer size of 70 aa for this wild-type spacer termed IgG3_UMLH (upper, middle and lower hinge). From that the inventors constructed variants consisting of upper hinge (ELKTPLGDTTHT, SEQ ID NO: 2), the n-terminal part of the middle hinge (CPRCP, SEQ ID NO: 59) and 0-10 copies of the EPKSCDTPPPCPRCP motif (SEQ ID NO: 1) leading to spacer domains spanning 17 to 167 aa in 15 aa steps named IgG3_MiHO to IgG3_MiH10.
Other investigators have previously implemented CH2-CH3-Hinge versions of IgG3 as spacer domains in CAR design12, 13. In contrast to the present invention, these researchers have used two variants in length where they removed the upper hinge (ELKTPLGDTTHT, SEQ ID NO: 2) and the start of the middle hinge (CPRCP, SEQ ID NO: 59), but instead additionally used IgG3 CH2 and CH3 domains. These two versions, termed CH2-CH3-Hinge and CH2-CH3-Hinge-Hinge, are both much longer (232 aa or 247 aa), carry FC-binding motifs potentially causing immunogenicity and are due to the inclusion of the relatively stiff CH2 and CH3 regions much less flexible than any of the variants the inventors have included in their present IgG3 spacer library12, 13.
The inventor's data show that an optimal IgG3 spacer configuration can be generated for every target investigated, with the sweet spot depending on the location of the scFv epitope within the target molecule. A general principle is that for epitopes that are located tumor-membrane distally, a shorter variant leads to most potent T cell effector functions, for epitopes that are located membrane-proximally, a longer variant leads to better function. In general, the inventors show that IgG3-based spacers inherit a great flexibility, surpassing that of other formats. In particular, CARs carrying a relatively short IgG3-based spacer of only 62 aa (IgG3_MiH3) outperform IgG4 variants that show best functionality with a very long spacer of 228 aa, thereby reducing the size of the CAR and the genetic cargo that has to be delivered. The reduction of the genetic cargo is associated with several advantageous effects, such as an increase of transfection or transduction efficiency, improved genetic safety, as well as enablement of the use of vectors which are limited to a particular maximum size. For potent scFvs like the CD19-specific scFv FMC63, the inventors show that most variants are functional in principle and that an optimized version of the IgG3 spacer is equally effective in inducing proliferation, cytokine secretion and cytotoxicity. For most other targets, an optimal configuration can be identified that leads to best antitumor efficacy in vitro as well as in vivo.
The inventor identified an antibody, termed anti-MiH antibody #1, that is capable of specifically binding the IgG3 middle Hinge region, though their data suggest that proper binding requires 3 or more IgG3_MiH repeats. Using this antibody and its derivatives, the inventors could show, that CAR T cells can be targeted antigen-independently but CAR-specifically. The inventors reveal that additional functions that can be exploited include stimulation, expansion and depletion as well as enrichment of CAR T cells directly via the CAR itself instead via a CAR-independent transduction marker.
Since the inventors' data suggest that a majority of CAR scFvs shows best function with a rather short spacer undercutting 3 IgG3_MiH repeats, they included a second multi-function site comprising 5 IgG3_MiH repeats between the first and the second domain of a scFv, thereby replacing the commonly used (G4S)3 linker.
The inventors show that this alternative linker between scFv VH and VL does not impair the target recognition of the CAR construct, allowing its exploitation for additional functions. The inventors' data demonstrate that targeting the multifunction site leads to efficient antigen-independent but CAR-specific stimulation and proliferation, as well as specific enrichment and depletion of CAR T cells.
In previous attempts, a StrepTag II was used as part of the spacer as well as a tag14, or a myc-tag was used as part of the spacer domain as well as a tag15. In contrast to that, the concept that the inventors provide originates from a fully human protein in an unmodified form, making the occurrence of immunogenicity much less likely as for such artificial proteins. Moreover, for these tags, it has not been shown that it is possible to arrange several copies of the motif one after another in order to optimize spacer length and flexibility.
In summary, the inventors' data encourage the use of IgG3-Hinge-derived spacer domains for implementation in CAR design. Their good functionality, in association with the unique exploitation of antigen-independent though CAR-specific functions using a spacer-targeting antibody, accompanied with a low immunogenicity of the CAR construct make this approach an attractive option for pre-clinical, clinical and commercial exploitation.
Definitions and Embodiments
Unless otherwise defined below, the terms used in the present invention shall be understood in accordance with the common meaning known to the person skilled in the art.
Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it is not inconsistent with the present invention. References are indicated by their reference numbers and their corresponding reference details which are provided in the “references” section.
An IgG3 middle hinge domain repeat motif in accordance with the invention is a motif located in the middle hinge of an antibody of an IgG3 class, which can occur more than once in the hinge region. In a preferred embodiment, the IgG3 middle hinge domain repeat motif consists the amino acid sequence of SEQ ID NO: 1.
An immunoreceptor according to the invention is a transmembrane receptor, which, when expressed by an immune cell, is capable of mediating an immune response. The immunoreceptor can be an endogenous immunoreceptor or a non-natural immunoreceptor, i.e. genetically engineered. Exemplary immunoreceptors in accordance with the invention are B-cell receptors (BCRs), T-cell receptors (TCRs), and chimeric antigen receptor (CARS). The immunoreceptor in its monomeric form may either consist of a single molecule comprising all of its domains or consist of a heterodimer that comprises all of its domains. The immunoreceptor can bind to its antigen either directly, or it can bind indirectly through an adapter.
The immunoreceptor according to the invention can comprise an antigen-binding domain which comprises a first domain, linker, and optionally a second domain. The first and second domain are not limited to a specific molecular orientation, i.e. both first and second domain can be located N-terminal or C-terminal to each other. Optionally, the second domain can be absent, i.e. the antigen-binding domain can be comprised of the first domain and the linker, in any orientation in respect of N-terminal or C-terminal orientation. An exemplary embodiment of an antigen-binding domain is a single chain variable fragment (scFv). In this case, the first domain can comprise a light chain variable domain or a heavy chain variable domain, and the second domain can comprise a light chain variable domain or a heavy chain variable domain, which are connected by a peptide linker. The first and second domain can both either be located at the N-terminus of the scFv, or at the C-terminus of the scFv.
In one embodiment, the immunoreceptor is capable of binding to an antigen, preferably a cancer antigen, more preferably a cancer cell surface antigen. In a preferred embodiment, the immunoreceptor is capable of binding to extracellular domain of a cancer antigen. In a preferred embodiment, the immunoreceptor is a chimeric antigen receptor. In a preferred embodiment, the immunoreceptor is a genetically engineered T-cell receptor.
In a preferred embodiment, the immunoreceptor is expressed in T cells. In a preferred embodiment of the invention, the immunoreceptor is expressed in T cells and allows said T cells to bind specifically to antigen-expressing cancer cells with high specificity to exert a growth inhibiting effect, preferably a cytotoxic effect, on said cancer cells.
In a preferred embodiment in accordance with the invention, immune cells are isolated from a healthy donor or a patient having cancer, transduced with a gene transfer vector encoding an immunoreceptor comprising one or more IgG3 middle hinge repeat domain motifs, which is capable of binding to an antigen expressed by said cancer, and administered to the patient to treat said cancer. In a preferred embodiment, the immune cells are B cells, NK cells, macrophages or T cells. In a more preferred embodiment, the T cells are CD8+ T cells or CD4+ T cells.
The term antibody as used herein refers to any functional antibody that is capable of specific binding to the antigen of interest. Without particular limitation, the term antibody encompasses antibodies from any appropriate source species, including avian such as chicken and mammalian such as mouse, goat, rabbit, non-human primate and human. Preferably, the antibody is a humanized antibody. Humanized antibodies are antibodies which contain human sequences and a minor portion of non-human sequences which confer binding specificity to an antigen of interest (e.g. human FLT3). The antibody is preferably a monoclonal antibody which can be prepared by methods well-known in the art. The term antibody encompasses an IgG-1, -2, -3, or -4, IgE, IgA, IgM, or IgD isotype antibody. The term antibody encompasses monomeric antibodies (such as IgD, IgE, IgG) or oligomeric antibodies (such as IgA or IgM). The term antibody also encompasses—without particular limitations—isolated antibodies and modified antibodies such as genetically engineered antibodies, e.g. chimeric antibodies or bispecific antibodies.
An antibody fragment or fragment of an antibody as used herein refers to a portion of an antibody that retains the capability of the antibody to specifically bind to the antigen (e.g. the IgG3 middle hinge repeat domain). This capability can, for instance, be determined by determining the capability of the antigen-binding portion to compete with the antibody for specific binding to the antigen by methods known in the art. Without particular limitation, the antibody fragment can be produced by any suitable method known in the art, including recombinant DNA methods and preparation by chemical or enzymatic fragmentation of antibodies. Antibody fragments may be Fab fragments, F(ab′) fragments, F(ab′)2 fragments, single chain antibodies (scFv), single-domain antibodies, diabodies or any other portion(s) of the antibody that retain the capability of the antibody to specifically bind to the antigen.
An “antibody” (e.g. a monoclonal antibody) or “a fragment thereof” as described herein may have been derivatized or be linked to a different molecule. For example, molecules that may be linked to the antibody are other proteins (e.g. other antibodies), a molecular label (e.g. a fluorescent, luminescent, colored or radioactive molecule), a pharmaceutical and/or a toxic agent. The antibody or antigen-binding portion may be linked directly (e.g. in form of a fusion between two proteins), or via a linker molecule (e.g. any suitable type of chemical linker known in the art).
A “bispecific antibody” is an antibody or fragment thereof as described herein which is capable of specifically binding to two antigens which are different from each other. An exemplary embodiment of a bispecific antibody is an antibody which is capable of specifically binding to a cancer cell surface antigen (e.g. CD19 or CD20) and an immune cell surface antigen (e.g. CD3). The bispecific antibody is preferably capable of recruiting immune cells to target cells, such as cancer cells, and thereby mediate antibody-dependent cell-mediated cytotoxicity (ADCC). The bispecific antibody may comprise a portion which interacts with Fc receptors.
Terms such as “treatment of cancer” or “treating cancer” according to the present invention refer to a therapeutic treatment. An assessment of whether or not a therapeutic treatment works can, for instance, be made by assessing whether the treatment inhibits cancer growth in the treated patient or patients. Preferably, the inhibition is statistically significant as assessed by appropriate statistical tests which are known in the art. Inhibition of cancer growth may be assessed by comparing cancer growth in a group of patients treated in accordance with the present invention to a control group of untreated patients, or by comparing a group of patients that receive a standard cancer treatment of the art plus a treatment according to the invention with a control group of patients that only receive a standard cancer treatment of the art. Such studies for assessing the inhibition of cancer growth are designed in accordance with accepted standards for clinical studies, e.g. double-blinded, randomized studies with sufficient statistical power. The term “treating cancer” includes an inhibition of cancer growth where the cancer growth is inhibited partially (i.e. where the cancer growth in the patient is delayed compared to the control group of patients), an inhibition where the cancer growth is inhibited completely (i.e. where the cancer growth in the patient is stopped), and an inhibition where cancer growth is reversed (i.e. the cancer shrinks). An assessment of whether or not a therapeutic treatment works can be made based on known clinical indicators of cancer progression.
A treatment of cancer according to the present invention does not exclude that additional or secondary therapeutic benefits also occur in patients. For example, an additional or secondary benefit may be an enhancement of engraftment of transplanted hematopoietic stem cells that is carried out prior to, concurrently to, or after the treatment of cancer. However, it is understood that the primary treatment for which protection is sought is for treating the cancer itself, and any secondary or additional effects only reflect optional, additional advantages of the treatment of cancer growth.
The treatment of cancer according to the invention can be a first-line therapy, a second-line therapy, a third-line therapy, or a fourth-line therapy. The treatment can also be a therapy that is beyond fourth-line therapy. The meaning of these terms is known in the art and in accordance with the terminology that is commonly used by the US National Cancer Institute.
The treatment of infectious, automimmune and degenerative diseases, respectively, can be a first-line therapy, a second-line therapy, a third-line therapy, or a fourth-line therapy. The treatment can also be a therapy that is beyond fourth-line therapy. The meaning of these terms is known in the art.
The term “capable of binding” as used herein refers to the capability to form a complex with a molecule that is to be bound (e.g. the IgG3 middle hinge repeat domain). Binding typically occurs non-covalently by intermolecular forces, such as ionic bonds, hydrogen bonds and Van der Waals forces and is typically reversible. Various methods and assays to determine binding capability are known in the art. Binding is usually a binding with high affinity, wherein the affinity as measured in KD values is preferably is less than 1 μM, more preferably less than 100 nM, even more preferably less than 10 nM, even more preferably less than 1 nM, even more preferably less than 100 pM, even more preferably less than 10 pM, even more preferably less than 1 pM.
As used herein, each occurrence of terms such as “comprising” or “comprises” may optionally be substituted with “consisting of” or “consists of”.
As used herein, terms such as a “linker” which “comprises one or more IgG3 middle hinge domain repeat motifs” or a “spacer domain” which “comprises one or more IgG3 middle hinge domain repeat motifs” can refer to a linker or spacer domain where said one or more IgG3 middle hinge domain repeat motifs are present in addition to said one or more IgG3 middle hinge domain repeat motifs of the immunoreceptor of the invention. Alternatively, terms such as a “linker” which “comprises one or more IgG3 middle hinge domain repeat motifs” or a “spacer domain” which “comprises one or more IgG3 middle hinge domain repeat motifs” can refer to a linker or spacer domain where said one or more IgG3 middle hinge domain repeat motifs are identical to said one or more IgG3 middle hinge domain repeat motifs of the immunoreceptor of the invention.
The term “reduced immunogenicity” in connection with an immunoreceptor or CAR or bispecific antibody is to be understood in accordance with its general meaning in the art. In a preferred embodiment in accordance with all other embodiments of the invention, “reduced immunogenicity” in connection with an immunoreceptor or CAR means that the immunoreceptor or CAR has reduced immunogenicity in comparison to a second immunoreceptor or CAR in an assay wherein said immunoreceptor or CAR is expressed in a HLA/A2-positive tumor cell line, followed by co-incubation of the cell line with PBMCs of a HLA/A2-positive donor, and followed by an enzyme-linked immunosorbent assay (ELISA)-based determination of whether the immunoreceptor or CAR causes reduced cytokine production by the PBMCs. In a preferred embodiment in accordance with all other embodiments of the invention, “reduced immunogenicity” in connection with a bispecific antibody means that the bispecific antibody causes reduced anti-drug antibody levels in human patients in comparison to a second bispecific antibody. Anti-drug antibody levels can be determined by methods known in the art including ELISA-based methods.
A pharmaceutically acceptable carrier, including any suitable diluent or, can be used herein as known in the art. As used herein, the term “pharmaceutically acceptable” means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. It will be understood that the formulation will be appropriately adapted to suit the mode of administration.
Compositions and formulations in accordance with the present invention are prepared in accordance with known standards for the preparation of pharmaceutical compositions and formulations. For instance, the compositions and formulations are prepared in a way that they can be stored and administered appropriately, e.g. by using pharmaceutically acceptable components such as carriers, excipients or stabilizers. Such pharmaceutically acceptable components are not toxic in the amounts used when administering the pharmaceutical composition or formulation to a patient. The pharmaceutical acceptable components added to the pharmaceutical compositions or formulations may depend on the chemical nature of the inhibitor and targeting agent present in the composition or formulation (depend on whether the targeting agent is e.g. an antibody or fragment thereof or a cell expressing a chimeric antigen receptor), the particular intended use of the pharmaceutical compositions and the route of administration.
In a preferred embodiment in accordance with the invention, the composition or formulation is suitable for administration to humans, preferably the formulation is sterile and/or non-pyrogenic.
In a preferred embodiment, the invention provides an immunoreceptor, comprising one or more IgG3 hinge repeat domain motifs, wherein the immunoreceptor does not comprise an IgG3 CH2 and/or CH3 domain.
In an alternative embodiment, the immunoreceptor comprises an IgG3 CH2 domain. In a further alternative embodiment, the immunoreceptor comprises an IgG3 CH3 domain. In a further alternative embodiment, the immunoreceptor comprises an IgG3 CH2 and CH3 domain. In a further alternative embodiment, the immunoreceptor comprises an IgG3 CH1 domain. In a further alternative embodiment, the immunoreceptor comprises an IgG3 CH1, CH2 and CH3 domain.
The terms “IgG3 CH2 domain” and “IgG3 CH3 domain” are to be understood in accordance with their meaning known in the art. In a preferred embodiment in accordance with all other embodiments of the invention, the IgG3 CH2 domain is the CH2 domain of human IgG3 consisting of the sequence of SEQ ID NO: 172, and the IgG3 CH3 domain is the CH3 domain of human IgG3 consisting of the sequence of SEQ ID NO: 173.
In a preferred embodiment, the immunoreceptor in accordance with the invention comprises an extracellular antigen-binding domain, a spacer domain, and a transmembrane domain, wherein the spacer domain is located between the antigen-binding domain and the transmembrane domain. In a preferred embodiment, the spacer domain comprises one or more IgG3 middle hinge domain repeat motifs. In a preferred embodiment, the transmembrane domain and the intracellular domain of the immunoreceptor together consist of a sequence selected from the group consisting of SEQ ID NO: 109, 110, 111, 112, 113, 114, 115 and 174. In a preferred embodiment, the immunoreceptor is a chimeric antigen receptor, and the antigen-binding domain is a single chain variable fragment, which is linked to the chimeric antigen receptor by said spacer, which comprises one or more IgG3 middle hinge domain repeat motifs, preferably two or more IgG3 middle hinge domain repeat motifs, more preferably three or more IgG3 middle hinge domain repeat motifs. In this embodiment, the antigen-binding protein (e.g. an antibody or fragment thereof) is capable of binding to the immunoreceptor by specifically binding to the one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs comprised in the immunoreceptor. Binding of said antigen-binding protein to said immunoreceptor by means of recognition of said IgG3 middle hinge domain repeat motifs may affect the immunoreceptor's effector function, such as its downstream signaling that modulates the properties of the cell which express said immunoreceptor, e.g. its proliferation or interaction with other immune cells. In this embodiment, the number of repeats of said IgG3 middle hinge domain repeat motifs comprised in said spacer domain comprised in said immunoreceptor can affect the capability of said immunoreceptor to selectively and efficiently bind to a particular target antigen present on a target cell's surface (e.g. CD19, CD20, ROR1, ROR2, SLAMF7, FLT3, Siglec-6, αvβ3 integrin, or BCMA). Preferably, the target cell is a cancer cell, and the target antigen is a cancer antigen, i.e. a cell surface marker expressed to a higher degree in cancer cells than in non-disease cells. In an exemplary embodiment, the immunoreceptor of the invention is a chimeric antigen receptor which comprises, as the transmembrane domain, the amino acid sequence of SEQ ID NO: 65. In this embodiment, the chimeric antigen receptor may further comprise a 4-1BB domain having an amino acid sequence as set forth in SEQ ID NO: 66, and a CD3 zeta domain having an amino acid sequence as set forth in SEQ ID NO: 67. In an exemplary embodiment, the immunoreceptor is a CD19 chimeric antigen receptor having an amino acid sequence as set forth in SEQ ID NO: 68.
In another preferred embodiment, the immunoreceptor is a chimeric antigen receptor, and the antigen-binding domain is a single chain variable fragment, wherein the single chain variable fragment comprises a first domain, a linker, and a second domain, and the linker comprises one or more IgG3 middle hinge domain repeat motifs, preferably two or more IgG3 middle hinge domain repeat motifs, more preferably three or more IgG3 middle hinge domain repeat motifs. In this embodiment, the antigen-binding protein (e.g. an antibody or fragment thereof) is capable of binding to the immunoreceptor by specifically binding to the one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs comprised in the immunoreceptor. In this embodiment, the antigen-binding protein (e.g. an antibody or fragment thereof) is capable of binding to the immunoreceptor by specifically binding to the one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs comprised in the immunoreceptor. Binding of said antigen-binding protein to said immunoreceptor by means of recognition of said IgG3 middle hinge domain repeat motifs may affect the immunoreceptor's effector function, such as its downstream signaling that modulates the properties of the cell which express said immunoreceptor, e.g. its proliferation or interaction with other immune cells.
In a preferred embodiment, the presence of the one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in said immunoreceptor does not cause unspecific or otherwise undesired immunogenic reactions against the cell expressing said immunoreceptor.
The antigen-binding domain in accordance with the invention is generally capable of specifically binding to a given target antigen. In a preferred embodiment, the antigen-binding domain is capable of specifically binding to a cell surface antigen, preferably a cancer antigen i.e. a cell surface marker expressed to a higher degree in cancer cells than in non-disease cells. The antigen-binding domain, when incorporated into an immunoreceptor in accordance with the invention, enables said immunoreceptor to specifically recognize and bind the target antigen which the antigen-binding domain is able to specifically bind to. In this embodiment, when said immunoreceptor comprising said antigen-binding domain is expressed by a cell, said cell acquires the capability of specifically recognizing a target cell which expresses said target antigen. In a preferred embodiment, the immunoreceptor is a chimeric antigen receptor, and the antigen-binding domain is a single chain variable fragment which is part of said chimeric antigen receptor.
In an embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor which comprises a spacer domain located between an extracellular antigen-binding domain and a transmembrane domain, wherein the spacer domain comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs, and wherein the extracellular antigen-binding domain is an scFv specific for CD19, CD20, ROR1, ROR2, SLAMF7, FLT3, Siglec-6, αvβ3 integrin, or BCMA, wherein the scFv does not comprise IgG3 middle hinge domain repeat motif.
In an embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor which comprises a spacer domain located between an extracellular antigen-binding domain and a transmembrane domain, wherein the spacer domain does comprise an IgG3 middle hinge domain repeat motifs, and wherein the extracellular antigen-binding domain is an scFv specific for CD19, CD20, ROR1, ROR2, SLAMF7, FLT3, Siglec-6, αvβ3 integrin, or BCMA, wherein the scFv comprises a first domain, linker, and second domain, and said linker comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for CD19, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 27,and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 28. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 27 and the light chain variable domain has the amino acid sequence of SEQ ID NO: 28. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for CD20, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 30,and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 29. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 30 and the light chain variable domain has the amino acid sequence of SEQ ID NO: 29. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for ROR1, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 31, 33, 35, or 37, and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 32, 34, 36, or 38, respectively. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 31, 33, 35, or 37, and the light chain variable domain has the amino acid sequence of SEQ ID NO: 32, 34, 36, or 38, respectively. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for ROR2, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 39,and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 40. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 39 and the light chain variable domain has the amino acid sequence of SEQ ID NO: 40. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for SLAMF7, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 41 or 43, and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 42 or 44, respectively. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 41 or 43, and the light chain variable domain has the amino acid sequence of SEQ ID NO: 42 or 44, respectively. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for FLT3, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 45 or 47, and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 46 or 48, respectively. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 45 or 47, and the light chain variable domain has the amino acid sequence of SEQ ID NO: 46 or 48, respectively. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for Siglec-6, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 49,and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 50. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 49 and the light chain variable domain has the amino acid sequence of SEQ ID NO: 50. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for αvβ3 integrin, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 51 or 53, and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 52 or 54, respectively. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 51 or 53, and the light chain variable domain has the amino acid sequence of SEQ ID NO: 52 or 54, respectively. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for BCMA, wherein said chimeric antigen receptor comprises a heavy chain variable domain which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 55 or 57, and the light chain variable domain has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, to SEQ ID NO: 56 or 58, respectively. In one embodiment, the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 55 or 57, and the light chain variable domain has the amino acid sequence of SEQ ID NO: 56 or 58, respectively. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In one embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the spacer domain of said chimeric antigen receptor. In another embodiment, said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are located within the linker comprised in the extracellular antigen-binding domain comprised in said chimeric antigen receptor, wherein the extracellular antigen-binding domain is an scFv. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for CD19, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 3 or 71. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for CD20, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 4 or 72. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for ROR1, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 5, 6, 7, 8, 73, 74, 75, 76, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for ROR2, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 9, 77, 101, 102, 103, 104, 105, 106, 107 or 108. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for SLAMF7, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 10, 11, 78 or 79. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for FLT3, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 12, 13, 80 or 81. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for Siglec-6, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 14 or 82. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for αvβ3 integrin, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 15, 16, 83 or 84. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In one embodiment, the immunoreceptor in accordance with the invention is a chimeric antigen receptor specific for BCMA, wherein said chimeric antigen receptor comprises an scFv which has an amino acid sequence having at least 80% sequence identity, preferably at least 90% sequence identity, optionally 100% sequence identity, to SEQ ID NO: 17, 18, 85 or 86. In this embodiment, said chimeric antigen receptor comprises one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs which are located within the spacer domain of said chimeric antigen receptor. In this embodiment, the linker comprised in the extracellular antigen-binding domain comprised in said scFv comprised in said chimeric antigen receptor does not comprise an IgG3 middle hinge domain repeat motif. In a preferred embodiment, said chimeric antigen receptor does not cause unspecific or undesired immune reactions compared to a chimeric antigen receptor which does not comprise said one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs but is otherwise similar, i.e. comprises the same intracellular, extracellular, and transmembrane domains, and only differs from said chimeric antigen receptor of the invention in the spacer domain and/or the linker comprised in the scFv comprised in said chimeric antigen receptor.
In another aspect, the invention also provides a chimeric antigen receptor comprising
wherein the spacer domain is located between the extracellular antigen-binding domain and the transmembrane domain, and wherein the spacer domain comprises an amino acid sequence which has 100% sequence identity with the amino acid sequence of [A-Bn], wherein
In a preferred embodiment of this aspect, the transmembrane domain and the intracellular domain together consist of a sequence selected from the group consisting of SEQ ID NO: 109, 110, 111, 112, 113, 114, 115 and 174.
All embodiments of the invention which are defined above for the immunoreceptor or CAR of the invention also apply to the chimeric antigen receptor of this aspect of the invention.
In preferred embodiments, the chimeric antigen receptor of the invention including this aspect of the invention can be specific for CD19, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 3 or 71, or the chimeric antigen receptor can be specific for CD20, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 4 or 72, or the chimeric antigen receptor can be specific for ROR1, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 5, 6, 7, 8, 73, 74, 75, 76, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100, or the chimeric antigen receptor can be specific for ROR2, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 9, 77, 101, 102, 103, 104, 105, 106, 107 or 108, or the chimeric antigen receptor can be specific for SLAMF7, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 10, 11, 78 or 79, or the chimeric antigen receptor can be specific for FLT3, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 12, 13, 80 or 81, or the chimeric antigen receptor can be specific for Siglec-6, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 14 or 82, or the chimeric antigen receptor can be specific for αvβ3 integrin, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 15, 16, 83 or 84, or the chimeric antigen receptor can be specific for BCMA, wherein said extracellular antigen-binding domain comprises an scFv which has an amino acid sequence having 100% sequence identity to SEQ ID NO: 17, 18, 85 or 86.
In a very preferred embodiment of the invention, the chimeric antigen receptor of the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, and 171.
In one embodiment, the immunoreceptor in accordance with the invention comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs is/are used in therapy. In an embodiment, the invention provides a medicine, comprising, as one active ingredient, cells, e.g. immune cells such as T cells, expressing an immunoreceptor in accordance with the invention.
In a preferred embodiment, the CD19-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said CD19-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the CD19-specific chimeric antigen receptor is used in the treatment of Non-Hodgkin lymphoma, Multiple Myeloma, Burkitt's lymphoma, Mantle cell lymphoma, Acute lymphoblastic leukemia, Chronic lymphocytic leukemia and Diffuse large B-cell lymphoma.
In a preferred embodiment, the CD20-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said CD20-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the CD20-specific chimeric antigen receptor is used in the treatment of Non-Hodgkin lymphoma, Multiple Myeloma, Burkitt's lymphoma, Mantle cell lymphoma, Acute lymphoblastic leukemia, Chronic lymphocytic leukemia and Diffuse large B-cell lymphoma.
In a preferred embodiment, the ROR1-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said ROR1-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the ROR1-specific chimeric antigen receptor is used in the treatment of breast cancer, lung cancer, Mantle cell lymphoma, Chronic lymphocytic leukemia and Diffuse large B-cell lymphoma.
In a preferred embodiment, the ROR2-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said ROR2-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the ROR2-specific chimeric antigen receptor is used in the treatment of breast cancer, colon cancer prostate cancer, osteosarcoma and Multiple Myeloma.
In a preferred embodiment, the SLAMF7-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said SLAMF7-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the SLAMF7-specific chimeric antigen receptor is used in the treatment of Multiple Myeloma, T cell and B cell leukemia or lymphoma.
In a preferred embodiment, the FLT3-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said FLT3-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the FLT3-specific chimeric antigen receptor is used in the treatment of Acute Myeloid leukemia, Acute lymphoblastic leukemia and Myelodysplastic Syndromes.
In a preferred embodiment, the Siglec-6-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said Siglec-6-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the Siglec-6-specific chimeric antigen receptor is used in the treatment of Acute Myeloid leukemia.
In a preferred embodiment, the αvβ3 integrin-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said αvβ3 integrin-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the αvβ3 integrin-specific chimeric antigen receptor is used in the treatment of breast cancer, pancreatic cancer, prostate cancer, melanoma and glioblastoma.
In a preferred embodiment, the BCMA-specific chimeric antigen receptor comprising one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs in accordance with the invention is used in the treatment of cancer, wherein in the method, cells expressing said BCMA-specific chimeric antigen receptor are administered to a patient in need thereof, thereby treating said cancer. In one embodiment, the cells are autologous, i.e. are obtained from the same patient that is to be treated. In one embodiment, the cells are allogeneic (because they are obtained from a source other than the patient that is to be treated). In a preferred embodiment, the BCR-specific chimeric antigen receptor is used in the treatment of Multiple Myeloma and amyloidosis.
In one embodiment, the immunoreceptor is a T-cell receptor (TCR), preferably a recombinant TCR; a B-cell receptor (BCR), preferably a recombinant BCR; or a chimeric antigen receptor (CAR). In one embodiment, the immunoreceptor is a recombinant, i.e. non-natural, genetically engineered T-cell receptor (TCR). In one embodiment, the immunoreceptor is a recombinant, i.e. non-natural, genetically engineered B-cell receptor (BCR). In a preferred embodiment, the immunoreceptor is a chimeric antigen receptor (CAR).
In a preferred embodiment, the IgG3 middle hinge repeat domain motif in accordance with the invention is from a human IgG3 middle hinge. In a preferred embodiment, said IgG3 middle hinge repeat domain motif comprises at least 10, 11, 12, 13, or 14 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 10 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 11 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 12 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 13 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 14 contiguous amino acids of SEQ ID NO: 1. In one embodiment, said IgG3 middle hinge repeat domain motif comprises at least 15 contiguous amino acids of SEQ ID NO: 1. In a preferred embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 5, 4, 3, 2, or 1 conservative amino acid substitutions. In one embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 5 conservative amino acid substitutions. In one embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 4 conservative amino acid substitutions. In one embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 3 conservative amino acid substitutions. In one embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 2 conservative amino acid substitutions. In one embodiment, said IgG3 middle hinge repeat domain motif consists of the amino acid sequence of SEQ ID NO: 1 having not more than 1 conservative amino acid substitutions. In a preferred embodiment, said IgG3 middle hinge repeat domain motif has the amino acid sequence of SEQ ID NO: 1.
In a preferred embodiment, the immunoreceptor in accordance with the invention does not comprise all or part of the sequence of the lower hinge domain of an IgG3 hinge domain, preferably said IgG3 hinge domain being human.
In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times. In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif once. In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif twice. In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif three times. In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif four times. In an embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif five times. In a preferred embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif at least three times. In a preferred embodiment, the immunoreceptor in accordance with the invention comprises the IgG3 middle hinge domain repeat motif not more than five times.
In a preferred embodiment, the immunoreceptor in accordance with the invention comprises an amino acid sequence which has at least 80% sequence identity, preferably at least 90% sequence identity, or optionally 100% sequence identity with the amino acid sequence of [A-Bn], wherein A is the amino acid sequence of SEQ ID NO: 2; B is said IgG3 middle hinge domain repeat motif, wherein said motif has the amino acid sequence of SEQ ID NO: 1; and n is an integer between 1 and 15, preferably between 1 and 10, more preferably between 1 and 5, most preferably between 3 and 5. In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, n is 3. In one embodiment, n is 4. In one embodiment, n is 5. In a preferred embodiment, n is between 3 and 5. In a preferred embodiment, the immunoreceptor in accordance with the invention comprises at least two IgG3 middle hinge domain repeat motifs which are adjacent to each other. In a preferred embodiment, the immunoreceptor in accordance with the invention comprises at least three IgG3 middle hinge domain repeat motifs which are adjacent to each other.
The present invention provides a nucleic acid which encodes the immunoreceptor in accordance with the invention. There are no particular limitations to the nucleic acids of the invention and to how it can be expressed. For example, the nucleic acid which encodes the immunoreceptor in accordance with the invention can be expressed stably or transiently. In a preferred embodiment, the nucleic acid is a viral vector. In one embodiment, the viral vector is a retroviral vector. In a preferred embodiment, the retroviral vector is a lentiviral vector. The lentiviral vector can be a first, second, third, or fourth generation lentiviral vector. Preferably, the lentiviral vector is a third or fourth generation lentiviral vector. In an exemplary embodiment, the lentiviral vector encoding the immunoreceptor comprises the nucleic acid sequence of SEQ ID NO: 61 and SEQ ID NO: 62, wherein the nucleic acid sequence of SEQ ID NO: 61 is located 5′ to the sequence encoding the immunoreceptor, and the nucleic acid sequence of SEQ ID NO: 62 is located 3′ relative to the sequence encoding the immunoreceptor, and the vector is circularized. In one embodiment, the viral vector is an episomal vector. In one embodiment, the viral vector is an adenoviral vector. In one embodiment, the viral vector is an adeno-associated viral vector. In one embodiment, the nucleic acid comprises nucleic acid sequences which enable stable integration into a host cell's genome via transpositions, such as inverted repeats. In an exemplary embodiment, the nucleic acid is a vector encoding the immunoreceptor which comprises the nucleic acid sequence of SEQ ID NO: 63 and SEQ ID NO: 64, wherein the nucleic acid sequence of SEQ ID NO: 63 is located 5′ to the sequence encoding the immunoreceptor, and the nucleic acid sequence of SEQ ID NO: 64 is located 3′ relative to the sequence encoding the immunoreceptor, and the vector is circularized.
In a preferred embodiment, the nucleic acid can be integrated into a host cell's genome via site-directed genome engineering techniques such as CRISPR/Cas9, Zinc finger nucleases or TALEN. In an embodiment, the nucleic acid is a DNA. In one embodiment, the nucleic acid is RNA. In one embodiment, the nucleic acid comprises non-natural nucleotides. In one embodiment, the nucleic acid does not comprise non-natural nucleotides.
The present invention provides a cell comprising the nucleic acid encoding the immunoreceptor in accordance with the invention. In a preferred embodiment, the cell expresses the immunoreceptor. In one embodiment, the cell can be induced to express the immunoreceptor. In a preferred embodiment, the cell is an immune cell. In a more preferred embodiment, the cell is a T cell. In a preferred embodiment, the T cell is a CD4+ T cell. In a preferred embodiment, the T cell is a CD8+ T cell. In a preferred embodiment, the T cell is a cytotoxic T cell (CTL). In one embodiment, the cell comprises all or part of the nucleic acid encoding the immunoreceptor in accordance with the invention stably integrated into its genome. In a preferred embodiment, the cell comprises the entire sequence encoding the immunoreceptor of the invention stably integrated into its genome. In one embodiment, the cell comprises all or part of the nucleic acid encoding the immunoreceptor in accordance with the invention as an episome. In a preferred embodiment, the cell comprises the entire sequence encoding the immunoreceptor of the invention stably as an episome.
In a preferred embodiment, the nucleic acid and cell comprising the immunoreceptor in accordance with the invention are provided for use in the treatment of cancer or autoimmune diseases, infectious diseases or degenerative diseases.
In a preferred embodiment, the cancer is a hematological cancer. In a preferred embodiment, the hematological cancer is leukemia or lymphoma, preferably acute myeloid leukemia, multiple myeloma, non-Hodgkin-lymphoma, Burkitt's lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, or diffuse large B cell lymphoma. In one embodiment, the cancer is a solid cancer. In an embodiment, the solid cancer is breast cancer, colon carcinoma, lung cancer, or prostate cancer.
The present invention provides an antigen-binding protein, which is capable of specifically binding to an epitope comprised of a sequence consisting of at least one, preferably at least two, more preferably at least three repeats of the IgG3 middle hinge repeat domain motifs. In a preferred embodiment, the antigen-binding protein in accordance with the invention is capable of specifically binding to an epitope comprised of the junction of two adjacent IgG3 middle hinge repeat domain motifs. In a preferred embodiment, the antigen-binding protein is an antibody or fragment thereof.
In a preferred embodiment, the antigen-binding protein is an antibody or fragment thereof comprising, as complementarity determining regions (CDRs) comprised in the heavy chain variable region a CDR1 having the amino acid sequence of SEQ ID NO: 20, a CDR2 having the amino acid sequence of SEQ ID NO: 21, and a CDR3 having the amino acid sequence of SEQ ID NO: 22; and as complementarity determining regions (CDRs) comprised in the light chain variable region a CDR1 having the amino acid sequence of SEQ ID NO: 24, a CDR2 having the amino acid sequence of SEQ ID NO: 25, and a CDR3 having the amino acid sequence of SEQ ID NO: 26.
In a preferred embodiment, antigen-binding protein is an antibody or fragment thereof and comprises a heavy chain variable domain having at least 80%, preferably at least 90%, optionally 100% sequence identity with the amino acid sequence of SEQ ID NO: 19, and a light chain variable region having at least 80%, preferably at least 90%, optionally 100% sequence identity with the amino acid sequence of SEQ ID NO: 23, capable of specifically binding to one or more, preferably two or more, more preferably three or more IgG3 middle hinge domain repeat motifs. In a preferred embodiment, the antibody or fragment thereof maintains 100% sequence identity in its CDRs to SEQ ID NO: 20, 21, 22, 24, 25, and 26.
In one embodiment, the antigen-binding protein capable of binding to an epitope comprised of at least one, preferably at least two, more preferably at least three IgG3 middle hinge repeat domain motifs is an antigen-binding protein which does not comprise SEQ ID NO: 19 and/or SEQ ID NO: 23.
The antigen-binding protein in accordance with the invention can be used for purification, detection, depletion, stimulation, expansion, or enrichment of cells expressing the immunoreceptor of the invention.
The present invention provides a method, comprising a step of binding the antigen-binding protein of the invention to cells expressing the immunoreceptor in accordance with the invention.
In one embodiment, the method of the invention is used for purification of cells expressing the immunoreceptor of the invention. In this embodiment said cells are incubated with a primary antibody which is an antigen-binding protein in accordance with the invention, under conditions which allow the primary antibody to bind to the immunoreceptor expressed on the cells' surface, and subsequently said cells are purified by means of separating antibody-bound cells from non-antibody bound cells. In one embodiment, incubation further comprises incubating said cells with an entity capable of binding to the antibody. In a preferred embodiment, the entity is a secondary antibody, preferably labelled with a fluorescent marker; or a bead, preferably a magnetic bead. In one embodiment, the primary antibody is labelled, preferably with a tag or a fluorescent dye. In a preferred embodiment, the separation is carried out by means of MACS or FACS.
In one embodiment, the method of the invention is used for depletion of cells expressing the immunoreceptor of the invention. In this embodiment, said cells are incubated with an antigen-binding protein in accordance with the invention which is coupled to a cytotoxic molecule. In one embodiment, the antigen-binding protein is comprised in a chimeric antigen receptor expressed by another cell, preferably a T cell.
In one embodiment, the method of the invention is used for stimulation of cells expressing the immunoreceptor of the invention. In this embodiment, said cells are incubated with an antigen-binding protein in accordance with the invention, thereby stimulating said cells. In a preferred embodiment, the antigen-binding protein is coupled to a solid phase. In a preferred embodiment, the solid phase is a tissue culture surface. In a preferred embodiment, the solid phase is a bead, preferably a magnetic bead. In one embodiment, the antigen-binding protein is expressed on the surface of another cell.
In one embodiment, the method of the invention is used for expansion of cells expressing the immunoreceptor of the invention. In this embodiment, said cells are incubated with an antigen-binding protein in accordance with the invention, thereby increasing proliferation and thus expanding said cells. In a preferred embodiment, the antigen-binding protein is coupled to a solid phase. In a preferred embodiment, the solid phase is a tissue culture surface. In a preferred embodiment, the solid phase is a bead, preferably a magnetic bead. In one embodiment, the antigen-binding protein is expressed on the surface of another cell.
The invention provides a method of enrichment of cells expressing the immunoreceptor in accordance with the invention, comprising the steps of stimulating or expanding the cells using the stimulation method of the invention and subsequently purifying said cells using the purification method of the invention.
In one embodiment, the method or use of the invention is an in vitro use or method. In one embodiment, the method or use of the invention is an in vivo use or method. In one embodiment, the method or use of the invention does not comprise a method for treatment of the human or animal body by surgery or therapy or a diagnostic method practised on the human or animal body.
The present invention provides a pharmaceutical composition, comprising the antigen-binding protein of the invention.
The present invention provides a pharmaceutical composition, comprising the nucleic acid of the invention.
The present invention provides a pharmaceutical composition, comprising the cells expressing the immunoreceptor of the invention.
The pharmaceutical composition of the invention can further comprise a pharmaceutically acceptable carrier, and/or excipient. The pharmaceutical composition can further comprise additional active ingredients. In a preferred embodiment, the pharmaceutical composition is useful for therapy.
The present invention provides the antigen-binding protein or pharmaceutical composition comprising same in accordance with the invention for use in a therapeutic method of depletion of cells expressing the immunoreceptor of the invention. In the method, the antigen-binding protein coupled to a cytotoxic molecule, or cells expressing the antigen-binding protein as part of a chimeric antigen receptor, optionally comprised in a pharmaceutical composition, are administered to a patient which has been administered the cells expressing the immunoreceptor of the invention, in order to deplete said cells.
The present invention provides a kit, comprising the immunoreceptor of the invention and the antigen-binding protein of the invention. The present invention provides a kit, comprising cells comprising a nucleic acid encoding the immunoreceptor of the invention and the antigen-binding protein of the invention.
TGACCATCAGCTGCAGAGCCAGCCAGGACATCAGCAAGTACCTGAACTGGTATCAGCAGAAACCCGACGGCA
CCGTGAAGCTGCTGATCTACCACACCAGCAGACTGCACAGCGGCGTGCCCAGCAGATTTTCTGGCAGCGGCTC
CGGCACCGACTACAGCCTGACCATCTCCAACCTGGAACAGGAAGATATTGCTACCTACTTCTGTCAGCAAGGC
AACACCCTGCCCTACACCTTCGGCGGAGGCACCAAGCTGGAAATCACCGAACTGAAAACCCCGCTTGGCGACA
CCACCCACACCTGTCCTAGATGTCCCGAACCCAAGAGCTGCGATACCCCCCCACCTTGCCCTAGATGCCCCGAG
CCTAAGTCCTGCGACACCCCTCCTCCATGCCCTCGGTGTCCTGAGCCTAAGAGCTGTGACACACCACCCCCCTG
CCCCAGATGTCCAGAGCCAAAATCTTGTGATACCCCTCCCCCCTGTCCCCGCTGCCCAGAACCCAAGTCCTGTG
ATACTCCACCTCCTTGTCCACGGTGCCCCGAAGTGAAACTGCAGGAAAGCGGCCCTGGACTGGTGGCCCCAAG
CCAGTCTCTGAGCGTGACCTGTACCGTGTCCGGCGTGTCCCTGCCTGACTATGGCGTGTCCTGGATCAGACAG
CCCCCCAGAAAGGGCCTGGAATGGCTGGGAGTGATCTGGGGCAGCGAGACAACCTACTACAACAGCGCCCTG
AAGTCCCGGCTGACCATCATCAAGGACAACTCCAAGAGCCAGGTGTTCCTGAAGATGAACAGCCTGCAGACCG
ACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCAGCTACGCTATGGACTACTGGGGCCA
GGGCACCAGCGTGACCGTGTCTAGCGAACTGAAAACCCCCCTGGGCGACACCACCCACACCTGTCCTAGATGT
CCGGAACCCAAGAGCTGCGATACCCCCCCACCTTGCCCCAGATGCCCCATGTTTTGGGTGCTGGTGGTCGTGG
GCGGAGTGCTGGCCTGTTACAGCCTGCTCGTGACCGTGGCCTTCATCATCTTTTGGGTCAAGCGGGGCAGAAA
GAAGCTGCTGTACATCTTTAAGCAGCCCTTCATGCGGCCCGTGCAGACCACCCAGGAAGAGGACGGCTGCTCC
TGCAGATTCCCCGAGGAAGAAGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCAGATCCGCCGACGCCCCT
GCCTATCAGCAGGGCCAGAACCAGCTATACAACGAGCTGAACCTGGGCAGACGGGAAGAGTACGACGTGCTG
GACAAGAGAAGAGGCCGGGACCCTGAGATGGGCGGAAAGCCCAGAAGAAAGAACCCCCAGGAAGGCCTGT
ATAACGAACTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGAATGAAGGGCGAGCGGCGGAG
AGGCAAGGGCCACGATGGACTGTATCAGGGCCTGAGCACCGCCACCAAGGACACCTATGACGCCCTGCACAT
GCAGGCCCTGCCCCCTAGACTCGAGGGCGGAGGCGAAGGCAGAGGCAGCCTGCTGACATGTGGCGACGTGG
GCGCCAGCCTGGGCGATAGAGTGACCATCAGCTGCAGAGCCAGCCAGGACATCAGCAAGTACCTGAACTGGT
ATCAGCAGAAACCCGACGGCACCGTGAAGCTGCTGATCTACCACACCAGCAGACTGCACAGCGGCGTGCCCA
GCAGATTTTCTGGCAGCGGCTCCGGCACCGACTACAGCCTGACCATCTCCAACCTGGAACAGGAAGATATTGC
TACCTACTTCTGTCAGCAAGGCAACACCCTGCCCTACACCTTCGGCGGAGGCACCAAGCTGGAAATCACCGAA
CTGAAAACCCCGCTTGGCGACACCACCCACACCTGTCCTAGATGTCCCGAACCCAAGAGCTGCGATACCCCCCC
ACCTTGCCCTAGATGCCCCGAGCCTAAGTCCTGCGACACCCCTCCTCCATGCCCTCGGTGTCCTGAGCCTAAGA
GCTGTGACACACCACCCCCCTGCCCCAGATGTCCAGAGCCAAAATCTTGTGATACCCCTCCCCCCTGTCCCCGCT
GCCCAGAACCCAAGTCCTGTGATACTCCACCTCCTTGTCCACGGTGCCCCGAAGTGAAACTGCAGGAAAGCGG
CCCTGGACTGGTGGCCCCAAGCCAGTCTCTGAGCGTGACCTGTACCGTGTCCGGCGTGTCCCTGCCTGACTAT
GGCGTGTCCTGGATCAGACAGCCCCCCAGAAAGGGCCTGGAATGGCTGGGAGTGATCTGGGGCAGCGAGAC
AACCTACTACAACAGCGCCCTGAAGTCCCGGCTGACCATCATCAAGGACAACTCCAAGAGCCAGGTGTTCCTG
AAGATGAACAGCCTGCAGACCGACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCAGCT
ACGCTATGGACTACTGGGGCCAGGGCACCAGCGTGACCGTGTCTAGCGAACTGAAAACCCCCCTGGGCGACA
CCACCCACACCTGTCCTAGATGTCCGGAACCCAAGAGCTGCGACACCCCTCCACCTTGCCCAAGATGCCCCATG
TTCTGGGTGCTGGTGGTCGTGGGCGGAGTGCTGGCCTGTTATAGCCTGCTCGTGACCGTGGCCTTCATCATCTT
TTGGGTCAAGCGGGGCAGAAAGAAACTGCTGTACATCTTTAAGCAGCCCTTCATGCGGCCCGTGCAGACCACC
CAGGAAGAGGACGGCTGCTCCTGCAGATTCCCCGAGGAAGAAGAAGGCGGCTGCGAGCTGAGAGTGAAGTT
CAGCAGATCCGCCGACGCCCCTGCCTATCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCAG
ACGGGAAGAGTACGACGTGCTGGACAAGAGAAGAGGCCGGGACCCTGAGATGGGCGGAAAGCCCAGAAGA
AAGAACCCCCAGGAAGGCCTGTATAACGAACTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGG
AATGAAGGGCGAGCGGCGGAGAGGCAAGGGCCACGATGGACTGTATCAGGGCCTGAGCACCGCCACCAAGG
ACACCTATGACGCCCTGCACATGCAGGCCCTGCCCCCTAGACTCGAGGGCGGAGGCGAAGGCAGAGGCAGCC
Additional aspects and details of the invention are exemplified by the following non-limiting examples. In particular, the Examples were carried out as follows:
Human Subjects
T cells for CAR-modification were isolated from the peripheral blood of healthy donors. All participants provided written informed consent to participate in research protocols approved by the institutional review board of the University of Würzburg.
Cell Lines and cell Culture Media
Jeko-1, K562, MDA-MB231, Raji, MM.1S, T-47D and U266 (all ATCC, Manassas, Va., USA) and OPM-2 (DSMZ, Braunschweig, Germany) cells were maintained in RPMI-1640 medium containing 8% fetal calf serum (FCS), 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin (all components from Gibco, Thermo Scientific, Schwerte, Germany). K562_CD19, K562_CD20, K562_SLAMF7 and K562_ROR1 cells were generated by lentiviral transduction with full-length human CD19, CD20, SLAMF7 or ROR1, respectively. K562_IgG3_MiH5 were generated by lentiviral transduction with the CD19 CAR construct CD19_IgG3_MiH5 (described in ‘Generation of T cell section’). K562_ROR1/E3AK cells were generated by lentiviral transduction with a truncated form of human ROR1 protein (UniProtKB-Q01973, aa 312-440) carrying an inflexible linker (AEAAAKA)16 introduced between aa 391 and 392. MDA-MB231_hROR2 cells were generated by lentiviral transduction with full-length human ROR2. All tumor cell lines were transduced with a lentiviral vector encoding a firefly luciferase (ffluc)/green fluorescent protein (GFP) transgene to enable detection by flow cytometry (GFP) and bioluminescence imaging (ffLuc) in mice, and to use it for bioluminescence-based cytotoxicity assays. T cells were maintained in RPMI-1640 medium containing 8% human serum, 2 mM Glutamax, 0,1% β-mercaptoethanol and 100 U/mL penicillin/streptomycin (T cell medium; all components from Gibco), or, where stated, in X-VIVO™ 15 serum-free medium (Lonza, Basel, Switzerland, containing 2 mM Glutamax, 0,1% β-mercaptoethanol and 100 U/mL penicillin/streptomycin (Serum-free medium). T cell cultures were supplemented with 50 U/ml IL-2 (Proleukin, Novartis, Basel, Switzerland).
Generation of CAR T Cells
The vector design and experimental procedure have been described in a previous study17. In brief, peripheral blood mononuclear cells (PBMCs) of healthy donors were purified using Ficoll-hypaque density centrifugation in 50 mL LeukoSep tubes (Greiner Bio One), and CD4+ and CD8+ T cells were isolated using negative magnetic sorting (CD4+ and CD8+ T cell Isolation Kits, human, Miltenyi). T cells were stimulated with anti-CD3/CD28 magnetic beads (Dynabeads® Human T-Activator CD3/CD28, ThermoScientific) and genetically modified either by lentiviral transduction (epHIV7 lentivirus) or by non-viral Sleeping Beauty gene transfer. The CAR constructs used comprise the following: an antigen-specific single chain variable fragment derived from monoclonal antibodies; an IgG4 or IgG3 hinge-derived spacer; a CD28 transmembrane region; a 4-1BB_CD3ζ signaling module; and a truncated epidermal growth factor receptor (EGFR) transduction marker18. T cells were enriched for EGFRt+ using the anti-EGFR monoclonal antibody (mAb) Cetuximab (Merck, Darmstadt, Germany), that had been biotinylated in-house (EZ-Link™Sulfo-NHS-SS-Biotin, ThermoFisher Scientific, IL) according to the manufacturer's instructions) and anti-Biotin Microbeads (Miltenyi). Purified CAR T and non-transduced control T cells were expanded using a rapid expansion protocol7, 19 or—for CD19,CD20 and SLAMF7-CAR T cells—using antigen-specific stimulation with irradiated (80Gy) CD19+/CD20/SLAMF7+ feeder cells7, 19.
In a preferred embodiment of the invention, the chimeric antigen receptor is a CD19 CAR having the amino acid sequence of SEQ ID NO: 68. In a more preferred embodiment, the CD19 CAR having the amino acid sequence of SEQ ID NO: 68 can be expressed using the lentiviral vector having the nucleotide sequence of SEQ ID NO: 70, or using the Sleeping Beauty vector having the nucleotide sequence of SEQ ID NO: 69.
SEQ ID NO: 61 and 62 (CAR lentiviral backbone, 5′ and 3′ sequences before and after CAR insert, respectively)
SEQ ID NO: 63 and 64 (CAR Sleeping Beauty backbone, 5′ and 3′ sequences before and after CAR insert, respectively)
scFvs Used for CAR Generation
Codon optimized targeting domains comprising VH and VL segments of the following antibodies were synthesized (GeneArt ThermoFisher, Regensburg, Germany) and used as targeting domain for CAR constructs: CD19: FMC6320; CD20: Leu1621; SLAMF7: huLuc6322; ROR1: R1123 and 4-224; ROR2: 4-124; IgG3 Hinge: anti-MiH antibody #1 (this invention).
CD19 (FMC63) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 27, light chain chain variable domain having the amino acid sequence of SEQ ID NO: 28. CD20 (Leu16) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 30, light chain variable domain having the amino acid sequence of SEQ ID NO: 29. SLAMF7 (huLuc63) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 43, light chain variable domain having the amino acid sequence of SEQ ID NO: 44. ROR1 (R11) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 35, light chain variable domain having the amino acid sequence of SEQ ID NO: 36. ROR1 (4-2) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 33, light chain variable domain having the amino acid sequence of SEQ ID NO: 34. ROR2 (4-1) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 39, light chain variable domain having the amino acid sequence of SEQ ID NO: 40. anti-MiH #1 scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 19, light chain variable domain having the amino acid sequence of SEQ ID NO: 23.
Antibodies and Flow Cytometry
CAR-transduced (i.e. EGFRt+) T cells were detected by staining with the anti-EGFR monoclonal antibody Cetuximab (Merck, Darmstadt, Germany), or the anti-Her2 monoclonal antibody Trastuzumab (Roche, Penzberg, Germany) that have been conjugated to AF647 using the Alexa Fluor™ 647 Protein Labeling Kit (ThermoFisher).
Antibodies against CD19 (clone HIB19; AF647), CD20 (clone 2H7; PE, AF647, APC), SLAMF7/CD319 (clone 162.1; PE) from BioLegend (London, United Kingdom); CD4 (clone M-T466; VioBlue & PE-Vio770), CD8 (clone BW135/80; VioBlue & PE-Vio770), ROR1 (clone 2A2; PE & APC) from Miltenyi, ROR2 (polyclonal goat; BioTeche, Minneapolis, Minn., USA) as well as 7-AAD (BD Biosciences, Heidelberg, Germany) to exclude dead cells from analysis were used. The anti-MiH antibody #1 (characterized by a heavy chain variable domain having the amino acid sequence of SEQ ID NO: 19, and a light chain variable domain having the amino acid sequence of by SEQ ID NO: 23, and having a mouse IgG1 backbone) was synthesized by evitria (Zürich-Schlieren, Switzerland). Flow cytometric analyses were performed with a FACS Canto II (BD) machine and analyzed using FlowJo software (TreeStar, Ashland, Oreg.).
Functional analyses were performed as previously described5, 7, 25-27. In brief, target cells expressing firefly luciferase (ffLuc) were incubated in triplicate at 5×103 cells/well with effector T cells at various effector to target (E:T) ratios. Luciferin substrate was added to the co-culture and the decrease in luminescence signal in wells that contained target cells and T cells was measured using a luminometer (Tecan, Männedorf, Switzerland) and compared to target cells alone. Specific lysis was calculated using the standard formula. For analysis of cytokine secretion, 5×104 T cells were plated in triplicate wells with target cells at a ratio of 4:1 and IFNγ and IL-2 production were measured by ELISA (Biolegend) in supernatant removed after 24-hour incubation. For analysis of proliferation, 5×104 T cells were labeled with 0.2 μM carboxyfluorescein succinimidyl ester (CFSE, ThermoFisher), washed and plated in triplicate wells with target cells at a ratio of 4:1 in medium without exogenous cytokines. After 72-hour incubation, cells were stained with anti-CD8/CD4 mAb and 7-AAD to exclude dead cells from analysis. Samples were analyzed by flow cytometry and division of live T cells assessed by CFSE dilution.
Analysis of CAR T Cell Function In Vivo
All experiments were approved by the competent Institutional Animal Care and Use Committees. NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice (female, 6-8 week old) were purchased from Charles River (Sulzfeld, Germany) or bred in-house. Mice were inoculated with 1×106 ffluc_GFP+ tumor cells by tail vein injection on day 0 and randomly allocated to treatment and control groups. On day 7, mice received a single dose of 5×106 T cells (i.e., 2.5×106 CD4+ and 2.5×106 CD8+ in 200 μL of PBS/0.5% FCS) by tail vein injection. Tumor progression/regression was assessed by serial bioluminescence imaging following i.p. administration of D-luciferin substrate (0.3 mg/g body weight) (Biosynth, Staad, Switzerland) using an IVIS Lumina imaging system (PerkinElmer, Waltham, Mass., USA). The data were analyzed using LivingImage software (PerkinElmer).
Targeting the Multi-Function Site In Vitro
Comparison of sorting efficiency was conducted by mixing 1×106 CAR T cells and 1×106 untransduced control T cells and labelling with anti-MiH antibody #1 or anti-EGFR antibody (Cetuximab, Merck, Darmstadt, Germany), that have been biotinylated in-house (EZ-Link™Sulfo-NHS-SS-Biotin, ThermoFisher Scientific, IL) according to the manufacturer's instructions, and anti-Biotin Microbeads (Miltenyi), followed by purification via the MACS system using LS columns (Miltenyi). Negative and positive fractions were stained with antibodies against CD4, CD8 and EGFRt; 123Count eBeads (ThermoFisher), were added directly before the measurement. In the following flow cytometric analysis, per sample, 1000 123count eBeads were taken up to allow a quantitative comparison of the yield.
For antigen-independent, but CAR-specific activation and expansion using plate-bound antibody, 5×104 T cells were plated in triplicate wells on 96 well plates precoated with 5 μg/mlanti-MiH antibody #1 and cultured in Serum-free medium either for 24 h followed by flow cytometric analysis of CD25 and CD69 expression, or for 7 days for expansion assays, followed by counting of the cells.
For analysis of proliferation in response to anti-MiH antibody #1-coupled Beads or K562 carrying the Anti-CAR, 5×104 T cells were labeled with 0.2 μM carboxyfluorescein succinimidyl ester (CFSE, ThermoFisher), washed and plated in triplicate wells with DynaBeads® (coupled with anti-CD3/anti-CD28, anti-MiH antibody #1, anti-MiH antibody #1+anti-CD28, anti-MiH antibody #1+anti-4-1BB) at a Bead:T cell ratio of 1.6:1 or target cells at a ratio of 4:1 in Serum-free medium without exogenous cytokines. After 72-hour incubation, cells were labeled with anti-CD8/CD4 mAb and 7-AAD to exclude dead cells from analysis. Samples were analyzed by flow cytometry and division of live T cells assessed by CFSE dilution.
For assessing the potential of depleting cells using a anti-MiH antibody #1-derived antibody drug-conjugate (ADC), 5×104 T cells were plated in triplicate wells and treated with different concentrations of anti-MiH antibody #1 that was conjugated to an anthracycline-based cytotoxic payload (NBE Therapeutics, Basel, Switzerland). Cells were cultivated in Serum-free medium in the presence of 50 IU IL-2 for 72 h, washed and stained with antibodies against CD4, CD8 and EGFRt as well as 7AAD; 123Count eBeads (ThermoFisher), were added directly before the measurement. In the following flow cytometric analysis, per sample, 1000 123count eBeads were taken up to allow a quantitative comparison of cytotoxic effects.
Targeting the Multi-Function Sites In Vivo
For in vivo tracking, CD4+ T cells were transduced with the advanced version of the IgG3-based CD19 CAR (CD19_IgG3_MiH5/MiH1) as well as with a ffluc_GFP fusion protein, enriched and expanded as above.
NSG mice (female, 6-8 week old, purchased from Charles River (Sulzfeld, Germany) were inoculated with 4.5×106 ffluc_GFP+ CART cells by tail vein injection on day 0. At day 8, half of the mice were treated with 100 μg of anti-MiH antibody #1 ADC (approximately 4.5 mg/kg bodyweight). At d11, T cells were restimulated with irradiated K562 cells equipped with an anti-MiH antibody #1-based Anti-CAR (1×106 irradiated K562 cells per mice). Kinetics of T cell persistence was assessed by serial bioluminescence imaging following i.p. administration of D—luciferin substrate (0.3 mg/g body weight) (Biosynth, Staad, Switzerland) using an IVIS Lumina imaging system (PerkinElmer, Waltham, Mass., USA). The data were analyzed using LivingImage software (PerkinElmer).
For analysis of in vivo proliferation, CD4+ T cells were transduced with the advanced version of the IgG3-based CD19 CAR (CD19_IgG3_MiH5/MiH1), enriched and expanded as above and labeled with 5 μM of the proliferation dye eFluor 670 (ThermoFisher) according to the manufacturer's instruction.
NSG mice (female, 6-8 week old, purchased from Charles River, Sulzfeld, Germany) were inoculated with 4.5×106 CAR T cells by tail vein injection on day 0. Groups of n=5 mice received irradiated stimulatory cells (either K562 or K562_Anti-CAR) subsequently at different time points per tail vein injection as indicated. At d4 after T cell transfer, mice were sacrificed, bone marrow cells were isolated, stained with antibodies against CD4, CD45 and EGFRt and subjected to flow cytometric analysis as above. CD45+/CD4+/EGFR+ bone-marrow derived T cells were analyzed for eFluor 670 dilution.
The inventors generated an IgG3 Hinge-based CAR spacer library, in which scFv and transmembrane domain are connected by variants of the human IgG3 Hinge domain. This naturally consists of upper hinge (12 aa, ELKTPLGDTTHT, SEQ ID NO: 2), middle hinge (50 aa, CPRCP, SEQ ID NO: 59+3 repeats of EPKSCDTPPPCPRCP, SEQ ID NO: 1) and lower hinge (8 aa, APELLGGP, SEQ ID NO: 60), leading to a total spacer size of 70 aa for this wild-type spacer termed IgG3_UMLH (upper, middle and lower hinge). From that the inventors constructed variants consisting of upper hinge, the start of the middle hinge (CPRCP, SEQ ID NO: 59) and 0-10 copies of the EPKSCDTPPPCPRCP motif (SEQ ID NO: 1) leading to spacer domains spanning 17 to 167 aa in 15 aa steps named IgG3_MiHO to IgG3_MiH10 (
A first set of experiments was conducted using the well-characterized CD19 scFv FMC637. Five IgG3 Hinge variants (IgG3_MiH1, IgG3_MiH2, IgG3_MiH3, IgG3_MiH4 and IgG3_MiH5) were compared to the optimized IgG4-based construct pJ02459 containing a short spacer from IgG4 (12 aa) in CD8+ bulk T cells. All other parts of the CARs were constructed in the same way (same scFV, CD28 transmembrane domain, 4-1BB and CD3 signaling domains). In functional in vitro assays, all variants showed a comparably strong specific proliferation upon encounter of CD19-expressing target cells. In contrast to that, variants IgG3_MiH1 and IgG3_MiH2 displayed a pronounced cytotoxic effect similar to that of the IgG4 CAR, while cytolysis was reduced for longer IgG3 variants. A similar outcome was observed for cytokine production: IgG3_MiH1 and the IgG4 variant led to highest secretion of IFNγ, all longer IgG3 variants secreted less (
A second set of experiments compared IgG3 variants of the ROR1 CARs R11 and 4-2 to their best-working IgG4 version (long IgG4 spacer for R11, short IgG4 spacer for 4-2).
In case of the 4-2 scFv which is targeting a membrane-distal epitope of ROR124, the IgG3_MiH1 variant and IgG4 showed comparable proliferation, cytotoxicity and cytokine secretion upon antigen encounter, while IgG3_MiH3, IgG3_MiH5 and IgG3_UMLH exhibited reduced antitumor responses (
In contrast, the IgG3_MiH1 variant of the R11 scFv, which is targeting a membrane-proximal epitope of ROR17, does not induce antigen-specific proliferation upon encounter of ROR1+ target cells. While IgG3_MiH2, IgG3_MiH4 and IgG3_MiH5 display specific proliferation, the optimum seems to be induced by IgG3_MiH3, in a similar manner as the IgG4 variant, suggesting that the sweet spot for IgG3 spacer length of this scFV is located at three repeats (
Interestingly, the inability of IgG3_MiH1 to induce antigen-dependent T cell effector functions is not caused by steric inability to bind the epitope in the target molecule but is caused by a spacer length insufficient to reach the epitope: when the kringle domain, bearing the targeting epitope of R117, is moved further away from the tumor cell membrane by introducing a small, inflexible A(EAAAK)A linker28 between transmembrane and kringle domain (
These results prove in general that the hinge domain of IgG3 is an effective option for the use as flexible spacer in CAR T cells offering a greater variability to optimize the interaction of scFV and target molecule.
To extend the proof of function to other targets, the inventors investigated IgG3 variants (IgG3_MiH1-IgG3_MiH5) of CARs equipped with the CD20-specific scFv Leu16. As this was reported to target a membrane-proximal epitope of CD2029, consequently, a longer IgG4-based spacer (Hinge-CH2-CH3) proved to be the optimal IgG4 format. Surprisingly, this does not translate to IgG3-based spacers one-to-one. Interestingly, the shortest IgG3 variant (IgG3_MiH1) showed the best proliferation upon antigen encounter, thereby surpassing the IgG4 variant by a wide margin, while longer IgG3 variants proliferated much less (
This example illustrates the great flexibility of the IgG3 spacer, as even the shortest version (32aa) seems to be able to bind to relatively membrane-proximal epitopes, whereas a short IgG4 spacer (12 aa) was found to be inferior to a longer one (228 aa)29.
Next, the investigators examined IgG3 variants (IgG3_MiH1-IgG3_MiH5, IgG3_UMLH) of CARs based on the SLAMF7-specific scFv huLuc63. As the inventors previously reported, huLuc63 IgG4 CARs work best when engineered to have a long IgG4 spacer (Hinge-CH2-CH3)30. Surprisingly, the shortest spacer variant investigated (IgG3_MiH1) showed the highest level of antigen-specific proliferation, outperforming the IgG4 variant equipped with a long IgG4-based spacer (Hinge-CH2-CH3). All CAR variants led to profound antigen-specific cytotoxicity and cytokine secretion. Even though none of the IgG3 variants could reach the level of IgG4 for killing of the SLAMF7 expressing myeloma cell line MM.1S, IgG3 variants equipped with 1, 2 or 3 IgG3_MiH repeats led to profound cytolysis. In regard of IFNy secretion, the IgG3_MiH1 IgG3 variant led to the highest secretion with IgG3_MiH2 equaling the IgG4 variant right behind (
In another example, the inventors constructed IgG3-based spacer variants (IgG3_MiH1, IgG3_MiH3, IgG3_MiH5, IgG3_UMLH) of CARs carrying the ROR2-trageting scFv 4-1, which the inventors previously reported to work better when quipped with a longer IgG4 spacer (Hinge-CH2-CH3) as compared to the shorter one (Hinge only)24. IgG3_MiH1 outperforms the IgG4 variant (IgG4 long) in specific proliferation and cytokine secretion (IFNγ) upon encounter of the antigen, while both variants display equal cytotoxic capacity. In contrast, the longer IgG3 variants (IgG3_MiH3, IgG3_MiH5, IgG3_UMLH) show reduced levels of proliferation, cytokine secretion and especially cytotoxicity with IgG3_MiH5 being the least functional one investigated (
To translate the investigator's in vitro results to an in vivo model, 1×106 CD19+ Raji tumor cells were engrafted in NSG mice that were treated 7d after tumor engraftment with 5×106 CD8+ bulk T cells. T cells comprising the IgG3_MiH5 variant exhibited no beneficial effect on tumor growth and survival as compared to unmodified control T cells. While the IgG3_MiH3 variant slightly slowed down the increase in tumor burden and led to a not significant increase in survival, the IgG3_MiH1 variant and the IgG4 CAR led to complete eradication of the tumor. Though tumor cells eventually grew out in all mice, the IgG3_MiH1 variant delayed this outgrow and led to a significantly prolonged survival rate as compared to the IgG4 variant (
No immunogenicity against the IgG3 hinge was observed in mice (similar counts of T cells equipped with either IgG4 or IgG3-based spacers were detectable until the end of the experiment 35 days after T cell infusion), making it possible to study in vivo function of IgG3 Hinge variants of CAR T cells without the need for further modifications (e.g. removal of FcRγ binding sites, as for IgG426) (
Another mouse experiment was performed applying ROR1-specific CAR T cells equipped with the R11 scFV in mice engrafted with Jeko-1 for 7d. While neither the IgG4 spacer variant, nor IgG3 variants IgG3_MiH1 and IgG3_MiH4 influenced Jeko-1 tumor growth and survival of the treated animals, IgG3_MiH3 and especially IgG3_MiH2 led to attenuated tumor growth and prolonged animal survival (
In summary, these in vivo data confirm the suitability and functionality of CARs with IgG3 Hinge-based spacer domains elaborated in in vitro experiments previously.
The inventors identified an antibody (termed anti-MiH antibody #1, characterized by a heavy chain variable domain having the amino acid sequence of SEQ ID NO: 19, and a light chain variable domain having the amino acid sequence of SEQ ID NO: 23) specifically targeting the IgG3_MiH repeats of human IgG3 and aimed to use this to utilize additional antigen-independent though CAR-specific functions.
Since the inventors found proper binding of the antibody only from 3 or more IgG3_MiH repeats (
To exclude that the introduction of this multi-function site between scFv heavy and light chain (“advanced format”) impairs the antigen binding and thereby functionality of the CAR, the inventors compared CD19 CAR T cells engineered in the advanced IgG3 format to the optimal first generation IgG3 variant and the IgG4 reference CAR. No obvious differences occurred for in vitro proliferation, cytotoxicity and cytokine production between any of the variants (
First, the inventors attempted to use the multi-function sites for purification of CAR-positive T cells. Therefore, the inventors compared their IgG3_MiH-specific antibody to an antibody targeting the well-established EGFRt (truncated epidermal growth factor receptor; included in the CAR transgene cassette, separated from the CAR by a T2A cleavage site) in the ability to purify CAR T cells from a 1:1 mixture of CART and untransduced T cells. While purification via EGFRt worked equally well for IgG4 and all IgG3_MiH variants (IgG3_MiH1-IgG3_MiH5), leading to purities of ˜90%, purification via the IgG3 Hinge achieved good purity only for 3 or more IgG3_MiH repeats. While for the longer IgG3_MiH variants, the cell products were comparable in purity, purification via IgG3_MiH lead to reduced yield of cells after purification (
These reduced levels in yield as compared to purification via EGFRt persisted, even after introduction of a second multifunction site between scFv VH and VL in the advanced format: while allowing to receive a highly pure cell population after sorting, the yield still falls behind EGFRt, also for the advanced IgG3-based CARs (
Activating CAR-modified T cells antigen-independently but CAR specifically offers the opportunity to expand these to large numbers in vitro without the need for irradiated feeder cells or bulk T cell activation by targeting CD3 and CD28. An additive beneficial effect is that the purity of the transgenic cell product is thereby increased without the need to manually enrich the cells. Therefore, the inventors investigated the ability of plate-bound IgG3 Hinge-specific anti-MiH antibody #1 to activate CAR T cells with IgG3-derived spacer domains. In good concordance with results obtained for purification, the antibody failed to induce upregulation of the T cell activation markers CD25 and CD69 for the IgG3_MiH1 variant. In contrast, both molecules were upregulated significantly in the IgG3_MiH3 and IgG3_MiH5 variants, with the 5 repeat variant being even more responsive (
These findings also correlated with the ability of the antibody to induce proliferation and expansion in CAR T cells equipped with spacers carrying 3 or more IgG3_MiH repeats. The presence of IgG3_MiH3 lead to a more than two-fold increase in CAR T cell numbers after 7 days of stimulation, 4 or more repeats resulted in a 4-fold expansion after one week (
In search for methods allowing specific stimulation that are more feasible than using precoated antibody, the inventors conjugated their IgG3 Hinge-specific antibody to magnetic beads (ThermoFisher)Dynabeads®, alone or in combination with a-CD28 or α-4-1BB costimulatory antibodies and compared these to the well-established α-CD3/α-CD28 Dynabeads®(ThermoFisher Dynabeads®Human T Activator). In addition, the inventors generated a CAR with IgG4-derived spacer equipped with anti-MiH antibody #1 scFv as targeting domain and stably introduced this ‘Anti-CAR’ in K562 cells (
While α-CD3/α-CD28 Dynabeads®were able to induce proliferation in CAR T cells carrying a IgG3_MiH1 spacer, Beads coupled with anti-MiH antibody #1 or irradiated K562 with Anti-CAR had no stimulatory effect (
These results prove that especially CAR T cells carrying the advanced IgG3 format can be efficiently activated and expanded to large numbers antigen-independent but CAR-specific.
Even though an EGFRt safety switch is included in all CAR transgene cassettes described in this invention, having the possibility of a second option of intervention is highly wanted for the management of potential life-threatening toxicities that may occur upon CAR T cell treatment. Therefore, the inventors conjugated their IgG3 Hinge-specific antibody to a cytotoxic payload to obtain an antibody-drug-conjugate (ADC) that is capable of directly targeting the CAR itself. While already a concentration of 50 ng/ml shows a slight cytotoxic effect on CAR T cells with the IgG3_MiH5 variant, only 5 μg/ml led to a near-complete elimination of all cells equipped with a IgG3_MiH4 or IgG3_MiH5 variant after 3 days of culture. The IgG3_MiH3 variant showed at least a more than half reduction at 5 μg/ml. The highest concentration investigated (10 μg/ml) seems to mediate also unspecific effects, as the number of viable IgG4 Spacer CART cells did also decrease (
Similar results were obtained when investigating the effects on CAR T cells carrying the advanced IgG3 spacer format: while the first generation IgG3 spacer variant for CD19 (1 IgG3_MiH repeat) was not susceptible to specific ADC effects even at 10 μg/ml, the advanced version showed a 60% reduction at 500 ng/ml and a near-complete elimination at 5 μg/ml (
The CD20-specific CAR Leu16 (carrying 3 IgG3_MiH repeats in its spacer domain) showed overall a slightly weaker response to the ADC, with the advanced IgG3 version responding to 500 ng/ml while the majority of cells was eliminated at f.c. 5 μg/ml (
For CARs with the ROR1-specific scFV R11, equipped with 3 IgG3_MiH repeats, already 500 ng/ml showed a strong effect, that was further pronounced at 5 μg/ml and led to near-complete elimination of all cells (
These results prove the potency of an ADC-based way of CAR T cell elimination.
Another potential option for CAR T cell depletion would be to target unwanted IgG3 Hinge-based CAR t cells with other T cells equipped with the before-mentioned Anti-CAR (spacer derived from IgG4 Hinge). In cytotoxicity experiments targeting K562 cells transduced with a IgG3_MiH5 IgG3 CAR, specific recognition and elimination of these target cells was mediated by T cells carrying the Anti-CAR (
Next, the inventors checked whether depletion would be also possible in vivo. Therefore, the inventors used CD4+ T cells transduced with the advanced IgG3 format version of the CD19 CAR (CD19_IgG3_MiH5/MiH1) together with a firefly luciferase/GFP fusion protein, allowing bioluminescent imaging of the T cells in mice. T cells were inoculated and had engrafted by day 7 mainly in the bone marrow. At day 8, half of the mice were treated with 100 μg of anti-MiH antibody #1 ADC (approximately 4.5 mg/kg bodyweight). While the overall luminescence signal was slowly reducing, the mice in the ADC-treated group showed significantly lower radiance. The difference between the two groups was further increased when all mice were subjected to restimulation using irradiated K562 cells equipped with the before mentioned anti-MiH antibody #1-based Anti-CAR (1×10{circumflex over ( )}6 irradiated cells per mice) at day 11. This finally led to a significant 2.4-fold reduction in bioluminescence signal (and thereby T cell count) at the end of the experiment at day 18 (
Next, the inventors examined whether induction of proliferation can be achieved in vivo. Therefore, the inventors used CD4+ T cells transduced with the advanced IgG3 format version of the CD19 CAR (CD19_IgG3_MiH5/MiH1) and labeled with the proliferation dye eFluor 670. T cells were inoculated and animals were additionally treated subsequently with 3×10{circumflex over ( )}6 irradiated K562 or K562_Anti-CAR cells at different time points. One group of mice (n=5 animals per group) received K562_Anti-CAR cells at the day of T cell injection (d0), 3 h after T transfer. A second group received an additional dose of irradiated K526_Anti-CAR cells at d3 post T cell injection (d0+d3), two other groups were treated with irradiated K562_Anti-CAR cells at day 1 post T cell transfer (d1) or at d1+d3, respectively. A control group received irradiated K562 cells at d0+d3. At day 4 post T cell transfer, mice were sacrificed and T cells from the bone marrow cells were collected and analyzed for eFluor 670 dilution. T cells from all groups showed proliferation to some extent. While mice treated with K562_Anti-CAR at d1 or d1+d3 or treated with K562 exhibited a lower proliferation rate, mice that received K562_Anti-CAR cells at d0 showed a much more pronounced rate of eFluor 670 dilution. Best proliferation was achieved after treatment with K562_Anti-CAR cells at d0+d3 (
The following additional Examples were carried out in the same way as the previous examples, with the following additions:
Cell Lines and Cell Culture Media
MV4-11, MOLM-13 (all ATCC, Manassas, Va., USA), as well as TM-EBV-LCL35 (a kind gift from Fred Hutchinson Cancer Research Center, Seattle, Wash., US) cells were maintained in RPMI-1640 medium containing 8% fetal calf serum (FCS), 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin (all components from Gibco, Thermo Scientific, Schwerte, Germany).
scFvs Used for CAR Generation
Codon optimized targeting domains comprising VH and VL segments of the following antibodies were synthesized (GeneArt ThermoFisher, Regensburg, Germany) and used as targeting domain for CAR constructs: FLT3: 4G832, BV1034, Siglec-6: JML-131.
FLT3 (BV10) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 45, light chain variable domain having the amino acid sequence of SEQ ID NO: 46.
FLT3 (4G8) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 47, light chain variable domain having the amino acid sequence of SEQ ID NO: 48.
Siglec-6 (JML-1) scFv: heavy chain variable domain having the amino acid sequence of SEQ ID NO: 49, light chain variable domain having the amino acid sequence of SEQ ID NO: 50.
Antibodies and Flow Cytometry
Antibodies against Siglec-6 (clone REA852; APC) from Miltenyi, FLT3 (clone 4G8; AF647) from BD Biosciences (Heidelberg, Germany), and Siglec-6 (767329; PE) from BioTeche, Minneapolis, Minn., USA) were used.
Targeting the Multi-Function Site In Vitro
For antigen-independent though CAR-specific expansion, 5×105 CAR T cells were co-cultured together with 5×106 TM-EBV-LCL or K562_Anti-CAR cells, that have been irradiated to 80 Gy using a gamma irradiator, in X-VIVO™ 15 serum-free medium in the presence of 50 IU IL-2 for 14 days.
Targeting the Multi-Function Sites In Vivo
For in vivo tracking, CD8+ T cells were transduced with the advanced version of the IgG3-based CD19 CAR (CD19_IgG3_MiH5/MiH1) as well as with a ffluc_GFP fusion protein, enriched and expanded as above.
For ADC-Depletion, NSG mice (female, 6-8 week old, purchased from Charles River (Sulzfeld, Germany) were inoculated with 4.5×106 ffluc_GFP+ CAR T cells by tail vein injection on day 0. At day 8, half of the mice were treated with 100 μg of anti-MiH antibody #1 ADC (approximately 4.5 mg/kg bodyweight). At d11, T cells were restimulated with irradiated K562 cells equipped with an anti-MiH antibody #1-based Anti-CAR (1×106 irradiated K562 cells per mice). Kinetics of T cell persistence was assessed by serial bioluminescence imaging following i.p. administration of D-luciferin substrate (0.3 mg/g body weight) (Biosynth, Staad, Switzerland) using an IVIS Lumina imaging system (PerkinElmer, Waltham, Mass., USA). The data were analyzed using LivingImage software (PerkinElmer).
For Anti-CAR-T cell mediated depletion, NSG mice (female, 6-8 week old, purchased from Charles River, Sulzfeld, Germany) per group were inoculated with 2.2×106 Target T cells (ffluc+GFP++anti-CD19-CAR CD19_MiH5/MiH1; (CD4+:CD8+ ratio 1:1) and treated after 24 h with 4×106 CD8+ Anti-CAR-CAR T cells or untransduced control T cells from the same donor. Serial bioluminescence imaging was conducted to assess T cell persistence/depletion in each treatment group following i.p. administration of D-luciferin substrate using an IVIS Lumina imaging system. The data were analyzed using LivingImage software.
For analysis of in vivo proliferation, CD4+ and CD8+ T cells were transduced with the advanced version of the IgG3-based CD19 CAR (CD19_IgG3_MiH5/MiH1), enriched and expanded as above and labeled with 5 μM of the proliferation dye eFluor 670 (ThermoFisher) according to the manufacturer's instruction or left unlabeled.
NSG mice (female, 6-8 week old, purchased from Charles River, Sulzfeld, Germany) were inoculated with indicated amounts of CAR T cells by tail vein injection on day 0. Groups of n=4-5 mice received irradiated stimulatory cells (either K562 or K562_Anti-CAR) subsequently at different time points per tail vein injection as indicated. Kinetics of T cell persistence/expansion was assessed by serial bioluminescence imaging following i.p. administration of D-luciferin substrate using an IVIS Lumina imaging system. The data were analyzed using LivingImage software. In some experiments, mice were sacrificed at d4 after T cell transfer, bone marrow cells were isolated, stained with antibodies against CD4, CD45 and EGFRt and subjected to flow cytometric analysis as above. CD45+/CD4+/EGFR+ bone-marrow derived T cells were analyzed for eFluor 670 dilution.
In an additional set of experiments, the inventors compared ROR1-specific CAR T cells (R11 scFv) engineered in the advanced IgG3 format to the optimal first generation IgG3 variant and a reference CAR in the widely applied CD8α setup (CD8α hinge and transmembrane domains)33. While advanced and first generation IgG3 variants showed a comparably good antigen-specific proliferation, the CD8α variant revealed only minor proliferative capacity. This weaker response of the latter also translated to a significantly reduced cytotoxicity and cytokine secretion while first generation and advanced IgG3 variants behaved similarly effective (
In an additional set of experiments, the inventors compared CD19-specific CAR T cells (FMC63 scFv) engineered in the advanced IgG3 format to the optimal first generation IgG3 variant and a reference CAR in the widely applied CD8α setup (CD8α hinge and transmembrane domains)33.
No obvious differences occurred for in vitro proliferation, cytotoxicity and cytokine production between first generation and advanced IgG3 variants of the CD19-specific CAR while the CD8α control variant revealed weaker responses (
The inventors investigated the cytotoxic capacity of T cells equipped with optimized IgG3 variants of additional CARs targeting ROR1 (4-2 scFv), FLT3 (4G8 and BV10 scFv) and Siglec-6 (JML-1 scFv) and compared them to CARs with the same scFvs constructed in the widely applied CD8α setup (CD8α hinge and transmembrane domains)33. All advanced IgG3 versions exhibited a significantly enhanced cytotoxic potential as compared to CD8α versions (
Next, the investigators aimed to examine whether the superiority of their advanced IgG3 CAR format over the CD8a control translated to a better antitumor efficacy also in vivo. Therefore, NSG mice were engrafted with 1×10{circumflex over ( )}6 ffluc/GFP+ Raji tumor cells and treated at d7 with 5×106 (1:1 CD8+:CD4+ ratio) control or CD19-specific CAR T cells. While treatment with the clinically used CD8α CAR led only to a slowdown in tumor growth and a moderately prolonged survival of the treated mice in comparison to the control T cell group, application of the advanced IgG3 format CAR T cells led to complete tumor eradication associated with significantly enhanced survival (
In search of methods for specific stimulation and expansion that are more feasible than precoated antibody, the investigators generated a CAR with IgG4-derived spacer equipped with anti-MiH1 scFv as targeting domains and stably introduced this ‘Anti-CAR’ in K562 cells. The inventors used irradiated K562 with Anti-CAR for T cell expansion and compared this to a well-established expansion protocol using irradiated TM-EBV-LCL feeder cells. Both, CD4+ and CD8+ T cells equipped with an advanced IgG3 version of the CD19-specific CAR exhibited similar expansion kinetics in the range of 250-fold expansion after 14 days with both protocols. In contrast, untransduced control T cells successfully expanded only when the TM-EBV-LCL feeder cell protocol+OKT3 was applied (
Next, the inventors tested, whether T cells can be activated in vivo. Therefore, NSG mice were inoculated with 1×107 GFP/ffluc+ CAR T cells (advanced IgG3 format), and after 8 days, mice were injected with 1×107 K562 or K562 with Anti-CAR. While BLI signal further decreased in the K562 treated mice, BLI signal was enhanced in the Anti-CAR treated mice (
The inventors equipped T cells with the before-mentioned Anti-CAR (spacer derived from IgG4 Hinge). In cytotoxicity experiments with T cells transduced with an advanced format IgG3 CAR as target cells, these were specifically recognized and eliminated by T cells carrying the Anti-CAR in an auto—as well as in an allogeneic setting (
Next, the investigators checked whether depletion would be also possible in vivo. Therefore, they used CD4+ and CD8+ T cells transduced with the advanced IgG3 format version of the CD19 CAR together with a firefly luciferase/GFP fusion protein, allowing bioluminescent imaging of the T cells in mice. Target T cells were inoculated, and 24 h later mice were treated at a 2:1 E:T ratio with either Mock or Anti-CAR CD8+ T cells. While overall luminescence signal was slowly reducing, the mice in the anti-CAR-treated group showed significantly lower radiance, thereby proving the significant reduction of the number of CAR T cells in vivo that could be used in a therapeutic setting if needed (
The immune cells for the uses according to the invention, as well as materials used for the methods of the invention, may be industrially manufactured and sold as products for the claimed methods and uses (e.g. for treating a cancer as defined herein), in accordance with known standards for the manufacture of pharmaceutical and diagnostic products. Accordingly, the present invention is industrially applicable.
| Number | Date | Country | Kind |
|---|---|---|---|
| 19181237.9 | Jun 2019 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2020/067124 | 6/19/2020 | WO |
