Patent Grant
11782011
The present invention relates to biosensors and methods for their use.
According to the present invention, there is presented the use of redox polymers such as PVI-Os(bpy)2 to carry reducible/oxidizable groups such as Os(bpy)2 complexes on their flexible side chains and the use of redox polymers in conjunction with redox enzymes and aptamers to achieve the development of ultra-sensitive electrochemical biosensors.
More specifically, a working electrode in an electrochemical cell is modified with the redox polymer by electro-crosslinking/depositing PVI-Os(bpy)2, amine-terminated capture aptamer (specific for a particular detection target is co-deposited with the redox polymer. Part of the capture aptamer (the binding sequence) is also complementary to part of a second ssDNA which is labeled with HRP (horseradish peroxidase), and the capture aptamer will form dsDNA with the HRP-labeled ssDNA and bring HRP into electrical contact with the redox polymer and the electrode. Prior to capturing the detection target, addition of H2O2 will lead to the highest reduction current due to the redox polymer-mediated, enzyme-amplified electroreduction of H2O2.
Alternatively, the electrode can be modified with the redox polymer hydrogel, PVI-Os(bpy)2, using a crosslinker such as poly(ethylene glycol) diglycidyl ether; i.e., PEGDGE. It is then followed by electrodeposition of amine-terminated capture aptamer.
The PVI-Os modified aptamer-sensing electrode (made with electrodeposition of PVI-Os or PESGDGE crosslinking) is immersed in a buffer solution (pH 7.4) containing the aptamer, and a negative potential (e.g. −1.4 V) (vs. Ag/AgCl) is applied for a certain amount of time, which allows the aptamer to be immobilized in the PVI-Os film. Then the electrode is immersed in a buffer solution containing HRP-labeled ssDNA which forms double helix with the immobilized capture aptamer. The electrode is then labeled with the enzyme HRP which catalyzes the electroreduction to H2O2 to water. A reduction current can be detected when H2O2 is present in the solution.
The effectiveness of the invention was demonstrated with detection of aflatoxin by immersing the above electrode sensor in a solution containing aflatoxins and H2O2. Binding of aflatoxin by the capture aptamer released some of the HRP-labeled ssDNA, leading to lowered reduction current which served as a measure of the level of aflatoxin. See
The redox polymer/aptamer/redox enzyme-modified electrode sensor of the invention is not limited to aflatoxins; by changing the aptamer, the electrode can be made sensitive to virtually any kind of toxins, biological molecules, even viruses and bacteria.
Poly (1-vinyl imidazole) (“PVI”) and osmium bipyridine complexes are prepared separately. Then, they are chemically derived into the Osmium-PVI (Nakabayashi et. al, 2001) polymer. Next, the chemical sensor electrode is made also using known methods from literature (Ohara et. al, 1993) and modified with catechol cross-linked with chitosan (Zhang et. al, 2012). The hydrogel PVIn-Os can function as a high conductor of electrons into the modified chemical sensor electrode. PVIn-Os polymers are highly water-soluble with redox potential of up to 200 mV. The voltammogram of this polymer has constant ΔEp (separation of peaks) value around 100 mV which shows that the electron diffusion kinetics is better than other similar films. These polymers form amperometric glucose sensors by linking with glucose oxidase (GOX). The procedures to make the above-mentioned chemicals are described in detail below.
Poly (1-vinyl imidazole) forms a group of hydrogels which have an adequate electron diffusion coefficient. This is used with an enzymatic electrode which can then conduct electrons through the gel's polymer network to the electrodes. In the preparation of PVI, the polymerization of 1-vinyl imidazole involves the bulk thermal polymerization using 2, 2′-azobis-isobutyronitrile (AIBN) as a radical initiator. For this purpose, a mixture containing 3 ml of 1-vinyl imidazole and 0.156 grams of AIBN is heated at 70° C. for one hour under an inert atmosphere of N2. The inert atmosphere may be created by flushing a gentle stream of N2 that displaces the oxygen existing in air. Such inert atmosphere is crucial to remove any traces of oxygen, which would otherwise react with existing radicals, inducing termination of the bulk radical polymerization process.
After heating is complete, a dark yellow precipitate of PVI is obtained with a yield of about 65.7%.
Purification of PVI
The synthesized polymer, once cooled down to room temperature, is dissolved in methanol and recrystallized by adding the solution dropwise to acetone while stirring vigorously with a magnetic bar. The solution is then filtered using vacuum filtration. The obtained final polymer, of a pale yellowish color, is purified PVI with a yield of about 34.4%.
The preparation of the osmium bipyridine complex may be carried out using known methods. The osmium (II) complex with PP (bpy, dmbpy), imidazole and Cl− can act as a much more efficient electron transfer mediators for glucose sensors.
Commercial (NH4) OsCl6 is heated with bipyridine at reflux for 1 hour using 1,2-ethanediol medium under an inert atmosphere and continuous magnetic stirring. 0.5 g of (NH4) OsCl6 is mixed with 0.356 g of PP (bpy in this case). The heat level is preferably kept at 9. The continuous stir level is preferably kept at 3. The reaction mixture is then allowed to cool down at room temperature. The cooled mixture is then treated with solution of 5.2 g of Na2S2O4 and 30 ml of water to reduce any osmium bipyridine ions that may have formed in the reaction mixture. The precipitate of dark violet-black color is collected after cooling for 30 min in ice bath. The associated chemical reaction is shown in
The osmium bipyridine complex precipitate may be further purified using vacuum filtration. The solid may be washed with water and then diethyl ether.
Alternative Method (Microwave) of Cis-[OsCl2(PP)2] Synthesis
According to an alternative method, the osmium bipyridine complex may be made according to a microwave method using 0.2 g of (NH4) OsCl6, 0.1424 g of PP and 4 ml of 1,2-ethanediol in a microwave container. The mixture may be heated using microwave at 200° C. for 20 min. The reaction mixture is allowed to cool down at room temperature afterwards. Then the cooled reaction mixture is treated with a solution of 2.6 g Na2S2O4 and 15 ml of water to reduce any osmium bipyridine ions that may have formed in the reaction mixture. The precipitate of dark violet-black color is collected after cooling for 30 min in ice bath. The precipitate may be purified by washing with water and diethyl ether. The cycle voltammetry ΔEp values for Os (II) complex are typically 56-65 mV indicating fast heterogeneous electron transfer potential in the complex. After the PVI and Os complex has been formed, the cross linking of Os-PVI is conducted using chemical derivatization of the redox polymer.
Preparation of the Chemically Derivatized Os-PVI Polymer
After filtration, the obtained polymer is subjected to chemical derivatization through the bonding of osmium. The chemical derivatization process involves the reaction of the synthesized polymer with Os(bpy)2Cl2. Briefly, this method involves the preparation of a mixture of 0.13 g of the vinyl imidazole polymer with a solution of 0.2 g of Os(bpy)2Cl2 in 10 ml ethanol and heating at reflux conditions for 72 hours. The mass required for PVI is calculated with molar calculations. The osmium bipyridine complex has the chemical formula of C20H16Cl2N4O5. The molecular weight is 573.506 g/mol. The number of moles required for 0.2 g of Os(bpy)2Cl2 to react with the PVI, the number of moles for osmium complex can was obtained as follows:
where N=4 (no. of molecules of compound). Therefore, m=n×M=0.0014×94=0.13 g of PVI.
The mixture is heated at 45° C. for three days. The chemical reaction is shown in
Following the heating, the reflux is complete, and the osmium bipyridine is complexed with the PVI. The final complex is shown in
The reflux may also be carried out using microwave assisted organic synthesis. In this case the mixture of 0.1 g of Os(bpy)2Cl2 and 0.065 PVI with 4 ml of ethanol is heated at 120° C. for one hour in the microSYNTH microwave system, significantly shortening the reflux time.
Dialysis of PVI-Os Complex
Dialysis may be performed for purification purposes to remove unwanted chemicals. This can also be performed to purify the PVI-Os complex. If performed, the following steps may be followed with reference to
Polishing Electrode
For the purposes of conducting CV studies, a properly polished electrode is essential. The electron transfer should not be interfered by the contaminants present in the electrode surface. The electrode may be polished according to any known method. Mechanical polishing may be carried out as follows:
After performing the steps described above, the electrodes can be used in their respective places in the electrochemical cell as working electrode and reference electrode.
Electrodeposition of PVI-Os Complex to the Electrode
The process of electrodeposition on the electrode depends on the scan rate. Higher the current, the higher the scan rate which is shown below.
Current∝Scan rate
Current∝√{square root over (Scan rate)}
The redox polymer can be electrodeposited using known electrodeposition methods. During electrodeposition, the current arranges random moving PVI-Os molecules on surface bound electrode in the presence of electrons and chloride ions as shown in
Preparation of the Chemical Sensor Electrode
According to an alternative method, the redox polymer can be crosslinked using a PEGDGE crosslinker. The electrode is then modified with the crosslinked polymer which forms a hydrogel in solution. This includes adding the PVI-Os complex to Poly (ethylene glycol) diglycidyl ether, i.e., PEGDGE together in solution. The PEGDGE structure (Peg 400) is shown in
The detailed procedures is as follows:
An example of an EC cell is shown in
Testing of Biosensor
The effectiveness of the biosensor of the present invention was demonstrated by detection of aflatoxin AFB1. The aptamer and HRP enzyme oligonucleotide were ordered from Integrated DNA Technologies (Iowa, USA). The sequence of the DNA-HRP that was used was /5HRPMD/AAAAAATGTGGGCCTAGCGA (SEQ.ID.No. 1) in an amount of 250 nmol. DNA-Amino (aptamer) was ordered in 2 batches of 1 μmole and 5 μmole with sequence /5AmMC12/AGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCAC A (SEQ.ID.No. 2) as ordered. The yield guarantee was different for these two batches with the first being 44 nmol and later being 219.8 nmol. The biosensor conditions were varied with different electrodes. The temperature was kept constant at 37° C. In the procedures for testing AF with the biosensor, only the amounts of AF were changed whereas the aptamer and DNA-HRP was kept constant. The following were the general procedures that were followed during testing of AF:
The respective electrode was crosslinked using PVI-Os and PEGDGE as described above. The crosslinked electrode was also tested using PBS using CV.
The aptamer that was obtained from external source was electrodeposited onto the electrode. This was also tested with CV and I-t studies. The voltage was kept at −1.4 V- and two-time conditions were applied: 5 min and 10 min. Later, the electrode was rinsed with water and tested with buffer two times using CV as well.
Incubation of HRP, AFB1 and PBS was done so that reaction could take place in solution. The electrode was kept inside the incubated solution for 20 min at 37° C. and tested again. Only the amounts of AFB1 were changed for the several test runs. The electrode was tested for CV at 0.6-0.2 V range. The amount of AFB1 that was used during the experiments ranged from 0.1 ng/mL to 100 ng/mL.
The electrode from the above step was put into H2O2 solution to measure the AF level. Also, CV test and I-t test were conducted. The reason for using H2O2 solution is that it leads to the highest reduction of current making the detection of AF faster.
Experiments utilizing four different electrodes (labeled) and AFB1 quantities are shown in table below:
During the testing, the aptamer quantity was kept constant at 10 μM and H2O2 was kept at 1 mM.
Results and Discussion
All electrochemical studies were performed using a CH Instrument Electrochemical analyzer in a single compartmental cell with a three-electrode configuration comprising a Pt wire as the auxiliary electrode, a glassy carbon electrode as the working electrode, and Ag/AgCl as the reference electrode. The CV profiles were obtained for the electrodeposition process, cross-linking and rhenium compounds interaction with DNA.
Data from Electrodeposition
During the electrodeposition of the redox polymer, several scan rates were utilized to obtain the voltammograms. There is dependence of the scan rate of the cyclic voltammograms with that of the completed electrodeposited polymer as scan rates were varied from 50 mV/s to 1000 mV/s. Results are shown in
It can be seen that as the scan rate increases so does the peak current; however, the peak separation remains almost constant, indicating a reversible process.
As shown in
Data from Cross Linking
The cross linking of the redox polymer via PEGDGE forms the electrical wire with which the electrons can be transferred from the target molecule with help of the solvent in the EC cell. This way there is higher sensitivity and freedom for the electrons to move. The CV graph at
As can be seen in
where,
or,
ip=(268,600)n3/2AD1/2Cv1/2
at 25° C. Although PVI-Os is crosslinked and deposited on the electrode surface, the redox species, the Os complex, still behaves like diffused species in a solution, unlike the case of electrodeposition where the Os complex behaves as surface-confined species. The reason for this is that with PEGDGE crosslinking PVI-Os forms a flexible and gigantic matrix, and upon hydration forms a micro-environment that is very similar to the bulk solution; Os complex inside the matrix therefore behave as diffusional species and follows the Randles-Sevcik equation. This also explains the excellent electron-conducting property of the PEGDGE-crosslinked PVI-Os polymer.
Data from AFB1 Tests
The last phase of testing consisted of testing aflatoxin AFB1 in the presence of aptamer and redox enzyme (HRP), the results of which are shown in
The electrode was then rinsed with PBS and immersed in PBS containing 1 mM H2O2, and while a potential of 0.1 V was applied the reduction current was recorded as shown in the above figure. The stabilized current (which should be obtained in about 3 min) was then used as a measure of the concentration of AFB1 in the sample. The background current was obtained using the sensor electrode (PVI-Os/aptamer-modified electrode) without the incubation step. Since no HRP-DNA was present to be captured by the aptamer, H2O2 would not be reduced at the electrode hence the detected current was extremely low, ˜5.5×10−8 A. The detection was based on a competitive model in which the immobilized aptamer could bind to both the HRP-oligo and AFB1. However, the binding between the aptamer and AFB1 is stronger than that between the aptamer and the HRP-oligo. When there was no AFB1 in the sample the amount of aptamer-bound HRP-oligo was the most, resulting in the highest reduction current of H2O2 (˜8.8×10−6 A). As the concentration of AFB1 increased in the sample, less HRP-oligo would be captured by the aptamer, leading to decreased reduction current. It can be clearly seen from the figure that higher amounts of AFB1 reduces the current generated from the analyte solution.
Comparing the working range of the tests conducted we can see from the data that anywhere from 0.01 ng/mL to 0.1 ng/mL of sensitivity of AFB1 samples can be detected using this novel method. In literature, working sensitivity level as low as 0.05 ng/mL has been reported for AFB1 on corn and paprika using extraction methods based in methanol-PBS and methanol-water, respectively. Therefore, the novel electrochemical immunosensor for AFB1 that is described here has higher sensitivity levels than previous biosensors. The novel method takes advantage of the aptamer-PBS solution to keep the detection of AFB1 to low levels as 0.01 ng/mL.
Biosensors were constructed using both electrodeposition and PEGDGE crosslinking. PEGDGE crosslinking resulted in sensors with larger reduction current and higher sensitivity.
As shown in
This invention was made with government support under Award Number NIH ULIGM118973 awarded by the National Institutes of Health. The U.S. government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 20020081588 | De Lumley-woodyear | Jun 2002 | A1 |
| 20170219572 | Kim | Aug 2017 | A1 |
| Number | Date | Country | |
|---|---|---|---|
| 20220057356 A1 | Feb 2022 | US |
| Number | Date | Country | |
|---|---|---|---|
| 63016369 | Apr 2020 | US |
