Universal peptide-binding scaffolds and protein chips

Information

  • Patent Grant
  • 7442773
  • Patent Number
    7,442,773
  • Date Filed
    Friday, January 21, 2005
    20 years ago
  • Date Issued
    Tuesday, October 28, 2008
    16 years ago
Abstract
The present invention provides a universal peptide-binding scaffold. This scaffold is used to bind a target. The target can be a peptide or peptides of interest (for example, peptides associated with a disease state) or can represent the entire proteome. The target can be either protein fragments prepared by enzymatic digestion of the entire proteome or N- or C-terminal short sequences exposed by chemical denaturation of the entire proteome (unfolded proteins). The universal peptide-binding scaffold can be tailored to specifically bind a target using the methods described herein.
Description
BACKGROUND OF THE INVENTION

Proteomic research is the study of all proteins in an organism and is expected to lead to discoveries leading to improved diagnosis and treatment of disease. One problem inherent in proteomics research is the requirement of a high throughput analysis of a large number of proteins. The most widely used protein analysis method is based on 2-D gel electrophoresis and mass spectrometry in which proteins are first separated on gels according to charge and size, and then identified by mass spectrometers. An alternative analysis method is based on isotopic labeling such as isotope-coded affinity tags (ICAT) and tandem mass spectrometry in which no protein separation is needed. Another analysis method is based on protein chips in which thousands of “bait” proteins such as antibodies are immobilized in an array format onto specially treated surfaces. Compared to the other two methods, protein chips have the advantage of being scalable, and their organized nature enables high throughput screening using robotic, imaging, or analytical methods. Protein chips are powerful tools for the genome-scale analysis of gene function, such as enzyme activity, protein-protein, protein-DNA, protein-RNA, and protein-ligand interactions, directly on the protein level. The main limitation in developing protein chips is the lack of a universal peptide-binding scaffold to create tailor-made protein capturing reagents that specifically bind to every single protein in a given organism.


Because of their high specificity and affinity to proteins, monoclonal antibodies have been widely considered for use as protein capturing reagents of choice for protein chips. Several antibody-based low-density protein chips have been developed. However, generation of specific antibodies for each protein remains a time-consuming and expensive challenge. In particular, the preparation of monoclonal antibodies requires the availability of thousands of purified soluble proteins which are difficult to obtain in large scale. In addition, the stability of immobilized antibodies is a concern. Therefore, non-antibody based protein capturing reagents that can be tailored to specifically bind to a target peptide are desired. Ideally, such reagents should have high stability, similar or better specificity and affinity as antibodies, and the reagents should be able to be prepared on a large scale.


BRIEF SUMMARY OF THE INVENTION

The present invention provides a universal peptide-binding scaffold. This scaffold is used to bind a target. A universal peptide-binding scaffold is a library of mutants of a universal peptide binding domain. A “mutant” is a naturally-occurring or wild-type peptide or protein with one or more amino acid substitutions from the naturally-occurring amino acid sequence. A “library” is a collection of more than one mutant. A “binding domain” is a minimum sequence having specific binding. The target can be a peptide or peptides of interest (for example, peptides associated with a disease state) or can be the entire proteome. The target includes protein fragments prepared by enzymatic digestion of the entire proteome and N- or C-terminal short sequences formed by chemical denaturation of the entire proteome (unfolded proteins). The universal peptide-binding scaffold can be tailored to specifically bind a target using the methods described herein. “Specific” binding between the universal peptide-binding scaffold and a target means the target binds only to the universal peptide-binding scaffold, within current detection abilities.


The universal peptide binding domain is selected from the group consisting of: SH2 domains, SH3 domains, PDZ domains, MHC class I peptide binding domains and MHC class II peptide binding domains. Any individual member or combination of members of the universal peptide binding domains listed forms a particular class of the invention. The universal peptide binding scaffold of the invention is formed using the description provided herein. The mutants of the universal peptide binding domain are formed using the description provided herein. One specific example is display of the mutants using yeast display system. One specific example is a mutant of MHC II having one or more amino acid alterations at positions where it is known yeast display of the mutant leads to correct conformation.


Also provided is a method of selecting proteins or peptides that bind to a universal peptide binding scaffold comprising: preparing a universal peptide binding scaffold; contacting said scaffold with labeled proteins or peptides of interest; and selecting those mutants from the scaffold that bind to the labeled proteins or peptides of interest with a desired affinity. The desired affinity is determined by the purposes of the experiment. Some desired affinities range from micromolar to subnanomolar, including all individual values and intermediate ranges therein, including 10−6 molar to 10−7 molar; 10−7 molar to 10−8 molar; 10−8 molar to 10−9 molar; 10−6 molar to 10−8 molar; and 10−7 molar to 10−9 molar.


Also provided is a protein chip comprising mutants of a universal peptide-binding domain bound to a substrate. These mutants may be bound to the substrate in patterns that facilitate analysis, as known in the art. Methods of forming patterns of substrates on chips are known in the art. Methods of analyzing protein chips for a desired binding interaction are known in the art, and include tagging one component with a label, such as a fluorescent label, and analyzing the protein chip for the presence of the label, the presence thereof indicates the label is bound to the material on the substrate. The substrate can be any composition known in the art and is preferably selected from the group consisting of: glass, polycarbonate, polytetrafluoroethylene, polystyrene, silicon oxide and silicon nitride.


As used herein, “protein” refers to a full-length protein, portion of a protein, or peptide. Proteins can be prepared recombinantly in an organism, preferably bacteria, yeast, insect cells or mammalian cells, or produced via fragmentation of larger proteins, or chemically synthesized.


As used herein, “functional domain” is a domain of a protein which is necessary and sufficient to give a desired functional activity. Examples of functional domains include domains which exhibit binding activity towards DNA, RNA, protein, hormone, ligand or antigen. A binding domain is one example of a functional domain.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 shows the peptide-binding site of MHC molecules.



FIG. 2A shows MHC molecules displayed on yeast.



FIG. 2B shows the general FACS sorting method.



FIG. 3 shows different constructs of single chain HLA-DR1 molecules.



FIG. 4 shows fluorescence of cells displaying the wild-type single-chain HLA-DR1 molecules, αβ, βα and HAβα compared to that of EBY100 control yeast (untransformed).



FIG. 5 shows flow cytometric analysis of mutant scHLA-DR1/yeast.



FIG. 6 shows DNA sequence analysis of the selected DR1 mutants from library lib-HAβα (A) and lib-αβ (B). The numbers below the diagrams refer to the amino acid positions in the domains. Dot indicates the residue is the same as wild type DR1. The number in the parenthesis is the number of identical DNA sequences in each group.



FIG. 7 shows the schematic representation of the two single chain constructs of β1α1 domain of HLA-DR1: wild type β1α1 (top) and double mutant β1α1Lβ11H,Iα8T (bottom).



FIG. 8 shows flow cytometric analysis of wild type β1α1 (top) and double mutant β1α1Lβ11H,Iα8T (bottom).



FIG. 9 shows flow cytometric analysis of binding by HA306-318 peptide. Binding levels of biotinylated DR-specific HA306-318 peptide (left) and A2-specific Tax-8Kbio peptide (right) for the yeast-displaying mutants scαβ DWP-7 (top), DWP-5 (middle) and β1α1Λβ11H,Iα8T (bottom) are shown.



FIG. 10 shows titration curve of the binding to biotinylated HA306-318 (DR-specific) and Tax-8Kbio (A2-specific) peptides by mutant DWP-7. A) Direct peptide binding. scDR1αβ-displaying yeast cells were incubated for 20 hours at 37° C. with a series of concentrations of biotinylated DR-specific HA306-318 (squares) or A2-specific Tax-8K (circles) peptides. Inset: Apparent association constants of biotinylated HA306-318 peptide to yeast-displayed single-chain HLA-DR1 variants. B) Competitive peptide binding. Binding of the biotinylated HA306-318 peptide was inhibited by an excess of the unlabeled HA306-318 peptide (squares), but not by an A2-specifc Tax-8K peptide (circles). scDR1αβ-displaying yeast cells were incubated for 20 hours at 37° C. with 10 μM of biotinylated peptide at pH 6.5 in the presence of a competitor unlabeled peptide (0-200 μM). DR1-bound biotinylated peptide was quantified by flow cytometry. Specific binding is expressed as the percentage of binding by using the following formula: percentage of binding=[(MFU with competitor-background)/(MFU without competitor-background)]×100%.



FIG. 11 shows the structure of the class I molecule HLA-A2. The bound peptide is labeled as pep between the α1 and α2 helices.



FIG. 12 shows the schematic representation of the two constructs of HLA-A2. scHLA-A2, single chain form of full-length HLA-A2; pbsHLA-A2, the peptide binding scaffold consisting of domains α1 and α2. Both V5 and 6H (polyhistidine) are epitopes for simple detection of displayed proteins. GS linker is the polypeptide (Gly4-Ser)3 plus Xpress epitope and some residues in between (Invitrogen catalog).



FIG. 13 shows the schematic representation of yeast surface display of various HLA-A2 proteins. The peptide antigen is labeled with a fluorescent dye-FITC.



FIG. 14 shows fluorescence of cells displaying wild-type single-chain HLA-A2 and α1α2 molecules.



FIG. 15 shows binding of Tax3K5Flc to yeast cells displaying single-chain HLA-A2 molecules.



FIG. 16 shows protein expression analysis using a protein chip.





DETAILED DESCRIPTION OF THE INVENTION

The single-chain Class II MHC molecule binding site is described herein as an example of the binding domain used in the universal peptide-binding scaffold, however, other universal peptide-binding domains may be used in the universal peptide-binding scaffold, including SH2 domains, SH3 domains, PDZ domains, and MHC class I peptide binding domains, as known in the art, using the disclosure herewith.


The sequences of each of the domains are discussed in the following references: SH2 domain: “Conservation analysis and structure prediction of the SH2 family of phosphotyrosine binding domains.” Russell R B, Breed J, Barton G J, FEBS Lett. 1992, 304(1):15-20; SH3 domain: “SH3—an abundant protein domain in search of a function.” Musacchio A, Gibson T, Lehto V P, Saraste M. FEBS Lett. 1992, 307(1):55-61; PDZ domain: “Evidence for PDZ domains in bacteria, yeast, and plants.” Ponting C P. Protein Sci. 1997, 6(2):464-8; MHC class I: the HLA-A2 sequence is provided here.


Human major histocompatibility complex (MHC) class II molecules are membrane-anchored heterodimers that bind and present peptides on the surface of antigen presenting cells to T cells in a cell-mediated immunity. MHC molecules are major contributors to the genetic susceptibility underlying autoimmune diseases, cancer and infectious diseases. For example, MHC class II molecule HLA-DR1 and HLA-DR4 are associated with rheumatoid arthritis while HLA-DR2 is associated with multiple sclerosis. Because of their important biological role in immune responsiveness, MHC proteins have attracted great attention as a new class of diagnostic and therapeutic agents. For example, the MHC-peptide complexes may be used to detect a variety of antigen-specific T cells in human blood or to induce antigen-specific autoreactive T cell unresponsiveness in human autoimmune diseases. The high specificity and affinity between the peptide and the MHC molecule and the stability of the peptide-complex are often considered to be prerequisite for successful development of MHC-based diagnostic and therapeutic agents or MHC-based peptide capturing agents for a protein chip. Unfortunately, it is very difficult to obtain soluble functional MHC molecules for characterization and protein engineering, in particular, in a system amenable to powerful combinatorial protein design approaches such as directed evolution.


The use of MHC molecules as universal peptide-binding scaffolds have several practical advantages over other universal peptide-binding scaffolds. MHC molecules are used in nature for peptide recognition and discrimination in the immune system. MHC molecules can capture peptides from the cellular environment and present these peptides for scrutiny by immune cells. MHC molecules are extremely polymorphic with distinct specificities, suggesting the versatility of these molecules for peptide recognition. Several hundred different MHC molecules have been found within the human species and their nucleotide sequences are available. Crystallographic studies of the MHC molecules have revealed a common overall structure, featuring a unique peptide-binding site situated at the outer domains. The peptide-binding site consists of two long α-helices and an eight-stranded anti-parallel β-sheet (groove-like structure, see FIG. 1). For class I MHC molecules, the binding site is formed as intrachain dimer of the α1 and α2 domains. For class II MHC molecules, the binding site is formed as interchain dimer of the α1 and β1 domains. Not surprisingly, the polymorphic residues are all concentrated along the peptide-binding site that determines the MHC specificity. A given peptide-binding groove can bind hundreds or thousands of different peptides, identical or homologous at only a few side chain positions. Nonetheless, the typical dissociation constant between a peptide antigen and a MHC molecule ranges from micromolar to nanomolar. Much of the binding energy comes from the interactions between the peptide main chain and MHC molecules (sequence-independent) while the interactions between the peptide side-chains (i.e. sequence) and MHC molecules accounts for the specificity.


The peptide binding groove of class II MHC molecules is open, allowing peptides of 10-25 amino acids in length to bind. The readily accessible N- and C-termini provide handles for convenient and universal chemical labeling. Unlike class I MHC molecules, functional class II MHC molecules have been produced in an empty, peptide-free form, suggesting the peptide-binding site can be formed without loaded peptides. This is desirable because the peptide-free functional class II MHC molecules are ready to bind a peptide as they are made.


In vitro evolution or directed evolution methods of the universal peptide-binding scaffold were used here to mimic the process of natural evolution in the test tube, involving repeated cycles of creating molecular diversity by random mutagenesis and gene recombination and screening/selecting the functionally improved variants. The power of in vitro evolution mainly lies in its use of a combinatorial algorithm to rapidly search and accumulate beneficial mutations from libraries containing a large number of different variants. Unlike rational design, in vitro evolution does not require extensive structural and mechanistic information on the biomolecules.


The universal peptide-binding scaffold of the invention is useful in all applications where antibodies are useful, for example, use as a diagnostic agent, therapeutic agent or research agent for protein purification and western blotting.


Directed evolution and yeast surface display were used to express mutants of human MHC class II molecule HLA-DR1 on the yeast cell surface that are properly folded and can bind specific antigenic peptides. This system can be used for further engineering of the affinity and specificity of peptide binding to DR1 molecules by powerful directed evolution approaches. Briefly, in vitro evolution experiments were focused on the peptide-binding site of HLA-DR1 consisting of α1 and β1 domains (˜180 residues). Genetic variations were introduced within this site using two distinct DNA diversification approaches. The first approach is to randomly introduce multiple amino acid substitutions using error-prone PCR. The second approach was to create different combinations of naturally existing mutations (polymorphism) among a set of homologous MHC genes using family shuffling. Genes encoding classical HLA molecules are extremely polymorphic, with most genes consisting of a large number of allelic variants specifying differences at the amino acid level and fine structural detail. The HLA IMGT/HLA database currently includes 1524 HLA allelic sequences (904 HLA I alleles and 620 HLA II alleles) (release 1.16, Oct. 14, 2002 “IMGT/HLA and IMGT/MHC: sequence databases for the study of the major histocompatibility complex” Nucleic Acids Res. 2003 Jan. 1; 31(1):311-4). The number of HLA allelic variants that diverge in at least one amino acid residue varies for the individual HLA genes, being greatest for HLA-B and DRB1 genes with 447 and 271 variants, respectively. The three HLA class II genes (HLA-DP, HLA-DQ, and HLA-DR) share more than 60% sequence identity whereas allelic sequences within the same gene, e.g. HLA-DR, share more than 90% identity. Family shuffling often creates a library of chimerical genes that has much richer functional diversity than error-prone PCR or DNA shuffling, allowing rapid improvement of desired protein functions. The co-transformation of mutated target gene products and the linear vector digested with two unique restriction sites into the yeast cells results in the cloning and expression of variants of the peptide-binding scaffold on the yeast cell surface.


The following nonlimiting examples are intended to further explain and illustrate the invention. The description below specifically describes expression of single-chain class II MHC HLA-DR1 and class I HLA-A2 molecules on a yeast cell surface and the use of in vitro evolution methods to rapidly create a variant of the scaffold that specifically binds to a given target peptide. Although yeast surface display is particularly described herein, as known in the art, phage display, ribosome display, bacterial display or yeast two hybrid systems can also be used in the present invention.


Yeast surface display allows expression of a protein of interest as a fusion protein with the yeast AGA2 agglutinin mating factor on the cell surface. It is an efficient system for directed evolution since a library of protein variants can be readily generated and screened by fluorescence-activated cell sorting (FACS) or magnetic beads (Yeung, Y. A., and Wittrup, K. D. (2002) Biotechnol Prog 18, 212-220), and it offers multiple advantages over other display methods such as phage display. Yeast is a eukaryote and so contains protein-processing machinery similar to that of a mammalian cell. Thus, yeasts are more appropriate than prokaryotes to correctly express and display human therapeutic proteins, including MHC molecules. Moreover, the robustness of the yeast surface provides an excellent scaffold for direct biochemical and biophysical characterization of the displayed protein. Yeast surface display coupled with sorting by flow cytometry or magnetic beads has been used to engineer single-chain antibodies, single-chain TCR receptors of increased affinity and stability, stabilized versions of class II I-Agg7, and more recently, tumor necrosis factor-α (TNF-α) mutants with higher expression levels. The yeast display system is described in U.S. Pat. Nos. 6,423,538 and 6,300,065, for example, which patents are hereby incorporated by reference to the extent not inconsistent herewith.


HLA-DR1


Directed evolution and yeast surface display methods were used to prepare soluble MHC molecules. Human MHC class II molecule HLA-DR1 was used as a model system. HLA-DR1 is associated with rheumatoid arthritis. Constructs of single-chain HLA-DR1 were made with and without a covalently bound high-affinity antigenic peptide containing residue 306-318 (HA306-318) of influenza virus hemagglutinin (PKYVKQNTLKILAT, SEQ ID NO:1). For construction of the peptide-free single-chain HLA-DR1 molecule, extracellular domains of DRα and DRβ were amplified from sscDRβHA plasmid (Zhu et al., Eur. I Immunol. 27(8):1933-41, 1997) and joined by a linker of 15 amino acids (G4SG3RSG4S, SEQ ID NO:45) (scDR1αβ) by splicing overlap extension PCR (SOE-PCR). The α and β domains were amplified from plasmid sscDRβHA with the oligonucleotide pairs α-5BX (5′ GTACCAGGATCCAGTG TGGTGGAA GGGGACACCCGACCACG 3′, SEQ ID NO:2) / α-3GS (5′ GCCAGAGCGGCCGCCACCTG A GCCGCCGCCTCCTAAGTTCTCTGTAGTCTCTGG 3′, SEQ ID NO:3), and β-5GS (5′ TCAGGTGGCGGCC GCTCTGGCGGAGGTGGATCCGGGGACACCCGACCAC 3′, SEQ ID NO:4)/β-3XH (5′ CCCTCTAGACT CGAGCTTGCTCTGTGCAGATTCAGAC 3′, SEQ ID NO:5), respectively. The primers α-3GS and β-5GS overlap by 20 nucleotides (nt) and were modified to introduce a unique NotI restriction site in the linker sequence that connects the α domain to the β domain. These two PCR products were mixed together and assembled by a primerless PCR, followed by reamplification of the assembled products with the external oligonucleotides α-5BX and β-3XH. The final product was purified, digested with BstXI and XhoI and cloned into the pYD1 vector digested with the same restriction enzymes, giving the plasmid pYD1scαβ (FIG. 3). DNA encoding the single chain βα (scDR1βα) was also obtained from plasmid sscDRβHA by PCR amplification with the oligonucleotides β-5BX (5′ GTACCAGGATCCAGTGTGGTGGAAGGGGACACCCGACCA CG 3′, SEQ ID NO:6) and α-3XH (5′ CCCTCTAGACTCGAGTAAGTTCTCTG TAGTCTCTGG 3′, SEQ ID NO:7). The resulting amplification product was cloned into pYD1 via BstXI and XhoI to give pYD1scβα (FIG. 3). The plasmids were sequenced through the entire encoding sequence to verify the absence of undesired mutations introduced by PCR.


Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, Iowa). Cloned PfuTurbo DNA polymerase and E. coli XL1-Blue were purchased from Stratagene (La Jolla, Calif.). Taq DNA polymerase was purchased from Promega (Madison, Wis.). Endonuclease restriction enzymes and DNA ligase were from New England Biolabs (NEB) (Beverly, Mass.). Peptides used in this study were synthesized and purified (>90%) commercially (Jerini AG, Berlin, Germany) and included a peptide containing residues 306-318 of influenza virus hemagglutinin (HA306-318) and a HLA-A2-specific Tax-derivative peptide (Tax-8K).


The assembled single-chain HLA-DR1 molecule was cloned into pYD1 vector (Invitrogen) in frame with the C-terminal end of the Aga2 gene. Vector pYD1 uses the α-agglutinin yeast adhesion receptor consisting of two domains, Aga1 and Aga2, to display recombinant proteins on the surface of S. cerevisiae based on the fact that Aga1 domain and Aga2-fusion protein can associate to each other by two disulfide bridges within the secretory pathway (FIG. 2A). The yeast surface display system has been successfully used to express single chain antibodies and single chain T-cell receptors (TCRs) and to create variants of these molecules with high affinity using directed evolution. As shown in FIG. 3, genes encoding the single-chain HLA-DR1 molecules HAβα (HA-linker-β-linker-α), βα (β-linker-α) and αβ (α-linker-β) were cloned into yeast surface display vector pYD1 as a fusion to the carboxyl-terminus of Xpress epitope and amino-terminal end of V5 tag. Antibody analysis of Xpress and V5 epitopes by flow cytometry allows the detection of expressed proteins on the cell surface and estimation of their expression levels.


Monoclonal antibodies used in this study were anti-DR L243 (Biodesign International, Saco, Me.), LB3.1 (American Tissue Culture Collection (ATCC), Manassas, Va.), Immuno-357 (Beckman Coulter, Fullerton, Calif.), anti-DR, -DP and -DQ CR3/43 (Biomeda, Foster City, Calif.), anti-Xpress, and anti-V5 (Invitrogen, Carlsbad, Calif.). Biotin-conjugated goat-anti-mouse (GAM) IgG was purchased from Rockland (Gilbertsville, Pa.) and streptavidin-phycoerytrin (SA-PE) conjugate was purchased from PharMingen (San Diego, Calif.). Alkaline phosphatase-conjugated GAM IgG was purchased from Sigma (St. Louis, Mo.). The Zymoprep miniprep kit was obtained from ZymoResearch (Orange, Calif.). The QIAprep spin plasmid mini-prep kits and QIAquick PCR purification kits were purchased from Qiagen (Valencia, Calif.). Unless otherwise indicated, all chemicals were purchased from Sigma (St. Louis, Mo.).



FIG. 2B shows the general sorting method. FIG. 4 shows fluorescence of cells displaying the wild-type single-chain HLA-DR1 molecules, αβ, βα and HAβα are compared to these of EBY100 control yeast (untransformed). Cells were labeled with V5, CR3/43, LB3.1, L234, Immuno-357 antibodies followed by secondary labeling with biotinylated-goat-anti-mouse Ig antibodies and streptavidin-PE conjugated, then analyzed by flow cytometry. Approximately 75-80% of the population of cells expressed HLA-DR1 on the surface. Histograms of surface expression level, as measured by epitope tag labeling with V5 and CR3/43 antibodies, are shown in the two left columns. Histograms of folded single chain HLA-DR1 as measured by L243, LB3.1 and Immuno-357 antibodies, are shown in the three right columns. Labeled yeast were analyzed on a Coulter Epics XL flow cytometer collecting 30000 cells gated on light scatter (size) to prevent analysis of the clumps. As shown in FIG. 4, all three constructs were capable of expressing soluble single-chain DR1 proteins on the yeast cell surface as indicated by the large cell population with high mean fluorescence intensity stained with anti-V5 antibodies. Similarly, binding of each single-chain DR1 molecule to the DR-specific antibody, CR3/43, which recognizes the denatured β chain of DR molecules, could also be detected by flow cytometry. However, when conformation-sensitive anti-DR antibodies L243, LB3.1 or Immu-357 were used to detect properly folded single chain DR1 molecules, binding of the antibody to the DR1 molecule was barely detected for each of these three DR1 constructs, indicating no or very low level of properly folded DR1 molecules on the yeast cell surface (FIG. 4).


To express properly folded single-chain DR1 molecules and address whether the presence of the peptide and/or chain order within the DR1 molecule could influence the functional soluble expression of this molecule, two mutant libraries, one consisting of single chain DR1 variants in the configuration α-linker-β (lib-αβ) and the other consisting of variants in the configuration HA-linker-β-linker-α (lib-HAβα) were generated by error-prone PCR. Each of these two libraries was sorted through three cycles of FACS with the conformation-sensitive anti-DR antibody L243 followed by biotin-labeled goat-anti-mouse (GAM) IgG and streptavidin-phycoeritrin (SA-PE). In each cycle, yeast cells collected from the previous sort were cultured and protein expression was induced. For the library lib-αβ, protein induction was performed both in the presence or absence of 1 μM of HA peptide into the induction medium. 19 clones isolated from each library were screened for binding to the anti-V5 and anti-DR antibodies L243, LB3.1 and Immu-357. In contrast to wild-type constructs, the mutants showed positive populations with the three conformational antibodies. Representative histograms of one clone of each library are shown in the FIG. 5. FIG. 5 shows flow cytometric analysis of mutant scHLA-DR1/yeast. Yeast displaying mutant αβ DWP-7 (top) or mutant HAβα H2-1 (bottom) was stained with anti-V5 monoclonal antibody, anti-DR LB3.1, L243 and Immu-357 antibodies followed by biotinylated goat-anti-mouse IgG and SA-PE. Unshaded peaks represent cells that were stained only with the secondary labeling reagents. Labeled yeast was analyzed on a Coulter Epics XL flow cytometer collecting 30000 cells gated on light scatter (size) to prevent analysis of the clumps. To ensure the phenotype of the mutant yeast was plasmid-linked, the plasmid was rescued from the respective mutant yeast clone and transformed into fresh EBY100 cells to verify that the selected phenotype was reconstituted. In general, all selected clones showed levels of binding to antibody L234 similar to those obtained with LB3.1 antibody but they differed in the binding to antibody Immu-357. In particular, clones isolated from library lib-HAβα showed reduced binding to this antibody.


To uncover the molecular basis of DR1 expression, the genes encoding those DR1 mutants that exhibited the highest binding to the conformational antibodies LB3.1 and L243 were sequenced (nucleotide and amino acid sequences are shown in Table 1). Deduced amino acid sequences of DR1 mutants selected from library lib-HAβα allowed classification of these mutants in four main groups, represented by H2-1, H2-2, H2-3 and H3-3 in FIG. 6A. Some variants contained several amino acid substitutions but others only presented one amino acid change from the wild type in the β chain, Lβ11H. Interestingly, this single amino acid substitution from the wild type was found in all mutants selected from the library after the third sort. Similarly, DNA sequencing of mutants selected from library lib-αβ allowed to discriminate three different groups of clones, referred as DO-1, DWP-7 and DWP-5 in FIG. 6B, although two of them presented amino acid sequence that only differed in an additional amino acid substitution in the α chain (FIG. 6B). Using site-directed mutagenesis and flow cytometric analysis, three novel single site mutations, Lβ11H, Dβ57A and Lβ26F, in the β1 domain, were found to be critical for the proper folding of the single chain DR1 molecules.


β1α1 domains (˜180 residues) connected by an amino acid linker were obtained by splicing overlap extension PCR (SOE-PCR). β1 domain was amplified from pYDHA β α with the oligonucleotides β-5BX (5′ TACCAGGATCCAGTGTGGTGGAAGGGGACACCC GACCACG 3′, SEQ ID NO:6) and β1-3GS (5′ CTTCTTTACTAGTACCTCCTGAGCC AACTCGCCGCTGCACTGTG 3′, SEQ ID NO:8). α1 domain was amplified from the same vector using the primers α1-5GS (5′ GGCTCAGGAGGTACTAGTAAAG 3′, SEQ ID NO:9) and α1-3XH (5′ CCCTCTAGACTCGAGATTGGTGATCGGAGTATAGTTG 3′, SEQ ID NO:10). The primers β1-3GS and α 1-5GS overlap 20 nucleotides with each other and present an unique SpeI restriction site in the linker sequence (GSGGT, SEQ ID NO: 46) that connects the β1 to the α1 domain. These two PCR products were mixed together, primerless assembled and reamplified by PCR with the external oligonucleotides β-5BX and α 1-3XH. The final product was digested with BstXI and XhoI and cloned as a single-chain molecule (β1-linker-α1) into pYD1, in frame with Aga2 and as a fusion to the carboxyl-terminus of Xpress epitope and amino-terminal end of V5 tag (FIG. 7). In order to express folded β1α1 domains on the yeast surface, the mutations Lβ11H and Iα8T previously found in the evolved single-chain αβ molecules were introduced into wild-type pYDβ1α1 to give pYDβ1α1Lβ11H,1α8.T (FIG. 7).


To make β1α1Lβ11H,1α8T, a fragment encoding the β1 domain with the mutations Lβ11H, Qβ92R and the amino terminal end of α1 domain with the mutation Iα8T was obtained by PCR amplification from DWP-7 with the oligonucleotides Xpress5′ GGTCGGGATCTGTACGAC GATGACGATAAGGTACCAGGATCCAGTGGGGACACCCGACCACGTTTC 3′, SEQ ID NO:11) and β1-3LSpe (5′GATAGAACTCGGCCTGGRTGATCACATGTTCTTCTTTACTA GTACCTCCTGAGCCAACTCGCCGCCGCACTG 3′, SEQ ID NO:12). This PCR fragment was inserted into BstXI/SpeI pYDβ1α1 by homologous recombination giving the plasmid pYDβ1α1mut that presents the mutations Lβ11H, Vβ75A, Qβ92R and Iα8T. β1 domain with the only mutation Lβ11H was amplified from the H2-1 mutant with the oligonucleotides Xpress and βrev73-67 ((5′ GGCCCGCCTCTGCTCCAGGA 3′, SEQ ID NO:13) and cloned by yeast homologous recombination into BstXI-treated pYDβ1α1 giving the plasmid pYDβ1α1Lβ11H. In one second step, α1 domain with the mutation I8T was amplified from pYDβ1α1 mut with the oligonucleotides β1R93 (5′ CGGCGAGTTGGCTCAGGAG 3′, SEQ ID NO:14) and pYDR3 (5′AGTATGTGTAAAGTTGGTAACG 3′, SEQ ID NO:5) and inserted into SpeI/XhoI-treated pDβ1α1H11 by yeast homologous recombination. Yeast clones with plasmid containing the mutations Lβ11H and Iα8T (pYDβ1α1Lβ11H,Iα8T) were selected by PCR screening with specific primers and DNA sequencing. Sequence of the single-chain β1α1 construct with these two mutations is shown in Table 2). Induction of yeast cells transformed with this plasmid yielding β1α1 domains properly folded, as revealed by their reactivity against conformation-sensitive anti-DR antibodies L243, LB3.1 (FIG. 8). Therefore, the mutations Lβ11H and Iα8T are important for the proper folding of the β1α1 domain.


The Lβ11H mutation plays an important role in the expression of folded scDR1αβ molecules. Although position 11 in the β chain is polymorphic, His is not found in any of the DR alleles with known sequences. Molecular modeling indicates that the substitution Lβ11H on the first β-sheet strand of the β1 domain approaches the δ(+) amino group of Hβ11 within 5 Å of the ring centroid of Fβ13 where it makes van der Waals contacts with the δ(−) π-electrons of the ring. This amino-aromatic interaction is analogous to the enthalpically favorable interaction between aromatic side chains. In addition, the sulfur atom of Cβ30 is placed at 4 Å from the ring centroid of Hβ11, and may form a strong non-covalent interaction with the π-electron system of the aromatic ring (histidine) of Hβ11. Sulfur-aromatic interactions are weakly polar interactions that are stronger than van der Waal's interactions between nonpolar atoms. These sulfur-aromatic interactions are commonly observed in the hydrophobic core of proteins and may have special significance for stabilizing the folded conformation of proteins. The Dβ57A mutation also promotes the folding of the single-chain DR1αβ molecule since its presence in the single mutant Lβ11H increases the expression level of folded protein by up to 50% (FIG. 10A). Position Dβ57 in DRB alleles, although usually Asp, is polymorphic. Interestingly, the substitution Dβ57A is characteristic of DQ alleles that correlate with insulin-dependent diabetes mellitus (IDDM) susceptibility. Residues Dβ57 in the β1 domain and Rα76 in the α1 domain form a salt-bridge underneath the bound peptide that links the HLA-DR1 β1- and α1-chain helical regions. The substitution of Asp by Ala breaks this salt bridge and therefore could destabilize the structure of HLA-DR1. However, our thermostability data obtained with the mutant scDR1αβLβ11H,Dβ57A (Inset of FIG. 10) do not seem to indicate that the Dβ57A substitution affects the stability of the single-chain DR1 molecules. This observation is in agreement with data previously reported for DQ molecules in which the Dβ57A substitution predominately alters the peptide-binding specificity rather than the overall stability of either empty or peptide-loaded forms of these MHC molecules. Therefore, the contribution of this salt bridge does not seem to be important for protein stability. However, formation of this salt bridge might be a kinetic barrier for the folding of the scDR1αβ molecule, as was proposed for other proteins. Since Aβ57 increases the hydrophobic interaction with Vβ38 and Wβ61 in the β1 chain (FIG. 11D), it is likely that Dβ57A may lower a kinetic barrier in the folding pathway of single-chain DR1 by enhancing the stability of the hydrophobic core of the β1α1 domain. However, we cannot exclude the possibility that these three mutations favor the close packing with some yeast endogenous peptides that in turn help to stabilize a conformation that is critical to subsequent binding of high affinity peptides, such as the HA306-318 peptide. Recently, it has been reported that mutation S11F in the β1 domain of DR3 stabilized the CLIP peptide in the antigen-binding groove.


For biotinylated HA306-318 peptide (bio-HA306-318), the biotin was attached to its N terminus via a linker of two 6-amino-hexanoic acid molecules. For biotinylated Tax peptide, the biotin was attached to the ε-amino group of a lysine residue, substituted at position 8 of the Tax peptide (Tax-8Kbio).


To determine whether the different single-chain DR1 mutant proteins were capable of binding peptides, the direct binding of the biotinylated HA306-318 peptide to yeast cells displaying mutant single-chain HLA-DR1 molecules was assayed. After incubation of the yeast cells with 25 μM of biotinylated HA306-318 peptide for 16 hours at 37° C., a positive population could be observed for the mutants expressing single-chain αβ or β1α1 molecules without a covalently bound peptide (FIG. 9, left panels). This positive population was not observed when the cells were incubated with the same concentration of a biotinylated derivative of the peptide Tax, specific for HLA-A2 molecules (right panels of FIG. 9). Similarly, incubation of yeast cells expressing a class I molecule failed to react with HA306-318 peptide (data not shown). In comparison, only a weak binding could be detected for the mutants expressing the heterotrimer of peptide HA, β chain and α chain as a covalently linked single-chain protein.


To estimate the binding constant of the expressed single chain DR1 mutants with the biotinylated HA306-318 peptide, and more importantly, to determine the sensitivity of the flow cytometric assay as a high throughput screening method for measuring the affinity and specificity between a specific peptide and the expressed single-chain DR1 mutants, the mean fluorescence units (MFU) of peptide binding of the biotinylated HA306-318 peptide to the DR1 mutants DWP-7 and DWP-5 at various peptide concentrations were measured. FIG. 10 shows titration curves of the binding to biotinylated HA306-318 (left panel) and Tax8 Kbio (right panel) peptides by mutant DWP-7. The binding of this mutant to different concentrations of biotinylated DR-specific HA306-318 peptide is compared to that obtained with a biotinylated derivative of the A2-specific peptide Tax (Tax8 Kbio).


The equilibrium dissociation constant (Kd) between the peptide and surface-expressed molecules is estimated from the fluorescence data of flow cytometry using the method described by VanAntwerp et al. with some modifications. Briefly, aliquots of yeast cells displaying HLA-A2 proteins are mixed with fluorescein-labeled peptide antigen ILKECVHGV (SEQ ID NO: 47) at a range of concentrations bracketing the expected Kd, and allowed to approach equilibrium at room temperature. Cells are then examined using a flow cytometer. The mean fluorescence intensity of the population of cells is measured. The Kd is calculated by a non-linear least square curve fit of the fluorescence data.


As shown in FIG. 10, the apparent dissociation constant KD of the biotinylated HA306-318 peptide-DWP-7 complex was estimated to be 5 μM. This value is larger than the KD value determined using soluble wild type HLA-DR1 molecules and non-biotinylated HA306-318 peptide (˜20 nM). There are several possibilities for this discrepancy. First, the expressed single chain DWP-7 or DWP-5 molecules may bind some weak endogenous peptides, which requires higher concentration of HA peptide for peptide displacement. This possibility is partially supported by the lack of reactivity of DR1 mutants (DWP-7 and DWP-5) with monoclonal antibody KL304 which specifically recognizes empty (peptide-free) HLA-DR molecules. Second, the mutations in the DWP-7 or DWP-5 may affect the peptide binding. Third and most likely, inherent problems of cellular binding assays such as aggregation of cells or other technical difficulties such as limited solubility of peptides may underestimate the real affinities. Nonetheless, the assay is very sensitive since a two-fold difference in peptide concentration between 1 and 10 μM can be discriminated (FIG. 10).


HLA-A2


Human lymphocyte antigen-A2 (HLA-A2) is capable of binding several important viral peptide antigens including influenza A virus matrix M1 residues 58-66, human immunodeficiency virus type 1 (HIV-1) reverse transcriptase residues 309-317, HIV-1 gp120 residues 197-205, human T lymphotrophic virus type 1 (HTLV-1) Tax residues 11-19 and hepatitis B virus nucleocapsid residues 18-27 and presenting them to the T-cells for antigenic recognition. The structure of HLA-A2 is shown in FIG. 11. HLA-A2 including its heavy chain and β2m subunit has been expressed in Escherichia coli at high levels as inclusion bodies. Thus, to produce functional soluble HLA-A2 molecules, an in vitro refolding process was required. Unfortunately, this refolding process is inefficient and laborious and in addition, such an expression system is not amenable to directed evolution in which screening tens of thousands of variants is required.


Here, two different forms of HLA-A2 molecules (FIG. 12) are expressed: a single chain form of two subunits (scHLA-A2), and a peptide binding scaffold consisting of α1 and α2 domains (pbsHLA-A2) on the yeast surface. These varying forms are designed to find out the minimal structural requirement of HLA-A2 for peptide antigen recognition and T-cell activation as well as the particular construct of HLA-A2 amenable to functional expression.


Expression of HLA-A2 as Wild Type Proteins Using a Yeast Surface Display System


Plasmids p4037 and p714 that contain genes encoding HLA-A2 heavy chain (amino acids 1-271) and β2m, respectively, are used as the templates to construct two different forms of HLA-A2 as mentioned above. These two plasmids were obtained from Dr. David N. Garboczi at National Institutes of Health.


As shown in FIG. 12, for the single chain full-length form of HLA-A2, scHLA-A2, the two separate subunits are connected through a flexible peptide linker so that the carboxyl-terminus of β2m is linked to the amino-terminus of the heavy chain. DNA encoding the extracellular domain of the heavy chain and the β2m joined by a linker of 15 amino acids was prepared by splicing overlap extension PCR (SOE-PCR) The DNA encoding the heavy chain subunit is amplified from p4037 with a standard PCR using oligonucleotide primers A1 (5′GGCGGCTCGGG TGGCGGCGGCTCTGGCGGAGGTGGATCCGGCTCTCACTCCATGAGGTATTTC-3′, SEQ ID NO:16), and A2 (5′-ATACCGCTCGAGT TCCCATCTCAGGGTGAGGGG-3′, SEQ ID NO:17). The DNA encoding β2m is analogously amplified from p714 using primers B1 (5′-GATCGAAGCCAGTGTGGTGGAAATGATCCAGCGTACTCCAAAG-3′, SEQ ID NO:18), and B2 (5′ ACCTCCGCCAGAGCCGCCGCCACCCGAGCCGCCGCCTCCCATGTCT CGATCCCACTTAAC 3″,SEQ ID NO:19). The assembled fragment was digested with BstXI and XhoI and cloned into vector pYD1 (Invitrogen).


For construction of the second form of HLA-A2 (pbsHLA-A2) (FIG. 12), the DNA encoding the α1 and α2 domains of HLA-A2 is amplified from p4037 with primer A3 (5′GATCGAAGCCAGTGTGGTGGAAATGGGCTCTCACTCCATGAGG 3′, SEQ ID NO:20) and A4 (5′ ATACCGCTCGAGCTGCAGCGTCTCCTTCCC3′, SEQ ID NO:21). The PCR product is digested with BstXI and XhoI and cloned into pYD1. Sequences are shown in Table 3.


The yeast display system including vector pYD1 and EBY100 S. cerevisiae can be obtained from Invitrogen. pYD1 uses the a-agglutinin yeast adhesion receptor consisting of two domains, Aga1 and Aga2, to display recombinant proteins on the surface of S. cerevisiae. Each form of HLA-A2 is cloned into the pYD1 vector in frame with the Aga2 gene. The resulting construct is transformed into the EBY100 S. cerevisiae strain. Aga1 and Aga2-fusion protein associate within the secretory pathway and are displayed on the cell surface (FIG. 13). Two epitopes (V5 and 6H) from pYD1 are fused to the C-terminus of the HLA-A2 proteins, allowing the simple detection of the displayed products with anti-V5 antibody or anti-6H antibody.


Antibody analysis of Xpress and V5 epitopes by flow cytometry allows the detection of expressed proteins on the cell surface and estimation of their expression levels. Expression of the Aga2p-HLA-A2 fusion products is induced by the addition of galactose into the growth medium. Surface localization of the fusion products is verified by laser scanning confocal fluorescence microscopy. Both an anti-V5 monoclonal antibody (labeled with a fluorescent dye other than fluorescein, such as phycoerythrin) and a fluorescein-conjugated peptide antigen variant from HIV-1 reverse transcriptase residues 309-317 (the peptide sequence is ILKECVHGV, SEQ ID NO:22) are incubated with the yeast cells. Phycoerythrin is attached to the antibody through an amido ester linkage to the lysine residues while fluorescein maleimide is attached to the peptide through a thio-ether linkage to the cysteine residues. The anti-V5 monoclonal antibody (mAb) specifically binds with the V5-epitope, which indicates the existence of surface-displayed fusion products. The peptide antigen specifically binds with the peptide-binding site of HLA-A2, which indicates the correct folding of the proteins. FIG. 14 shows fluorescence of cells displaying the wild-type single-chain HLA-A2 and α1α2 molecules. Cells were labeled with V5, MA2.1, BB7.2 antibodies followed by secondary labeling with biotinylated-goat-anti-mouse Ig antibodies and streptavidin-PE conjugated, then analyzed by flow cytometry. Histograms of surface expression level, as measured by epitope tag labeling with V5 are shown in the left column. Histograms of folded single chain HLA-A2 and α1α2 as measured by MA2.1 and BB7.2 antibodies, are shown in the two right columns. As shown in FIG. 14, both constructs were capable of expressing soluble single-chain HLA-A2 on the yeast cell surface as indicated by the mean fluorescence intensity obtained when the induced yeast were stained with anti-V5 antibodies. However, when conformation-sensitive anti-A2 antibodies were used to detect properly folded single chain HLA-A2 molecules, only binding of the antibody to the scHLA-A2 molecule was detected (FIG. 14).


In addition, to evaluate whether the single-chain HLA-A2 molecules were capable of binding peptides, the direct binding of the fluorescein-conjugated Tax peptide (Tax3K5Flc) to yeast cells displaying the single-chain HLA-A2 molecules was assayed. After incubation of the yeast cells with 25 μM of Tax3K5Flc peptide for 12 hours at room temperature, a positive population could be observed for the yeast displaying single-chain HLA-A2 molecules (FIG. 15). This positive population was not observed when the cells were incubated with the same concentration of the DR-specific HA306-318 peptide attached to fluorescein (right panels of FIG. 15). Similarly, incubation of yeast cells expressing the single-chain DR1 molecules described above failed to react with Tax3K5Flc peptide (data not shown).


Protein Chips


The mutant universal peptide-binding scaffolds can be used on a protein chip. In this embodiment, mutants of the universal peptide-binding scaffold are attached to a solid support. The target peptide or peptides are placed in contact with the solid support to allow binding of the target peptide or peptides with the mutants. Binding is determined by means known in the art, such as the use of a fluorescent tag. The mutants that exhibit the desired binding specificity and affinity are isolated. Making protein chips is described in the art, for example, Heng, Z. et al. Global analysis of protein activities using proteome chips. Science 293, 2101-2105 (2001); WO 02/054070; WO01/83827; Mitchell, A perspective on protein microarrays. Nature Biotechnology 20, 225-229 (2002).


The universal peptide binding scaffolds can be used to “read” unique peptide sequences representing the proteins in a given proteome, similar to DNA hybridization in a standard DNA chip. Further, all proteins in a cell population, including membrane proteins can be directly analyzed. Purifying all the proteins is also straightforward, using methods known in the art. Prior to the subject invention, it was difficult to isolate and express folded intact membrane proteins, so no protein capturing agents such as antibodies to recognize membrane proteins had been developed.



FIG. 16 shows one embodiment of the protein chip. (1) The total pool of proteins from each cell population (control and sample) is extracted. (2) The proteins are denatured and digested into peptides using proteases. (3) The peptides from each sample are labeled with different fluorescent dyes. (4) The two pools of fluorescently labeled peptides are then mixed and hybridized with a protein chip in which the universal peptide-binding scaffolds are arrayed on a glass slide, each of them recognizing a unique peptide sequence representing each protein in a given proteome.


Although the description above contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently-preferred embodiments of this invention. Specific names of compounds are intended to be exemplary, as it is known that one of ordinary skill in the art can name the same compounds differently. One of ordinary skill in the art will appreciate that methods, device elements, starting materials, synthetic methods, and display methods other than those specifically exemplified can be employed in the practice of the invention without resort to undue experimentation. All art-known functional equivalents, of any such methods, device elements, starting materials, synthetic methods, and display methods are intended to be included in this invention. Whenever a range is given in the specification, for example, a temperature range, a time range, or a composition range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure.


As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term “comprising”, particularly in a description of components of a composition or in a description of elements of a device, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or elements. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.


The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. In general the terms and phrases used herein have their art-recognized meaning, which can be found by reference to standard texts, journal references and contexts known to those skilled in the art. All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The mutants and methods and accessory methods described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.


Although the description herein contains many specificities, these should not be construed as limiting the scope of the invention, but as merely providing illustrations of some of the embodiments of the invention. Thus, additional embodiments are within the scope of the invention and within the following claims. All references cited herein are hereby incorporated by reference to the extent that there is no inconsistency with the disclosure of this specification. Some references provided herein are incorporated by reference herein to provide details concerning additional starting materials, additional methods of synthesis, additional methods of analysis, additional methods of mutation, additional methods of display and additional uses of the invention.









TABLE 1





DNA and amino acid sequences of the evolved scHLA-DR1 variants.
















1. Mutant H2-1 (SEQ ID NOs:23 and 24)











       P  K  Y  V  K  Q  N  T  L  K  L  A  T  G  T  G  G  S  L  V











1
cccaagtatgttaagcaaaacaccctgaagttggcaacaggtaccggtggctcactagtg
  60







P  R  G  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H


61
ccacggggctctggaggaggtgggtccggggacacccgaccacgtttcttgtggcagcat
 120






K  F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I


121
aagtttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatc
 180






Y  N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T


181
tataaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacg
 240






E  L  G  R  P  D  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R


241
gagctggggcggcctgatgccgagtactggaacagccagaaggacctcctggagcagagg
 300






R  A  A  V  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  T  V


301
cgggccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtg
 360






Q  R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H


361
cagcggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcac
 420






H  N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W


421
cacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtgg
 480






F  R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G


481
ttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatgga
 540






D  W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y


541
gattggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttac
 600






T  C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R


601
acctgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacgg
 660






S  E  S  A  Q  R  S  G  G  G  G  S  G  G  T  S  K  E  E  H


661
tctgaatctgcacagagatctggaggtggaggctcaggaggtactagtaaagaagaacat
 720






V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G  E  F  M  F  D


721
gtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgac
 780






F  D  G  D  E  I  F  H  V  D  M  A  K  K  E  T  V  W  R  L


781
tttgatggtgatgagattttccatgtggatatggcaaagaaggagacggtctggcggctt
 840






E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L  A  N  I  A  V


841
gaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtg
 900






D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T  P  I  T  N  V


901
gacaaagccaacctggaaatcatgacaaagcgctccaactatactccgatcaccaatgta
 960






P  P  E  V  T  V  L  T  N  S  P  V  E  L  R  E  P  N  V  L


961
cctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctc
1020






I  C  F  I  D  K  F  T  P  P  V  V  N  V  T  W  L  R  N  G


1021
atctgtttcatcgacaagttcaccccaccagtggtcaatgtcacgtggcttcgaaatgga
1080






K  P  V  T  T  G  V  S  E  T  V  F  L  P  R  E  D  H  L  F


1081
aaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttc
1140






R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V  Y  D  C  R  V


1141
cgcaagttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtg
1200






E  H  W  G  L  D  E  P  L  L  K  H  W  E  F  D  A  P  S  P


1201
gagcactggggcttggatgagcctcttctcaagcactgggagtttgatgcaccaagccct
1260






L  P  E  T  T  E  N  L  L  E  S  R  G  P  F  E  G  K  P  I


1261
ctcccagagactacagagaacttactcgagtctagagggcccttcgaaggtaagcctatc
1320






P  N  P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1321
cctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1380











2. Mutant H2-2 (SEQ ID NOs:25 and 26)











       P  K  Y  V  K  Q  N  T  L  K  L  A  T  G  T  G  G  S  L  V











1
cccaagtatgttaagcaaaacaccctgaagttggcaacaggtaccggtggctcactagtg
  60







P  R  G  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H


61
ccacggggctctggaggaggtgggtccggggacacccgaccacgtttcttgtggcagcat
 120






K  F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I


121
aagtttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatc
 180






Y  N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T


181
tataaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacg
 240






E  L  G  R  P  D  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R


241
gagctggggcggcctgatgccgagtactggaacagccagaaggacctcctggagcagagg
 300






R  A  A  V  D  T  Y  C  K  H  N  Y  G  V  G  E  S  F  T  V


301
cgggccgcggtggacacctactgcaaacacaactacggggttggtgagagcttcacagtg
 360






Q  R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H


361
cagcggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcac
 420






H  N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W


421
cacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtgg
 480






F  R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G


481
ttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatgga
 540






D  W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y


541
gattggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttac
 600






T  C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R


601
acctgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacgg
 660






S  E  S  A  Q  R  S  G  G  G  G  S  G  G  T  S  R  E  E  H


661
tctgaatctgcacagagatctggaggtggaggctcaggaggtactagtagagaagaacat
 720






V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G  E  F  M  F  D


721
gtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgac
 780






F  D  G  D  E  I  F  H  V  D  M  A  K  K  E  T  V  W  R  L


781
tttgatggtgatgagattttccatgtggatatggcaaagaaggagacggtctggcggctt
 840






E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L  A  N  I  A  V


841
gaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtg
 900






D  K  A  N  L  E  I  L  T  K  R  S  N  Y  T  P  I  T  N  V


901
gacaaagccaacctggaaatcttgacaaagcgctccaactatactccgatcaccaatgta
 960






P  P  E  V  T  V  L  T  N  S  P  V  E  L  R  E  P  N  V  L


961
cctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctc
1020






I  C  F  I  D  K  F  T  P  P  V  V  N  V  T  W  L  R  N  G


1021
atctgtttcatcgacaagttcaccccaccagtggtcaatgtcacgtggcttcgaaatgga
1080






K  P  V  T  T  G  V  S  E  T  V  F  L  P  R  E  D  H  L  F


1081
aaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttc
1140






R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V  Y  D  C  R  V


1141
cgcaagttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtg
1200






E  H  W  G  L  D  E  P  L  L  K  H  W  E  F  D  A  P  S  P


1201
gagcactggggcttggatgagcctcttctcaagcactgggagtttgatgcaccaagccct
1260






L  P  E  T  T  E  N  L  L  E  S  R  G  P  F  E  G  K  P  I


1261
ctcccagagactacagagaacttactcgagtctagagggcccttcgaaggtaagcctatc
1320






P  N  P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1321
cctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1380











3. Mutant H2-3 (SEQ ID NOs:27 and 28)











P  K  Y  V  K  Q  N  T  L  K  L  A  T  G  T  G  G  S  L  V











1
cccaagtatgttaagcaaaacaccctgaagttggcaacaggtaccggtggctcactagtg
  60







P  R  G  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H


61
ccacggggctctggaggaggtgggtccggggacacccgaccacgtttcttgtggcagcat
 120






K  F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I


121
aagtttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatc
 180






Y  N  Q  K  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T


181
tataaccaaaaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacn
 240






E  L  G  R  P  D  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R


241
gagctggggcggcctgatgccgagtactggaacagccagaaggacctcctggagcaaagg
 300






R  A  A  V  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  T  V


301
cgggccgccgtggacacctactgcagacacaactacggggttggtgagagcttcacagtg
 360






Q  R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H


361
cagcggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcac
 420






H  N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W


421
cacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtgg
 480






F  R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G


481
ttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatgga
 540






D  W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y


541
gattggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttac
 600






T  C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R


601
acctgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacgg
 660






S  E  S  A  Q  R  S  G  G  G  G  S  G  G  T  S  K  E  E  H


661
tctgaatctgcacagagatctggaggtggaggctcaggaggtactagtaaagaagaacat
 720






V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G  E  F  M  F  D


721
gtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgac
 780






F  D  G  D  E  I  F  H  V  D  M  A  K  K  S  T  V  W  R  L


781
tttgatggtgatgagattttccatgtggatatggcaaagaaggagacggtctggcggctt
 840






E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L  A  N  I  A  V


841
gaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtg
 900






D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T  P  I  T  N  V


901
gacaaagccaacctggaaatcatgacaaagcgctccaactatactccgatcaccaatgta
 960






P  P  E  V  T  V  L  T  N  S  P  V  E  L  R  E  P  N  V  L


961
cctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctc
1020






I  C  F  I  D  K  F  T  P  P  V  V  N  V  T  W  L  R  N  G


1021
atctgtttcatcgacaagttcaccccaccagtggtcaatgtcacgtggcttcgaaatgga
1080






K  P  V  T  T  G  V  S  E  T  V  F  L  P  R  E  D  H  L  F


1081
aaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttc
1140






R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V  Y  D  C  R  V


1141
cgcaagttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtg
1200






E  H  W  G  L  D  S  P  L  L  K  H  W  E  F  D  A  P  S  P


1201
gagcactggggcttggatgagcctcttctcaagcactgggagtttgatgcaccaagccct
1260






L  P  E  T  T  E  N  *  L  E  S  R  G  P  F  E  G  K  P  I


1261
ctcccagagactacagagaactgactcgagtctagagggcccttcgaaggtaagcctatc
1320






R  S  P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1321
cgtagccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1380











4. Mutant H3-3 (SEQ ID NOs:29 and 30)












S  K  Y  V  K  Q  N  T  L  K  L  A  T  G  T  G  G  S  L  V




1
tccaagtatgttaagcaaaacaccctgaagttggcaacaggtaccggtggctctctagtg
  60






P  R  G  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H


61
ccacggggctctggaggaggtgggtccggggacacccgaccacgtttcttgtggcagcat
 120






K  F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I


121
aagtttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatc
 180






Y  N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T


181
tataaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacg
 240






E  L  G  R  P  D  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R


241
gagctggggcggcctgatgccgagtactggaacagccagaaggacctcctggagcagagg
 300






R  A  A  V  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  T  V


301
cgggccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtg
 360






Q  R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H


361
cagcggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcac
 420






H  N  L  L  V  C  S  V  S  G  F  Y  P  G  S  T  E  V  R  W


421
cacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtgg
 480






F  R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G


481
ttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatgga
 540






D  W  T  F  Q  T  L  V  M  L  E  T  V  F  R  S  G  E  V  Y


541
gattggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttac
 600






T  C  Q  V  E  H  P  S  V  T  S  F  L  T  V  E  W  S  A  R


601
acctgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagtgcacgg
 660






S  E  S  A  Q  R  S  G  G  G  G  S  G  G  T  S  K  E  E  H


661
tctgaatctgcacagagatctggaggtggaggctcaggaggtactagtaaagaagaacat
 720






V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G  E  F  M  F  D


721
gtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgac
 780






F  D  S  D  E  T  F  H  V  D  M  A  K  K  E  T  V  W  R  L


781
tttgatagtgatgagactttccatgtggatatggcaaagaaggagacggtctggcggctt
 840






E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L  A  N  I  A  V


841
gaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtg
 900






D  K  A  N  L  H  I  M  T  K  R  S  N  Y  T  P  I  T  N  V


901
gacaaagccaacctggaaatcatgacaaagcgctccaactatactccgatcaccaatgta
 960






P  P  E  V  T  V  L  T  N  S  F  V  E  L  R  E  F  N  V  L


961
cctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctc
1020






I  C  F  I  D  K  F  T  P  P  V  V  N  V  T  W  L  R  N  G


1021
atctgtttcatcgacaagttcaccccaccagtggtcaatgtcacgtggcttcgaaatgga
1080






K  F  V  T  T  G  V  S  E  T  V  F  L  P  R  E  D  H  L  F


1081
aaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttc
1140






R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V  Y  D  C  R  V


1141
cgcaagttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtg
1200






E  H  W  G  L  D  E  P  L  L  K  H  W  E  F  D  A  P  S  F


1201
gagcactggggcttggatgagcctcttctcaagcactgggagtttgatgcaccaagccct
1260






L  P  E  T  T  E  N  L  L  E  S  R  G  P  F  E  G  K  P  I


1261
ctcccagagactacagagaacttactcgagtctagagggcccttcgaaggtaagcctatc
1320






P  N  F  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1321
cctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1380P








For mutants H2-1, H2-2, H2-3 and H3-3, aa1 of α chain is Ser instead Ile and



aa 193 (last amino acid of α chain) is Leu instead Val.





5. Mutant DO-1 (SEQ ID NOs:31 and 32)












R  K  E  E  H  V  I  T  Q  A  E  F  Y  L  N  P  D  Q  S  G




1
aggaaagaagaacatgtgatcacccaggccgagttctatctgaatcctgaccaatcaggc
  60






E  F  M  F  D  F  D  G  D  E  I  F  H  V  D  M  A  K  K  E


61
gagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggag
 120






T  V  W  R  L  E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L


121
acggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattg
 180






A  N  I  A  V  D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T


181
gccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatact
 240






P  I  T  N  V  P  P  E  V  T  V  L  T  N  S  P  V  E  L  R


241
ccgatcaccaatgtacctccagaggtaactgtgctcacgaacagccctgtggaactgaga
 300






E  P  N  V  L  I  C  Y  I  D  K  F  T  P  P  V  V  N  V  T


301
gagcccaacgtcctcatctgttacatcgacaagttcaccccaccagtggtcaatgtcacg
 360






W  L  R  N  G  K  P  V  T  T  G  V  S  E  T  V  F  L  P  R


361
tggcttcgaaatggaaaacctgtcaccacaggagtgtcagagacagtcttcctgcccagg
 420






E  D  H  L  F  R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V


421
gaagaccaccttttccgcaagttccactatctccccttcctgccctcaactgaggacgtt
 480






Y  D  C  R  V  E  H  W  G  L  D  E  P  L  L  K  H  W  E  F


481
tacgactgcagggtggagcactggggcttggatgagcctcttctcaagcactgggagttt
 540






N  A  P  S  P  L  P  E  T  T  E  N  L  G  G  G  G  S  G  G


541
aatgcaccaagccctctcccagagactacagagaacttaggaggcggcggctcaggtggc
 600






G  R  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H  K


601
ggccgctctggcggaggtggatccggggacacccgaccacgtttcttgtggcagcataag
 660






F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I  Y


661
tttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatctat
 720






N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T  E


721
aaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacggag
 780






L  G  R  P  A  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R  R


781
ctggggcggcctgctgccgagtactggaacagccagaaggacctcctggagcagaggcgg
 840






A  A  A  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  T  V  R


841
gccgcggcggacacctactgcagacacaactacggggttggtgagagcttcacagtgcgg
 900






R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H  H


901
cggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccac
 960






N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W  F


961
aacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtggttc
1020






R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G  D


1021
cggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatggagat
1080






W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y  T


1081
tggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacc
1140






C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R  S


1141
tgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacggtct
1200






E  S  A  Q  S  K  L  E  S  R  G  P  F  E  G  K  P  I  P  N


1201
gaatctgcacagagcaagctcgagtctagagggcccttcgaaggtaagcctatccctaac
1260






P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1261
cctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1314











6. Mutant DWP-5 (SEQ ID NOs:33 and 34)












R  K  E  E  H  V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G




1
aggaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggc
  60






E  F  M  F  D  F  D  G  D  E  I  F  H  V  D  M  A  K  K  E


61
gagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggag
 120






T  V  W  R  L  E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L


121
acggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattg
 180






A  N  I  A  V  D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T


181
gccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatact
 240






P  I  T  N  V  P  P  E  V  T  V  L  T  N  S  P  V  E  L  R


241
ccgatcaccaatgtacctccagaggtaactgtgctcacgaacagccctgtggaactgaga
 300






E  P  N  V  L  I  C  F  I  D  K  F  T  P  P  V  V  N  V  T


301
gagcccaacgtcctcatctgtttcatcgacaagttcaccccaccagtggtcaatgtcacg
 360






W  L  R  N  G  K  P  V  T  T  G  V  S  E  T  V  F  L  P  R


361
tggcttcgaaatggaaaacctgtcaccacaggagtgtcagagacagtcttcctgcccagg
 420






D  D  H  L  F  R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V


421
gatgaccaccttttccgcaagttccactatctccccttcctgccctcaactgaggacgtt
 480






Y  D  C  R  V  E  H  W  G  L  D  E  P  L  L  K  H  W  E  F


481
tacgactgcagggtggagcactggggcttggatgagcctcttctcaagcactgggagttt
 540






D  A  P  S  P  L  P  E  T  T  E  N  L  G  G  G  G  S  G  G


541
gatgcaccaagccctctcccagagactacagagaacttaggaggcggcggctcaggtggc
 600






G  R  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  L  K


601
ggccgctctggcggaggtggatccggggacacccgaccacgtttcttgtggcagcttaag
 660






F  E  C  H  F  F  N  G  T  E  R  V  R  F  L  E  R  C  I  Y


661
tttgaatgtcatttcttcaatgggacggagcgggtgcggtttctggaaagatgcatctat
 720






N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T  E


721
aaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacggag
 780






L  G  R  P  D  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R  R


781
ctggggcggcctgatgccgagtactggaacagccagaaggacctcctggagcagaggcgg
 840






A  A  A  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  S  V  R


841
gccgcggcggacacctactgcagacacaactacggggttggtgagagcttctcagtgcgg
 900






R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H  H


901
cggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccac
 960






N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W  F


961
aacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtggttc
1020






R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G  D


1021
cggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatggagat
1080






W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y  T


1081
tggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacc
1140






C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R  S


1141
tgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacggtct
1200






E  S  A  Q  S  K  L  E  S  R  G  P  F  E  G  K  P  I  P  N


1201
gaatctgcacagagcaagctcgagtctagagggcccttcgaaggtaagcctatccctaac
1260






P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1261
cctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1314











7. Mutant DWP-7 (SEQ ID NOs:35 and 36)












R  K  E  E  H  V  I  T  Q  A  E  F  Y  L  N  P  D  Q  S  G




1
aggaaagaagaacatgtgatcacccaggccgagttctatctgaatcctgaccaatcaggc
  60






E  F  M  F  D  F  D  G  D  E  I  F  H  V  D  M  A  K  K  E


61
gagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggag
 120






T  V  W  R  L  E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L


121
acggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattg
 180






A  N  I  A  V  D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T


181
gccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatact
 240






P  I  T  N  V  P  P  E  V  T  V  L  T  N  S  P  V  E  L  R


241
ccgatcaccaatgtacctccagaggtaactgtgctcacgaacagccctgtggaactgaga
 300






E  P  N  V  L  I  C  Y  I  D  K  F  T  P  P  V  V  N  V  T


301
gagcccaacgtcctcatctgttacatcgacaagttcaccccaccagtggtcaatgtcacg
 360






W  L  R  N  G  K  P  V  T  T  G  V  S  E  T  V  F  L  P  R


361
tggcttcgaaatggaaaacctgtcaccacaggagtgtcagagacagtcttcctgcccagg
 420






E  D  H  L  F  R  K  F  H  Y  L  P  F  L  P  S  T  E  D  V


421
gaagaccaccttttccgcaagttccactatctccccttcctgccctcaactgaggacgtt
 480






Y  D  C  R  V  E  H  W  G  L  D  E  P  L  L  K  H  W  E  F


481
tacgactgcagggtggagcactggggcttggatgagcctcttctcaagcactgggagttt
 540






N  A  P  S  P  L  P  E  T  T  E  N  L  G  G  G  G  S  G  G


541
aatgcaccaagccctctcccagagactacagagaacttaggaggcggcggctcaggtggc
 600






G  R  S  G  G  G  G  S  G  D  T  R  P  R  F  L  W  Q  H  K


601
ggccgctctggcggaggtggatccggggacacccgaccacgtttcttgtggcagcataag
 660






F  E  C  H  F  F  N  G  T  E  R  V  R  L  L  E  R  C  I  Y


661
tttgaatgtcatttcttcaatgggacggagcgggtgcggttgctggaaagatgcatctat
 720






N  Q  E  E  S  V  R  F  D  S  D  V  G  E  Y  R  A  V  T  E


721
aaccaagaggagtccgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacggag
 780






L  G  R  P  A  A  E  Y  W  N  S  Q  K  D  L  L  E  Q  R  R


781
ctggggcggcctgctgccgagtactggaacagccagaaggacctcctggagcagaggcgg
 840






A  A  A  D  T  Y  C  R  H  N  Y  G  V  G  E  S  F  T  V  R


841
gccgcggcggacacctactgcagacacaactacggggttggtgagagcttcacagtgcgg
 900






R  R  V  E  P  K  V  T  V  Y  P  S  K  T  Q  P  L  Q  H  H


901
cggcgagttgagcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccac
 960






N  L  L  V  C  S  V  S  G  F  Y  P  G  S  I  E  V  R  W  F


961
aacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtggttc
1020






R  N  G  Q  E  E  K  A  G  V  V  S  T  G  L  I  Q  N  G  D


1021
cggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatggagat
1080






W  T  F  Q  T  L  V  M  L  E  T  V  P  R  S  G  E  V  Y  T


1081
tggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacc
1140






C  Q  V  E  H  P  S  V  T  S  P  L  T  V  E  W  R  A  R  S


1141
tgccaagtggagcacccaagtgtgacgagccctctcacagtggaatggagagcacggtct
1200






E  S  A  Q  S  K  L  E  S  R  G  P  F  E  G  K  P  I  P  N


1201
gaatctgcacagagcaagctcgagtctagagggcccttcgaaggtaagcctatccctaac
1260






P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H  H  *


1261
cctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattga
1314








For mutants DO-1, DWP-5 and DWP-7, aal of α domain is Arg instead Ile and



aa 193 (last amino acid of α chain) is Leu instead Val.
















TABLE 2





DNA and amino acid sequences of the wild type scβ1α1 (A) and


the engineered scβ1α1 mutant (B).
















A. Wild-type scβ1α1 (SEQ ID NOs:37 and 38)



    G  D  T  R  P  R  F  L  W  Q  L  K  F  E  C  H  F  F  N  G



  1 ggggacacccgaccacgtttcttgtggcagcttaagtttgaatgtcatttcttcaatggg  60





   T  E  R  V  R  L  L  E  R  C  I  Y  N  Q  E  E  S  V  R  F


61 acggagcgggtgcggttgctggaaagatgcatctataaccaagaggagtccgtgcgcttc 120






    D  S  D  V  G  E  Y  R  A  V  T  E  L  G  R  P  D  A  E  Y




121 gacagcgacgtgggggagtaccgggcggtgacggagctggggcggcctgatgccgagtac 180







    W  N  S  Q  K  D  L  L  E  Q  R  R  A  A  V  D  T  Y  C  R




181 tggaacagccagaaggacctcctggagcagaggcgggccgcggtggacacctactgcaga 240







    H  N  Y  G  V  G  E  S  F  T  V  Q  R  R  V  G  S  G  G  T




241 cacaactacggggttggtgagagcttcacagtgcagcggcgagttggctcaggaggtact 300






    S  K  E  E  H  V  I  I  Q  A  E  F  Y  L  N  P  D  Q  S  G



301 agtaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggc 360






    E  F  M  F  D  F  D  G  D  E  I  F  H  V  D  M  A  K  K  E



361 gagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggag 420






    T  V  W  R  L  E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L



421 acggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattg 480






    A  N  I  A  V  D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T



481 gccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatact 540






    P  I  T  N


541 ccgatcaccaat                                                 552


β1 domain underlined and α1 domain in bold.



Aal of α1 is Ser instead Ile.










B. mutant scβ1α1Lβ11H,Iα8T(SEQ ID NOs:39 and 40)


    G  D  T  R  P  R  F  L  W  Q  H  K  F  E  C  H  F  F  N  G


  1 ggggacacccgaccacgtttcttgtggcagcataagtttgaatgtcatttcttcaatggg  60





    T  E  R  V  R  L  L  E  R  C  I  Y  N  Q  E  E  S  V  R  F


 61 acggagcgggtgcggttgctggaaagatgcatctataaccaagaggagtccgtgcgcttc 120





    D  S  D  V  G  E  Y  R  A  V  T  E  L  G  R  P  D  A  E  Y


121 gacagcgacgtgggggagtaccgggcggtgacggagctggggcggcctgatgccgagtac 180





    W  N  S  Q  K  D  L  L  E  Q  R  R  A  A  V  D  T  Y  C  R


181 tggaacagccagaaggacctcctggagcagaggcgggccgcggtggacacctactgcaga 240





    H  N  Y  G  V  G  E  S  F  T  V  Q  R  R  V  G  S  G  G  T


241 cacaactacggggttggtgagagcttcacagtgcagcggcgagttggctcaggaggtact 300





    S  K  E  E  H  V  I  T  Q  A  E  F  Y  L  N  P  D  Q  S  G


301 agtaaagaagaacatgtgatcacccaggccgagttctatctgaatcctgaccaatcaggc 360





    E  F  M  F  D  F  D  G  D  E  I  F  H  V  D  M  A  K  K  E


361 gagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggag 420





    T  V  W  R  L  E  E  F  G  R  F  A  S  F  E  A  Q  G  A  L


421 acggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattg 480





    A  N  I  A  V  D  K  A  N  L  E  I  M  T  K  R  S  N  Y  T


481 gccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatact 540





    P  I  T  N


541 ccgatcaccaat                                                 552
















TABLE 3





DNA and amino acid sequences of two forms of single chain HLA-A2 molecules.
















A. scHLA-A2 (SEQ ID NOs:41 and 42)












M  I  Q  R  T  P  K  I  Q  V  Y  S  R  H  P  A  E  N  G  K




1
atgatccagcgtactccaaagattcaggtttactcacgtcatccagcagagaatggaaag
60






S  N  F  L  N  C  Y  V  S  G  F  H  P  S  D  I  E  V  D  L


61
tcaaatttcctgaattgctatgtgtctgggtttcatccatccgacattgaagttgactta
120






L  K  N  G  E  R  I  E  K  V  E  H  S  D  L  S  F  S  K  D


121
ctgaagaatggagagagaattgaaaaagtggagcattcagacttgtctttcagcaaggac
180






W  S  F  Y  L  L  Y  Y  T  E  F  T  P  T  E  K  D  E  Y  A


181
tggtctttctatctcttgtactacactgaattcacccccactgaaaaagatgagtatgcc
240






C  R  V  N  H  V  T  L  S  Q  P  E  I  V  K  W  D  R  D  M


241
tgccgtgtgaaccatgtgactttgtcacagcccgagatagttaagtgggatcgagacatg
300






G  G  G  G  S  G  G  G  G  S  G  G  G  G  S  G  S  H  S  M


301
ggaggcggcggctcgggtggcggcggctctggcggaggtggatccggctctcactccatg
360






R  Y  F  F  T  S  V  S  R  P  G  R  G  E  P  R  F  I  A  V


361
aggtatttcttcacatccgtgtcccggcccggccgcggggagccccgcttcatcgcagtg
420






G  Y  V  D  D  T  Q  F  V  R  F  D  S  D  A  A  S  Q  R  M


421
ggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagccagaggatg
480






E  P  R  A  P  W  I  E  Q  E  G  P  E  Y  W  D  G  E  T  R


481
gagccgcgggcgccgtggatagagcaggagggtccggagtattgggacggggagacacgg
540






K  V  K  A  H  S  Q  T  H  R  V  D  L  G  T  L  R  G  Y  Y


541
aaagtgaaggcccactcacagactcaccgagtggacctggggaccctgcgcggctactac
600






N  Q  S  E  A  G  S  H  T  V  Q  R  M  Y  G  C  D  V  G  S


601
aaccagagcgaggccggttctcacaccgtccagaggatgtatggctgcgacgtggggtcg
660






D  W  R  F  L  R  G  Y  H  Q  Y  A  Y  D  G  K  D  Y  I  A


661
gactggcgcttcctccgcgggtaccaccagtacgcctacgacggcaaggattacatcgcc
720






L  K  E  D  L  R  S  W  T  A  A  D  M  A  A  Q  T  T  K  H


721
ctgaaagaggacctgcgctcttggaccgcggcggacatggcagctcagaccaccaagcac
780






K  W  E  A  A  H  V  A  E  Q  L  R  A  Y  L  E  G  T  C  V


781
aagtgggaggcggcccatgtggcggagcagttgagagcctacctggagggcacgtgcgtg
840






E  W  L  R  R  Y  L  E  N  G  K  E  T  L  Q  R  T  D  A  P


841
gagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcacggacgccccc
900






K  T  H  M  T  H  H  A  V  S  D  H  E  A  T  L  R  C  W  A


901
aaaacgcatatgactcaccacgctgtctctgaccatgaagccaccctgaggtgctgggcc
960






L  S  F  Y  P  A  E  I  T  L  T  W  Q  R  D  G  E  D  Q  T


961
ctgagcttctaccctgcggagatcacactgacctggcagcgggatggggaggaccagacc
1020






Q  D  T  E  L  V  E  T  R  P  A  G  D  G  T  F  Q  K  W  A


1021
caggacacggagctcgtggagaccaggcctgcaggggatggaaccttccagaagtgggcg
1080






A  V  V  V  P  S  G  Q  E  Q  R  Y  T  C  H  V  Q  H  E  G


1081
gctgtggtggtgccttctggacaggagcagagatacacctgccatgtgcagcatgagggt
1140






L  P  K  P  L  T  L  R  W  E  L  E  S  R  G  P  F  E  G  K


1141
ttgcccaagcccctcaccctgagatgggaactcgagtctagagggcccttcgaaggtaag
1200






P  I  P  N  P  L  L  G  L  D  S  T  R  T  G  H  H  H  H  H


1201
cctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcac
1260






H  *


1261
cattga
1266











B. pbsHLA-A2 (SEQ ID NOs:43 and 44)












M  G  S  H  S  M  R  Y  F  F  T  S  V  S  R  P  G  R  G  E




1
atgggctctcactccatgaggtatttcttcacatccgtgtcccggcccggccgcggggag
60






P  R  F  I  A  V  G  Y  V  D  D  T  Q  F  V  R  F  D  S  D


61
ccccgcttcatcgcagtgggctacgtggacgacacgcagttcgtgcggttcgacagcgac
120






A  A  S  Q  R  M  E  P  R  A  P  W  I  E  Q  E  G  P  E  Y


121
gccgcgagccagaggatggagccgcgggcgccgtggatagagcaggagggtccggagtat
180






W  D  G  E  T  R  K  V  K  A  H  S  Q  T  H  R  V  D  L  G


181
tgggacggggagacacggaaagtgaaggcccactcacagactcaccgagtggacctgggg
240






T  L  R  G  Y  Y  N  Q  S  E  A  G  S  H  T  V  Q  R  M  Y


241
accctgcgcggctactacaaccagagcgaggccggttctcacaccgtccagaggatgtat
300






G  C  D  V  G  S  D  W  R  F  L  R  G  Y  H  Q  Y  A  Y  D


301
ggctgcgacgtggggtcggactggcgcttcctccgcgggtaccaccagtacgcctacgac
360






G  K  D  Y  I  A  L  K  E  D  L  R  S  W  T  A  A  D  M  A


361
ggcaaggattacatcgccctgaaagaggacctgcgctcttggaccgcggcggacatggca
420






A  Q  T  T  K  H  K  W  E  A  A  H  V  A  E  Q  L  R  A  Y


421
gctcagaccaccaagcacaagtgggaggcggcccatgtggcggagcagttgagagcctac
480






L  E  G  T  C  V  E  W  L  R  R  Y  L  E  N  G  K  E  T  L


481
ctggagggcacgtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctg
540






Q


541
cag
543









REFERENCES



  • Pandey, A. and M. Mann, Nature, 2000. 405(6788): p. 837-46.

  • Gygi, S. P., et al., Nat Biotechnol, 1999. 17(10): p. 994-9.

  • Emili, A. Q. and G. Cagney, Nat Biotechnol, 2000. 18(4): p. 393-7.

  • de Wildt, R. M., et al., Nat Biotechnol, 2000. 18(9): p. 989-94.

  • Cahill, D. J., J Immunol Methods, 2001. 250(1-2): p. 81-91.

  • Stanfield, R. L. and I. A. Wilson, Curr Opin Struct Biol, 1995. 5(1): p. 103-13.

  • Schneider, S., et al., Nat Biotechnol, 1999. 17(2): p. 170-5.

  • Madden, D. R., Annu Rev Immunol, 1995. 13: p. 587-622.

  • Pinilla, C., et al., Curr Opin Immunol, 1999. 11(2): p. 193-202.

  • Stern, L. J. and D. C. Wiley, Cell, 1992. 68(3): p. 465-77.

  • Arnold, F. H., F. M. Richards, and D. Eisenberg, eds. Advanced Protein Chemistry. Vol. 55. 2001, Academic Press.

  • Zhu, X., et al., Eur J Immunol, 1997. 27(8): p. 1933-41.

  • Crameri, A., et al., Nature, 1998. 391(6664): p. 288-91.

  • Shusta, E. V., et al., J Mol Biol, 1999. 292(5): p. 949-56.

  • Leary, J. F., Methods Cell Biol, 1994. 42(Pt B): p. 331-58.

  • Townsend, A. R., et al., The epitopes of influenza nucleoprotein recognized by cytotoxic T lymphocytes can be defined with short synthetic peptides. Cell, 1986. 44(6): p. 959-68.

  • Buus, S., Description and prediction of peptide-MHC binding: the ‘human MHC project’. Curr Opin Immunol, 1999. 11(2): p. 209-13.

  • Garboczi, D. N., D. R. Madden, and D. C. Wiley, Five viral peptide-HLA-A2 co-crystals. Simultaneous space group determination and X-ray data collection. J Mol Biol, 1994. 239(4): p. 581-7.

  • Garboczi, D. N., D. T. Hung, and D. C. Wiley, HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides. Proc Natl Acad Sci USA, 1992. 89(8): p. 3429-33.

  • Boder, E. T. and K. D. Wittrup, Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol, 1997. 15(6): p. 553-7.

  • Arnold, F. H., Design by directed evolution. Acct. Chem. Res., 1998. 31(3): p. 125-131.

  • Lin, Z., T. Thorsen, and F. H. Arnold, Functional expression of horseradish peroxidase in E. coli by directed evolution. Biotechnol Prog, 1999. 15(3): p. 467-71.

  • Kieke, M. C., et al., Selection of functional T cell receptor mutants from a yeast surface-display library. Proc Natl Acad Sci USA, 1999. 96(10): p. 5651-6.

  • Madden, D. R., D. N. Garboczi, and D. C. Wiley, The antigenic identity of peptide-MHC complexes: a comparison of the conformations of five viral peptides presented by HLA-A2. Cell, 1993. 75(4): p. 693-708.

  • Joshi, R. V., J. A. Zarutskie, and L. J. Stern, A three-step kinetic mechanism for peptide binding to MHC class II proteins. Biochemistry, 2000. 39(13): p. 3751-62.

  • Zhao, H., et al., Methods for optimizing industrial enzymes by directed evolution, in Manual of Industrial Microbiology and Biotechnology, 2nd Ed., A. L. Demain and J. E. Davies, Editors. 1999, ASM Press: Washington, D.C. p. 597-604.

  • VanAntwerp, J. J. and K. D. Wittrup, Fine affinity discrimination by yeast surface display and flow cytometry. Biotechnol Prog, 2000. 16(1): p. 31-7.

  • Tissot, A. C., et al., Viral escape at the molecular level explained by quantitative T-cell Receptor/Peptide/MHC interactions and the crystal structure of a Peptide/MHC complex. J Mol Biol, 2000. 302(4): p. 873-85.

  • Bertoletti, A., et al., Natural variants of cytotoxic epitopes are T-cell receptor antagonists for antiviral cytotoxic T cells. Nature, 1994. 369(6479): p. 407-10.

  • Klenerman, P., et al., Cytotoxic T-cell activity antagonized by naturally occurring HIV-1 Gag variants. Nature, 1994. 369(6479): p. 403-7.

  • Jain, R. K. and L. T. Baxter, Mechanisms of heterogeneous distribution of monoclonal antibodies and other macromolecules in tumors: significance of elevated interstitial pressure. Cancer Res, 1988. 48(24 Pt 1): p. 7022-32.

  • Strominger, J. L., and Wiley, D. C. (1995) JAMA 274, 1074-1076

  • Tiwari, J. L., and Terasaki, P. I. (1981) Prog Clin Biol Res 58, 151-163

  • Singh, N., Agrawal, S., and Rastogi, A. K. (1997) Emerging Infectious Diseases 3, 41-49

  • Maile, R., Wang, B., Schooler, W., Meyer, A., Collins, E. J., and Frelinger, J. A. (2001) J Immunol 167, 3708-3714

  • Casares, S., Hurtado, A., McEvoy, R. C., Sarukhan, A., von Boehmer, H., and Brumeanu, T. D. (2002) Nat Immunol 3, 383-391

  • Masteller, E. L., Warner, M. R., Ferlin, W., Judkowski, V., Wilson, D., Glaichenhaus, N., and Bluestone, J. A. (2003) J Immunol 171, 5587-5595

  • Sharma, S. D., Nag, B., Su, X. M., Green, D., Spack, E., Clark, B. R., and Sriram, S. (1991) Proc Natl Acad Sci USA 88, 11465-11469

  • Kwok, W. W., Ptacek, N. A., Liu, A. W., and Buckner, J. H. (2002) J Immunol Methods 268, 71-81

  • Boehncke, W. H., Takeshita, T., Pendleton, C. D., Houghten, R. A., Sadegh-Nasseri, S., Racioppi, L., van der Burg, S. H., Visseren, M. J., Brandt, R. M., Kast, W. M., and Melief, C. J. (1996) J Immunol 156, 3308-3314

  • Hackett, C. J., and Sharma, O. K. (2002) Nat Immunol 3, 887-889

  • Arnold, F. H. (2001) Nature 409, 253-257

  • Schmidt-Dannert, C. (2001) Biochemistry 40, 13125-13136

  • Waldo, G. S. (2003) Curr Opin Chem Biol 7, 33-38

  • Pedelacq, J. D., Piltch, E., Liong, E. C., Berendzen, J., Kim, C. Y., Rho, B. S., Park, M. S., Terwilliger, T. C., and Waldo, G. S. (2002) Nat Biotechnol 20, 927-932

  • Bulter, T., Alcalde, M., Sieber, V., Meinhold, P., Schlachtbauer, C., and Arnold, F. H. (2003) Appl Environ Microbiol 69, 987-995

  • Kalandadze, A., Galleno, M., Foncerrada, L., Strominger, J. L., and Wucherpfennig, K. W. (1996) Journal of Biological Chemistry 271, 20156-20162

  • Scott, C. A., Garcia, K. C., Carbone, F. R., Wilson, I. A., and Teyton, L. (1996) J Exp Med 183, 2087-2095

  • Kozono, H., White, J., Clements, J., Marrack, P., and Kappler, J. (1994) Nature 369, 151-154

  • Scheirle, A., Takacs, B., Kremer, L., Marin, F., and Sinigaglia, F. (1992) J Immunol 149, 1994-1999

  • Boder, E. T., and Wittrup, K. D. (1998) Biotechnol Prog 14, 55-62.

  • Yeung, Y. A., and Wittrup, K. D. (2002) Biotechnol Prog 18, 212-220

  • Wittrup, K. D. (2001) Curr Opin Biotechnol 12, 395-399

  • Boder, E. T., Midelfort, K. S., and Wittrup, K. D. (2000) Proc Natl Acad Sci USA 97, 10701-10705

  • Feldhaus, M. J., Siegel, R. W., Opresko, L. K., Coleman, J. R., Feldhaus, J. M., Yeung, Y. A., Cochran, J. R., Heinzelman, P., Colby, D., Swers, J., Graff, C., Wiley, H. S., and Wittrup, K. D. (2003) Nat Biotechnol 21, 163-170

  • Kieke, M. C., Cho, B. K., Boder, E. T., Kranz, D. M., and Wittrup, K. D. (1997) Protein Eng 10, 1303-1310

  • Holler, P. D., Holman, P. O., Shusta, E. V., O'Herrin, S., Wittrup, K. D., and Kranz, D. M. (2000) Proceedings of the National Academy of Sciences of the United States of America 97, 5387-5392

  • Kieke, M. C., Shusta, E. V., Boder, E. T., Teyton, L., Wittrup, K. D., and Kranz, D. M. (1999) Proc Natl Acad Sci USA 96, 5651-5656

  • Kieke, M. C., Sundberg, E., Shusta, E. V., Mariuzza, R. A., Wittrup, K. D., and Kranz, D. M. (2001) J Mol Biol 307, 1305-1315

  • Starwalt, S. E., Masteller, E. L., Bluestone, J. A., and Kranz, D. M. (2003) Protein Eng 16, 147-156

  • Schweickhardt, R. L., Jiang, X., Garone, L. M., and Brondyk, W. H. (2003) J Biol Chem 278, 28961-28967

  • Horton, R. M., Ho, S. N., Pullen, J. K., Hunt, H. D., Cai, Z., and Pease, L. R. (1993) Methods Enzymol 217, 270-279

  • Oldenburg, K. R., Vo, K. T., Michaelis, S., and Paddon, C. (1997) Nucleic Acids Res 25, 451-452

  • Prado, F., and Aguilera, A. (1994) Current Genetics 25, 180-183

  • Zhao, H., Giver, L., Shao, Z., Affholter, J. A., and Arnold, F. H. (1998) Nat Biotechnol 16, 258-261

  • Gietz, R. D., and Woods, R. A. (2002) Guide to Yeast Genetics and Molecular and Cell Biology, Pt B 350, 87-96

  • Orr, B. A., Carr, L. M., Wittrup, K. D., Roy, E. J., and Kranz, D. M. (2003) Biotechnol Prog 19, 631-638

  • Stern, L. J., Brown, J. H., Jardetzky, T. S., Gorga, J. C., Urban, R. G., Strominger, J. L., and Wiley, D. C. (1994) Nature 368, 215-221

  • Shusta, E. V., Holler, P. D., Kieke, M. C., Kranz, D. M., and Wittrup, K. D. (2000) Nat Biotechnol 18, 754-759

  • Adams, T. E., Bodmer, J. G., and Bodmer, W. F. (1983) Immunology 50, 613-624

  • Boder, E. T., and Wittrup, K. D. (2000) Methods Enzymol 328, 430-444

  • Zhao, H., Shen, Z. M., Kahn, P. C., and Lipke, P. N. (2001) J Bacteriol 183, 2874-2880

  • LaPan, K. E., Klapper, D. G., and Frelinger, J. A. (1992) Hybridoma 11, 217-223

  • Santambrogio, L., Sato, A. K., Fischer, F. R., Dorf, M. E., and Stern, L. J. (1999) Proc Natl Acad Sci USA 96, 15050-15055

  • Busch, R., and Rothbard, J. B. (1990) Journal of Immunological Methods 134, 1-22

  • Frayser, M., Sato, A. K., Xu, L., and Stern, L. J. (1999) Protein Expr Purif 15, 105-114

  • Ueda, M., and Tanaka, A. (2000) Biotechnology Advances 18, 121-140

  • Hammond, C., and Helenius, A. (1994) J Cell Biol 126, 41-52

  • Chang, J. W., Mechling, D. E., Bachinger, H. P., and Burrows, G. G. (2001) Journal of Biological Chemistry 276, 24170-24176

  • Burley, S. K., and Petsko, G. A. (1986) Febs Letters 203, 139-143

  • Burley, S. K., and Petsko, G. A. (1988) Adv Protein Chem 39, 125-189

  • Zauhar, R. J., Colbert, C. L., Morgan, R. S., and Welsh, W. J. (2000) Biopolymers 53, 233-248

  • Reid, K. S. C., Lindley, P. F., and Thornton, J. M. (1985) FEBS Lett 190, 209-213

  • Todd, J. A., Bell, J. I., and Mcdevitt, H. O. (1987) Nature 329, 599-604

  • Sato, A. K., Stumiolo, T., Sinigaglia, F., and Stern, L. J. (1999) Hum Immunol 60, 1227-1236

  • Waldburger, C. D., Jonsson, T., and Sauer, R. T. (1996) Proceedings of the National Academy of Sciences of the United States of America 93, 2629-2634

  • Doebele, R. C., Pashine, A., Liu, W., Zaller, D. M., Belmares, M., Busch, R., and Mellins, E. D. (2003) Journal of Immunology 170, 4683-4692

  • Sato, A. K., Zarutskie, J. A., Rushe, M. M., Lomakin, A., Natarajan, S. K., Sadegh-Nasseri, S., Benedek, G. B., and Stern, L. J. (2000) Journal of Biological Chemistry 275, 2165-2173

  • Natarajan, S. K., Assadi, M., and Sadegh-Nasseri, S. (1999) Journal of Immunology 162, 4030-4036

  • Ferlin, W., Glaichenhaus, N., and Mougneau, E. (2000) Current Opinion in Immunology 12, 670-675

  • Shusta, E. V., Raines, R. T., Pluckthun, A., and Wittrup, K. D. (1998) Nature Biotechnology 16, 773-777

  • U.S. Pat. No. 6,391,625 (May 21, 2002); WO 02/54070; WO 01/83827


Claims
  • 1. A universal peptide or protein binding scaffold comprising: a library of mutants of a peptide or protein binding scaffold of MHC class II DR1 peptide binding domains having an affinity for a ligand between 10−6 and 10−9 molar and having a point mutation L11H in the β1 domain.
  • 2. The scaffold of claim 1, wherein the library of mutants is displayed on a yeast cell surface.
  • 3. The scaffold of claim 1, wherein the scaffold is presented in a protein chip.
  • 4. A protein chip comprising: a substrate and mutants of a peptide or protein binding scaffold of MHC class II DR1 peptide binding domains having a point mutation L11H in the β1 domain bound to the substrate, wherein the peptide has an affinity for a ligand between 10−6 and 10−9 molar.
  • 5. The protein chip of claim 4, wherein the mutants are bound to the substrate in a pattern.
  • 6. The protein chip of claim 4, wherein the substrate is selected from the group consisting of: glass, polycarbonate, polytetrafluoroethylene, polystyrene, silicon oxide and silicon nitride.
  • 7. A method of selecting proteins or peptides that bind to a peptide binding scaffold comprising: preparing a library of mutants of a peptide binding domain of MHC class II peptide binding domains having a point mutation L11H in the β1 domain; contacting said library with labeled peptides or proteins; and selecting those mutants that bind to labeled peptides or proteins with a desired affinity.
  • 8. The method of claim 7, wherein the peptide binding domain is a DR1 protein variant of a MHC class II binding domain.
  • 9. The method of claim 7, wherein the desired affinity is between 10−6 and 10−9 molar.
  • 10. The method of claim 7, wherein the selection is performed by fluorescence activated cell sorting.
  • 11. The method of claim 7, wherein the library of mutants is displayed on a yeast cell surface.
  • 12. The method of claim 7, further comprising selecting those mutants having the highest fluorescence.
  • 13. The method of claim 7, wherein the library of mutants is in the form of protein chips.
  • 14. The method of claim 13, wherein the protein chips are in a high throughput format.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. provisional application 60/538,959, filed Jan. 23, 2004, which is hereby incorporated by reference to the extent not inconsistent with the disclosure herewith.

US Referenced Citations (5)
Number Name Date Kind
6300065 Kieke et al. Oct 2001 B1
6391625 Park et al. May 2002 B1
6423538 Wiltrup et al. Jul 2002 B1
7049413 Zhang et al. May 2006 B2
20020165149 Kranz et al. Nov 2002 A1
Foreign Referenced Citations (2)
Number Date Country
WO 0183827 Nov 2001 WO
WO 02054070 Jul 2002 WO
Related Publications (1)
Number Date Country
20050191706 A1 Sep 2005 US
Provisional Applications (1)
Number Date Country
60538959 Jan 2004 US