Use of a BMP protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II BMP receptor and type I BMP receptor

Abstract

The present invention relates to a method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex. The invention further relates to a method for determining the concentration of a BMP receptor ligand in a clinical sample. The invention also relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for the BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for a soluble or incomplete BMP type I receptor kinase protein and a soluble or incomplete BMP receptor kinase protein BRK-3. The invention further relates to a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex.

Description

TECHNICAL FIELD

The present invention relates to the field of bone formation and development. Specifically, the present invention relates to the use of a new bone morphogenetic protein type II receptor, together with a bone morphogenetic type I receptor, for screening bone metabolism actives. The invention further relates to cells co-transfected with DNA coding for this receptor and DNA coding for a type I bone morphogenetic protein receptor.

BACKGROUND

Humans and other warm-blooded animals can be afflicted by a number of bone-related disorders. Such disorders range from bone fractures, to debilitating diseases such as osteoporosis. While in healthy individuals bone growth generally proceeds normally and fractures heal without the need for pharmacological intervention, in certain instances bones may become weakened or may fail to heal properly. For example, healing may proceed slowly in the elderly and in patients undergoing treatment with corticosteroids (e.g., transplant patients). Osteoporosis is a condition in which bone hard tissue is lost disproportionately to the development of new hard tissue. Osteoporosis can generally be defined as the reduction in the quantity of bone, or the atrophy of skeletal tissue; marrow and bone spaces become larger, fibrous binding decreases, and compact bone becomes fragile. Another bone related disorder is osteoarthritis, which is a disorder of the movable joints characterized by deterioration and abrasion of articular cartilage, as well as by formation of new bone at the joint surface.

While a variety of treatments are available for such bone-related disorders, none of the treatments provide optimum results. One of the difficulties facing individuals who treat bone-related disorders is a lack of complete understanding of bone metabolism and of the bone-related disorders. A key to such understanding is identifying and characterizing each of the components involved in bone growth. Bone morphogenetic proteins (BMPs) have been demonstrated to play a role in bone formation and development (J. M. Wozney, Molec. Reproduct. and Develop., 32: 160-167 (1992)).

Furthermore, the role of BMPs may not be limited to their role in bone. The finding that the BMPs are found at significant concentrations in other tissues such as brain, kidney, stratified squamous epithelia, and hair follicle (N. A. Wall, M. Blessing, C. V. E. Wright, and B. L. M. Hogan, J. Cell Biol., 120: 493-502 (1993); E. Özkaynak, P. N. J. Schnegelsberg, D. F. Jin, G. M. Clifford, F. D. Warren, E. A. Drier, and H. Oppermann, J. Biol. Chem., 267: 25220-25227 (1992); K. M. Lyons, C. M. Jones, and B. L. M. Hogan, Trends in Genetics, 7: 408-412 (1991); V. Drozdoff, N. A. Wall, and W. J. Pledger, Proceedings of the National. Academy of Sciences, U.S.A., 91: 5528-5532 (1994)) suggests that they may play additional roles in development and differentiation. In support of this, BMPs have recently been found to promote nerve cell differentiation and to affect hair follicle formation (K. Basler, T. Edlund, T. M. Jessell, and T. Yamada, Cell, 73: 687-702 (1993); V. M. Paralkar, B. S. Weeks, Y. M. Yu, H. K. Kleinman, and A. H. Reddi, J. Cell Biol., 119: 1721-1728 (1992); M. Blessing, L. B. Nanney, L. E. King, C. M. Jones, and B. L. Hogan, Genes Dev., 7: 204-215 (1993)).

A BMP initiates its biological effect on cells by binding to a specific BMP receptor expressed on the plasma membrane of a BMP-responsive cell. A receptor is a protein, usually spanning the cell membrane, which binds to a ligand from outside the cell, and as a result of that binding sends a signal to the inside of the cell which alters cellular function. In this case, the ligand is the protein BMP, and the signal induces the cellular differentiation.

Because of the ability of a BMP receptor to specifically bind BMPs, purified BMP receptor compositions are useful in diagnostic assays for BMPs, as well as in raising antibodies to the BMP receptor for use in diagnosis and therapy. In addition, purified BMP receptor compositions may be used directly in therapy to bind or scavenge BMPs, thereby providing a means for regulating the activities of BMPs in bone and other tissues. In order to study the structural and biological characteristics of BMP receptors and the role played by BMPs in the responses of various cell populations to BMPs during tissue growth/formation stimulation, or to use a BMP receptor effectively in therapy, diagnosis, or assay, purified compositions of BMP receptor are needed. Such compositions, however, are obtainable in practical yields only by cloning and expressing genes encoding the receptors using recombinant DNA technology. Efforts to purify BMP receptors for use in biochemical analysis or to clone and express mammalian genes encoding BMP receptors have been impeded by lack of a suitable source of receptor protein or mRNA. Prior to the present invention, few cell lines were known to express high levels of high affinity BMP receptors which precluded purification of the receptor for protein sequencing or construction of genetic libraries for direct expression cloning. Availability of the BMP receptor sequence will make it possible to generate cell lines with high levels of recombinant BMP receptor for biochemical analysis and use in screening experiments.

The BMPs are members of the TGF-β superfamily. Other members of the TGF-β superfamily include TGF-β, activins, inhibins, Müllerian Inhibiting Substance, and the Growth and Differentiation Factors (GDFs). As expected, the receptors for various members of the TGF-β superfamily share similar structural features. Receptors of the TGF-β ligand superfamily are typically classified into one of two sub-groups, designated as type I and type II. The type I and type II receptors are classified as such based on amino acid sequence characteristics. Both the type I and type II receptors possess a relatively small extracellular ligand binding domain, a transmembrane region, and an intracellular protein kinase domain that is predicted to have serine/threonine kinase activity (Lin and Moustakas, Cellular and Molecular Biology, 40: 337-349 (1994); L. S. Mathews, Endocrine Reviews, 15: 310-325 (1994); L. Attisano, J. L. Wrana, F. López-Casillas, , and J. Massagué, Biochimica et Biophysica Acta, 1222: 71-80 (1994)).

The type I receptors cloned to date belong to a distinct family whose kinase domains are highly related and share >85% sequence similarity (B. B. Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994)). The intracellular juxtamembrane region of the type I receptors is characterized by an SGSGSG motif 35-40 amino acids from the transmembrane region, and the carboxy terminus of these receptors is extremely short (B. B. Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994); L. Attisano, J. L. Wrana, F. López-Casillas, and J. Massagué, Biochimica et Biophysica Acta, 1222: 71-80 (1994)). The extracellular domain of the type I receptors contains a characteristic cluster of cysteine residues, termed the “cysteine box”, located within 25-30 amino acids of the transmembrane region, and another cluster of cysteine residues, termed the “upstream cysteine box”, located after the putative signal sequence (B. B. Koenig, et al., Molecular and Cellular Biology, 14: 5961-5974 (1994); L. Attisano, et al., Biochimica et Biophysica Acta, 1222: 71-80 (1994)).

In contrast to the type I receptors, the kinase domains of the type II receptors are only distantly related to one another. The SGSGSG motif found in type I receptors is not found in type II receptors. Also, the “upstream cysteine box” of type I receptors is not present in type II receptors. Furthermore, while all of the activin type II receptors contain a proline-rich sequence motif in the intracellular juxtamembrane region, there is no characteristic sequence motif that is common to all type II receptors (L. S. Mathews, Endocrine Reviews, 15: 310-325 (1994)). The length of the carboxy terminus of the type II receptors is considerably variable, with the longest known carboxy terminus being found in the BMP type II receptor, DAF-4 (M. Estevez, L. Attisano, J. L. Wrana, P. S. Albert, J. Massagué, and D. L. Riddle, Nature, 365: 644-49 (1993)), that was cloned from the nematode C. elegans. The extracellular domain of the type II receptors contains a single cysteine box located near the transmembrane region. Aside from the presence of the cysteine box, there is little sequence similarity amongst the extracellular domains of the type II receptors for TGF-β, activin, and BMPs.

Signaling by members of the TGF-β ligand superfamily requires the presence of both type I and type II receptors on the surface of the same cell (L. S. Mathews, Endocrine Reviews, 15: 310-325 (1994); L. Attisano, J. L. Wrana, F. López-Casillas, and J. Massagué, Biochimica et Biophysica Acta, 1222: 71-80 (1994)). The BMPs are members of the TGF-β ligand superfamily; given the high degree of structural similarity among these family members, it is expected that their receptors will be structurally and functionally related to the TGF-β and activin receptors. It is anticipated that, like the TGF-β and activin receptor systems (J. Massagué, L. Attisano, and J. L. Wrana, Trends in Cell Biology, 4: 172-178 (1994)), both a BMP type I receptor and a BMP type II receptor will be needed in order to transduce a BMP signal within a cell or tissue. Hence, there is a need for a mammalian type II BMP receptor kinase protein in addition to the type I receptors that have already been cloned.

Three distinct mammalian type I receptors have been reported for the BMPs: Bone Morphogenetic Protein Receptor Kinase-1 (herein referred to as “BRK-1”) (see U.S. Ser. No. 08/158,735, filed Nov. 24, 1993 by J. S. Cook, et al.; and B. B. Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994)), ALK-2, and ALK-6. BRK-1 is the mouse homologue of ALK-3, which has also been demonstrated to bind BMP-4, as does ALK-6; ALK-2 binds BMP-7 (see P. ten Dijke, H. Yamashita, T. K. Sampath, A. H. Reddi, M. Estevez, D. L. Riddle, H. Ichijo, C.-H. Heldin, and K. Miyazono, J. Biological Chemistry, 269: 16985-16988 (1994)). It is also postulated that ALK-6 is the mouse homologue of the chicken receptor Bone Morphogenetic Protein Receptor Kinase-2 (herein referred to as “BRK-2”) (also referred to as RPK-1) (S. Sumitomo, T. Saito, and T. Nohno, DNA Sequence, 3: 297-302 (1993)). The rat homologue of BRK-1 has also been cloned, as BMPR-Ia (K. Takeda, S. Oida, H. Ichijo, T. Iimura, Y. Marnoka, T. Amagasa and S. Sasaki, Biochemical and Biophysical Research Communications, 204: 203-209 (1994)).

In co-pending application U.S. Ser. No. 08/334,179, filed Nov. 4, 1994 by Rosenbaum and Nohno, a novel mammalian BMP type II receptor (referred to as “BRK-3”) is described and claimed. Prior to the cloning of the BRK-3 receptor, the only type II receptor for BMP-2 and BMP-4, named DAF-4, was cloned from the nematode C. elegans (M. Estevez, L. Attisano, J. L. Wrana, P. S. Albert, J. Massagué, and D. L. Riddle, Nature, 365: 644-9 (1993)). Because of the large evolutionary distance between the nematode and mammals, it has not been possible to use the DAF-4 cDNA as a probe with which to clone the mammalian DAF-4 homologue. This implies that the DNA sequence of the mammalian type II receptor for BMPs is substantially divergent from that of DAF-4, and it was therefore necessary to clone a mammalian type II receptor for the BMPs.

The BMP receptor kinase protein BRK-3 of the co-pending application provides a mammalian type II receptor which enables the formation of a complex with a BMP type I receptor. This complex, which is described in detail below, is capable of binding BMPs with high affinity, and is therefore useful for identifying compounds having BMP receptor affinity. The complex of the present invention will also enable the formation of a high affinity complex that is competent for signaling a response to BMPs in concert with the mammalian type I receptor(s) for BMPs. The mammalian BMP receptor complex is therefore more relevant for the identification of novel compounds which interact with the BMP receptor, and which will be useful as therapeutic agents in humans and other mammals, than is a receptor complex that is composed of the nematode type II receptor and the mammalian type I receptor.

OBJECTS OF THE PRESENT INVENTION

It is an object of the present invention to provide a method for identifying compounds capable of binding to a BMP receptor kinase protein complex.

It is also an object of the present invention to provide a method for determining the amount of a compound capable of binding a BMP receptor kinase protein complex in a sample.

It is also an object of the present invention to provide a host cell comprising a recombinant expression vector encoding a BMP type II receptor kinase protein and a recombinant expression vector encoding a BMP type I receptor kinase protein comprising said BMP receptor kinase protein complex.

It is also an object of the present invention to provide a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex.

SUMMARY

The present invention relates to a method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex, the method comprising introducing a sample comprising the compound to the BMP receptor kinase protein complex and allowing the compound to bind to the BMP receptor kinase protein complex, wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and the BMP receptor kinase protein BRK-3.

The invention further relates to a method for determining the concentration of a BMP receptor ligand in a clinical sample, the method comprising introducing the sample comprising the ligand to a BMP receptor kinase protein complex and allowing the ligand to bind to the BMP receptor kinase protein complex, wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3.

The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for the BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein.

The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for a soluble BMP type I receptor kinase protein and a soluble BMP receptor kinase protein BRK-3.

The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for an incomplete BMP type I receptor kinase protein and an incomplete BMP receptor kinase protein BRK-3.

The invention further relates to a method for determining a test compound produces a signal upon binding to a BMP receptor protein complex, the method comprising: (a) labeling BMP receptor protein complex expressing cells with 32 P, wherein the cells have been transfected with a DNA sequence coding for BMP receptor kinase protein BRK-3 and a DNA sequence coding for a BMP type I receptor kinase protein; (b) culturing (i) a first set of the cells in the presence of the test compound, and (ii) a second set of the cells in the absence of the test compound; (c) quantitating via autoradiography any phosphorylated proteins produced from step (b); and (d) comparing the amount of phosphorylated proteins quantitated in step (c) from the first set of cells to the amount of phosphorylated proteins quantitated in step (c) for the second set of cells.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the DNA sequence of the degenerate oligonucleotide primers used in the PCR amplification of t-BRK-3. The nucleotide bases adenine, thymine, cytosine, and guanine are represented by A, T, C and G respectively. The letter N represents the presence of an equal mixture of A, T, C, and G at that site. The primers are derived from the sequence of the TGF-β type II receptor (H. Y. Lin, X. F. Wang, E. Ng-Eaton, R. A. Weinberg, and H. F. Lodish, Cell, 68: 775-785 (1992)).

FIG. 2 shows the construct pJT4-hBRK3T, used for transient mammalian expression of t-BRK-3. CMV, cytomegalovirus early promoter/enhancer; R, the “R” element from the long terminal repeat of human T-cell leukemia virus-1; SP, an intron splice site from the SV40 virus; T3, promoter region from the T3 bacteriophage; T7, promoter region from the T7 bacteriophage; poly A, region from the SV40 virus directing polyadenylation of the message; SV40 ORI, origin of replication from the SV40 virus; Amp, ampicillin resistance gene for selection in E. coli.

FIG. 3 shows the construct pJT4-J159F, used for transient mammalian expression of BRK-1. Abbreviations are the same as those in FIG. 2 .

FIG. 4 shows the construct pJT3-BRK2, used for transient mammalian expression of BRK2. Abbreviations are the same as those in FIG. 2 .

FIG. 5 shows the construct pJT4-Daf4, used for transient mammalian expression of the C. elegans receptor DAF-4. Abbreviations are the same as those in FIG. 2 .

FIG. 6 shows whole cell binding of [ 125 I]-BMP-4 to t-BRK-3 expressed in COS-7 cells, in the presence or absence of the type I receptors BRK-1 and BRK2. Bars represent specific binding of [ 125 I]-BMP-4, normalized to cell number. Left to right, NIH3T3 embryonic fibroblasts; COS-7 cells; COS-7 cells transfected with the vector pJT-4 alone (designated “mock”); COS-7 cells transfected with BRK-1 alone, BRK-1 plus 10 or 20 μg of t-BRK-3, BRK-2 alone, BRK-2 plus 10 or 20 μg of t-BRK-3, and t-BRK-3 alone (20 μg).

FIG. 7 shows crosslinking of [ 125 I]-BMP-4 to COS-1 cells transfected with t-BRK-3, in the presence or absence of the type I receptors BRK-1 and BRK-2. Molecular weight standards are shown on the left. Labels on the right indicate the bands which migrate at the predicted molecular weights of t-BRK-3, BRK-1, and BRK-2 crosslinked to [ 125 I]-BMP-4. Left to right, the lanes represent COS-1 cells transfected with BRK-1 alone; BRK-1 plus 2 μg/ml t-BRK-3; BRK-1 plus 4 μg/ml t-BRK-3; BRK-2 alone; BRK-2 plus 2 μg/ml t-BRK-3; BRK-2 plus 4 μg/ml t-BRK-3; t-BRK-3 alone at 2 μg/ml; and t-BRK alone at 4 μg/ml. Volume of DNA mixture is 4 ml. In this figure, “BRK-3*” is t-BRK-3.

FIG. 8 shows an immunoprecipitation of t-BRK-3 and the C. elegans type II receptor DAF-4 expressed in COS-1 cells and crosslinked to [ 125 I]-BMP-4 in the presence or absence of the type I receptors BRK-1 or BRK-2. Molecular weight standards are shown on the left; areas shown at the right indicate labeled protein bands migrating at the predicted molecular weight of DAF-4, t-BRK-3, BRK-1, or BRK-2 crosslinked to [ 125 I]-BMP-4. Antiserum 1379 was used for COS-1 cells transfected with BRK-1 in the presence or absence of type II receptors, and antiserum 1380 for COS-1 cells transfected with BRK-2 in the presence or absence of type II receptors. For all others, antiserum is listed in parentheses. Left to right, NIH3T3 embryonic fibroblasts (1379), followed by COS-1 cells transfected with BRK-1 alone; BRK-1 plus DAF-4; BRK-1 plus t-BRK-3; BRK-2 alone; BPK-2 plus DAF-4; BRK-2 plus t-BRK-3. This is followed by NIH3T3 cells (1380), followed by COS-1 cells transfected with DAF-4 alone (1379), and t-BRK-3 alone (1380). In this figure, “BRK-3*” is t-BRK-3.

FIG. 9 shows an immunoprecipitation of COS-1 cells transfected with BRK-2 and t-BRK-3 and crosslinked to [ 125 I]-BMP-4 at a concentration of 210 pM, in the presence or absence of excess unlabeled competitors as indicated. Antiserum 1380 is used. Duplicate lanes at left show no unlabeled competitor added, followed by addition of (left to right) 10 nM BMP-4; 10 nM BMP-2; 10 nM DR-BRMP-2; and 50 nM TGF-β 1 . In this figure, “BRK-3*” is t-BRK-3.

FIG. 10 shows the construct pJT6-mBRK-3L, used for transient mammalian expression of mouse BRK-3. Abbreviations used are the same as those for FIG. 2 .

FIG. 11 shows the construct pJT6-mBRK-3 S, used for transient mammalian expression of mouse BRK-3. In this construct, most of the untranslated 3′ region has been removed. Abbreviations used are the same as those for FIG. 2 .

FIG. 12 shows whole cell binding of [ 125 I]-BMP-4 to mouse BRK-3 expressed in COS-1 cells, in the presence or absence of the type I receptor BRK-2. Bars represent specific binding of [ 125 I]-BMP-4, normalized to cell number. Constructs used for mouse BRK-3 are pJT6-mBRK-3L and pJT6-mBRK-3S; for BRK-2, the construct is pJT3-BRK-2. Both constructs contain the complete coding region of mouse BRK-3. In pJT6-mBRK-3S, an A-T rich region in the 3′ untranslated region has been deleted. Left to right, COS-1 cells transfected with the vector pJT-6 alone (designated “mock”); pJT3-BRK-2 alone; the construct pJT6-mBRK-3S alone; pJT6-mBRK-3L alone; pJT3-BRK-2 plus pJT6-BRK-3S; and pJT3-BRK-2 plus pJT6-BRK-3L.

FIG. 13 shows crosslinking of [ 125 I]-BMP-4 to m-BRK-3 in the presence and absence of type I BMP receptors. COS-1 cells are transfected with the cDNA for BRK-3 using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2). The cells are then allowed to bind [ 125 I]-BMP-4, crosslinked with disuccinimidyl suberate, and subjected to SDS gel electrophoresis. Position of molecular weight standards is indicated on the left. Left to right: COS-1 cells transfected with BRK-1 alone; BRK-1 plus m-BRK-3; m-BRK-3 alone; BRK-2 plus m-BRK-3; BRK-2 alone; and vector alone. Bands identified with BRK-1, BRK-2, and BRK-3 are indicated on the right.

FIG. 14 shows immunoprecipitation of m-BRK-3 in the presence and absence of type I BMP receptors. COS-1 cells are transfected with the cDNA for m-BRK-3 using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2). The cells are then allowed to bind [ 125 I]-BMP-4, crosslinked with disuccinimidyl suberate, immunoprecipitated with antibodies to BRK-1 or BRK-2, and subjected to SDS gel electrophoresis. Antisera used are indicated below the lanes: PI, preimmune; 1379, for cells transfected with cDNA for BRK-1; 1380, for cells transfected with cDNA for BRK-2. Position of molecular weight standards is indicated on the left. Left to right, COS-1 cells transfected with BRK-1 plus m-BRK-3 (preimmune serum); BRK-1 alone; BRK-1 plus m-BRK-3; BRK-2 plus m-BRK-3; BRK-2 alone; and BRK-2 plus m-BRK-3 (preimmune serum).

FIG. 15 shows a map of the insert of pHSK1040. This construct contains the complete coding region of human BRK-3 in BLUESCRIPT II SK (−).

DESCRIPTION

The present invention answers the need for a method for determining whether a compound has BMP receptor affinity. The method comprises introducing a sample comprising a test compound to a BMP receptor kinase protein complex and allowing the compound to bind to the BMP receptor kinase protein complex, wherein the receptor complex comprises a BMP type I receptor kinase protein and the BMP type II receptor kinase protein designated herein as “BRK-3”. The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. Also provided is a method for determining the concentration of a BMP receptor ligand in a clinical sample, the method comprising introducing the sample comprising the ligand to a BMP receptor kinase protein complex and allowing the ligand to bind to the receptor complex, wherein the receptor complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3. The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for a soluble BMP receptor kinase proten BRK-3 and an expression vector comprising a DNA sequence that codes for a soluble BMP type I receptor kinase protein. The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for an incomplete BMP receptor kinase proten BRK-3 and an expression vector comprising a DNA sequence that codes for an incomplete BMP type I receptor kinase protein.

As used herein, “human BMP receptor kinase protein-3” or “h-BRK-3” means a protein having the amino acid sequence SEQ ID NO:2, as well as proteins having amino acid sequences substantially similar to SEQ ID NO:2, and which are biologically active in that they are capable of binding a BMP molecule (including, but not limited to BMP-2, DR-BMP-2, BMP-4, and/or BMP-7), or transducing a biological signal initiated by a BMP molecule binding to a cell, or crossreacting with antibodies raised against h-BRK-3 protein, or peptides derived from the protein sequence of h-BRK-3 or m-BRK-3 (see below), or forming a complex with a BMP type I receptor, or co-immunoprecipitating with a BMP type I receptor when antibodies specific for either h-BRK-3 or a BMP type I receptor are used.

As used herein, “truncated human BMP receptor kinase protein” or “t-BRK-3” means a protein having amino acid sequence SEQ ID NO:4, or a sequence having the properties described above for BRK-3.

As used herein, “mouse BMP receptor kinase protein” or “m-BRK-3” means a protein having amino acid sequence SEQ ID NO:8, or a sequence having the properties described above for BRK-3.

As used herein, “BMP receptor kinase protein BRK-3” or “BRK-3” refers individually and collectively to the receptor proteins h-BRK-3, t-BRK-3, and m-BRK-3 (and soluble and incomplete fragments thereof), described above, as well as BMP receptor kinase proteins substantially similar to h-BRK-3, t-BRK-3, and m-BRK-3 (and soluble and incomplete fragments thereof). Such receptor proteins, DNA sequences coding for the proteins, and recombinant expression vectors comprising said DNA are described and claimed in U.S. Ser. No. 08/334,179, filed on Nov. 4, 1994, by Rosenbaum and Nohno.

As used herein, a “BMP Type I Receptor Kinase” is a protein capable of binding BMP-2, BMP-4 and/or other known BMPs, and bears sequence characteristics of a type I receptor including, but not limited to, an extracellular ligand binding domain containing a cysteine box and an upstream cysteine box, an SGSGSG motif, designated the GS domain, in the intracellular juxtamembrane region, an intracellular kinase domain that is greater than about 85% similar to other type I receptors for other ligands in the TGF-β superfamily, and/or a relatively short carboxy terminus. As used herein, “BMP Type I Receptor Kinase” also includes receptor proteins having the characteristics of a BMP type I receptor as described in the literature, such as in: B. B. Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994); L. Attisano, et al., Biochimica et Biophysica Acta, 1222: 71-80 (1994); J. Massagué, L. Attisano, and J. L. Wrana, Trends in Cell Biology, 4: 172-178 (1994); and ten Dijke, et al., J. Biological Chemistry, 269: 16985-16988 (1994).

Examples of BMP type I receptors include, but are not limited to: BRK-1 (B. B. Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994), the rat homologue of which is BMPR-Ia (K. Takeda, S. Oida, H. Ichijo, T. Iimura, Y. Maruoka, T. Amagasa, and S. Sasaki, Biochem. Biophys. Res. Communica., 204: 203-209 (1994)); BRK-2, also referred to as RPK-1 (S. Sumitomo, T. Saito, and T. Nohno, DNA Sequence, 3: 297-302 (1993), and postulated to be the chicken homologue of ALK-6 (P. ten Dijke, H. Yamashita, H. Ichijo, P. Franzén, M. Laiho, K. Miyazono, and C.-H. Heldin, Science, 264: 101-104 (1994)); ALK-2, which has been shown to be a receptor for BMP-7 (ten Dijke et al., J. Biological Chemistry, 269: 16985-16988 (1994)); the Xenopus BMP type I receptor that binds BMP-2 and BMP-4 and which is involved in mesoderm induction (J. M. Graff, R. S. Thies, J. J. Song, A. J. Celeste, and D. A. Melton, Cell, 79: 169-179 (1994)); and type I receptors from Drosophila that bind the decapentaplegic peptide, which is the Drosophila homologue of BMP-2 and BMP-4. These Drosophila receptors are designated 25D1, 25D2, and 43E (T. Xie, A. L. Finelli, and R. W. Padgett, Science, 263: 1756-1759 (1994); A. Penton, Y. Chen, K. Staehling-Hampton, J. L. Wrana, L. Attisano, J. Szidonya, J. A. Cassill, J. Massagué, and F. M. Hoffmann, Cell, 78: 239-250 (1994); and T. J. Brummel, V. Twombly, G. Marqués, J. L. Wrana, S. J. Newfeld, L. Attisano, J. Massagué, M. B. O'Connor, and W. M. Gelbart, Cell, 78: 251-261 (1994)). Preferred BMP type I receptors useful in the present invention include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:12 (BRK-1), SEQ ID NO: 16 (soluble BRK-1); SEQ ID NO:20 (incomplete BRK-1); SEQ ID NO:14 (BRK-2); SEQ ID NO:18 (soluble BRK-2); and SEQ ID NO:22 (incomplete BRK-2).

As used herein, “soluble fragment” refers to an amino acid sequence corresponding to the extracellular region of BRK-1, BRK-2, or BRK-3 which is capable of binding BMPs. Soluble fragments include truncated proteins wherein regions of the receptor molecule not required for BMP binding have been deleted. Examples of such soluble fragments for BRK-3 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:6; SEQ ID NO:10; amino acid residues 1-150 depicted in SEQ ID NO:2;amino acid residues 1-150 depicted in SEQ ID NO:8; or polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO:5; SEQ ID NO:9; nucleic acid residues 409-858 depicted in SEQ ID NO:1, or nucleic acid residues 17-466 depicted in SEQ ID NO:7.

Examples of soluble fragments for BRK-1 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:16; amino acid residues 1-152 in SEQ ID NO:12; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO:15; or polypeptides encoded by nucleic acid residues substantially similar to 11-466 in SEQ ID NO:11.

Examples of soluble fragments for BRK-2 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:18; amino acid residues 1-126 in SEQ ID NO:14; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 17; or polypeptides encoded by nucleic acid residues substantially similar to 355-732 in SEQ ID NO:13.

As used herein, “incomplete receptor kinase fragment” refers to an amino acid sequence corresponding to the extracellular, transmembrane, and intracellular juxtamembrane region of BRK-1, BRK-2, or BRK-3 which is capable of binding BMPs in a manner similar to the full-length receptor, but which is incapable of signalling due to deletion of the intracelllular kinase domain. Examples of such incomplete receptor fragments for BRK-3 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO: 24; SEQ ID NO:26; amino acids 1-200 in SEQ ID NO:2; amino acids 1-200 in SEQ ID NO:8; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 23; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 25; polypeptides encoded by nucleic acid residues substantially similar to 409-1008 in SEQ ID NO:1; or polypeptides encoded by nucleic acid residues substantially similar to 17-616 in SEQ ID NO:7.

Examples of incomplete receptor fragments for BRK-1 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:20; amino acid residues 1-231 in SEQ ID NO:12; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO:19; or polypeptides encoded by nucleic acid residues substantially similar to 11-703 in SEQ ID NO:11.

Examples of incomplete receptor fragments for BRK-2 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:22; amino acid residues 1-201 in SEQ ID NO:14; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 21; or polypeptides encoded by nucleic acid residues substantially similar to 355-957 in SEQ ID NO:13.

As used herein, a “BMP receptor kinase protein complex” is the combination of a BMP type I receptor and BMP receptor kinase protein BRK-3. The combination of the type I and BRK-3 receptors includes, but is not limited to, a combination of the type I and BRK-3 receptors in solution (e.g., as soluble fragments); a combination of the receptors (e.g., as soluble fragments) attached to a solid support; or a combination of the receptors (e.g., as full-length or incomplete fragments) within a cell membrane of transfected cells.

As used herein, “digit-removed BMP-2” and “DR-BMP-2” refer to a fragment of BMP-2 protein wherein the amino terminus of mature BMP-2 has been removed by mild trypsin digestion (B. B. Koenig et al., Molecular and Cellular Biolog, 14: 5961-5974 (1994)).

As used herein, “isolated”, in reference to the receptor protein of the present invention or DNA sequences encoding said protein, means that the protein or DNA sequence is removed from the complex cellular milieu in which it naturally occurs, and said protein is expressible from said DNA sequence in a cell that does not naturally express it when operably linked to the appropriate regulatory sequences.

As used herein, “substantially similar” when used to define either amino acid or nucleic acid sequences, means that a particular subject sequence, for example, a sequence altered by mutagenesis, varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which is to retain biological activity of the BRK-3 protein. Alternatively, nucleic acid sequences and analogs are “substantially similar” to the specific DNA sequence disclosed herein if the DNA sequences, as a result of degeneracy in the genetic code, encode an amino acid sequence substantially similar to the reference amino acid sequence. In addition, “substantially similar” means a receptor protein that will react with antibodies generated against the BRK-3 protein or peptides derived from the protein sequence of BRK-3.

As used herein, “biologically active” means that a particular molecule shares sufficient amino acid sequence similarity with the embodiments of the present invention disclosed herein to be capable of binding detectable quantities of BMP-2 or BMP-4, or transmitting a BMP-2 or BMP-4 stimulus to a cell, for example, as a component of a hybrid receptor construct. Preferably, a biologically active BRK-3 receptor complex within the scope of the present invention means the receptor protein kinase complex is capable of binding [ 125 I]-BMP-4 with nanomolar or subnanomolar affinity (K d approximately equal to 10 −9 M). Preferably, the affinity is from about 1×10 −12 M to 1×10 −9 M, with a proportion of binding sites exhibiting a K d less than 10 −12 M.

As used herein, “operably linked” refers to a condition in which portions of a linear DNA sequence are capable of influencing the activity of other portions of the same linear DNA sequence. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous in reading frame.

As used herein, “ATCC” means American Type Culture Collection, Rockville, Md.

As used herein, “bone morphogenetic protein 2” or “BMP-2” means a peptide encoded by a DNA sequence contained in ATCC No. 40345 (see ATCC/NIH R EPOSITORY C ATALOGUE OF H UMAN AND M OUSE DNA P ROBES AND L IBRARIES, sixth Edition, 1992, p. 57, hereinafter “ATCC/NIH R EPOSITORY C ATALOGUE ”). Isolation of BMP-2 is disclosed in U.S. Pat. No. 5,013,649, Wang, Wozney and Rosen, issued May 7, 1991; U.S. Pat. No. 5,166,058, Wang, Wozney and Rosen, issued Nov. 24, 1992; and U.S. Pat. No. 5,168,050, Hammonds and Mason, issued Dec. 1, 1992; each of which is incorporated herein by reference.

As used herein, “bone morphogenetic protein 4” or “BMP-4” means a peptide encoded by a DNA sequence contained in ATCC No. 40342 (see ATCC/NIH R EPOSITORY C ATALOGUE ). Isolation of BMP-4 is disclosed in U.S. Pat. No. 5,013,649, Wang, Wozney and Rosen, issued May 7, 1991, incorporated herein by reference.

As used herein, “bone morphogenetic protein 7” or “BMP-7” means a peptide encoded by a DNA sequence contained in ATCC No. 68020 and ATT 68182 (see ATCC/NIH Repository Catalogue), where the cDNA in ATCC 68182 is claimed to contain all of the nucleotide sequences necessary to encode BMP-7 proteins. Isolation of BMP-7 is disclosed in U.S. Pat. No. 5,141,905, issued Aug. 25, 1992, to Rosen, et al., which is incorporated herein by reference.

As used herein, “DNA sequence” refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the sequence and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector. Such sequences are preferably provided in the form of an open reading frame uninterrupted by internal nontranslated sequences (introns) which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences could also be used. Sequences of non-translated DNA may be present 5′ or 3′ from the open reading frame, where the same do not interfere with manipulation or expression of the coding regions. DNA sequences encoding the proteins provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.

As used herein, “recombinants” means that a protein is derived from a DNA sequence which has been manipulated in vitro and introduced into a host organism.

As used herein, “microbial” refers to recombinant proteins made in bacterial, fungal (e.g., yeast), or insect expression systems.

As used herein, “recombinant expression vector” refers to a DNA construct used to express DNA which encodes a desired protein (for example, BRK-3) and which includes a transcriptional subunit comprising an assembly of 1) genetic elements having a regulatory role in gene expression, for example, promoters and enhancers, 2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and 3) appropriate transcription and translation initiation and termination sequences. Using methodology well known in the art, recombinant expression vectors of the present invention can be constructed. Possible vectors for use in the present invention include, but are not limited to: for mammalian cells, pJT4 (discussed further below), pcDNA-1 (Invitrogen, San Diego, Calif.) and pSV-SPORT 1 (Gibco-BRL, Gaithersburg, Md.); for insect cells, pBlueBac III or pBlueBacHis baculovirus vectors (Invitrogen, San Diego, Calif.); and for bacterial cells, pET-3 (Novagen, Madison, Wis.). The DNA sequence coding for a BRK-3 protein receptor kinase of the present invention can be present in the vector operably linked to regulatory elements.

The present invention relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. In one embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the h-BRK-3 receptor protein, or a soluble or incomplete fragment thereof. (The DNA can be genomic or cDNA.) Preferably the h-BRK-3 protein is coded for by the nucleic acid sequence SEQ ID NO: 1; the soluble fragment thereof is preferably coded for by the nucleic acid sequence SEQ ID NO: 5, the incomplete receptor fragment is preferably coded for by nucleic acid SEQ ID NO:23. In another embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the t-BRK-3 protein. (The DNA sequence can be genomic DNA or cDNA.) Preferably the DNA sequence is SEQ ID NO:3. In another embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the m-BRK-3 protein, or a soluble or incomplete fragment thereof. (The DNA sequence can be genomic DNA or cDNA.) Preferably the m-BRK-3 protein is coded for by the DNA sequence SEQ ID NO:7; the soluble fragment is preferably coded for by the DNA sequence SEQ ID NO:9; the incomplete fragment is preferably coded for by the DNA SEQ ID NO:25.

In a preferred embodiment of the present invention, the host cells of the present invention are co-transfected with the plasmid construct pJT6-mBRK-3L and the plasmid construct pJT4-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in co-expression of m-BRK-3 and BRK-1, or m-BRK-3 and BRK-2, respectively. In another preferred embodiment, the host cells of the present invention are co-transfected with the plasmid construct pJT6-mBRK-3S and the plasmid construct pJT4-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in co-expression of m-BRK-3 and BRK-1, or m-BRK-3 and BRK-2, respectively. In another preferred embodiment, mammalian host cells are co-transfected with the plasmid construct, pJT4-hBRK3T and the plasmid construct pJT6-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in co-expression of t-BRK-3 and BRK-1, or t-BRK-3 and BRK-2, respectively. Transfection with the recombinant molecules can be effected using methods well known in the art.

As used herein, “host cell” means a cell comprising a recombinant expression vector described herein. Host cells may be stably transfected or transiently transfected within a recombinant expression plasmid or infected by a recombinant virus vector. The host cells include prokaryotic cells, such as Escherichia coli, fungal systems such as Saccharomyces cerevisiae, permanent cell lines derived from insects such as Sf-9 and Sf-21, and permanent mammalian cell lines such as Chinese hamster ovary (CHO) and SV40-transformed African green monkey kidney cells (COS).

In one embodiment, the present invention relates to a method that is useful for identifying compounds capable of binding to a BMP receptor kinase protein. In another embodiment, the invention relates to a method that is useful for determining the concentration of a BMP receptor ligand (e.g., BMP-2, BMP-4, or BMP-7, or another as yet identified BMP receptor ligand) in a clinical sample. In each of these methods, a sample comprising a putative ligand or a known ligand is introduced to a BMP receptor kinase protein complex, wherein the receptor complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3. Preferably, the BRK-3 receptor kinase protein is h-BRK-3, having an amino acid sequence SEQ ID NO:2, or the soluble fragment thereof having an amino acid sequence SEQ ID NO:6 or the incomplete fragment thereof having an amino acid sequence SEQ ID NO:24. Also preferred is the receptor protein m-BRK-3 having an amino acid sequence SEQ ID NO:8, or the soluble fragment thereof having an amino acid sequence SEQ ID NO:10 or the incomplete fragment thereof having an amino acid sequence SEQ ID NO:26. Also preferred is the receptor protein t-BRK-3 having an amino acid sequence SEQ ID NO:4.

For example, BMP concentration in a sample can be determined by radioreceptor assay, in which unlabeled BMP in the sample competes with labeled BMP for binding to the BRK-3 receptor complex. As the amount of BMP in the sample increases, it reduces the amount of labeled BMP which is able to bind to the receptor protein complex comprising BRK-3 and the type I receptor. Comparison with a standard curve prepared with known concentrations of unlabeled BMP allows accurate quantitation of BMP concentration in the sample. Labeling of BMP is preferably done by iodination with [ 125 I]Na1. BRK-3 can be expressed in the outer membrane of a stable cell line which also expresses the BMP type I receptor kinase, or supplied as a soluble fragment in solution with a soluble type I receptor fragment, or as a soluble fragment covalently attached to a solid support in conjunction with a type I receptor covalently attached to a solid support. To perform the assay, unlabeled BMP from the sample and labeled BMP compete for binding to the receptor until equilibrium is reached. The receptor-BMP complex is then isolated from free ligand, for example by washing (in the case of an adherent cell line), rapid filtration or centrifugation (in the case of a nonadherent cell line or receptor bound to a solid support), or precipitation of the receptor-ligand complex with antibodies, polyethylene glycol, or other precipitating agent followed by filtration or centrifugation (in the case of a soluble receptor). The amount of labeled BMP in the complex is then quantitated, typically by gamma counting, and compared to known standards. These methods have been described in the literature using other receptors (M. Williams, Med. Res. Rev., 11: 147-184 (1991); M. Higuchi and B. B. Aggarwal, Anal Biochem., 204: 53-58 (1992); M. J. Cain, R. K. Garlick and P. M. Sweetman, J. Cardiovasc. Pharm., 17: S150-S151 (1991); each of which are incorporated herein by reference), and are readily adapted to the present BRK-3 receptor/BMP system. Such a radioreceptor assay can be used for diagnostic purposes for quantitation of BMP in clinical samples, where such quantitation is necessary.

The methods of the present invention is also useful in high-throughput screens to identify compounds capable of binding to BRK-3, or a homologous receptor protein, that is complexed to a BMP type I receptor kinase protein. In such a method, the higher the affinity of the compound for the BRK-3/type I complex, the more efficiently it will compete with the tracer for binding to the complex, and the lower the counts in the receptor-ligand complex. In this case, one compares a series of compounds within the same concentration range to see which competed for receptor binding with the highest affinity.

This invention is useful for determining whether a ligand, such as a known or putative drug, is capable of binding to and/or activating the receptors encoded by the DNA molecules of the present invention. Transfection of said DNA sequence into the cell systems described herein provides an assay system for the ability of ligands to bind to and/or activate the receptor complex encoded by the isolated DNA molecules. Recombinant cell lines, such as those described herein, are useful as living cell cultures for competitive binding assays between known or candidate drugs and ligands which bind to the receptor and which are labeled by radioactive, spectroscopic or other reagents. Membrane preparations containing the receptor isolated from transfected cells are also useful for competitive binding assays. Soluble receptors derived from the ligand binding domain of the receptor can also be employed in high-throughput screening of drug candidates. Functional assays of intracellular signaling can act as assays for binding affinity and efficacy in the activation of receptor function. In addition, the recombinant cell lines may be modified to include a reporter gene operably linked to a response element such that a signal sent by the receptor turns on the reporter gene. Such a system is especially useful in high throughput screens directed at identification of receptor agonists. These recombinant cell lines constitute “drug discovery systems”, useful for the identification of natural or synthetic compounds with potential for drug development. Such identified compounds could be further modified or used directly as therapeutic compounds to activate or inhibit the natural functions of the receptor encoded by the isolated DNA molecule.

The soluble receptor protein complex of the present invention can be administered in a clinical setting using methods such as by intraperitoneal, intramuscular, intravenous, or subcutaneous injection, implant or transdermal modes of administration, and the like. Such administration can be expected to provide therapeutic alteration of the activity of the BMPs.

The nucleotide sequences disclosed herein, SEQ ID NO:3 and SEQ ID NO:1, represent the sequence of the DNA that codes for t-BRK-3 and h-BRK-3, respectively, isolated from human skin fibroblasts. SEQ ID NO:7 represents the DNA sequence coding for m-BRK-3 receptor protein from mouse NIH3T3 cells. These sequences could be readily used to obtain the cDNA for BRK-3 from other species, including, but not limited to, rat, rabbit, Drosophila, and Xenopus. These sequences could also readily be used to obtain the cDNA for other BMP type II receptors from mouse and other species listed above which are capable of binding BNIs in a complex with the type I receptors. These cDNA sequences can also be readily used to isolate the genomic DNA for BRK-3. This would permit analysis of the regulatory elements controlling receptor gene expression, which may offer new opportunities for therapeutic intervention and disease diagnosis. The nucleotide sequences are also useful to determine the distribution of the BRK-3 receptor in normal tissues and in disease states, which allows an assessment of its physiological role in vivo.

The present invention further relates to a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex. Such a method comprises employing the BMP receptor protein complex in a protein phosphorylation assay. Protein phosphorylation assays are generally known in theart. Hardie, D. G., “Protein Phosphorylation A Practical Approach”, IRL Press: Oxford, N.Y., Tokyo, (1993), incorporated herein by reference, provides a general overview phosphorylation assays. The method for determining whether a test compound produces signal upon binding to the BMP receptor protien complex comprises (a) labeling BMP receptor protein complex expressing cells with 32 p, wherein the cells have been transformed with a DNA sequence coding for BMP receptor kinase protein BRK-3 and a DNA sequence coding for a BMP type I receptor kinase protein; (b) culturing (i) a first set of the cells in the presence of the test compound, and (ii) a second set of the cells in the absence of the test compound; (c) quantitating via autoradiography any phosphorylated proteins produced from step (b); and (d) comparing the amount of phosphorylated proteins quantitated in step (c) from the first set of cells to the amount of phosphorylated proteins quantitated in step (c) for the second set of cells.

For purposes of illustrating a preferred embodiment of the present invention, the following non-limiting examples are discussed in detail.

EXAMPLE 1

Generation of PCR Fragments

In order to generate a PCR fragment of type II receptors related to the TGF-β type II receptor, primers shown in FIG. 1 are designed from the kinase domains of the TGF-β type II receptor. For the first round of PCR, the primers are TSK-1, derived from kinase domain II, and TSK-2, derived from kinase domain VIII. The template DNA consists of cDNA prepared from mRNA isolated from human skin fibroblasts from a 9 month old male. The PCR reaction, carried out in a total volume of 50 μl, contains approximately 0.2 μg of this cDNA, primers TSK-1 and TSK-2 at a concentration of 15 μM, stocks of all four deoxynucleotides at a concentration of 0.2 mM each, 1.5 unit of DNA polymerase from Thermus thermophilus (hereafter, Tth polymerase) (Toyobo, Osaka, Japan) and reaction buffer for the Tth polymerase (Toyobo, Osaka, Japan). After an initial melting period of 1 min at 94° C., the temperature cycle is carried out as follows for 35 cycles: melting, 92° C. for 40 sec; annealing, 48° C. for 40 sec; extension, 75° C. for 90 sec. After the 35th cycle, the reaction is held at 75° C. for an additional 5 min to complete the extension.

Several bands are amplified, including some in the area of 470 base pairs (bp) corresponding to the predicted sequence length of a type II receptor homologous to the TGF-β type II receptor. Accordingly, fragments in this size range are recovered from an agarose gel using QIAEX (Qiagen, Chatsworth, Calif.; a kit for gel purification of DNA fragments, including activated silica spheres and buffers) according to the manufacturer's instructions, then resuspended in 10 mM Tris, pH 8.0, 1 mM EDTA (TE) in a volume of 20 μl.

To reduce the background from fragments amplified from cDNAs not related to the TGF-β type II receptor, a second round of PCR is carried out using “nested” primers based on conserved regions of the TGF-β type II receptor located within the 470 bp region amplified in the first round. The nested primers are AVR-5, derived from kinase domain IV of the TGF-β type II receptor, and TSK-4, derived from kinase domain VIB (FIG. 1 ). The template consists of an aliquot (0.5 μl) of the PCR fragments isolated from the first round of PCR. To this is added the primers AVR-5 (5 μM) and TSK-4 (15 μM), all four deoxynucleotides (0.2 mM each), 1.5 units of Tth DNA polymerase, and reaction buffer for the Tth DNA polymerase, in a total volume of 50 μl. The temperature cycle program is executed exactly as described above for the first round of PCR. Agarose gel electrophoresis of the PCR reaction products shows amplification of a band in the range of 300 bp, as expected. This fragment is isolated using QIAEX.

In order to subclone the PCR product of the second PCR reaction, the purified fragment is phosphorylated using polynucleotide kinase and ligated to the cloning vector pGEM7Zf (+) (Promega, Madison, Wis.) which has previously been cut with Sma I and dephosphorylated. The ligation mix is used to transform E. coli XL1-Blue (Stratagene, La. Jolla, Calif.). When the transformation mix is plated on agar containing isopropyl-β-D-thiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal), colonies are obtained which lack blue color, indicating the presence of an insert. Plasmid DNA is prepared from a selection of these colonies. Three of the candidate plasmids, designated HSK7-1, HSK7-2, and HSK7-4 are found to have inserts of the expected size (300 bp). Upon sequencing of the inserts, the 300 bp insert from HSK7-2 is found to encode a portion of a novel kinase that is predicted to be a novel member of the TGF-β receptor superfamily. Accordingly, the HSK7-2 PCR fragment is used as a probe to isolate the full-length receptor clone.

EXAMPLE 2

Isolation of Human t-BRK-3 cDNA

In order to locate the cDNA corresponding to the 300 bp insert in HSK7-2, a cDNA library is constructed from the same mRNA used to isolate the PCR fragment. This is accomplished using the SUPERSCRIPT Choice System (Life Technologies, Gaithersburg, Md.; a kit for cDNA synthesis, including primers, adapters, SUPERSCRIPT II RNAse H − Reverse Transcriptase (Life Technologies, Gaithersburg Md.; a modified form of reverse transcriptase from Moloney murine leukemia virus), enzymes, nucleotides, buffers, and gel filtration columns) according to the manufacturer's instructions, except that 180 units of RNase inhibitor (Takara, Kyoto, Japan) is added to the first strand synthesis. The template is mRNA (4 μg) from human skin fibroblasts from a 9 month old male. A total of 4 μg of cDNA is obtained after first and second strand synthesis. This is followed by the addition of Eco RI adapters (supplied with the kit) which contain internal Not I and Sal I sites. The Eco RI-adapted cDNA is then phosphorylated and subjected to size fractionation according to the manufacturer's instructions, using gel filtration columns provided with the kit.

The size fractionated cDNA is ligated into the Eco RI site of the phage λgt10, and packaged in vitro with GIGAPACK II Gold Packaging Extract (Stratagene, La Jolla, Calif.; a restriction-minus in vitro packaging extract for high-efficiency construction of cDNA libraries in λ phage) according to the manufacturer's instructions. A total of 8.1×10 5 phages are obtained.

The library is screened on ten HYBOND Nylon membranes (Amersham, Arlington Heights, Ill.; nylon membranes optimized for immobilization of nucleic acids), at a density of 1×10 5 plaques/filter. The insert from HSK7-2 is labeled with the MULTIPRIME DNA Labeling System (Amersham, Arlington Heights, Ill.; a kit for random primer labeling of DNA, including Klenow DNA polymerase, primers, and buffers) according to the manufacturer's instructions. The labeled probe is allowed to hybridize to the library filters in 50% formamide, 6× SSPE (1×SSPE=0.14 M NaCI, 8 mM sodium phosphate, 0.08 mM EDTA, pH 7.7), 5× Denhardt's solution (1×Denhardt's=0.02% Ficoll type 400, 0.02% polyvinylpyrrolidone, 0.02% BSA), 0.5% sodium dodecyl sulfate (SDS), and 100 μg/ml denatured salmon sperm DNA at 42° C. for 12 hr. The blot is then washed in 2×SSPE, 0.1% SDS three times at room temperature (15 minutes each), followed by a 1 hr wash at 42° C.

After three rounds of screening, 3 independent clones are obtained. One of the clones, designated HSK723, is found to encode the same sequence as the HSK7-2 insert. Complete DNA sequence is obtained for this clone. The cDNA from this clone is designated t-BRK-3.

EXAMPLE 3

t-BRK-3 Sequence Analysis

The DNA sequence of this t-BRK-3 clone is shown in SEQ ID NO:3, and the deduced protein sequence of t-BRK-3 in SEQ ID NO:4. The t-BRK-3 open reading frame derived from clone HSK723 encodes a protein of at least 583 amino acids. No stop codon is observed to be located in-frame in the 3′ region of the HSK723 cDNA, indicating that this clone is incomplete at the 3′ end. It is thus designated t-BRK-3.

The deduced protein sequence of t-BRK-3 shown in SEQ ID NO:4 is searched against all translated protein sequences in GenBank Release 84.0, dated Aug. 15, 1994, using a standard Needleman-Wunsch algorithm (S. B. Needleman and C. D. Wunsch, J. Mol. Biol. 48: 443-453 (1970)), and is found to represent a novel sequence.

Analysis of the predicted protein sequence reveals a predicted structure of a TGF-β type II superfamily member transmembrane serine/threonine kinase. The predicted single transmembrane region encompasses residues 151-172 in SEQ ID NO:4. Three potential N-linked glycosylation sites are located at amino acid residues 55, 110, and 126 in the predicted extracellular domain. Amino acids 116-123 in SEQ ID NO:4 contain the cluster of cysteine residues called the “cysteine box” that is a characteristic of receptors for ligands of the TGF-β superfamily. The cysteine box of t-BRK-3 is identical in 6 of 8 amino acid residues to the cysteine box of the DAF-4 type II receptor for BMP-2 and BMP-4. However, the overall sequence identity of t-BRK-3 to DAF-4 in the extracellular domain is only 7.1%.

Amino acids 200-504 (in SEQ ID NO: 4) in the predicted cytoplasmic region of t-BRK-3 contains all of the consensus sequences that characterize a protein kinase domain with predicted specificity for serine/threonine residues (S. K. Hanks, A. M. Quinn, and T. Hunter, Science, 241: 42-52 (1988)).

EXAMPLE 4

Construction of Expression Vectors for t-BRK-3, BRK-1, BRK-2, and DAF-4

In order to express t-BRK-3 in mammalian cells, it is subcloned into the vector pJT4, designed for transient expression. The pJT4 vector, optimized for transient expression in COS cells, includes the cytomegalovirus early promoter and enhancer, which gives very efficient transcription of message; an “R” element from the long terminal repeat of the human T-cell leukemia virus-1, which has been shown to increase expression levels further; an intron splice site from SV40, which is believed to enhance message stability; a multiple cloning site; a polyadenylation signal derived from SV40, which directs the addition of a poly A tail to the message, as is required for most eukaryotic mRNA; and the SV40 origin of replication, which permits the replication of the plasmid to extremely high copy number in cells which contain the SV40 large T antigen, such as COS cells. In addition, for manipulation and amplification of the vector in bacteria, the vector contains an E. coli origin of replication and an ampicillin resistance gene. Insertion of the truncated human BRK-3 cDNA into pJT4 is accomplished as follows.

Since no stop codon had been identified in the 3′ region of the kinase domain, PCR is performed to insert a stop codon to permit translation of the protein. Accordingly, a PCR primer is designed to insert two stop codons after nucleotide 2028 in SEQ ID NO:3, thus terminating the kinase after Ile 540 in SEQ ID NO: 4. This is chosen to correspond to the length of the activin type II receptor (L. S. Mathews and W. V. Vale, Cell, 65: 973-982 (1991)), so that it should be sufficient for proper folding of the kinase domain. The stop codons are followed by a Kpn I site. The complete sequence of the primer (which includes the reverse complement of nucleotides 2013-2028 in SEQ ID NO:3) is 5′ ACG CGG TAC CTC ACT AAA TTT TTG GCA CAC GC 3′. A second primer is designed as an exact match to the t-BRK-3 sequence in the area of the Afl III site (nucleotides 1618-1637 in SEQ ID NO:3), having the sequence 5′ GTA GAC ATG TAT GCT CTT GG 3′. The template for the reaction is clone HSK723, described in example 2, which contains the cDNA for t-BRK-3 in BLUESCRIPT II SK (+) (Stratagene, La Jolla, Calif.; a 2.96 kb colony-producing phagemid derived from pUC 19).

PCR is carried out using the GENE AMP PCR Kit with AMPLITAQ DNA Polymerase (Perkin Elmer, Norwalk, Conn.; a kit containing components necessary for amplification of DNA using the polymerase chain reaction, including AMPLITAQ, a recombinant modified form of the DNA polymerase from Thermus aquaticus (Perkin-Elmer, Norwalk Conn.), nucleotides, and buffers), according to the manufacturer's instructions, using a GENE AMP PCR System 9600 Thermocycler (Perkin Elmer, Norwalk, Conn.). An initial melting at 95° C. for 5 min is followed by 20 cycles of the following program: melting at 95° C. for 1 min, annealing at 50° C. for 1 min, and extension at 72° C. for 1 min. After the last cycle, the temperature is held at 72° C. for an additional 2 min to complete extension.

The resulting amplified band, at the expected size of 400 bp, is isolated from an agarose gel and digested with Afl III and Kpn I. Meanwhile, the cDNA for t-BRK-3 is digested with Eco RV and Afl III, and the vector pJT4 is digested with Eco RV and Kpn I. These three isolated fragments are ligated in a single step to give the construct pJT4-hBRK3T, shown in FIG. 2 . To confirm that no errors are introduced during PCR, the region from the Afl III site to the KpnI site at the 3′ end is sequenced using the TAQ DYE DEOXY Terminator Cycle Sequencing Kit (Applied Biosystems, Foster, Calif.; kit containing components for automated DNA sequencing using the dideoxy terminator method, including AMPLITAQ, nucleotide mix, dye-labeled dideoxy nucleotide terminators, and buffers) and an Applied Biosystems Model 373A Automated DNA Sequencer. No errors are found.

To determine the effects of co-expression of t-BRK-3 with type I BMP receptors, it is necessary to co-express the cDNA for t-BRK-3 with the cDNA for BRK-1 or the cDNA for BRK-2. The DNA sequence for mouse BRK-1 is shown in SEQ ID NO: 11, and the deduced amino acid sequence for mouse BRK-1 is shown in SEQ ID NO: 12. The DNA sequence for chicken BRK-2 is shown in SEQ ID NO: 13, and the deduced protein sequence shown for chicken BRK-2 is shown in SEQ ID NO: 14.

For mammalian expression of BRK-1, the plasmid pJT4-J159F is used. Construction of this plasmid is described in U.S. Ser. No. 08/158,735, filed Nov. 24, 1993 by Cook, et al. and B. B. Koenig et al., Molecular and Cellular Biology 14: 5961-5974 (1994); ATCC 69457. Briefly, the construct containing the BRK-1 cDNA subcloned in BLUESCRIPT SK (−) is linearized with the restriction endonuclease Alf III, and the overhanging end filled in using DNA Polymerase I Klenow fragment. The linearized plasmid is then digested with Not I, liberating the insert from the plasmid. The insert is then subcloned into the pJT4 expression vector at the Not I and EcoRV sites. The blunt end generated by the Klenow reaction is compatible with the EcoRV site, which is also a blunt end; ligation eliminates the Eco RV site. The construct pJT4-J159F is shown in FIG. 3 .

For mammalian expression of BRK-2, its cDNA is subcloned into the vector pJT3. This vector is identical to pJT4, described in this example, except that the multiple cloning site is in the opposite orientation, and an additional Not I site is present at the 5′ end of the multiple cloning site. The cDNA for BRK-2 (see S. Sumitomo, et al., DNA Sequence 3: 297-302 (1993)), originally obtained in the vector pRc/CMV (Invitrogen, San Diego, Calif.; a mammalian expression vector), is excised by digestion with Kpn I and Xho I. It is subcloned into pJT3 at the Kpn I and Sal I sites. This regenerates a Kpn I site at the 5′ end of BRK-2, while the Xho I and Sal I sites are destroyed. The resulting construct is designated pJT3-BRK-2 and is shown in FIG. 4 .

For mammalian expression of DAF-4, the type II BMP receptor from Caenorhabditis elegans (M. Estevez, L. Attisano, J. L. Wrana, P. S. Albert, J. Massagué, and D. L. Riddle, Nature, 365: 644-9 (1993), the cDNA is obtained in BLUESCRIPT II and subcloned into pJT4 as follows. A 2.4 kb fragment containing the daf-4 cDNA is excised by digestion with Dra I and Apa I. This fragment is subcloned into pJT4 at the Sma I and Apa I site. The Apa I site is regenerated, while the Dra I and Sma I sites are destroyed. This construct is designated pJT4-Daf4, and is shown in FIG. 5 .

For mammalian expression of m-BRK-3, see Example 10, below.

EXAMPLE 5

Mammalian Expression of t-BRK-3, BRK-1, BRK-2, and DAF-4

Transient expression of BRK-3 in mammalian cells using pJT4-hBRK3T is carried out in COS-7 cells (ATCC CRL 1651) using electroporation or COS-1 cells (ATCC CRL 1650) using DEAE Dextran (Pharmacia Biotech, Piscataway, N.J.).

COS-7 cells are grown to confluence in Dulbecco's Modified Eagle (DME) high glucose media supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah), nonessential amino acids (GIBCO, Gaithersburg, Md.), and glutamine, then trypsinized to release cells from the plate. The detached COS-7 cells are pelleted in a tabletop centrifuge, then resuspended in fresh media at a concentration of 6.25×10 6 cells/ml. The cell suspension (5×10 6 cells, 0.8 ml) is transferred to the cuvette of a BioRad GENE PULSER electroporation system (BioRad, Hercules, Calif.). The purified plasmid containing the receptor DNA of interest (10 μg for pJT4-J159F and pJT3-BRK2 and/or 20 μg for pJT4-hBRK3T) is added to the cuvette, and the cells subjected to electoporation at 4.0 kV/cm, with a capacitance of 25 μFd. Cells are then plated (400,000 cells per well for 12 well plates and 5×10 6 cells for 100 mm plates) and allowed to recover. Fresh media is supplied after 24 hr. At 48 hr, cells are ready to be tested for binding of BMP-4.

For transient expression of BMP receptors in COS-1 cells, the cells are grown to approximately 50%-80% confluence in DME high glucose media supplemented with 10% fetal bovine serum (HyClone, Logan, Utah), nonessential amino acids, and glutamine in 100 mm plates. The cells are washed twice with 37° C. serum-free DME media, after which 4 ml of DNA mixture is added to each 100 mm plate. The DNA mixture contains DME, 10% Nu-Serum (Collaborative-Biomedical Products, Bedford, Mass.), 400 μg/ml DEAE-Dextran (Pharmacia, Piscataway, N.J.), 0.1 mM chloroquine (Sigma, St. Louis, Mo.), and the cDNAs of interest: for t-BRK-3, 16 μg pJT4-hBRK3T; for BRK-1, 8 μg pJT4-J159F; for BRK-2, 8 μg pJT3-BRK2; for DAF-4, 16 μg pJT4-Daf4. The cells are then incubated at 37° C. with the DNA mixture for 3 hr. The solution is aspirated and the cells are incubated with 4 ml of a solution containing 10% dimethylsulfoxide (DMSO) in Dulbecco's phosphate buffered saline without calcium or magnesium (PBS; Life Technologies, Gaithersburg, Md.). After 2 min, the DMSO solution is aspirated, the cells are washed with the growth media described above, and fresh media is returned to the plates. The transfected cells are split into 12 well plates 24 hr post transfection for whole cell binding or cross linking. After 48 to 68 hr the cells are suitable for binding analysis.

EXAMPLE 6

Generation of the Radiolabeled BMP-4 Ligand

[ 125 I]-BMP-4 is prepared using IODOBEADS (Pierce, Rockford, Ill.; immobilized chloramine-T on nonporous polystyrene beads). Lyophilized BMP-4 (2 μg) is taken up in 50 μl of 10 mM acetic acid and added to 450 μl of phosphate-buffered saline (PBS) (Sigma, St. Louis, Mo.) on ice. To the tube is added 500 μCurie of 125 I (Amersham, Arlington Heights, Ill.) (2200 Ci/mmol) in 5 μl, and one IODOBEAD. The reaction is incubated on ice for 10 min with occasional shaking. The reaction is then terminated by removal of the reaction from the IODOBEAD. To remove unreacted 125 I, the mixture is applied to a PD-10 gel filtration column (Pharmacia, Piscataway, N.J.) previously equilibrated in 10 mM acetic acid, 0.1 M NaCl, 0.25% gelatin. The resulting labeled protein is >95% precipitable by trichloroacetic acid, indicating that all 125 I is protein bound, and has a typical specific activity of 4000 to 9000 Ci/mmol.

Alternatively, BMP-4 is labeled with 125 I by the chloramine-T method (C. A. Frolik, L. M. Wakefield, D. M. Smith, and M. B. Sporn, J. Biol. Chem., 259: 10995-11000 (1984)). BMP-4 (2 μg) is taken up in 5 μl of 30% acetonitrile, 0.1% trifluoracetic acid (TFA) plus an additional 5 μl of 1.5 M sodium phosphate, pH 7.4. Carrier free 125 I (1 mCi, 9 μl) is added, together with 2 μl of a chloramine T solution (100 μg/ml). An additional 2 μl of the chloramine T solution is added at 2.0 min and at 3.5 min. After 4.5 minutes, the reaction is stopped by the addition of 10 μl of 50 mM N-acetyl tyrosine, 100 μl of 60 mM potassium iodide, and 100 μl of 11M urea, 1 M acetic acid. After a 3.5 minute incubation, unreacted iodine is removed on a PD-10 gel filtration column (Pharmacia, Piscataway, N.J.) run in 4 mM HCI, 75 mM NaCl, 1 mg/ml bovine serum albumin (BSA). The resulting labeled protein is >95% precipitable by trichloroacetic acid, indicating that all 125 I is protein bound, and has a typical specific activity of 3000-8000 Ci/mmol.

EXAMPLE 7

Characterization of BMP-4 Binding to t-BRK-3

Binding of BMP-4 to t-BRK-3 can be demonstrated by whole cell binding of radiolabeled BMP-4, and by covalent crosslinking of radiolabeled BMP-4 to the receptor. These two methods are described in detail below.

a. Whole Cell Binding

COS-7 or COS-1 cells are transfected with pJT4-hBRK3T as described in example 5. After transfection, cells are seeded into 12 well plates and the binding experiments are carried out at 48 to 68 hr. At that time, cells are washed once with binding buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCl, 5 MM MgSO 4 , 1.2 mM CaCl 2 , 2 mg/ml BSA), then equilibrated in the same buffer at 4° C. for 30-60 min with gentle shaking. The buffer is then aspirated, and to each well is added 500 μl of binding buffer (4° C.), containing [ 125 I]-BMP-4 tracer (100-400 pM), as well as varying concentrations of unlabeled BMP-2, BMP-4, or other unlabeled ligand, depending on the assay. For determination of nonspecific binding, BMP-4 is added to the binding buffer at a final concentration of 10 to 50 nM. To prevent degradation of ligand during the incubation, a protease inhibitor cocktail is also added, to give a final concentration of 10 μg/ml leupeptin, 10 μg/ml antipain, 50 μg/ml aprotinin, 100 μg/ml benzamidine, 100 μg/ml soybean trypsin inhibitor, 10 μg/ml bestatin, 10 μ/ml pepstatin, and 300 μM phenylmethylsulfonyl fluoride (PMSF). The cells are incubated for 4 hr at 4° C. with gentle shaking. At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCI, 5 mM MgSO4, 1.2 mM CaCI2, 0.5 mg/ml BSA). After the final wash is aspirated, 200 μl of solubilization buffer (10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% (v/v) Triton X-100) is added to each well and incubated at room temperature for 15-30 min. The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden, Conn.).

Results are shown in FIG. 6 , which shows specific binding of [ 125 I]-BMP-4 to NIH3T3 cells (ATCC CRL 1658), which display significant endogenous binding of BMP-4, and COS 7 cells transfected with the cDNA for t-BRK-3 in the presence and absence of BRK-1 and BRK-2. t-BRK-3 is capable of binding [ 125 I]-BMP-4 when expressed alone (bar on far right), at a level similar to that seen for BRK-1 and BRK-2 expressed alone. Binding of [ 125 I]-BMP-4 is increased by co-expression of t-BRK-3 with BRK-1, and to a greater extent by co-expression of t-BRK-3 with BRK-2.

b. Covalent Crosslinking

Bifunctional crosslinking reagent disuccinimidyl glutarate (DSG) (Pierce, Rockford, Ill.) is used to covalently crosslink bound radiolabeled ligand to its receptor by reaction with free amino groups on lysine residues in the two proteins. Following the crosslinking, cellular proteins are separated by gel electrophoresis, and radioactive bands visualized. The labeled bands represent the receptor selectively “tagged” with the radiolabeled ligand. In this procedure, cells are transfected with the cDNA for BRK-3, and/or BRK-1 or BRK-2, as described in example 5, then seeded into 12 well plates. At 48-68 hr after transfection, the cells are washed, equilibrated, and incubated with [ 125 I]-BMP-4 and competing unlabeled ligands as described in this example for whole cell binding studies. After completion of the 4 hr incubation with ligand, the cells are washed two to three times at 4° C. with 2 ml of binding buffer having the same composition as described above, except that no BSA is added. To each well is then added 1 ml of fresh BSA-free binding buffer, followed by freshly prepared DSG to a final concentration of 135 μM. After swirling gently to mix the DSG, the plates are incubated for exactly 15 minutes at 4° C. with gentle shaking. At this point the media is aspirated and the cells washed with 3 ml detachment buffer (10 mM Tris base, 0.25 M sucrose, 1 mM EDTA, 0.3 mM PMSF) or PBS. Solubilization buffer (50 μl) is then added to each well and the cells are allowed to solubilise for 30-45 minutes at 4° C. with shaking. An aliquot of the sample (20 μl) is transferred to a fresh tube and 5 μl of 5× sample loading buffer (0.25 M TrisCl, pH 6.8, 10% SDS, 0.5 M DTT, 0.5% bromophenol blue, 50% glycerol; purchased from Five Prime Three Prime, Boulder, Colo.) is added. The samples are boiled for 5 min and centrifuged (13,0000×g, 5 min). The supernatants are loaded onto 7.5% SDS-polyacrylamide gels (Integrated Separation Systems, Natick, Mass.) and subjected to electrophoresis. The gels are stained in 0.12% Coomassie Blue R250, 5% methanol, 7.5% acetic acid; destained in 5% methanol, 7.5% acetic acid; then dried. Radioactivity on the dried gel is visualized and quantitated on a PHOSPHORIMAGER (Molecular Devices, Sunnyvale, Calif., a device for quantitation of radioactivity using stable phosphor screens), or subjected to autoradiography using Kodak X-OMAT AR autoradiography film (Kodak, Rochester, N.Y.).

Results are shown in FIG. 7 . When t-BRK-3 is expressed alone in COS-1 cells, no crosslinked band is seen. Expression of BRK-1 alone results in a crosslinked band at a molecular weight of 78 kD, corresponding to the predicted molecular weight of BRK-1 plus the monomer molecular weight of BMP-4. Co-expression of t-BRK-3 and BRK-1 results in the appearance of a band of similar size to that for BRK-1, as well as a new crosslinked band at 94 kD, corresponding to the predicted molecular weight of t-BRK-3 plus the monomer molecular weight of crosslinked BMP-4. Similarly, expression of BRK-2 alone yields a single crosslinked band at 75 kD, corresponding to the predicted molecular weight of BRK-2 plus the crosslinked BMP-4 monomer. Co-expression of t-BRK-3 with BRK-2 yields a crosslinked band corresponding to that seen for BRK-2 alone, as well as a new crosslinked band at 94 kD, again corresponding to the predicted molecular weight of t-BRK-3 plus the monomer molecular weight of crosslinked BMP-4. Thus, crosslinking of [ 125 I]-BMP-4 to t-BRK-3 is observed only in the presence of a co-expressed type I BMP receptor.

EXAMPLE 8

Demonstration of Complex Formation with Type I BMP Receptors

Receptors of the TGF-β receptor family have been shown to form complexes involving a type I and a type II receptor (L. Attisano, J. L. Wrana, F. Lopez-Casillas, and J. Massagué, J. Biochim Biophys. Acta, 1222: 71-80 (1994)). In order to demonstrate that the type II BMP receptor t-BRK-3 can form a complex with the type I BMP receptors BRK-1 and BRK-2, COS-1 cells are co-transfected with the cDNA for t-BRK-3 and BRK-1, or t-BRK-3 and BRK-2, as described in Example 5. The receptors are crosslinked to [ 125 I]-BMP-4, then subjected to immunoprecipitation with antibodies specific for the type I receptors BRK-1 and BRK-2. If antibodies specific for a type I receptor precipitate not only the type I receptor crosslinked to [ 125 I]-BMP-4, but also BRK-3 crosslinked to [ 125 I]-BMP-4, this indicates that the two receptors must be forming a complex, as expected for type I and type II receptors having the same ligand-binding specificity.

Antibodies specific for the type I receptors BRK-1 and BRK-2 are generated using as antigen the peptide LNTRVGTKRYMAPEVLDESLNKNC (SEQ ID NO:27) (B. B. Koenig, et al., Molec. Cell. Biol., 14: 5961-5974 (1994)). This peptide is based on the amino acid sequence of BRK-1 in the intracellular kinase domain, amino acids 398-420 in SEQ ID NO: 12, with the addition of a cysteine at the C terminus to permit conjugation of the peptide. Comparison of the amino acid sequence of the kinase domain of BRK-1 with the kinase domain of the Raf protein suggests that this region of BRK-1 corresponds to a region of the Raf kinase which was used to make highly specific antibodies (W. Kolch, E. Weissinger, H. Mischak, J. Troppmair, S. D. Showalter, P. Lloyd, G. Heidecker, and U. R. Rapp, Oncogene, 5: 713-720 (1990)). This peptide is conjugated by standard methods to keyhole limpet hemocynanin, and used to immunize three New Zealand White rabbits (Hazleton Washington, Vienna, Va.). The resulting antisera are evaluated for their ability to recognize the original peptide coated on plastic, using an antibody capture ELISA. The antisera are designated 1378, 1379, and 1380. These antibodies are shown to immunoprecipitate BRK-1 from COS-7 cells transfected with the cDNA for BRK-1, using the procedure detailed in this example (B. B. Koenig, et al., Mol. Cell. Biol., 14: 5961-5974 (1994)). Because the sequence of BRK-2 is nearly identical to that of BRK-1 in this region, these antibodies are subsequently tested for their ability to immunoprecipitate BRK-2 as well, and are found to be effective for this purpose. Antibody 1379 gives superior results for immunoprecipitation of BRK-1, and antibody 1380 is preferred for immunoprecipitation of BRK-2.

In the immunoprecipitation procedure, COS-7 or COS-1 cells are transfected with the cDNA for t-BRK-3 and/or BRK-1, BRK-2, or DAF-4 as described in Example 5, and plated into 100 mm dishes. They are then crosslinked to [ 125 I]-BMP-4 as described in example 7, except that the incubation with [ 125 I]-BMP-4 and unlabeled ligand is carried out in a total of 4 ml, instead of 500 μl, and all other volumes are increased accordingly. Following the crosslinking, cells are washed three times with ice-cold PBS, then lysed with 1 ml of RIP buffer (20 mM TrisCl, pH 8.0, 100 mM NaCl, 1 mM Na 2 EDTA, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, 10 mM sodium iodide, and 1% bovine serum albumin) for 10 min. The lysate is centrifuged in a microcentrifuge at 13,000 rpm for 10 min at 4° C. The supernatant is transferred to a fresh tube and made 0.1% in SDS. To remove any existing antibody present in the lysate, 50 μl of PANSORBIN (Calbiochem, La Jolla, Calif.; a 10% solution of Staphylococcus aureus ) is added. After a 30 minute incubation at 4° C., the lysate is centrifuged as before, and the supernatant again transferred to a fresh tube.

The primary antibody—1379 when cells are transfected with t-BRK-3 and BRK-1; 1380 when cells are transfected with t-BRK-3 and BRK-2—is then added to the tube at a final dilution of 1:100, and incubated for 2 hr on ice or overnight at 40° C. To precipitate the complex of antigen:primary antibody, 25-50 μl of PANSORBIN is then added and incubated 30 min on ice. The complex is pelleted at 13,000 rpm for 10 min in a microcentrifuge and the supernatant discarded. The pellet is washed twice in RIP buffer containing 0.1% SDS, and once in TNEN buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% NP-40). The pellet is resuspended in 25 μl of 1× sample loading buffer. (Alternatively, the pellet may be washed twice with TNEN buffer, with similar results.) The sample is boiled for 5 min, centrifuged for 5 min, and subjected to gel electrophoresis after loading of the samples onto a 7.5% SDS-polyacrylamide gel.

Results of this experiment are shown in FIG. 8 , which shows the results of immunoprecipitations on COS-1 cells transfected with t-BRK-3 in the presence or absence of BRK-1 or BRK-2. Cells transfected with t-BRK-3 alone, crosslinked to [ 125 I]-BMP-4, and immunoprecipitated with antibody 1380 show no radiolabel in the immunoprecipitate, as expected since t-BRK-3 does not crossreact with this antibody. Cells transfected with BRK-1, crosslinked, and immunoprecipitated with antibody 1379 show a single labeled band at 78 kD, consistent with the predicted molecular weight of BRK-1 plus the cross-linked monomer of BMP-4. Immunoprecipitation of cells co-transfected with BRK-1 and t-BRK-3 yields the same band seen with BRK-1 alone, plus an additional labeled band at 94 kD, consistent with the predicted molecular weight of t-BRK-3 plus the crosslinked BMP-4 monomer. (A less intense band at 120 kD is also observed.) The fact that antibodies to BRK-1 precipitate not only BRK-1, but t-BRK-3 as well in these cells indicates complex formation between BRK-1 and t-BRK-3. Similarly, cells transfected with BRK-2, crosslinked to [ 125 I]-BMP-4, and subjected to immunoprecipitation with antibody 1380 show a labeled band at 75 kD, consistent with the predicted molecular weight of BRK-2 plus the crosslinked monomer of BMP-4. Immunoprecipitation of cells co-transfected with BRK-2 and t-BRK-3 yields the same band seen with BRK-2 alone, plus a strongly labeled band at 94 kD, consistent with the predicted molecular weight of t-BRK-3 plus the crosslinked monomer of BMP-4. As expected, this band co-migrates with the larger labeled band in cells co-transfected with BRK-1 and t-BRK-3. (A less intense band at 120 kD is also observed.) Again, the fact that an antibody to BRK-2 precipitates not only BRK-2 but t-BRK-3 as well in these cells strongly indicates that BRK-2 and t-BRK-3 form a complex. Thus, t-BRK-3 forms a complex with two different type I BMP receptors, as expected for a type II BMP receptor.

A second immunoprecipitation experiment is carried out to test the ligand specificity of the t-BRK-3 receptor complex for BMP-2, BMP-4, and TGF-β 1 . A derivative of BMP-2 designated “digit-removed” BMP-2 (DR-BMP-2) is also tested; DR-BMP-2 is prepared by mild trypsin digestion of BMP-2 to remove the amino terminus, and shows significantly reduced nonspecific binding to whole cells (B. B. Koenig, et al., Molec. Cell. Biol., 14: 5961-5974 (1994)).

COS-1 cells are co-transfected with the cDNA for BRK-2 and t-BRK-3 as described in Example 5, crosslinked to [ 125 I]-BMP-4, and subjected to immunoprecipitation with antibody 1380 as described in this example, except that an excess of unlabeled ligand (10 nM BMP-4, 10 nM BMP-2, 10 nM DR-BMP-2, or 50 nM TGF-β 1 ) is added to the incubation at the same time as the [ 125 I]-BMP-4. The results are shown in FIG. 9 . When no competing unlabeled ligands are present, two labeled bands are observed, at 75 kD and 94 kD, consistent with crosslinked BRK-2 and BRK-3 respectively, as seen in FIG. 8 . In the presence of excess unlabeled BMP-4, BMP-2, or DR-BMP-2, however, these bands are completely abolished, demonstrating that these ligands compete effectively with [ 125 I]-BMP-4 to bind to the complex, and that all these ligands show specific binding to the BRK-2 and BRK-3 receptor complex. However, the presence of 50 nM TGF-β 1 has no effect on the labeled bands, indicating that TGF-β 1 does not bind to the same site as [ 125 I]-BMP-4. This shows that the BRK-2/t-BRK-3 complex binds specifically to BMP-2 and BMP-4 and does not bind TGF-β.

EXAMPLE 9

Isolation of Mouse BRK-3

In order to isolate the full-length mouse homologue of BRK-3, a cDNA library is constructed from NIH3T3 mouse embryonic fibroblasts (ATCC CRL 1658). Total RNA (1.26 mg) is isolated from the cells using a Total RNA Separator Kit (Clontech, Palo Alto, Calif.). Messenger RNA (81 μg) is isolated from this total RNA (1 mg) using the mRNA Separator Kit (Clontech, Palo Alto, Calif.). An aliquot of the mRNA (4 μg) is used to make cDNA library using the SUPER SCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning (Life Technologies, Gaithersburg, Md.) according to the manufacturer's instructions. The resulting library contained approximately 4.9×10 5 primary colonies, and is divided into 98 pools, each containing 5000 colonies.

The initial screen of the library is accomplished by Southern blotting. Plasmids are purified from each of the 98 pools, using QIAGEN columns (Qiagen, Chatsworth, Calif.). DNA from each pool (approximately 5 μg) is digested with Mlu I to release the cDNA insert, then run on a 1% agarose gel. The gel is denatured for 30 min in 0.6 M NaCl, 0.4 N NaOH, then neutralized 30 min in 1.5 M NaCl, 0.5 M Tris, pH 7.5. The DNA is then transferred overnight to a HYBOND Nylon membrane (Amersham, Arlington Heights, Ill.) using 10×SSC as the transfer buffer (1×SSC=0.15 M NaCl, 0.015 M sodium citrate, pH 7.0).

Human t-BRK-3 is cut with EcoRV and Afl III to give a 1.5 kb fragment. The fragment is randomly labeled with alpha[ 32 P]-dCTP having a specific activity of 3000 Ci/mmol (NEN Research Products, Boston, Mass.), using a PRIME-IT II Random Primer Labeling Kit (Stratagene, La Jolla, Calif.; a kit for random primer labeling of DNA, including Klenow DNA polymerase, primers, and buffers). The labeled probe is allowed to hybridize to the Southern blot for 18 hr at 42° C. in hybridization buffer (Sigma, St. Louis, Mo.) consisting of 50% deionized formamide, 5×SSPE (1× SSPE=0.14 M NaCl, 8 mM sodium phosphate, 0.08 mM EDTA, pH 7.7), 1× Denhardt's solutions, and 100 μg/ml of denatured salmon testis DNA. The blot is then washed in 0.25×SSPE, 0.5% sodium dodecyl sulfate (SDS), two times at 42° C. for 15 min each, then two times at 65° C. for 20 min each. The blot is then exposed to Kodak X-OMAT AR autoradiography film for 18 hr at −80° C. Development of the film shows five positive pools, as judged by the presence of a labeled band of approximately 2.5 kb.

For secondary screening, plates are streaked with the E. coli stocks from the five positive pools (5000 colonies/plate). A HYBOND nylon membrane is placed on top of the plate so that the bacterial colonies are transferred to the filter. The colonies are then allowed to recover at 37° C. for 2-3 hr. The filter is soaked in 10% SDS for 3 min, then transferred to 1.5 M NaCl, 0.5 M NaOH for 5 min, neutralized in 1.5 M NaCl, 1.5 M Tris, pH 7.5 for 5 min, and washed in 2×SSC. To remove proteins, the blots are then shaken with 50 μg/ml of proteinase K (Boehringer Mannheim, Indianapolis, Ind.) in 0.1 M Tris, pH 7.6, 10 mM EDTA, 0.15 M NaCl, 0.02% SDS at 55° C. for 1 hr. The human BRK-3 fragment (Eco RV-Afl III) is labeled and the blots hybridized, washed, and subjected to autoradiography exactly as described above for the primary screening.

Colonies which corresponded to labeled spots on the autoradiograph are streaked on plates for tertiary screening, which is performed exactly as described above for secondary screening. Four positive clones are isolated. One clone, pSPORT1/N89-5, is found to have the largest insert size, 2.9 kb.

The inserts from the four positive clones are sequenced using the TAQ DYE DEOXY Terminator Cycle Sequencing Kit and an Applied Biosystems Model 373A Automated DNA Sequencer. Comparison of the four sequences shows that three of the four are identical at the 3′ end, and all four align with the coding region of human BRK-3 at the 5′ end. The longest clone, pSPORT1/N89-5, aligns with the human BRK-3 sequence approximately 600 pairs from the beginning of the coding region.

To generate more sequence information, the insert from pSPORT1/N89-5 is digested with EcoRi and Sca I, and the resulting 1.4 kb fragment is subcloned into BLUESCRIPT II SK(−) at the Eco RI and Hinc II sites. pSPORT1/N89-5 is also digested with Eco RI and Eco RV and the resulting 2.1 kb insert subcloned into the same vector at the same sites. Finally, the plasmid is digested with Sca I and Not I, and subcloned into the same vector at the Hinc II and Not I sites. Sequencing of these three constructs yields the complete sequence of the insert from pSPORT1/N89-5.

The missing 600 base pairs at the 5′ end of the coding region is cloned using the 5′ RACE System for Rapid Amplification of cDNA Ends (Life Technologies, Gaithersburg, Md.). An antisense primer is designed corresponding to the known sequence of pSPORT1/N89-5, having the sequence 5′ CTG TGT GAA GAT AAG CCA GTC 3′ (SEQ ID NO:28) (the reverse complement of nucleotides 968-948 in SEQ ID NO:7). After first strand synthesis of cDNA from 1 μg of NIH3T3 mRNA, a poly C tail is added to the newly synthesized cDNA using terminal deoxynucleotidyl transferase, according to the manufacturer's instructions. The primer above is used to amplify the 5′ end of the BRK-3 cDNA, together with the Anchor Primer supplied with the kit, having the sequence 5′ (CUA) 4 GGC CAC GCG TCG ACT AGT ACG GGI IGG GII GGG IIG 3′ (SEQ ID NO:29, 30, and 31) (where I=inosine and U=uracil). PCR was performed using the GENE-AMP PCR Kit with AMPLITAQ DNA Polymerase. An initial melting period at 95° C. for 5 min was followed by 35 cycles of the following program: melting at 95° C. for 1 min, annealing at 55° C. for 1 min, and extension at 72° C. for 2 min. After the last cycle, the reaction was held at 72° C. for 5 min to complete extension. To reduce background from nonspecific primer binding, a second round of PCR is performed using the nested primer 5′ CAA GAG CTT ACC CAA TCA CTT G 3′, (SEQ ID NO:32) again derived from the known sequence of the insert from pSPORT1/N89-5 (the reverse complement of nucleotides 921-900 in SEQ ID NO: 7), together with same 5′ anchor primer used in the first round of PCR.

The amplified products of the second PCR reaction in the size range of 600-1000 bp are digested with Ecl XI and Sal I and subcloned into BLUESCRIPT II SK(−) at the Ecl XI and Sal I sites. The inserts are then sequenced, yielding an additional 600 bp of sequence which align with the coding region of human t-BRK-3. Three separate clones, designated R6-8B2, R6-11-1, and R6-11-2, are sequenced with identical results.

In order to assemble a full length clone of mouse BRK-3, a Sal I site is first placed at the 5′ end of clone R6-11-1 as follows. A primer is synthesized which contains a Sal I site followed by nucleotides 1-20 of the sequence of R6-11-1; the sequence of the primer is 5′ CAC ACG CGT CGA CCA TGA CTT CCT CGC TGC ATC G 3′ (SEQ ID NO:33). This is used together with the M13 reverse primer, 5′ AAC AGC TAT GAC CAT G 3′ (SEQ ID NO:34), in order to amplify a DNA fragment using plasmid DNA from clone R6-11-1 as the template. PCR was performed using the GENE-AMP PCR Kit with AMPLITAQ DNA Polymerase. An initial melting period at 95° C. for 5 min was followed by 35 cycles of the following program: melting at 95° C. for 1 min, annealing at 55° C. for 1 min, and extension at 72° C. for 2 min. After the last cycle, the reaction was held at 72° C. for 5 min to complete extension. The fragment amplified from R6-11-1, together with the insert from pSPORT1/N89-5 (230 ng), is then subcloned in to BLUESCRIPT II SK(−) as follows. The amplified fragment from R6-11-1 is digested with Sal I and Ecl XI. The insert from pSPORT1/N89-5 is digested with Ecl XI and Pst I. The vector BLUESCRIPT II SK(−) is digested with Sal I and Pst I. The three fragments are combined in a three-way ligation using T4 DNA ligase (3 hr, 25° C.) and used to transform electrocompetent E coli, strain DH5-a, using a BIO-RAD Gene PULSER (BIO-RAD, Hercules, Calif.) according to the manufacturer's instructions. A positive colony is selected and is designated pBLUESCRIPT-mBRK3. Sequencing of the 5′ portion of the insert that was amplified by PCR shows a sequence identical to that of clone R6-11-1, indicating that no mutations are introduced during the amplification.

For mammalian expression, m-BRK-3 is subcloned into the mammalian expression vector pJT6. This vector is a derivative of pJT3, described in example 4 above, in which the Not I site at the 5′ end of the multiple cloning site has been deleted, and a spacer inserted between the Pst I and BamHI restriction sites in the multiple cloning site. To accomplish the subcloning, m-BRK-3 is excised from pBLUESCRIPT-mBRK3 using Not I and Sal I, then subcloned into pJT6 at the Not I and Sal I sites to generate pJT6-mBRK3.

However, resequencing of the 3′ end of pJT6-mBRK3 and the original cDNA in pSPORT1/N89-5 results in an altered reading frame at the 3′ end, and shows that the stop codon is actually located 3′ to the Pst I site. Thus, pJT6-mBRK3 does not contain a stop codon. Accordingly, two new constructs are prepared as follows.

First, pJT6-mBRK3 is digested with SpeI (site at position 2306 in SEQ ID NO: 7) and Not I (in the multiple cloning site of pJT6), removing the 3′ end of the insert. The longest clone isolated during the screening of the NIH-3T3 library, pSPORT1/N89-5, is also digested with Spe I and Not I. The 1.2 kb fragment liberated from pSPORT1/N89-5 is subcloned into the Spe I/Not I digested pJT6-mBRK3, regenerating both sites. This construct is designated pJT6-mBRK-3L, and contains the entire 3'end of the pSPORT1/N89-5 clone. A map of the construct is shown in FIG. 10 .

The 3′ end of the clone contains 403 nucleotides in the untranslated region 3′ to the stop codon. This region is very A-T rich, which might possibly lead to decreased expression levels. To remove this region, a second construct is prepared. The pSPORT1/N89-5 plasmid is digested with Hind III (site at nucleotide 3168 in SEQ ID NO:7, 21 bases 3′ to the stop codon). The linearized plasmid is treated with Klenow fragment of DNA polymerase (Boehringer Mannheim, Indianapolis, Ind.) to fill in overhangs, then cut with Spe I to liberate an 863 bp fragment at the 3′ end of the insert. At the same time, pJT6-mBRK3 is digested with Not I. The linearized plasmid is treated with Klenow fragment, then cut with Spe I, releasing the 3′ end of the insert. The Not I/Spe I digested pJT6-mBRK3 is then ligated to the fragment liberated from pSPORT1/N89-5 by Hind III/Spe I. This regenerates the Spe I site; the Hind III and Not I sites are destroyed. The resulting construct is designated pJT6-mBRK3S, and is shown in FIG. 11 .

The construct pJT6-mBRK-3S is also constructed directly from the partial cDNA clone of m-BRK-3, pSPORT1/N89-5, and the construct containing the 5′ end of the cDNA, clone R6-11-1. This is accomplished by digestion of clone R6-1 1-1 with Sal I and Ecl XI, digestion of pSPORT1/N89-5 with Ecl XI and Hind III, and digestion of BLUESCRIPT II SK (−) with Sal I and Hind III. These fragments are then subjected to a three-way ligation to generate the full length m-BRK-3 cDNA in the BLUESCRIPT II vector. The full length cDNA is then excised from this construct using Sal I and Not I, then subcloned into the Sal I and Not I sites of the pJT6 vector. The resulting plasmid has exactly the same cDNA for BRK-3 as does pJT6-mBRK3S described in the above example. However, it carries additional vector sequence at the 3′ end of the cDNA, comprising the region between the Hind III and Not I sites in the multiple cloning site of BLUESCRIPT II SK(−).

EXAMPLE 10

Sequence Analysis of Mouse BRK-3

The DNA sequence of the full length mouse BRK-3 insert from pJT6-mBRK3L is shown in SEQ ID NO: 7, and the deduced protein sequence is shown in SEQ ID NO: 8. The deduced amino acid sequence of mouse BRK-3 is searched against all translated protein sequences in GenBank release 84.0, dated Aug. 15, 1994, using a standard Needleman-Wunsch algorithm (S. B. Needleman and C. D. Wunsch, J. Mol. Biol, 48: 443-453 (1970)). It is found to be a unique sequence. It encodes a protein of 1038 amino acids. Comparing mouse BRK-3 with the truncated human receptor over the region encoded by t-BRK-3 (amino acids 1-582 in SEQ ID NO:4; amino acids 1-582 in SEQ ID NO: 8), the two receptors are 98% identical in sequence. Like t-BRK-3, m-BRK-3 contains a predicted transmembrane region encompassing amino acids 151-172. As with t-BRK-3, the intracellular domain contains all of the consensus sequences that characterize a protein kinase domain with predicted specificity for serine/threonine residues (S. K. Hanks, A. M. Quinn, and T. Hunter, Science, 241: 42-52 (1988)). The kinase domain is followed by an extremely long carboxy terminus (534 amino acids). Indeed, due to the presence of this carboxy terminus, the intracellular domain in BRK-3 (866 amino acids) is much larger than that of any other receptor in the TGF-β receptor family. It is nearly twice as long as the intracellular domain of DAF-4 (490 amino acids), which has the longest intracellular domain known in the TGF-β family until the present invention.

EXAMPLE 11

Demonstration of [ 125 I]-BMP-4 Binding to m-BRK-3

In order to demonstrate that [ 125 I]-BMP-4 binds specifically to m-BRK-3, COS-1 cells are transfected as described in Example 5 using the constructs pJT6-mBRK-3S and pJT6-mBRK-3L. In addition, the cells are also co-transfected with cDNA for the type I receptor BRK-2, using the construct pJT3-BRK-2, to determine whether the presence of a type I BMP receptor affects binding of [ 125 I]-BMP-4. Whole cell binding with [ 125 I]-BMP-4 is carried out as described in Example 7.

The results are shown in FIG. 12 , which shows specific binding of [ 125 I]-BMP-4 normalized to cell number. When cells are transfected with mouse BRK-3 alone, using either of the two constructs tested, specific binding of [125I]-BMP-4 is increased to 4-7 times the level seen with mock transfected cells. Transfection of BRK-2 alone shows increased binding at a similar level to that seen with mouse BRK-3 alone. When cells are co-transfected with BRK-2 as well as mouse BRK-3, the binding is further increased to 9-11 times that of mock-transfected cells, consistent with the results obtained with BRK-2 in combination with t-BRK-3 ( FIG. 6 in Example 7 above).

As an additional demonstration that m-BRK-3 binds to[ 125 I]-BMP-4, a crosslinking experiment is carried out. COS-1 cells are transfected with the cDNA for m-BRK-3, using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2) as described in Example 5. The transfected cells are incubated with [ 125 I]-BMP-4 and crosslinked as described in Example 7, except that disuccinimidyl suberate (DSS) is used as the crosslinking agent rather than disuccinimidyl glutarate. The results of such an experiment are shown in FIG. 13 . Cells transfected with m-BRK-3 alone show no crosslinked band, consistent with the results obtained with t-BRK-3 (FIG. 7 ). Cells transfected with the cDNA for BRK-1 alone show a single species migrating at an apparent molecular weight of 81 kD, consistent with the predicted molecular weight of BRK-1 plus the crosslinked BMP-4 monomer. Cells transfected with the cDNAs for BRK-1 and m-BRK-3 show three labeled bands, one of which is consistent with the band seen with BRK-1 alone (81 kD). The other bands migrate with an apparent molecular weight of 159 kD and 128 kD. The larger of these is consistent with the predicted molecular weight of m-BRK-3 plus the crosslinked BMP-4 monomer. Note that the intensity of the crosslinked band identified with BRK-1 is considerably increased, compared to that seen with BRK-1 alone.

Similarly, transfection of cells with the cDNA for BRK-2 alone yields a crosslinked band migrating at an apparent molecular weight of 78 kD, consistent with the predicted molecular weight of BRK-2 plus the crosslinked BMP-4 monomer. In cells transfected with the cDNAs for BRK-2 and mBRK3, the 78 kD species identified with BRK-2 is observed, as well as crosslinked bands at 159 kD and 128 kD, comigrating with the higher molecular weight bands seen in cells transfected with the cDNAs for BRK-1 and m-BRK-3. As with BRK-1, the intensity of crosslinking to the band identified with BRK-2 is considerably increased compared to that seen with BRK-2 alone. Finally, no labeled bands are observed in cells transfected with vector alone.

An immunoprecipitation experiment is carried out to demonstrate the ability of m-BRK-3 to form a complex with type I BMP receptors. COS-1 cells are transfected with the cDNA for m-BRK-3, using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2) as described in Example 5. The transfected cells are incubated with [ 125 I]-BMP-4, crosslinked , and subjected to immunoprecipitation with antibodies to the appropriate type I receptor or preimmune serum as described in example 8, except that DSS is used as the crosslinking agent rather than disuccinimidyl glutarate. The results of this experiment are shown in FIG. 14 . In cells transfected with cDNA for BRK-1 alone, a single band is precipitated by antibodies to BRK-1, migrating at an apparent molecular weight of 81 kD. In cells transfected with cDNAs for BRK-1 and m-BRK-3, antibodies to BRK-1 precipitate the 81 kD band, which is now increased in intensity. In addition, however, a band migrating at an apparent molecular weight of 159 kD is observed, consistent with the predicted molecular weight of m-BRK-3 plus crosslinked BMP-4 monomer. Similarly, in cells transfected with cDNA for BRK-2 alone, antibodies to BRK-2 precipitate a labeled species migrating at an apparent molecular weight of 78 kD. In cells transfected with cDNAs for BRK-2 and m-BRK-3 and precipitated with antibodies to BRK-2, the 78 kD band identified with BRK-2 is again observed, at increased intensity. In addition, a labeled species is seen at 159 kD, consistent with m-BRK-3 and comigrating with the higher molecular weight band seen in cells transfected with cDNAs for BRK-1 and m-BRK-3. In cells transfected with cDNAs for BRK-2 and m-BRK-3, an additional labeled band is observed at 94 kD. As a control, cells are transfected with the cDNAs for BRK-1 and m-BRK-3, or BRK-2 and m-BRK-3, then subjected to immunoprecipitation with preimmune sera (lanes far left and far right); no labeled bands are observed.

This experiment shows that when m-BRK-3 is co-expressed with the type I BMP receptors BRK-1 or BRK-2, antibodies which precipitate the type I receptor also precipitate m-BRK-3. Thus, m-BRK-3 can form a complex with either of these mammalian type I BMP receptors, as expected for a mammalian type II BMP receptor. This is consistent with results obtained with t-BRK-3 described in Example 8 above.

EXAMPLE 12

Isolation of Full Length Human BRK-3 cDNA

Since clone HSK723, described in Example 2, does not contain an in-frame stop codon, it is desired to obtain additional sequence 3′ to the end of this cDNA. Accordingly, the human foreskin fibroblast library prepared in Example 1 is rescreened with the HSK7-2 PCR fragment, using labeling and screening conditions exactly as described in Example 2. This results in isolation of a longer clone, designated pHSK1030, which contains additional human BRK-3 sequence (total of 3355 base pairs) subcloned in BLUESCRIPT SK(−). Sequencing of the insert from pHSK1030 discloses a coding region of 982 amino acids, but the insert still does not contain an in-frame stop codon.

The remainder of the coding region is cloned by PCR as follows. Two forward primers are derived from the plus strand of clone pHSK1030. The sequences of these primers are as follows: primer RPK3-1, 5′ CCTGTCACATAATAGGCGTGTGCC-3′ (SEQ ID NO:37) (identical to nucleotides 1998-2021 in SEQ ID NO:1); primer RPK3-2, 5′ CGCGGATCCATCATACTGACAGCATCG 3′ (SEQ ID NO:36) (which incorporates a BamHI site followed by nucleotides 2078-2095 in SEQ ID NO:1). Two additional primers are derived from the minus strand of λgt10. These primers are: G10F1, 5′ GCTGGGTAGTCCCCACCTTT 3′ (SEQ ID NO:37) and G10F2, 5′ GAGCAAGTTCAGCCTGGT 3′ (SEQ ID NO:38).

The human fibroblast cDNA library prepared in Example 1 is used as the template for PCR. The library (0.3 μg) is incubated with the RPK3-1 and G10F1 primers (1 μM each), Tth polymerase ( 1.2 units), all four deoxynucleotides (200 μM each), buffer for the Tth polymerase, and water in a total of 50 μl. Conditions for the PCR cycle are as follows: initial melting at 94° C. for 2 min, followed by 20 cycles of melting, 94° C. for 1.5 min; annealing, 52° C. for 2 min; and extension, 72° C. for 3 min. After cycle 20, the sample is held at 72° C. for an additional 8 min to insure complete extension.

To increase specificity and reduce background, a second round of nested PCR is carried out. The incubation mixture is the same as described in this example for the first round, except that (1) an aliquot of the first PCR reaction (0.5 μl) is used as the template; and (2) RPK3-2 and G10F2 primers are used, instead of RPK3-1 and G10F1. Conditions for the PCR run are identical to those described in this example for the first round of PCR.

The second round of PCR results in the amplification of a 1.6 kb fragment, which is isolated from an agarose gel by QIAEX. This fragment is digested with EcoRI and BamHI, and subcloned into BLUESCRIPT SK(−) at the EcoRI and Bam HI sites. The resulting construct, pHSK723-3U, is sequenced and found to encode the remaining coding region of BRK-3 with an in-frame stop codon.

In order to assemble the full length human BRK-3, the inserts from pHSK1030 and pHSK723-3U are joined at a unique Stu I site (located at nucleotide 3219 in SEQ ID NO: 1) in the vector BLUESCRIPT II SK(−). This yields the complete construct pHSK1040, which contains the complete coding sequence of human BRK-3. The pHSK1040 is shown in FIG. 15 . The DNA sequence of human BRK-3 is shown in SEQ ID NO: 1, and the deduced amino acid sequence for human BRK-3 is shown in SEQ ID NO: 2.

The amino acid sequence of human BRK-3 (SEQ ID NO:2) is compared to the amino acid sequence for m-BRK-3 (SEQ ID NO:8) and found to be 96.7% identical.

EXAMPLE 13

Use of the BRK-3 in a Ligand Binding Assay for the Identification of BMP Receptor Agonists and Antagonists

Identification of ligands that interact with BRK-3 can be achieved through the use of assays that are designed to measure the interaction of ligands with BRK-3. An example of a receptor binding assay that is adapted to handle large numbers of samples is carried out as follows.

COS-1 cells are transfected with the cDNA for m-BRK-3 using the construct pJT6-mBRK-3L as described in example 11 above, except that cells are grown in a 12 well culture dish. At 48-68 hr after transfection, the cells are washed once with 1.0 ml binding buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCL, 5 mM MgSO 4 , 1.2 mM CaCl 2 , 2 mg/ml BSA), then equilibrated in the same buffer at 4° C. for 60 min. with gentle shaking. After equilibration, the buffer is aspirated, and to each well is added 500 μl of 4° C. binding buffer containing [ 125 I]BMP-4 tracer (100-400 pM) in the presence or absence of varying concentrations of unlabeled test compounds (i.e., putative ligands), for a period of 4 hours at 4° C. with gentle shaking. For determination of nonspecific binding and complete displacement from the BMP receptor complex, BMP-2 is added at a final concentration of 10 nM. To prevent degradation of ligand, a protease inhibitor cocktail is also added, to give a final concentration of 10 μg/ml leupeptin, 10 μg/ml antipain, 50 μg/ml aprotinin, 100 μg/ml benzamidine, 100 μg/ml soybean trypsin inhibitor, 10 μg/ml bestatin, 10 μg/ml pepstatin, and 300 μM phenylmethylsulfonyl fluoride (PMSF). At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCl, 5 mM MgSO 4 , 1.2 mM CaCl 2 , 0.5 mg/ml BSA). After the final wash is aspirated, 200 μl of solubilization buffer (10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% (v/v) Triton X-100) is added to each well and incubated at room temperature for 15-30 min. The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden, Conn.).

Test compounds which interact with the m-BRK-3 receptor are observed to compete with binding to the receptor with the [ 125 I]BMP-4 tracer in the cells expressing m-BRK-3, such that less [ 125 I]BMP-4 tracer is bound in the presence of the test compound in comparison to the binding observed when the tracer is incubated in the absence of the novel compound. A decrease in binding of the [ 125 I]BMP-4 tracer by ≧30% at the highest concentration of the test compound that is studied demonstrates that the test compound binds to m-BRK-3.

Similar results are obtained when other, related BRK-3 protein receptor kinases of the present invention are used according to the method of this example.

EXAMPLE 14

Use of m-BRK-3 and BRK-2 in a Ligand Binding Assay for the Identification of BMP Receptor Agonists and Antagonists

Identification of ligands that interact with BRK-3 complexed to a type I BMP receptor can be achieved through the use of assays that are designed to measure the interaction of the ligands with this BMP receptor complex. A receptor binding assay that uses the m-BRK-3/BRK-2 complex and is adapted to handle large numbers of samples is carried out as follows.

COS-1 cells are transfected with the cDNAs for m-BRK-3, using the construct pJT6-mBRK-3L, and BRK-2, using the construct pJT3-BRK-2, as described in example 11 above, except that the cells are grown in a 12 well culture dish. The DNA mixture used to transfect the cells contains 2 μg/ml of pJT3-BRK-2 and 4 μg/ml of pJT6-mBRK-3L. At 48-68 hours after transfection, the cells are washed once with 1 ml binding buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCL, 5 mM MgSO 4 , 1.2 mM CaCl 2 , 2 mg/ml BSA), then equilibrated in the same buffer at 4° C. for 60 min with gentle shaking. After equilibration, the buffer is aspirated, and to each well is added 500 μl of 4° C. binding buffer containing [ 125 I]BMP-4 tracer (100-400 pM) in the presence or absence of varying concentrations of test compounds (i.e., putative ligands), for a period of 4 hours at 4° C. with gentle shaking. For determination of nonspecific binding and complete displacement from the BMP receptor complex, BMP-2 is added at a final concentration of 10 nM. To prevent degradation of ligand, a protease inhibitor cocktail is also added, to give a final concentration of 10 μg/ml leupeptin, 10 μg/ml antipain, 50 μg/ml aprotinin, 100 μg/ml benzamidine, 100 μg/ml soybean trypsin inhibitor, 10 μg/ml bestatin, 10 μg/ml pepstatin, and 300 μM phenylmethylsulfonyl fluoride (PMSF). At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCl, 5 mM KCl, 5 mM MgSO 4, 1.2 mM CaCl 2 , 0.5 mg/ml BSA). After the final wash is aspirated, 200 μl of solubilization buffer ( 10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% (v/v) Triton X-100) is added to each well and incubated at room temperature for 15-30 min. The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden, Conn.).

Test compounds which interact with the m-BRK-3/BRK-2 receptor complex are observed to compete for binding to the receptor complex with the [ 125 I]BMP-4 tracer, such that less [ 125 I]BMP-4 tracer is bound in the presence of the test compound in comparison to the binding observed when the tracer is incubated in the absence of the novel compound. A decrease in binding of the [ 125 I]BMP-4 tracer by ≧30% at the highest concentration of the test compound that is studied demonstrates that the test compound binds to the m-BRK-3/BRK-2 receptor complex.

Similar results are obtained when the other BRK-3 protein receptor kinases of the present invention, or homologues thereof, are used in combination with BRK-2 or other BMP type I receptors.

EXAMPLE 15

Use of m-BRK-3 and BRK-2 in a Signaling Assay for the Identification of BMP Receptor Agonists and Antagonists

Identification of ligands that signal upon interaction with BRK-3 complexed to a type I receptor can be achieved through the use of assays that are designed to measure the activation of the receptor protein kinase domain after binding of the ligand to the receptor complex. An in vivo phosphorylation assay that measures changes in phosphorylation of proteins that are immunoprecipitated by antibodies to the BRK-2 Type I receptor in cells that express the mBRK-3/BRK-2 complex is carried out as follows.

COS-1 cells are transfected with the cDNAs for m-BRK-3, using the construct pJT6-mBRK-3 S, and BRK-2, using the construct pJT3-BRK-2, as described in Example 11 above, except that cells are grown in a T175 flask (Falcon). The DNA mixture used to transfect the cells contains 2 μg/ml of pJT3-BRK-2 and 4 μg/ml of pJT6-mBRK-3S. 24 hours after transfection, the cells are plated into 100 millimeter tissue culture dishes, allowed to attach to the plates for at least 5 hours, and then the media is changed to DMEM (Life Technologies, Inc., Gaithersburg, Md.) containing 1% fetal bovine serum (HyClone, Logan, Utah), and 2 mM L-glutamine, 0.1 mM MEM nonessential amino acids solution; and grown in this low serum media for an additional 12-18 hours. These serum-starved cells are washed three times with ten milliliters per dish of phosphate-free Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Inc., Gaithersburg, Md.) supplemented with 2 mM L-glutamine, 0.1 mM MEM nonessential amino acids solution, and 25 mM HEPES buffer, pH 7.4. Three milliliters per dish of supplemented phosphate-free DMEM and 0.8-1.0 milliCuries per dish of [ 32 P] orthophosphoric acid (DuPont New England Nuclear, Wilmington, Del.) are then added to the cells, which are incubated at 37° C. in 95% air/5% C 2 for 3 hours. Following incubation, the cells are treated with appropriate concentrations of ligand stimulators such as BMP-4 for 5 minutes at 37° C. Treated cells are washed three times with ten milliliters per dish of 4° C. 50 mM Tris-buffered saline solution (Sigma, St. Louis, Mo.) and lysed for ten minutes at 4° C. in one milliliter per dish of P-RIP buffer (20 mM Tris pH 8.0, 100 mM sodium chloride, 1 mM disodium ethylenediaminetetraacetic acid, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, 10 mM sodium iodide, 1% bovine serum albumin, 50 mM sodium fluoride, 30 mM tetrasodium pyrophosphate, 250 mM sodium orthovanadate, and 1 mM phenylmethylsulfonyl fluoride (all reagents from Sigma, St. Louis, Mo.)). The lysates are clarified by centrifugation at 10,000×g for ten minutes and sodium dodecyl sulfate (Sigma, St. Louis, Mo.) is added to 0.1% final concentration from a 10% stock solution (the resulting buffer is called P-RIPS: P-RIP supplemented with 0.1% sodium dodecyl sulfate). 100 μl of PANSORBIN (a 10% solution of S. aureus cells; Pansorbin: Calbiochem, La Jolla, Calif.) is added and tubes are incubated for 30 minutes on ice. The PANSORBIN is removed by centrifugation at 10,000×g for three minutes and the supernatants are transferred to new tubes containing a 1:100 dilution of rabbit anti-BRK-2 polyclonal antisera obtained as described in Example 8 above, except that the BRK-2 antibody that is used for this assay is generated against the peptide ARPRYSIGLEQDETYIPPC, (SEQ ID NO:39) which is based on the amino acid sequence of BRK-2 in the intracellular juxtamembrane region, comprising amino acids 155-172 in SEQ ID NO: 14, with the addition of a cysteine at the C terminus to permit conjugation of the peptide, as described in Example 8, above. Following an overnight incubation at 4° C., 50 microliters of Pansorbin is added and incubated for an additional 30 minutes at 4° C. The Pansorbin-bound complexes are pelleted by centrifugation at 10,000×g for three minutes and the pellets are washed three times with P-RIPS buffer and once with P-TNEN buffer (20 mM Tris pH 8.0, 100 mM sodium chloride, 1 mM disodium ethylenediaminetetraacetic acid, 0.5% Nonidet P-40, 50 mM sodium fluoride, 30 mM tetrasodium pyrophosphate, 250 mM sodium orthovanadate, and 1 mM phenylmethylsulfonyl fluoride). The pellets are then resuspended in 20 microliters per tube of SDS-PAGE sample buffer (5 Prime-3 Prime, Boulder, Colo.: 50 mM Tris pH 6.8, 2% sodium dodecyl sulfate, 0.1 M dithiothreitol, 0.1% bromophenol blue, 10% glycerol), heated at 95° C. for five minutes, and pelleted by centrifugation at 10,000×g for three minutes. The supernatants are electrophoresed through a 7.5%, 12.5%, or 15% SDS-polyacrylamide gel (Integrated Separation Systems, Natick, Mass.) at a current of 35 milliamps per gel in an electrophoretic running buffer consisting of 25 mM Tris pH 8.5, 192 mM glycine, and 0.1% sodium dodecyl sulfate (Integrated Separation Systems, Natick, Mass.). The gels are fixed for 15 minutes in a 40% methanol/10% acetic acid solution, dried, and either exposed for autoradiography at −80° C. or subjected to PhosphorImager analysis (Molecular Dynamics, Sunnyvale, Calif.).

Test compounds which are agonists of the BRK-2/BRK-3 receptor complex will cause an increase in phosphorylation of the proteins immunoprecipitated by antibodies to the BRK-2 receptor, as judged by an increased labeling of the proteins with [ 32 p]. In order to test for antagonist activity, test compounds are added in the presence of a fixed concentration of BMP-4 or another BMP receptor agonist. Test compounds which are antagonists of the BRK-2/BRK-3 complex will cause a decrease in the labeling of the proteins present in the BRK-2 immunoprecipitate in comparison to that observed after stimulation of the cells with only the fixed concentration of BMP-4, or another BMP receptor agonist.

Deposit of BRK-3, t-BRK-3 and m-BRK-3

E. coli transformed with pJT4-J159F (SEQ ID NO:11 subcloned into expression vector pJT4) was deposited with the ATCC on Oct. 7, 1993, and assigned ATCC Designation No. 69457.

E. coli transformed with pJT4-hBRK3T (SEQ ID NO:3 subcloned into expression vector pJT4) was deposited with the ATCC on Aug. 16, 1994 and assigned ATCC designation No. 69676.

E. coli transformed with pJT6-mBRK-3S (SEQ ID NO: 7 subcloned into expression vector pJT6) was deposited with the ATCC on Sep. 28, 1994 and assigned ATCC designation No. 69694.

E. coli transformed with pJT6-mBRK-3L (SEQ ID NO:7 subcloned into expression vector pJT6) was deposited with the ATCC on Sep. 28, 1994 and assigned ATCC designation No. 69695.

E. coli transformed with pHSK1040 (SEQ ID NO:1 subcloned into BLUESCRIPT II SK(−) was deposited with the ATCC on Oct. 12, 1994, and assigned ATCC designation No. 69703.

As is recognized in the art, there are occasionally errors in DNA and amino acid sequencing methods. As a result, the sequences encoded in the deposited material are incorporated herein by reference and controlling in the event of an error in any of the sequences found in the written description of the present invention. It is further noted that one of ordinary skill in the art reproducing Applicants'work from the written disclosure can discover any sequencing errors using routine skill. The deposit of ATCC No. 69457, ATCC No. 69676, ATCC No. 69694, ATCC No. 69695 and ATCC No. 69703 is not to be considered as an admission that the deposited material is essential to the practice of the present invention.

All publications mentioned hereinabove are hereby incorporated in their entirety by reference.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to one skilled in the art and are to be included in the spirit and purview of this application and scope of the appended claims.

39 3603 base pairs nucleic acid single linear DNA (genomic) unknown 1CGCCCCCCGA CCCCGGATCG AATCCCCGCC CTCCGCACCC TGGATATGTT TTCTCCCAGA 60CCTGGATATT TTTTTGATAT CGTGAAACTA CGAGGGAAAT AATTTGGGGG ATTTCTTCTT 120GGCTCCCTGC TTTCCCCACA GACATGCCTT CCGTTTGGAG GGCCGCGGCA CCCCGTCCGA 180GGCGAAGGAA CCCCCCCAGC CGCGAGGGAG AGAAATGAAG GGAATTTCTG CAGCGGCATG 240AAAGCTCTGC AGCTAGGTCC TCTCATCAGC CATTTGTCCT TTCAAACTGT ATTGTGATAC 300GGGCAGGATC AGTCCACGGG AGAGAAGACG AGCCTCCCGG CTGTTTCTCC GCCGGTCTAC 360TTCCCATATT TCTTTTCTTT GCCCTCCTGA TTCTTGGCTG GCCCAGGGAT GACTTCCTCG 420CTGCAGCGGC CCTGGCGGGT GCCCTGGCTA CCATGGACCA TCCTGCTGGT CAGCACTGCG 480GCTGCTTCGC AGAATCAAGA ACGGCTATGT GCGTTTAAAG ATCCGTATCA GCAAGACCTT 540GGGATAGGTG AGAGTAGAAT CTCTCATGAA AATGGGACAA TATTATGCTC GAAAGGTAGC 600ACCTGCTATG GCCTTTGGGA GAAATCAAAA GGGGACATAA ATCTTGTAAA ACAAGGATGT 660TGGTCTCACA TTGGAGATCC CCAAGAGTGT CACTATGAAG AATGTGTAGT AACTACCACT 720CCTCCCTCAA TTCAGAATGG AACATACCGT TTCTGCTGTT GTAGCACAGA TTTATGTAAT 780GTCAACTTTA CTGAGAATTT TCCACCTCCT GACACAACAC CACTCAGTCC ACCTCATTCA 840TTTAACCGAG ATGAGACAAT AATCATTGCT TTGGCATCAG TCTCTGTATT AGCTGTTTTG 900ATAGTTGCCT TATGCTTTGG ATACAGAATG TTGACAGGAG ACCGTAAACA AGGTCTTCAC 960AGTATGAACA TGATGGAGGC AGCAGCATCC GAACCCTCTC TTGATCTAGA TAATCTGAAA 1020CTGTTGGAGC TGATTGGCCG AGGTCGATAT GGAGCAGTAT ATAAAGGCTC CTTGGATGAG 1080CGTCCAGTTG CTGTAAAAGT GTTTTCCTTT GCAAACCGTC AGAATTTTAT CAACGAAAAG 1140AACATTTACA GAGTGCCTTT GATGGAACAT GACAACATTG CCCGCTTTAT AGTTGGAGAT 1200GAGAGAGTCA CTGCAGATGG ACGCATGGAA TATTTGCTTG TGATGGAGTA CTATCCCAAT 1260GGATCTTTAT GCAAGTATTT AAGTCTCCAC ACAAGTGACT GGGTAAGCTC TTGCCGTCTT 1320GCTCATTCTG TTACTAGAGG ACTGGCTTAT CTTCACACAG AATTACCACG AGGAGATCAT 1380TATAAACCTG CAATTTCCCA TCGAGATTTA AACAGCAGAA ATGTCCTAGT GAAAAATGAT 1440GGAACCTGTG TTATTAGTGA CTTTGGACTG TCCATGAGGC TGACTGGAAA TAGACTGGTG 1500CGCCCAGGGG AGGAAGATAA TGCAGCCATA AGCGAGGTTG GCACTATCAG ATATATGGCA 1560CCAGAAGTGC TAGAAGGAGC TGTGAACTTG AGGGACTGTG AATCAGCTTT GAAACAAGTA 1620GACATGTATG CTCTTGGACT AATCTATTGG GAGATATTTA TGAGATGTAC AGACCTCTTC 1680CCAGGGGAAT CCGTACCAGA GTACCAGATG GCTTTTCAGA CAGAGGTTGG AAACCATCCC 1740ACTTTTGAGG ATATGCAGGT TCTCGTGTCT AGGGAAAAAC AGAGACCCAA GTTCCCAGAA 1800GCCTGGAAAG AAAATAGCCT GGCAGTGAGG TCACTCAAGG AGACAATCGA AGACTGTTGG 1860GACCAGGATG CAGAGGCTCG GCTTACTGCA CAGTGTGCTG AGGAAAGGAT GGCTGAACTT 1920ATGATGATTT GGGAAAGAAA CAAATCTGTG AGCCCAACAG TCAATCCAAT GTCTACTGCT 1980ATGCAGAATG AACGCAACCT GTCACATAAT AGGCGTGTGC CAAAAATTGG TCCTTATCCA 2040GATTATTCTT CCTCCTCATA CATTGAAGAC TCTATCCATC ATACTGACAG CATCGTGAAG 2100AATATTTCCT CTGAGCATTC TATGTCCAGC ACACCTTTGA CTATAGGGGA AAAAAACCGA 2160AATTCAATTA ACTATGAACG ACAGCAAGCA CAAGCTCGAA TCCCCAGCCC TGAAACAAGT 2220GTCACCAGCC TCTCCACCAA CACAACAACC ACAAACACCA CAGGACTCAC GCCAAGTACT 2280GGCATGACTA CTATATCTGA GATGCCATAC CCAGATGAAA CAAATCTGCA TACCACAAAT 2340GTTGCACAGT CAATTGGGCC AACCCCTGTC TGCTTACAGC TGACAGAAGA AGACTTGGAA 2400ACCAACAAGC TAGACCCAAA AGAAGTTGAT AAGAACCTCA AGGAAAGCTC TGATGAGAAT 2460CTCATGGAGC ACTCTCTTAA ACAGTTCAGT GGCCCAGACC CACTGAGCAG TACTAGTTCT 2520AGCTTGCTTT ACCCACTCAT AAAACTTGCA GTAGAAGCAA CTGGACAGCA GGACTTCACA 2580CAGACTGCAA ATGGCCAAGC ATGTTTGATT CCTGATGTTC TGCCTACTCA GATCTATCCT 2640CTCCCCAAGC AGCAGAACCT TCCCAAGAGA CCTACTAGTT TGCCTTTGAA CACCAAAAAT 2700TCAACAAAAG AGCCCCGGCT AAAATTTGGC AGCAAGCACA AATCAAACTT GAAACAAGTC 2760GAAACTGGAG TTGCCAAGAT GAATACAATC AATGCAGCAG AACCTCATGT GGTGACAGTC 2820ACCATGAATG GTGTGGCAGG TAGAAACCAC AGTGTTAACT CCCATGCTGC CACAACCCAA 2880TATGCCAATG GGACAGTACT ATCTGGCCAA ACAACCAACA TAGTGACACA TAGGGCCCAA 2940GAAATGTTGC AGAATCAGTT TATTGGTGAG GACACCCGGC TGAATATTAA TTCCAGTCCT 3000GATGAGCATG AGCCTTTACT GAGACGAGAG CAACAAGCTG GCCATGATGA AGGTGTTCTG 3060GATCGTCTTG TGGACAGGAG GGAACGGCCA CTAGAAGGTG GCCGAACTAA TTCCAATAAC 3120AACAACAGCA ATCCATGTTC AGAACAAGAT GTTCTTGCAC AGGGTGTTCC AAGCACAGCA 3180GCAGATCCTG GGCCATCAAA GCCCAGAAGA GCACAGAGGC CTAATTCTCT GGATCTTTCA 3240GCCACAAATG TCCTGGATGG CAGCAGTATA CAGATAGGTG AGTCAACACA AGATGGCAAA 3300TCAGGATCAG GTGAAAAGAT CAAGAAACGT GTGAAAACTC CCTATTCTCT TAAGCGGTGG 3360CGCCCCTCCA CCTGGGTCAT CTCCACTGAA TCGTTCTGGA CTGTGAAGTC AACAATAATG 3420GCAGTAACAG GGCAGTTCAT TCCAAATCCA GCACTGCTGT TTACCTTGCA GAAGGAGGCA 3480CTGCTACAAC CATGGTGTCT AAAGATATAG GAATGAACTG TCTGTGAAAT GTTTTCAAGC 3540CTATGGAGTG AAATTATTTT TTGCATCATT TAAACATGCA GAAGATGTTT AAAAAAAAAA 3600AAA 3603 2887 amino acids amino acid Not Relevant Not Relevant protein unknown 2Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu Gly Leu1 5 10 15Asn Ala Arg Gly Pro Arg Thr Arg Pro Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Pro Arg Thr Arg Pro Thr His Arg Ile Leu 35 40 45Glu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Ala Leu 50 55 60Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu Ala Leu Ala Leu Glu Ala 420 425 430Leu Ala Ser Glu Arg Val Ala Leu Ser Glu Arg Val Ala Leu Leu Glu 435 440 445Ala Leu Ala Val Ala Leu Leu Glu Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Leu Glu Cys Tyr Ser Pro His Glu Gly Leu Tyr Thr Tyr Arg Ala465 470 475 480Arg Gly Met Glu Thr Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Pro 485 490 495Ala Arg Gly Leu Tyr Ser Gly Leu Asn Gly Leu Tyr Leu Glu His Ile 500 505 510Ser Ser Glu Arg Met Glu Thr Ala Ser Asn Met Glu Thr Met Glu Thr 515 520 525Gly Leu Ala Leu Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu 530 535 540Pro Arg Ser Glu Arg Leu Glu Ala Ser Pro Leu Glu Ala Ser Pro Ala545 550 555 560Ser Asn Leu Glu Leu Tyr Ser Leu Glu Leu Glu Gly Leu Leu Glu Ile 565 570 575Leu Glu Gly Leu Tyr Ala Arg Gly Gly Leu Tyr Ala Arg Gly Thr Tyr 580 585 590Arg Gly Leu Tyr Ala Leu Ala Val Ala Leu Thr Tyr Arg Leu Tyr Ser 595 600 605Gly Leu Tyr Ser Glu Arg Leu Glu Ala Ser Pro Gly Leu Ala Arg Gly 610 615 620Pro Arg Val Ala Leu Ala Leu Ala Val Ala Leu Leu Tyr Ser Val Ala625 630 635 640Leu Pro His Glu Ser Glu Arg Pro His Glu Ala Leu Ala Ala Ser Asn 645 650 655Ala Arg Gly Gly Leu Asn Ala Ser Asn Pro His Glu Ile Leu Glu Ala 660 665 670Ser Asn Gly Leu Leu Tyr Ser Ala Ser Asn Ile Leu Glu Thr Tyr Arg 675 680 685Ala Arg Gly Val Ala Leu Pro Arg Leu Glu Met Glu Thr Gly Leu His 690 695 700Ile Ser Ala Ser Pro Ala Ser Asn Ile Leu Glu Ala Leu Ala Ala Arg705 710 715 720Gly Pro His Glu Ile Leu Glu Val Ala Leu Gly Leu Tyr Ala Ser Pro 725 730 735Gly Leu Ala Arg Gly Val Ala Leu Thr His Arg Ala Leu Ala Ala Ser 740 745 750Pro Gly Leu Tyr Ala Arg Gly Met Glu Thr Gly Leu Thr Tyr Arg Leu 755 760 765Glu Leu Glu Val Ala Leu Met Glu Thr Gly Leu Thr Tyr Arg Thr Tyr 770 775 780Arg Pro Arg Ala Ser Asn Gly Leu Tyr Ser Glu Arg Leu Glu Cys Tyr785 790 795 800Ser Leu Tyr Ser Thr Tyr Arg Leu Glu Ser Glu Arg Leu Glu His Ile 805 810 815Ser Thr His Arg Ser Glu Arg Ala Ser Pro Thr Arg Pro Val Ala Leu 820 825 830Ser Glu Arg Ser Glu Arg Cys Tyr Ser Ala Arg Gly Leu Glu Ala Leu 835 840 845Ala His Ile Ser Ser Glu Arg Val Ala Leu Thr His Arg Ala Arg Gly 850 855 860Gly Leu Tyr Leu Glu Ala Leu Ala Thr Tyr Arg Leu Glu His Ile Ser865 870 875 880Thr His Arg Gly Leu Leu Glu Pro Arg Ala Arg Gly Gly Leu Tyr Ala 885 890 895Ser Pro His Ile Ser Thr Tyr Arg Leu Tyr Ser Pro Arg Ala Leu Ala 900 905 910Ile Leu Glu Ser Glu Arg His Ile Ser Ala Arg Gly Ala Ser Pro Leu 915 920 925Glu Ala Ser Asn Ser Glu Arg Ala Arg Gly Ala Ser Asn Val Ala Leu 930 935 940Leu Glu Val Ala Leu Leu Tyr Ser Ala Ser Asn Ala Ser Pro Gly Leu945 950 955 960Tyr Thr His Arg Cys Tyr Ser Val Ala Leu Ile Leu Glu Ser Glu Arg 965 970 975Ala Ser Pro Pro His Glu Gly Leu Tyr Leu Glu Ser Glu Arg Met Glu 980 985 990Thr Ala Arg Gly Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Asn Ala 995 1000 1005Arg Gly Leu Glu Val Ala Leu Ala Arg Gly Pro Arg Gly Leu Tyr Gly 1010 1015 1020Leu Gly Leu Ala Ser Pro Ala Ser Asn Ala Leu Ala Ala Leu Ala Ile1025 1030 1035 1040Leu Glu Ser Glu Arg Gly Leu Val Ala Leu Gly Leu Tyr Thr His Arg 1045 1050 1055Ile Leu Glu Ala Arg Gly Thr Tyr Arg Met Glu Thr Ala Leu Ala Pro 1060 1065 1070Arg Gly Leu Val Ala Leu Leu Glu Gly Leu Gly Leu Tyr Ala Leu Ala 1075 1080 1085Val Ala Leu Ala Ser Asn Leu Glu Ala Arg Gly Ala Ser Pro Cys Tyr 1090 1095 1100Ser Gly Leu Ser Glu Arg Ala Leu Ala Leu Glu Leu Tyr Ser Gly Leu1105 1110 1115 1120Asn Val Ala Leu Ala Ser Pro Met Glu Thr Thr Tyr Arg Ala Leu Ala 1125 1130 1135Leu Glu Gly Leu Tyr Leu Glu Ile Leu Glu Thr Tyr Arg Thr Arg Pro 1140 1145 1150Gly Leu Ile Leu Glu Pro His Glu Met Glu Thr Ala Arg Gly Cys Tyr 1155 1160 1165Ser Thr His Arg Ala Ser Pro Leu Glu Pro His Glu Pro Arg Gly Leu 1170 1175 1180Tyr Gly Leu Ser Glu Arg Val Ala Leu Pro Arg Gly Leu Thr Tyr Arg1185 1190 1195 1200Gly Leu Asn Met Glu Thr Ala Leu Ala Pro His Glu Gly Leu Asn Thr 1205 1210 1215His Arg Gly Leu Val Ala Leu Gly Leu Tyr Ala Ser Asn His Ile Ser 1220 1225 1230Pro Arg Thr His Arg Pro His Glu Gly Leu Ala Ser Pro Met Glu Thr 1235 1240 1245Gly Leu Asn Val Ala Leu Leu Glu Val Ala Leu Ser Glu Arg Ala Arg 1250 1255 1260Gly Gly Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg Leu Tyr1265 1270 1275 1280Ser Pro His Glu Pro Arg Gly Leu Ala Leu Ala Thr Arg Pro Leu Tyr 1285 1290 1295Ser Gly Leu Ala Ser Asn Ser Glu Arg Leu Glu Ala Leu Ala Val Ala 1300 1305 1310Leu Ala Arg Gly Ser Glu Arg Leu Glu Leu Tyr Ser Gly Leu Thr His 1315 1320 1325Arg Ile Leu Glu Gly Leu Ala Ser Pro Cys Tyr Ser Thr Arg Pro Ala 1330 1335 1340Ser Pro Gly Leu Asn Ala Ser Pro Ala Leu Ala Gly Leu Ala Leu Ala1345 1350 1355 1360Ala Arg Gly Leu Glu Thr His Arg Ala Leu Ala Gly Leu Asn Cys Tyr 1365 1370 1375Ser Ala Leu Ala Gly Leu Gly Leu Ala Arg Gly Met Glu Thr Ala Leu 1380 1385 1390Ala Gly Leu Leu Glu Met Glu Thr Met Glu Thr Ile Leu Glu Thr Arg 1395 1400 1405Pro Gly Leu Ala Arg Gly Ala Ser Asn Leu Tyr Ser Ser Glu Arg Val 1410 1415 1420Ala Leu Ser Glu Arg Pro Arg Thr His Arg Val Ala Leu Ala Ser Asn1425 1430 1435 1440Pro Arg Met Glu Thr Ser Glu Arg Thr His Arg Ala Leu Ala Met Glu 1445 1450 1455Thr Gly Leu Asn Ala Ser Asn Gly Leu Ala Arg Gly Ala Ser Asn Leu 1460 1465 1470Glu Ser Glu Arg His Ile Ser Ala Ser Asn Ala Arg Gly Ala Arg Gly 1475 1480 1485Val Ala Leu Pro Arg Leu Tyr Ser Ile Leu Glu Gly Leu Tyr Pro Arg 1490 1495 1500Thr Tyr Arg Pro Arg Ala Ser Pro Thr Tyr Arg Ser Glu Arg Ser Glu1505 1510 1515 1520Arg Ser Glu Arg Ser Glu Arg Thr Tyr Arg Ile Leu Glu Gly Leu Ala 1525 1530 1535Ser Pro Ser Glu Arg Ile Leu Glu His Ile Ser His Ile Ser Thr His 1540 1545 1550Arg Ala Ser Pro Ser Glu Arg Ile Leu Glu Val Ala Leu Leu Tyr Ser 1555 1560 1565Ala Ser Asn Ile Leu Glu Ser Glu Arg Ser Glu Arg Gly Leu His Ile 1570 1575 1580Ser Ser Glu Arg Met Glu Thr Ser Glu Arg Ser Glu Arg Thr His Arg1585 1590 1595 1600Pro Arg Leu Glu Thr His Arg Ile Leu Glu Gly Leu Tyr Gly Leu Leu 1605 1610 1615Tyr Ser Ala Ser Asn Ala Arg Gly Ala Ser Asn Ser Glu Arg Ile Leu 1620 1625 1630Glu Ala Ser Asn Thr Tyr Arg Gly Leu Ala Arg Gly Gly Leu Asn Gly 1635 1640 1645Leu Asn Ala Leu Ala Gly Leu Asn Ala Leu Ala Ala Arg Gly Ile Leu 1650 1655 1660Glu Pro Arg Ser Glu Arg Pro Arg Gly Leu Thr His Arg Ser Glu Arg1665 1670 1675 1680Val Ala Leu Thr His Arg Ser Glu Arg Leu Glu Ser Glu Arg Thr His 1685 1690 1695Arg Ala Ser Asn Thr His Arg Thr His Arg Thr His Arg Thr His Arg 1700 1705 1710Ala Ser Asn Thr His Arg Thr His Arg Gly Leu Tyr Leu Glu Thr His 1715 1720 1725Arg Pro Arg Ser Glu Arg Thr His Arg Gly Leu Tyr Met Glu Thr Thr 1730 1735 1740His Arg Thr His Arg Ile Leu Glu Ser Glu Arg Gly Leu Met Glu Thr1745 1750 1755 1760Pro Arg Thr Tyr Arg Pro Arg Ala Ser Pro Gly Leu Thr His Arg Ala 1765 1770 1775Ser Asn Leu Glu His Ile Ser Thr His Arg Thr His Arg Ala Ser Asn 1780 1785 1790Val Ala Leu Ala Leu Ala Gly Leu Asn Ser Glu Arg Ile Leu Glu Gly 1795 1800 1805Leu Tyr Pro Arg Thr His Arg Pro Arg Val Ala Leu Cys Tyr Ser Leu 1810 1815 1820Glu Gly Leu Asn Leu Glu Thr His Arg Gly Leu Gly Leu Ala Ser Pro1825 1830 1835 1840Leu Glu Gly Leu Thr His Arg Ala Ser Asn Leu Tyr Ser Leu Glu Ala 1845 1850 1855Ser Pro Pro Arg Leu Tyr Ser Gly Leu Val Ala Leu Ala Ser Pro Leu 1860 1865 1870Tyr Ser Ala Ser Asn Leu Glu Leu Tyr Ser Gly Leu Ser Glu Arg Ser 1875 1880 1885Glu Arg Ala Ser Pro Gly Leu Ala Ser Asn Leu Glu Met Glu Thr Gly 1890 1895 1900Leu His Ile Ser Ser Glu Arg Leu Glu Leu Tyr Ser Gly Leu Asn Pro1905 1910 1915 1920His Glu Ser Glu Arg Gly Leu Tyr Pro Arg Ala Ser Pro Pro Arg Leu 1925 1930 1935Glu Ser Glu Arg Ser Glu Arg Thr His Arg Ser Glu Arg Ser Glu Arg 1940 1945 1950Ser Glu Arg Leu Glu Leu Glu Thr Tyr Arg Pro Arg Leu Glu Ile Leu 1955 1960 1965Glu Leu Tyr Ser Leu Glu Ala Leu Ala Val Ala Leu Gly Leu Ala Leu 1970 1975 1980Ala Thr His Arg Gly Leu Tyr Gly Leu Asn Gly Leu Asn Ala Ser Pro1985 1990 1995 2000Pro His Glu Thr His Arg Gly Leu Asn Thr His Arg Ala Leu Ala Ala 2005 2010 2015Ser Asn Gly Leu Tyr Gly Leu Asn Ala Leu Ala Cys Tyr Ser Leu Glu 2020 2025 2030Ile Leu Glu Pro Arg Ala Ser Pro Val Ala Leu Leu Glu Pro Arg Thr 2035 2040 2045His Arg Gly Leu Asn Ile Leu Glu Thr Tyr Arg Pro Arg Leu Glu Pro 2050 2055 2060Arg Leu Tyr Ser Gly Leu Asn Gly Leu Asn Ala Ser Asn Leu Glu Pro2065 2070 2075 2080Arg Leu Tyr Ser Ala Arg Gly Pro Arg Thr His Arg Ser Glu Arg Leu 2085 2090 2095Glu Pro Arg Leu Glu Ala Ser Asn Thr His Arg Leu Tyr Ser Ala Ser 2100 2105 2110Asn Ser Glu Arg Thr His Arg Leu Tyr Ser Gly Leu Pro Arg Ala Arg 2115 2120 2125Gly Leu Glu Leu Tyr Ser Pro His Glu Gly Leu Tyr Ser Glu Arg Leu 2130 2135 2140Tyr Ser His Ile Ser Leu Tyr Ser Ser Glu Arg Ala Ser Asn Leu Glu2145 2150 2155 2160Leu Tyr Ser Gly Leu Asn Val Ala Leu Gly Leu Thr His Arg Gly Leu 2165 2170 2175Tyr Val Ala Leu Ala Leu Ala Leu Tyr Ser Met Glu Thr Ala Ser Asn 2180 2185 2190Thr His Arg Ile Leu Glu Ala Ser Asn Ala Leu Ala Ala Leu Ala Gly 2195 2200 2205Leu Pro Arg His Ile Ser Val Ala Leu Val Ala Leu Thr His Arg Val 2210 2215 2220Ala Leu Thr His Arg Met Glu Thr Ala Ser Asn Gly Leu Tyr Val Ala2225 2230 2235 2240Leu Ala Leu Ala Gly Leu Tyr Ala Arg Gly Ala Ser Asn His Ile Ser 2245 2250 2255Ser Glu Arg Val Ala Leu Ala Ser Asn Ser Glu Arg His Ile Ser Ala 2260 2265 2270Leu Ala Ala Leu Ala Thr His Arg Thr His Arg Gly Leu Asn Thr Tyr 2275 2280 2285Arg Ala Leu Ala Ala Ser Asn Gly Leu Tyr Thr His Arg Val Ala Leu 2290 2295 2300Leu Glu Ser Glu Arg Gly Leu Tyr Gly Leu Asn Thr His Arg Thr His2305 2310 2315 2320Arg Ala Ser Asn Ile Leu Glu Val Ala Leu Thr His Arg His Ile Ser 2325 2330 2335Ala Arg Gly Ala Leu Ala Gly Leu Asn Gly Leu Met Glu Thr Leu Glu 2340 2345 2350Gly Leu Asn Ala Ser Asn Gly Leu Asn Pro His Glu Ile Leu Glu Gly 2355 2360 2365Leu Tyr Gly Leu Ala Ser Pro Thr His Arg Ala Arg Gly Leu Glu Ala 2370 2375 2380Ser Asn Ile Leu Glu Ala Ser Asn Ser Glu Arg Ser Glu Arg Pro Arg2385 2390 2395 2400Ala Ser Pro Gly Leu His Ile Ser Gly Leu Pro Arg Leu Glu Leu Glu 2405 2410 2415Ala Arg Gly Ala Arg Gly Gly Leu Gly Leu Asn Gly Leu Asn Ala Leu 2420 2425 2430Ala Gly Leu Tyr His Ile Ser Ala Ser Pro Gly Leu Gly Leu Tyr Val 2435 2440 2445Ala Leu Leu Glu Ala Ser Pro Ala Arg Gly Leu Glu Val Ala Leu Ala 2450 2455 2460Ser Pro Ala Arg Gly Ala Arg Gly Gly Leu Ala Arg Gly Pro Arg Leu2465 2470 2475 2480Glu Gly Leu Gly Leu Tyr Gly Leu Tyr Ala Arg Gly Thr His Arg Ala 2485 2490 2495Ser Asn Ser Glu Arg Ala Ser Asn Ala Ser Asn Ala Ser Asn Ala Ser 2500 2505 2510Asn Ser Glu Arg Ala Ser Asn Pro Arg Cys Tyr Ser Ser Glu Arg Gly 2515 2520 2525Leu Gly Leu Asn Ala Ser Pro Val Ala Leu Leu Glu Ala Leu Ala Gly 2530 2535 2540Leu Asn Gly Leu Tyr Val Ala Leu Pro Arg Ser Glu Arg Thr His Arg2545 2550 2555 2560Ala Leu Ala Ala Leu Ala Ala Ser Pro Pro Arg Gly Leu Tyr Pro Arg 2565 2570 2575Ser Glu Arg Leu Tyr Ser Pro Arg Ala Arg Gly Ala Arg Gly Ala Leu 2580 2585 2590Ala Gly Leu Asn Ala Arg Gly Pro Arg Ala Ser Asn Ser Glu Arg Leu 2595 2600 2605Glu Ala Ser Pro Leu Glu Ser Glu Arg Ala Leu Ala Thr His Arg Ala 2610 2615 2620Ser Asn Val Ala Leu Leu Glu Ala Ser Pro Gly Leu Tyr Ser Glu Arg2625 2630 2635 2640Ser Glu Arg Ile Leu Glu Gly Leu Asn Ile Leu Glu Gly Leu Tyr Gly 2645 2650 2655Leu Ser Glu Arg Thr His Arg Gly Leu Asn Ala Ser Pro Gly Leu Tyr 2660 2665 2670Leu Tyr Ser Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Gly 2675 2680 2685Leu Leu Tyr Ser Ile Leu Glu Leu Tyr Ser Leu Tyr Ser Ala Arg Gly 2690 2695 2700Val Ala Leu Leu Tyr Ser Thr His Arg Pro Arg Thr Tyr Arg Ser Glu2705 2710 2715 2720Arg Leu Glu Leu Tyr Ser Ala Arg Gly Thr Arg Pro Ala Arg Gly Pro 2725 2730 2735Arg Ser Glu Arg Thr His Arg Thr Arg Pro Val Ala Leu Ile Leu Glu 2740 2745 2750Ser Glu Arg Thr His Arg Gly Leu Ser Glu Arg Leu Glu Ala Ser Pro 2755 2760 2765Cys Tyr Ser Gly Leu Val Ala Leu Ala Ser Asn Ala Ser Asn Ala Ser 2770 2775 2780Asn Gly Leu Tyr Ser Glu Arg Ala Ser Asn Ala Arg Gly Ala Leu Ala2785 2790 2795 2800Val Ala Leu His Ile Ser Ser Glu Arg Leu Tyr Ser Ser Glu Arg Ser 2805 2810 2815Glu Arg Thr His Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Leu Glu 2820 2825 2830Ala Leu Ala Gly Leu Gly Leu Tyr Gly Leu Tyr Thr His Arg Ala Leu 2835 2840 2845Ala Thr His Arg Thr His Arg Met Glu Thr Val Ala Leu Ser Glu Arg 2850 2855 2860Leu Tyr Ser Ala Ser Pro Ile Leu Glu Gly Leu Tyr Met Glu Thr Ala2865 2870 2875 2880Ser Asn Cys Tyr Ser Leu Glu 2885 2156 base pairs nucleic acid single linear DNA (genomic) unknown 3CGCCCCCCGA CCCCGGATCG AATCCCCGCC CTCCGCACCC TGGATATGTT TTCTCCCAGA 60CCTGGATATT TTTTTGATAT CGTGAAACTA CGAGGGAAAT AATTTGGGGG ATTTCTTCTT 120GGCTCCCTGC TTTCCCCACA GACATGCCTT CCGTTTGGAG GGCCGCGGCA CCCCGTCCGA 180GGCGAAGGAA CCCCCCCAGC CGCGAGGGAG AGAAATGAAG GGAATTTCTG CAGCGGCATG 240AAAGCTCTGC AGCTAGGTCC TCTCATCAGC CATTTGTCCT TTCAAACTGT ATTGTGATAC 300GGGCAGGATC AGTCCACGGG AGAGAAGACG AGCCTCCCGG CTGTTTCTCC GCCGGTCTAC 360TTCCCATATT TCTTTTCTTT GCCCTCCTGA TTCTTGGCTG GCCCAGGGAT GACTTCCTCG 420CTGCAGCGGC CCTGGCGGGT GCCCTGGCTA CCATGGACCA TCCTGCTGGT CAGCACTGCG 480GCTGCTTCGC AGAATCAAGA ACGGCTATGT GCGTTTAAAG ATCCGTATCA GCAAGACCTT 540GGGATAGGTG AGAGTAGAAT CTCTCATGAA AATGGGACAA TATTATGCTC GAAAGGTAGC 600ACCTGCTATG GCCTTTGGGA GAAATCAAAA GGGGACATAA ATCTTGTAAA ACAAGGATGT 660TGGTCTCACA TTGGAGATCC CCAAGAGTGT CACTATGAAG AATGTGTAGT AACTACCACT 720CCTCCCTCAA TTCAGAATGG AACATACCGT TTCTGCTGTT GTAGCACAGA TTTATGTAAT 780GTCAACTTTA CTGAGAATTT TCCACCTCCT GACACAACAC CACTCAGTCC ACCTCATTCA 840TTTAACCGAG ATGAGACAAT AATCATTGCT TTGGCATCAG TCTCTGTATT AGCTGTTTTG 900ATAGTTGCCT TATGCTTTGG ATACAGAATG TTGACAGGAG ACCGTAAACA AGGTCTTCAC 960AGTATGAACA TGATGGAGGC AGCAGCATCC GAACCCTCTC TTGATCTAGA TAATCTGAAA 1020CTGTTGGAGC TGATTGGCCG AGGTCGATAT GGAGCAGTAT ATAAAGGCTC CTTGGATGAG 1080CGTCCAGTTG CTGTAAAAGT GTTTTCCTTT GCAAACCGTC AGAATTTTAT CAACGAAAAG 1140AACATTTACA GAGTGCCTTT GATGGAACAT GACAACATTG CCCGCTTTAT AGTTGGAGAT 1200GAGAGAGTCA CTGCAGATGG ACGCATGGAA TATTTGCTTG TGATGGAGTA CTATCCCAAT 1260GGATCTTTAT GCAAGTATTT AAGTCTCCAC ACAAGTGACT GGGTAAGCTC TTGCCGTCTT 1320GCTCATTCTG TTACTAGAGG ACTGGCTTAT CTTCACACAG AATTACCACG AGGAGATCAT 1380TATAAACCTG CAATTTCCCA TCGAGATTTA AACAGCAGAA ATGTCCTAGT GAAAAATGAT 1440GGAACCTGTG TTATTAGTGA CTTTGGACTG TCCATGAGGC TGACTGGAAA TAGACTGGTG 1500CGCCCAGGGG AGGAAGATAA TGCAGCCATA AGCGAGGTTG GCACTATCAG ATATATGGCA 1560CCAGAAGTGC TAGAAGGAGC TGTGAACTTG AGGGACTGTG AATCAGCTTT GAAACAAGTA 1620GACATGTATG CTCTTGGACT AATCTATTGG GAGATATTTA TGAGATGTAC AGACCTCTTC 1680CCAGGGGAAT CCGTACCAGA GTACCAGATG GCTTTTCAGA CAGAGGTTGG AAACCATCCC 1740ACTTTTGAGG ATATGCAGGT TCTCGTGTCT AGGGAAAAAC AGAGACCCAA GTTCCCAGAA 1800GCCTGGAAAG AAAATAGCCT GGCAGTGAGG TCACTCAAGG AGACAATCGA AGACTGTTGG 1860GACCAGGATG CAGAGGCTCG GCTTACTGCA CAGTGTGCTG AGGAAAGGAT GGCTGAACTT 1920ATGATGATTT GGGAAAGAAA CAAATCTGTG AGCCCAACAG TCAATCCAAT GTCTACTGCT 1980ATGCAGAATG AACGCAACCT GTCACATAAT AGGCGTGTGC CAAAAATTGG TCCTTATCCA 2040GATTATTCTT CCTCCTCATA CATTGAAGAC TCTATCCATC ATACTGACAG CATCGTGAAG 2100AATATTTCCT CTGAGCATTC TATGTCCAGC ACACCTTTGA CTATAGGGGA AAAAAA 2156 1618 amino acids amino acid Not Relevant Not Relevant protein unknown 4Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu Gly Leu1 5 10 15Asn Ala Arg Gly Pro Arg Thr Arg Pro Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Pro Arg Thr Arg Pro Thr His Arg Ile Leu 35 40 45Glu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Ala Leu 50 55 60Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu Ala Leu Ala Leu Glu Ala 420 425 430Leu Ala Ser Glu Arg Val Ala Leu Ser Glu Arg Val Ala Leu Leu Glu 435 440 445Ala Leu Ala Val Ala Leu Leu Glu Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Leu Glu Cys Tyr Ser Pro His Glu Gly Leu Tyr Thr Tyr Arg Ala465 470 475 480Arg Gly Met Glu Thr Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Pro 485 490 495Ala Arg Gly Leu Tyr Ser Gly Leu Asn Gly Leu Tyr Leu Glu His Ile 500 505 510Ser Ser Glu Arg Met Glu Thr Ala Ser Asn Met Glu Thr Met Glu Thr 515 520 525Gly Leu Ala Leu Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu 530 535 540Pro Arg Ser Glu Arg Leu Glu Ala Ser Pro Leu Glu Ala Ser Pro Ala545 550 555 560Ser Asn Leu Glu Leu Tyr Ser Leu Glu Leu Glu Gly Leu Leu Glu Ile 565 570 575Leu Glu Gly Leu Tyr Ala Arg Gly Gly Leu Tyr Ala Arg Gly Thr Tyr 580 585 590Arg Gly Leu Tyr Ala Leu Ala Val Ala Leu Thr Tyr Arg Leu Tyr Ser 595 600 605Gly Leu Tyr Ser Glu Arg Leu Glu Ala Ser Pro Gly Leu Ala Arg Gly 610 615 620Pro Arg Val Ala Leu Ala Leu Ala Val Ala Leu Leu Tyr Ser Val Ala625 630 635 640Leu Pro His Glu Ser Glu Arg Pro His Glu Ala Leu Ala Ala Ser Asn 645 650 655Ala Arg Gly Gly Leu Asn Ala Ser Asn Pro His Glu Ile Leu Glu Ala 660 665 670Ser Asn Gly Leu Leu Tyr Ser Ala Ser Asn Ile Leu Glu Thr Tyr Arg 675 680 685Ala Arg Gly Val Ala Leu Pro Arg Leu Glu Met Glu Thr Gly Leu His 690 695 700Ile Ser Ala Ser Pro Ala Ser Asn Ile Leu Glu Ala Leu Ala Ala Arg705 710 715 720Gly Pro His Glu Ile Leu Glu Val Ala Leu Gly Leu Tyr Ala Ser Pro 725 730 735Gly Leu Ala Arg Gly Val Ala Leu Thr His Arg Ala Leu Ala Ala Ser 740 745 750Pro Gly Leu Tyr Ala Arg Gly Met Glu Thr Gly Leu Thr Tyr Arg Leu 755 760 765Glu Leu Glu Val Ala Leu Met Glu Thr Gly Leu Thr Tyr Arg Thr Tyr 770 775 780Arg Pro Arg Ala Ser Asn Gly Leu Tyr Ser Glu Arg Leu Glu Cys Tyr785 790 795 800Ser Leu Tyr Ser Thr Tyr Arg Leu Glu Ser Glu Arg Leu Glu His Ile 805 810 815Ser Thr His Arg Ser Glu Arg Ala Ser Pro Thr Arg Pro Val Ala Leu 820 825 830Ser Glu Arg Ser Glu Arg Cys Tyr Ser Ala Arg Gly Leu Glu Ala Leu 835 840 845Ala His Ile Ser Ser Glu Arg Val Ala Leu Thr His Arg Ala Arg Gly 850 855 860Gly Leu Tyr Leu Glu Ala Leu Ala Thr Tyr Arg Leu Glu His Ile Ser865 870 875 880Thr His Arg Gly Leu Leu Glu Pro Arg Ala Arg Gly Gly Leu Tyr Ala 885 890 895Ser Pro His Ile Ser Thr Tyr Arg Leu Tyr Ser Pro Arg Ala Leu Ala 900 905 910Ile Leu Glu Ser Glu Arg His Ile Ser Ala Arg Gly Ala Ser Pro Leu 915 920 925Glu Ala Ser Asn Ser Glu Arg Ala Arg Gly Ala Ser Asn Val Ala Leu 930 935 940Leu Glu Val Ala Leu Leu Tyr Ser Ala Ser Asn Ala Ser Pro Gly Leu945 950 955 960Tyr Thr His Arg Cys Tyr Ser Val Ala Leu Ile Leu Glu Ser Glu Arg 965 970 975Ala Ser Pro Pro His Glu Gly Leu Tyr Leu Glu Ser Glu Arg Met Glu 980 985 990Thr Ala Arg Gly Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Asn Ala 995 1000 1005Arg Gly Leu Glu Val Ala Leu Ala Arg Gly Pro Arg Gly Leu Tyr Gly 1010 1015 1020Leu Gly Leu Ala Ser Pro Ala Ser Asn Ala Leu Ala Ala Leu Ala Ile1025 1030 1035 1040Leu Glu Ser Glu Arg Gly Leu Val Ala Leu Gly Leu Tyr Thr His Arg 1045 1050 1055Ile Leu Glu Ala Arg Gly Thr Tyr Arg Met Glu Thr Ala Leu Ala Pro 1060 1065 1070Arg Gly Leu Val Ala Leu Leu Glu Gly Leu Gly Leu Tyr Ala Leu Ala 1075 1080 1085Val Ala Leu Ala Ser Asn Leu Glu Ala Arg Gly Ala Ser Pro Cys Tyr 1090 1095 1100Ser Gly Leu Ser Glu Arg Ala Leu Ala Leu Glu Leu Tyr Ser Gly Leu1105 1110 1115 1120Asn Val Ala Leu Ala Ser Pro Met Glu Thr Thr Tyr Arg Ala Leu Ala 1125 1130 1135Leu Glu Gly Leu Tyr Leu Glu Ile Leu Glu Thr Tyr Arg Thr Arg Pro 1140 1145 1150Gly Leu Ile Leu Glu Pro His Glu Met Glu Thr Ala Arg Gly Cys Tyr 1155 1160 1165Ser Thr His Arg Ala Ser Pro Leu Glu Pro His Glu Pro Arg Gly Leu 1170 1175 1180Tyr Gly Leu Ser Glu Arg Val Ala Leu Pro Arg Gly Leu Thr Tyr Arg1185 1190 1195 1200Gly Leu Asn Met Glu Thr Ala Leu Ala Pro His Glu Gly Leu Asn Thr 1205 1210 1215His Arg Gly Leu Val Ala Leu Gly Leu Tyr Ala Ser Asn His Ile Ser 1220 1225 1230Pro Arg Thr His Arg Pro His Glu Gly Leu Ala Ser Pro Met Glu Thr 1235 1240 1245Gly Leu Asn Val Ala Leu Leu Glu Val Ala Leu Ser Glu Arg Ala Arg 1250 1255 1260Gly Gly Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg Leu Tyr1265 1270 1275 1280Ser Pro His Glu Pro Arg Gly Leu Ala Leu Ala Thr Arg Pro Leu Tyr 1285 1290 1295Ser Gly Leu Ala Ser Asn Ser Glu Arg Leu Glu Ala Leu Ala Val Ala 1300 1305 1310Leu Ala Arg Gly Ser Glu Arg Leu Glu Leu Tyr Ser Gly Leu Thr His 1315 1320 1325Arg Ile Leu Glu Gly Leu Ala Ser Pro Cys Tyr Ser Thr Arg Pro Ala 1330 1335 1340Ser Pro Gly Leu Asn Ala Ser Pro Ala Leu Ala Gly Leu Ala Leu Ala1345 1350 1355 1360Ala Arg Gly Leu Glu Thr His Arg Ala Leu Ala Gly Leu Asn Cys Tyr 1365 1370 1375Ser Ala Leu Ala Gly Leu Gly Leu Ala Arg Gly Met Glu Thr Ala Leu 1380 1385 1390Ala Gly Leu Leu Glu Met Glu Thr Met Glu Thr Ile Leu Glu Thr Arg 1395 1400 1405Pro Gly Leu Ala Arg Gly Ala Ser Asn Leu Tyr Ser Ser Glu Arg Val 1410 1415 1420Ala Leu Ser Glu Arg Pro Arg Thr His Arg Val Ala Leu Ala Ser Asn1425 1430 1435 1440Pro Arg Met Glu Thr Ser Glu Arg Thr His Arg Ala Leu Ala Met Glu 1445 1450 1455Thr Gly Leu Asn Ala Ser Asn Gly Leu Ala Arg Gly Ala Ser Asn Leu 1460 1465 1470Glu Ser Glu Arg His Ile Ser Ala Ser Asn Ala Arg Gly Ala Arg Gly 1475 1480 1485Val Ala Leu Pro Arg Leu Tyr Ser Ile Leu Glu Gly Leu Tyr Pro Arg 1490 1495 1500Thr Tyr Arg Pro Arg Ala Ser Pro Thr Tyr Arg Ser Glu Arg Ser Glu1505 1510 1515 1520Arg Ser Glu Arg Ser Glu Arg Thr Tyr Arg Ile Leu Glu Gly Leu Ala 1525 1530 1535Ser Pro Ser Glu Arg Ile Leu Glu His Ile Ser His Ile Ser Thr His 1540 1545 1550Arg Ala Ser Pro Ser Glu Arg Ile Leu Glu Val Ala Leu Leu Tyr Ser 1555 1560 1565Ala Ser Asn Ile Leu Glu Ser Glu Arg Ser Glu Arg Gly Leu His Ile 1570 1575 1580Ser Ser Glu Arg Met Glu Thr Ser Glu Arg Ser Glu Arg Thr His Arg1585 1590 1595 1600Pro Arg Leu Glu Thr His Arg Ile Leu Glu Gly Leu Tyr Gly Leu Leu 1605 1610 1615Tyr Ser 471 base pairs nucleic acid single linear DNA (genomic) unknown 5TTCTTGGCTG GCCCAGGGAT GACTTCCTCG CTGCAGCGGC CCTGGCGGGT GCCCTGGCTA 60CCATGGACCA TCCTGCTGGT CAGCACTGCG GCTGCTTCGC AGAATCAAGA ACGGCTATGT 120GCGTTTAAAG ATCCGTATCA GCAAGACCTT GGGATAGGTG AGAGTAGAAT CTCTCATGAA 180AATGGGACAA TATTATGCTC GAAAGGTAGC ACCTGCTATG GCCTTTGGGA GAAATCAAAA 240GGGGACATAA ATCTTGTAAA ACAAGGATGT TGGTCTCACA TTGGAGATCC CCAAGAGTGT 300CACTATGAAG AATGTGTAGT AACTACCACT CCTCCCTCAA TTCAGAATGG AACATACCGT 360TTCTGCTGTT GTAGCACAGA TTTATGTAAT GTCAACTTTA CTGAGAATTT TCCACCTCCT 420GACACAACAC CACTCAGTCC ACCTCATTCA TTTAACCGAG ATGAGACATG A 471 417 amino acids amino acid Not Relevant Not Relevant protein unknown 6Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu Gly Leu1 5 10 15Asn Ala Arg Gly Pro Arg Thr Arg Pro Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Pro Arg Thr Arg Pro Thr His Arg Ile Leu 35 40 45Glu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Ala Leu 50 55 60Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg 3508 base pairs nucleic acid single linear DNA (genomic) unknown 7CTTTGCTGGC CCAGGGATGA CTTCCTCGCT GCATCGGCCC TTTCGGGTGC CCTGGCTGCT 60ATGGGCCGTC CTGCTGGTCA GCACTACGGC TGCTTCTCAG AATCAAGAAC GGCTGTGTGC 120ATTTAAAGAT CCATATCAAC AAGATCTTGG GATAGGTGAG AGTCGAATCT CTCATGAAAA 180TGGGACAATA TTATGTTCCA AAGGGAGCAC GTGTTATGGT CTGTGGGAGA AATCAAAAGG 240GGACATCAAT CTTGTGAAAC AAGGATGTTG GTCTCACATC GGTGATCCCC AAGAGTGCCA 300CTATGAAGAG TGTGTAGTAA CTACCACCCC ACCCTCAATT CAGAATGGAA CGTACCGCTT 360TTGCTGCTGT AGTACAGATT TATGTAATGT CAACTTTACT GAGAACTTTC CACCCCCTGA 420CACAACACCA CTCAGTCCAC CTCATTCATT TAATCGAGAT GAAACGATAA TCATTGCTTT 480GGCATCAGTT TCTGTGTTAG CTGTTTTGAT AGTCGCCTTA TGTTTTGGAT ACAGAATGTT 540GACAGGAGAC CGGAAACAGG GTCTTCACAG CATGAACATG ATGGAGGCGG CAGCAGCAGA 600GCCCTCCCTT GACCTGGATA ACCTGAAGCT GCTGGAGCTG ATTGGACGGG GTCGATACGG 660AGCAGTATAT AAAGGTTCCT TGGATGAGCG TCCAGTTGCT GTAAAAGTAT TTTCTTTTGC 720AAACCGTCAG AATTTTATAA ATGAAAAAAA CATTTACAGA GTGCCTTTGA TGGAACATGA 780CAACATTGCT CGCTTCATAG TTGGAGACGA GAGGCTCACT GCAGACGGCC GCATGGAGTA 840TTTGCTTGTG ATGGAGTATT ATCCCAATGG ATCTCTGTGC AAATATCTGA GTCTCCACAC 900AAGTGATTGG GTAAGCTCTT GCCGTCTGGC TCATTCTGTG ACTAGAGGAC TGGCTTATCT 960TCACACAGAA TTACCACGAG GAGATCATTA TAAACCCGCA ATCTCCCACC GAGATTTAAA 1020CAGCAGGAAT GTCCTGGTAA AGAATGACGG CGCGTGTGTT ATCAGTGACT TTGGTTTATC 1080CATGAGGCTA ACTGGAAATC GGCTGGTGCG CCCAGGGGAA GAAGATAATG CGGCTATAAG 1140TGAGGTTGGC ACAATTCGCT ATATGGCACC AGAAGTGCTA GAAGGAGCTG TGAACCTGAG 1200GGACTGTGAG TCAGCTCTGA AGCAAGTGGA CATGTATGCG CTTGGACTCA TCTACTGGGA 1260GGTGTTTATG AGGTGTACAG ACCTCTTCCC AGGTGAATCT GTACCAGATT ACCAGATGGC 1320TTTTCAGACA GAAGTTGGAA ACCATCCCAC ATTTGAGGAT ATGCAGGTTC TTGTGTCCAG 1380AGAGAAGCAG AGACCCAAGT TCCCAGAAGC CTGGAAAGAA AATAGCCTGG CAGTGAGGTC 1440ACTCAAGGAA ACAATTGAAG ACTGCTGGGA CCAGGATGCA GAGGCTCGGC TCACTGCACA 1500GTGTGCTGAG GAGAGGATGG CTGAACTCAT GATGATATGG GAGAGAAACA AGTCTGTGAG 1560CCCAACGGTC AACCCAATGT CAACTGCTAT GCAGAATGAA CGCAACCTGT CACATAATAG 1620GCGTGTGCCA AAAATCGGGC CTTACCCAGA TTATTCCTCT TCCTCATATA TTGAAGACTC 1680TATCCATCAT ACTGACAGCA TTGTGAAGAA TATTTCCTCT GAGCATTCGA TGTCCAGCAC 1740ACCATTGACA ATAGGAGAAA AGAATCGAAA TTCAATTAAT TATGAACGAC AGCAAGCACA 1800AGCTCGAATC CCTAGCCCAG AAACAAGCGT CACAAGCCTG TCCACAAACA CAACCACCAC 1860AAACACCACC GGCCTCACTC CAAGTACTGG CATGACCACT ATATCTGAGA TGCCATACCC 1920AGATGAGACA CATTTGCACG CCACAAATGT TGCACAGTCA ATCGGGCCAA CCCCTGTCTG 1980CTTACAGCTG ACAGAAGAAG ACTTGGAGAC TAATAAGCTA GATCCAAAAG AAGTTGATAA 2040GAACCTCAAG GAAAGCTCTG ATGAGAATCT CATGGAGCAT TCTCTGAAGC AGTTCAGTGG 2100GCCAGACCCA TTGAGCAGTA CCAGTTCTAG CTTGCTTTAT CCACTCATAA AGCTCGCAGT 2160GGAAGTGACT GGACAACAGG ACTTCACACA GGCTGCAAAT GGGCAAGCAT GTTTAATTCC 2220TGATGTTCCA CCTGCTCAGA TCTATCCTCT CCCTAAGCAA CAGAACCTTC CTAAGAGACC 2280TACTAGTTTG CCTTTGAACA CCAAAAATTC AACAAAAGAA CCCCGGCTAA AATTTGGCAA 2340CAAGCACAAA TCAAACTTGA AACAAGTAGA AACTGGAGTT GCCAAGATGA ATACAATCAA 2400TGCAGCAGAG CCTCATGTGG TGACAGTAAC TATGAATGGT GTGGCAGGTA GAAGCCACAA 2460TGTTAATTCT CATGCTGCCA CAACCCAGTA TGCCAATGGC GCAGTGCCAG CTGGCCAGGC 2520AGCCAACATA GTGGCACATA GGTCCCAAGA AATGCTGCAG AATCAATTTA TTGGTGAGGA 2580TACCAGGCTG AATATCAATT CCAGTCCTGA TGAGCATGAA CCTTTACTGA GACGAGAGCA 2640ACAGGCTGGC CATGATGAAG GGGTTCTGGA TCGTTTGGTA GATAGGAGGG AACGGCCATT 2700AGAAGGTGGC CGAACAAATT CCAATAACAA CAACAGCAAT CCATGTTCAG AACAAGATAT 2760CCTTACACAA GGTGTTACAA GCACAGCTGC AGATCCTGGG CCATCAAAGC CCAGAAGAGC 2820ACAGAGGCCC AATTCTCTGG ATCTTTCAGC CACAAATATC CTGGATGGCA GCAGTATACA 2880GATAGGTGAG TCAACACAAG ATGGCAAATC AGGATCAGGT GAAAAGATCA AGAGACGTGT 2940GAAAACTCCA TACTCTCTTA AGCGGTGGCG CCCGTCCACC TGGGTCATCT CCACCGAGCC 3000GCTGGACTGT GAGGTCAACA ACAATGGCAG TGACAGGGCA GTCCATTCTA AATCTAGCAC 3060TGCTGTGTAC CTTGCAGAGG GAGGCACTGC CACGACCACA GTGTCTAAAG ATATAGGAAT 3120GAATTGTCTG TGAGATGTTT TCAAGCTTAT GGAGTGAAAT TATTTTTTTG CATCATTTAA 3180ACATGCAGAA GACATTTAAA AAAAAAACTG CTTTAACCTC CTGTCAGCAC CCCTTCCCAC 3240CCCTGCAGCA AGGACTTGCT TTAAATAGAT TTCAGCTATG CAGAAAATTT TAGCTTATGC 3300TTCCATAATT TTTAATTTTG TTTTTTAAGT TTTGCACTTT TGTTTAGTCT TGCTAAAGTT 3360ATATTTGTCT GTTATGACCA CATTATATGT GTGCTTATCC AAAGTGGTCT CCAAATATTT 3420TTTTAAGAAA AAAGCCCAAA CAATGGATTG CTGATAATCA GTTTGGACCA TTTTCTAAAG 3480GTCATTAAAA CAGAAGCAAA TTCAGACC 3508 2887 amino acids amino acid Not Relevant Not Relevant protein unknown 8Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu His Ile1 5 10 15Ser Ala Arg Gly Pro Arg Pro His Glu Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Leu Glu Thr Arg Pro Ala Leu Ala Val Ala 35 40 45Leu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Thr His 50 55 60Arg Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu Ala Leu Ala Leu Glu Ala 420 425 430Leu Ala Ser Glu Arg Val Ala Leu Ser Glu Arg Val Ala Leu Leu Glu 435 440 445Ala Leu Ala Val Ala Leu Leu Glu Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Leu Glu Cys Tyr Ser Pro His Glu Gly Leu Tyr Thr Tyr Arg Ala465 470 475 480Arg Gly Met Glu Thr Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Pro 485 490 495Ala Arg Gly Leu Tyr Ser Gly Leu Asn Gly Leu Tyr Leu Glu His Ile 500 505 510Ser Ser Glu Arg Met Glu Thr Ala Ser Asn Met Glu Thr Met Glu Thr 515 520 525Gly Leu Ala Leu Ala Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu 530 535 540Pro Arg Ser Glu Arg Leu Glu Ala Ser Pro Leu Glu Ala Ser Pro Ala545 550 555 560Ser Asn Leu Glu Leu Tyr Ser Leu Glu Leu Glu Gly Leu Leu Glu Ile 565 570 575Leu Glu Gly Leu Tyr Ala Arg Gly Gly Leu Tyr Ala Arg Gly Thr Tyr 580 585 590Arg Gly Leu Tyr Ala Leu Ala Val Ala Leu Thr Tyr Arg Leu Tyr Ser 595 600 605Gly Leu Tyr Ser Glu Arg Leu Glu Ala Ser Pro Gly Leu Ala Arg Gly 610 615 620Pro Arg Val Ala Leu Ala Leu Ala Val Ala Leu Leu Tyr Ser Val Ala625 630 635 640Leu Pro His Glu Ser Glu Arg Pro His Glu Ala Leu Ala Ala Ser Asn 645 650 655Ala Arg Gly Gly Leu Asn Ala Ser Asn Pro His Glu Ile Leu Glu Ala 660 665 670Ser Asn Gly Leu Leu Tyr Ser Ala Ser Asn Ile Leu Glu Thr Tyr Arg 675 680 685Ala Arg Gly Val Ala Leu Pro Arg Leu Glu Met Glu Thr Gly Leu His 690 695 700Ile Ser Ala Ser Pro Ala Ser Asn Ile Leu Glu Ala Leu Ala Ala Arg705 710 715 720Gly Pro His Glu Ile Leu Glu Val Ala Leu Gly Leu Tyr Ala Ser Pro 725 730 735Gly Leu Ala Arg Gly Leu Glu Thr His Arg Ala Leu Ala Ala Ser Pro 740 745 750Gly Leu Tyr Ala Arg Gly Met Glu Thr Gly Leu Thr Tyr Arg Leu Glu 755 760 765Leu Glu Val Ala Leu Met Glu Thr Gly Leu Thr Tyr Arg Thr Tyr Arg 770 775 780Pro Arg Ala Ser Asn Gly Leu Tyr Ser Glu Arg Leu Glu Cys Tyr Ser785 790 795 800Leu Tyr Ser Thr Tyr Arg Leu Glu Ser Glu Arg Leu Glu His Ile Ser 805 810 815Thr His Arg Ser Glu Arg Ala Ser Pro Thr Arg Pro Val Ala Leu Ser 820 825 830Glu Arg Ser Glu Arg Cys Tyr Ser Ala Arg Gly Leu Glu Ala Leu Ala 835 840 845His Ile Ser Ser Glu Arg Val Ala Leu Thr His Arg Ala Arg Gly Gly 850 855 860Leu Tyr Leu Glu Ala Leu Ala Thr Tyr Arg Leu Glu His Ile Ser Thr865 870 875 880His Arg Gly Leu Leu Glu Pro Arg Ala Arg Gly Gly Leu Tyr Ala Ser 885 890 895Pro His Ile Ser Thr Tyr Arg Leu Tyr Ser Pro Arg Ala Leu Ala Ile 900 905 910Leu Glu Ser Glu Arg His Ile Ser Ala Arg Gly Ala Ser Pro Leu Glu 915 920 925Ala Ser Asn Ser Glu Arg Ala Arg Gly Ala Ser Asn Val Ala Leu Leu 930 935 940Glu Val Ala Leu Leu Tyr Ser Ala Ser Asn Ala Ser Pro Gly Leu Tyr945 950 955 960Ala Leu Ala Cys Tyr Ser Val Ala Leu Ile Leu Glu Ser Glu Arg Ala 965 970 975Ser Pro Pro His Glu Gly Leu Tyr Leu Glu Ser Glu Arg Met Glu Thr 980 985 990Ala Arg Gly Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Asn Ala Arg 995 1000 1005Gly Leu Glu Val Ala Leu Ala Arg Gly Pro Arg Gly Leu Tyr Gly Leu 1010 1015 1020Gly Leu Ala Ser Pro Ala Ser Asn Ala Leu Ala Ala Leu Ala Ile Leu1025 1030 1035 1040Glu Ser Glu Arg Gly Leu Val Ala Leu Gly Leu Tyr Thr His Arg Ile 1045 1050 1055Leu Glu Ala Arg Gly Thr Tyr Arg Met Glu Thr Ala Leu Ala Pro Arg 1060 1065 1070Gly Leu Val Ala Leu Leu Glu Gly Leu Gly Leu Tyr Ala Leu Ala Val 1075 1080 1085Ala Leu Ala Ser Asn Leu Glu Ala Arg Gly Ala Ser Pro Cys Tyr Ser 1090 1095 1100Gly Leu Ser Glu Arg Ala Leu Ala Leu Glu Leu Tyr Ser Gly Leu Asn1105 1110 1115 1120Val Ala Leu Ala Ser Pro Met Glu Thr Thr Tyr Arg Ala Leu Ala Leu 1125 1130 1135Glu Gly Leu Tyr Leu Glu Ile Leu Glu Thr Tyr Arg Thr Arg Pro Gly 1140 1145 1150Leu Val Ala Leu Pro His Glu Met Glu Thr Ala Arg Gly Cys Tyr Ser 1155 1160 1165Thr His Arg Ala Ser Pro Leu Glu Pro His Glu Pro Arg Gly Leu Tyr 1170 1175 1180Gly Leu Ser Glu Arg Val Ala Leu Pro Arg Ala Ser Pro Thr Tyr Arg1185 1190 1195 1200Gly Leu Asn Met Glu Thr Ala Leu Ala Pro His Glu Gly Leu Asn Thr 1205 1210 1215His Arg Gly Leu Val Ala Leu Gly Leu Tyr Ala Ser Asn His Ile Ser 1220 1225 1230Pro Arg Thr His Arg Pro His Glu Gly Leu Ala Ser Pro Met Glu Thr 1235 1240 1245Gly Leu Asn Val Ala Leu Leu Glu Val Ala Leu Ser Glu Arg Ala Arg 1250 1255 1260Gly Gly Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg Leu Tyr1265 1270 1275 1280Ser Pro His Glu Pro Arg Gly Leu Ala Leu Ala Thr Arg Pro Leu Tyr 1285 1290 1295Ser Gly Leu Ala Ser Asn Ser Glu Arg Leu Glu Ala Leu Ala Val Ala 1300 1305 1310Leu Ala Arg Gly Ser Glu Arg Leu Glu Leu Tyr Ser Gly Leu Thr His 1315 1320 1325Arg Ile Leu Glu Gly Leu Ala Ser Pro Cys Tyr Ser Thr Arg Pro Ala 1330 1335 1340Ser Pro Gly Leu Asn Ala Ser Pro Ala Leu Ala Gly Leu Ala Leu Ala1345 1350 1355 1360Ala Arg Gly Leu Glu Thr His Arg Ala Leu Ala Gly Leu Asn Cys Tyr 1365 1370 1375Ser Ala Leu Ala Gly Leu Gly Leu Ala Arg Gly Met Glu Thr Ala Leu 1380 1385 1390Ala Gly Leu Leu Glu Met Glu Thr Met Glu Thr Ile Leu Glu Thr Arg 1395 1400 1405Pro Gly Leu Ala Arg Gly Ala Ser Asn Leu Tyr Ser Ser Glu Arg Val 1410 1415 1420Ala Leu Ser Glu Arg Pro Arg Thr His Arg Val Ala Leu Ala Ser Asn1425 1430 1435 1440Pro Arg Met Glu Thr Ser Glu Arg Thr His Arg Ala Leu Ala Met Glu 1445 1450 1455Thr Gly Leu Asn Ala Ser Asn Gly Leu Ala Arg Gly Ala Ser Asn Leu 1460 1465 1470Glu Ser Glu Arg His Ile Ser Ala Ser Asn Ala Arg Gly Ala Arg Gly 1475 1480 1485Val Ala Leu Pro Arg Leu Tyr Ser Ile Leu Glu Gly Leu Tyr Pro Arg 1490 1495 1500Thr Tyr Arg Pro Arg Ala Ser Pro Thr Tyr Arg Ser Glu Arg Ser Glu1505 1510 1515 1520Arg Ser Glu Arg Ser Glu Arg Thr Tyr Arg Ile Leu Glu Gly Leu Ala 1525 1530 1535Ser Pro Ser Glu Arg Ile Leu Glu His Ile Ser His Ile Ser Thr His 1540 1545 1550Arg Ala Ser Pro Ser Glu Arg Ile Leu Glu Val Ala Leu Leu Tyr Ser 1555 1560 1565Ala Ser Asn Ile Leu Glu Ser Glu Arg Ser Glu Arg Gly Leu His Ile 1570 1575 1580Ser Ser Glu Arg Met Glu Thr Ser Glu Arg Ser Glu Arg Thr His Arg1585 1590 1595 1600Pro Arg Leu Glu Thr His Arg Ile Leu Glu Gly Leu Tyr Gly Leu Leu 1605 1610 1615Tyr Ser Ala Ser Asn Ala Arg Gly Ala Ser Asn Ser Glu Arg Ile Leu 1620 1625 1630Glu Ala Ser Asn Thr Tyr Arg Gly Leu Ala Arg Gly Gly Leu Asn Gly 1635 1640 1645Leu Asn Ala Leu Ala Gly Leu Asn Ala Leu Ala Ala Arg Gly Ile Leu 1650 1655 1660Glu Pro Arg Ser Glu Arg Pro Arg Gly Leu Thr His Arg Ser Glu Arg1665 1670 1675 1680Val Ala Leu Thr His Arg Ser Glu Arg Leu Glu Ser Glu Arg Thr His 1685 1690 1695Arg Ala Ser Asn Thr His Arg Thr His Arg Thr His Arg Thr His Arg 1700 1705 1710Ala Ser Asn Thr His Arg Thr His Arg Gly Leu Tyr Leu Glu Thr His 1715 1720 1725Arg Pro Arg Ser Glu Arg Thr His Arg Gly Leu Tyr Met Glu Thr Thr 1730 1735 1740His Arg Thr His Arg Ile Leu Glu Ser Glu Arg Gly Leu Met Glu Thr1745 1750 1755 1760Pro Arg Thr Tyr Arg Pro Arg Ala Ser Pro Gly Leu Thr His Arg His 1765 1770 1775Ile Ser Leu Glu His Ile Ser Ala Leu Ala Thr His Arg Ala Ser Asn 1780 1785 1790Val Ala Leu Ala Leu Ala Gly Leu Asn Ser Glu Arg Ile Leu Glu Gly 1795 1800 1805Leu Tyr Pro Arg Thr His Arg Pro Arg Val Ala Leu Cys Tyr Ser Leu 1810 1815 1820Glu Gly Leu Asn Leu Glu Thr His Arg Gly Leu Gly Leu Ala Ser Pro1825 1830 1835 1840Leu Glu Gly Leu Thr His Arg Ala Ser Asn Leu Tyr Ser Leu Glu Ala 1845 1850 1855Ser Pro Pro Arg Leu Tyr Ser Gly Leu Val Ala Leu Ala Ser Pro Leu 1860 1865 1870Tyr Ser Ala Ser Asn Leu Glu Leu Tyr Ser Gly Leu Ser Glu Arg Ser 1875 1880 1885Glu Arg Ala Ser Pro Gly Leu Ala Ser Asn Leu Glu Met Glu Thr Gly 1890 1895 1900Leu His Ile Ser Ser Glu Arg Leu Glu Leu Tyr Ser Gly Leu Asn Pro1905 1910 1915 1920His Glu Ser Glu Arg Gly Leu Tyr Pro Arg Ala Ser Pro Pro Arg Leu 1925 1930 1935Glu Ser Glu Arg Ser Glu Arg Thr His Arg Ser Glu Arg Ser Glu Arg 1940 1945 1950Ser Glu Arg Leu Glu Leu Glu Thr Tyr Arg Pro Arg Leu Glu Ile Leu 1955 1960 1965Glu Leu Tyr Ser Leu Glu Ala Leu Ala Val Ala Leu Gly Leu Val Ala 1970 1975 1980Leu Thr His Arg Gly Leu Tyr Gly Leu Asn Gly Leu Asn Ala Ser Pro1985 1990 1995 2000Pro His Glu Thr His Arg Gly Leu Asn Ala Leu Ala Ala Leu Ala Ala 2005 2010 2015Ser Asn Gly Leu Tyr Gly Leu Asn Ala Leu Ala Cys Tyr Ser Leu Glu 2020 2025 2030Ile Leu Glu Pro Arg Ala Ser Pro Val Ala Leu Pro Arg Pro Arg Ala 2035 2040 2045Leu Ala Gly Leu Asn Ile Leu Glu Thr Tyr Arg Pro Arg Leu Glu Pro 2050 2055 2060Arg Leu Tyr Ser Gly Leu Asn Gly Leu Asn Ala Ser Asn Leu Glu Pro2065 2070 2075 2080Arg Leu Tyr Ser Ala Arg Gly Pro Arg Thr His Arg Ser Glu Arg Leu 2085 2090 2095Glu Pro Arg Leu Glu Ala Ser Asn Thr His Arg Leu Tyr Ser Ala Ser 2100 2105 2110Asn Ser Glu Arg Thr His Arg Leu Tyr Ser Gly Leu Pro Arg Ala Arg 2115 2120 2125Gly Leu Glu Leu Tyr Ser Pro His Glu Gly Leu Tyr Ala Ser Asn Leu 2130 2135 2140Tyr Ser His Ile Ser Leu Tyr Ser Ser Glu Arg Ala Ser Asn Leu Glu2145 2150 2155 2160Leu Tyr Ser Gly Leu Asn Val Ala Leu Gly Leu Thr His Arg Gly Leu 2165 2170 2175Tyr Val Ala Leu Ala Leu Ala Leu Tyr Ser Met Glu Thr Ala Ser Asn 2180 2185 2190Thr His Arg Ile Leu Glu Ala Ser Asn Ala Leu Ala Ala Leu Ala Gly 2195 2200 2205Leu Pro Arg His Ile Ser Val Ala Leu Val Ala Leu Thr His Arg Val 2210 2215 2220Ala Leu Thr His Arg Met Glu Thr Ala Ser Asn Gly Leu Tyr Val Ala2225 2230 2235 2240Leu Ala Leu Ala Gly Leu Tyr Ala Arg Gly Ser Glu Arg His Ile Ser 2245 2250 2255Ala Ser Asn Val Ala Leu Ala Ser Asn Ser Glu Arg His Ile Ser Ala 2260 2265 2270Leu Ala Ala Leu Ala Thr His Arg Thr His Arg Gly Leu Asn Thr Tyr 2275 2280 2285Arg Ala Leu Ala Ala Ser Asn Gly Leu Tyr Ala Leu Ala Val Ala Leu 2290 2295 2300Pro Arg Ala Leu Ala Gly Leu Tyr Gly Leu Asn Ala Leu Ala Ala Leu2305 2310 2315 2320Ala Ala Ser Asn Ile Leu Glu Val Ala Leu Ala Leu Ala His Ile Ser 2325 2330 2335Ala Arg Gly Ser Glu Arg Gly Leu Asn Gly Leu Met Glu Thr Leu Glu 2340 2345 2350Gly Leu Asn Ala Ser Asn Gly Leu Asn Pro His Glu Ile Leu Glu Gly 2355 2360 2365Leu Tyr Gly Leu Ala Ser Pro Thr His Arg Ala Arg Gly Leu Glu Ala 2370 2375 2380Ser Asn Ile Leu Glu Ala Ser Asn Ser Glu Arg Ser Glu Arg Pro Arg2385 2390 2395 2400Ala Ser Pro Gly Leu His Ile Ser Gly Leu Pro Arg Leu Glu Leu Glu 2405 2410 2415Ala Arg Gly Ala Arg Gly Gly Leu Gly Leu Asn Gly Leu Asn Ala Leu 2420 2425 2430Ala Gly Leu Tyr His Ile Ser Ala Ser Pro Gly Leu Gly Leu Tyr Val 2435 2440 2445Ala Leu Leu Glu Ala Ser Pro Ala Arg Gly Leu Glu Val Ala Leu Ala 2450 2455 2460Ser Pro Ala Arg Gly Ala Arg Gly Gly Leu Ala Arg Gly Pro Arg Leu2465 2470 2475 2480Glu Gly Leu Gly Leu Tyr Gly Leu Tyr Ala Arg Gly Thr His Arg Ala 2485 2490 2495Ser Asn Ser Glu Arg Ala Ser Asn Ala Ser Asn Ala Ser Asn Ala Ser 2500 2505 2510Asn Ser Glu Arg Ala Ser Asn Pro Arg Cys Tyr Ser Ser Glu Arg Gly 2515 2520 2525Leu Gly Leu Asn Ala Ser Pro Ile Leu Glu Leu Glu Thr His Arg Gly 2530 2535 2540Leu Asn Gly Leu Tyr Val Ala Leu Thr His Arg Ser Glu Arg Thr His2545 2550 2555 2560Arg Ala Leu Ala Ala Leu Ala Ala Ser Pro Pro Arg Gly Leu Tyr Pro 2565 2570 2575Arg Ser Glu Arg Leu Tyr Ser Pro Arg Ala Arg Gly Ala Arg Gly Ala 2580 2585 2590Leu Ala Gly Leu Asn Ala Arg Gly Pro Arg Ala Ser Asn Ser Glu Arg 2595 2600 2605Leu Glu Ala Ser Pro Leu Glu Ser Glu Arg Ala Leu Ala Thr His Arg 2610 2615 2620Ala Ser Asn Ile Leu Glu Leu Glu Ala Ser Pro Gly Leu Tyr Ser Glu2625 2630 2635 2640Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn Ile Leu Glu Gly Leu Tyr 2645 2650 2655Gly Leu Ser Glu Arg Thr His Arg Gly Leu Asn Ala Ser Pro Gly Leu 2660 2665 2670Tyr Leu Tyr Ser Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr 2675 2680 2685Gly Leu Leu Tyr Ser Ile Leu Glu Leu Tyr Ser Ala Arg Gly Ala Arg 2690 2695 2700Gly Val Ala Leu Leu Tyr Ser Thr His Arg Pro Arg Thr Tyr Arg Ser2705 2710 2715 2720Glu Arg Leu Glu Leu Tyr Ser Ala Arg Gly Thr Arg Pro Ala Arg Gly 2725 2730 2735Pro Arg Ser Glu Arg Thr His Arg Thr Arg Pro Val Ala Leu Ile Leu 2740 2745 2750Glu Ser Glu Arg Thr His Arg Gly Leu Pro Arg Leu Glu Ala Ser Pro 2755 2760 2765Cys Tyr Ser Gly Leu Val Ala Leu Ala Ser Asn Ala Ser Asn Ala Ser 2770 2775 2780Asn Gly Leu Tyr Ser Glu Arg Ala Ser Pro Ala Arg Gly Ala Leu Ala2785 2790 2795 2800Val Ala Leu His Ile Ser Ser Glu Arg Leu Tyr Ser Ser Glu Arg Ser 2805 2810 2815Glu Arg Thr His Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Leu Glu 2820 2825 2830Ala Leu Ala Gly Leu Gly Leu Tyr Gly Leu Tyr Thr His Arg Ala Leu 2835 2840 2845Ala Thr His Arg Thr His Arg Thr His Arg Val Ala Leu Ser Glu Arg 2850 2855 2860Leu Tyr Ser Ala Ser Pro Ile Leu Glu Gly Leu Tyr Met Glu Thr Ala2865 2870 2875 2880Ser Asn Cys Tyr Ser Leu Glu 2885 469 base pairs nucleic acid single linear DNA (genomic) unknown 9CTTTGCTGGC CCAGGGATGA CTTCCTCGCT GCATCGGCCC TTTCGGGTGC CCTGGCTGCT 60ATGGGCCGTC CTGCTGGTCA GCACTACGGC TGCTTCTCAG AATCAAGAAC GGCTGTGTGC 120ATTTAAAGAT CCATATCAAC AAGATCTTGG GATAGGTGAG AGTCGAATCT CTCATGAAAA 180TGGGACAATA TTATGTTCCA AAGGGAGCAC GTGTTATGGT CTGTGGGAGA AATCAAAAGG 240GGACATCAAT CTTGTGAAAC AAGGATGTTG GTCTCACATC GGTGATCCCC AAGAGTGCCA 300CTATGAAGAG TGTGTAGTAA CTACCACCCC ACCCTCAATT CAGAATGGAA CGTACCGCTT 360TTGCTGCTGT AGTACAGATT TATGTAATGT CAACTTTACT GAGAACTTTC CACCCCCTGA 420CACAACACCA CTCAGTCCAC CTCATTCATT TAATCGAGAT GAAACGTGA 469 417 amino acids amino acid Not Relevant Not Relevant protein unknown 10Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu His Ile1 5 10 15Ser Ala Arg Gly Pro Arg Pro His Glu Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Leu Glu Thr Arg Pro Ala Leu Ala Val Ala 35 40 45Leu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Thr His 50 55 60Arg Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg 2402 base pairs nucleic acid single linear DNA (genomic) unknown 11GAATCAGACA ATGACTCAGC TATACACTTA CATCAGATTA CTGGGAGCCT GTCTGTTCAT 60CATTTCTCAT GTTCAAGGGC AGAATCTAGA TAGTATGCTC CATGGCACTG GTATGAAATC 120AGACTTGGAC CAGAAGAAGC CAGAAAATGG AGTGACTTTA GCACCAGAGG ATACCTTGCC 180TTTCTTAAAG TGCTATTGCT CAGGACACTG CCCAGATGAT GCTATTAATA ACACATGCAT 240AACTAATGGC CATTGCTTTG CCATTATAGA AGAAGATGAT CAGGGAGAAA CCACATTAAC 300TTCTGGGTGT ATGAAGTATG AAGGCTCTGA TTTTCAATGC AAGGATTCAC CGAAAGCCCA 360GCTACGCAGG ACAATAGAAT GTTGTCGGAC CAATTTGTGC AACCAGTATT TGCAGCCTAC 420ACTGCCCCCT GTTGTTATAG GTCCGTTCTT TGATGGCAGC ATCCGATGGC TGGTTGTGCT 480CATTTCCATG GCTGTCTGTA TAGTTGCTAT GATCATCTTC TCCAGCTGCT TTTGCTATAA 540GCATTATTGT AAGAGTATCT CAAGCAGGGG TCGTTACAAC CGTGATTTGG AACAGGATGA 600AGCATTTATT CCAGTAGGAG AATCATTGAA AGACCTGATT GACCAGTCCC AAAGCTCTGG 660GAGTGGATCT GGATTGCCTT TATTGGTTCA GCGAACTATT GCCAAACAGA TTCAGATGGT 720TCGGCAGGTT GGTAAAGGCC GCTATGGAGA AGTATGGATG GGTAAATGGC GTGGTGAAAA 780AGTGGCTGTC AAAGTGTTTT TTACCACTGA AGAAGCTAGC TGGTTTAGAG AAACAGAAAT 840CTACCAGACG GTGTTAATGC GTCATGAAAA TATACTTGGT TTTATAGCTG CAGACATTAA 900AGGCACTGGT TCCTGGACTC AGCTGTATTT GATTACTGAT TACCATGAAA ATGGATCTCT 960CTATGACTTC CTGAAATGTG CCACACTAGA CACCAGAGCC CTACTCAAGT TAGCTTATTC 1020TGCTGCTTGT GGTCTGTGCC ACCTCCACAC AGAAATTTAT GGTACCCAAG GGAAGCCTGC 1080AATTGCTCAT CGAGACCTGA AGAGCAAAAA CATCCTTATT AAGAAAAATG GAAGTTGCTG 1140TATTGCTGAC CTGGGCCTAG CTGTTAAATT CAACAGTGAT ACAAATGAAG TTGACATACC 1200CTTGAATACC AGGGTGGGCA CCAAGCGGTA CATGGCTCCA GAAGTGCTGG ATGAAAGCCT 1260GAATAAAAAC CATTTCCAGC CCTACATCAT GGCTGACATC TATAGCTTTG GTTTGATCAT 1320TTGGGAAATG GCTCGTCGTT GTATTACAGG AGGAATCGTG GAGGAATATC AATTACCATA 1380TTACAACATG GTGCCCAGTG ACCCATCCTA TGAGGACATG CGTGAGGTTG TGTGTGTGAA 1440ACGCTTGCGG CCAATCGTGT CTAACCGCTG GAACAGCGAT GAATGTCTTC GAGCAGTTTT 1500GAAGCTAATG TCAGAATGTT GGGCCCATAA TCCAGCCTCC AGACTCACAG CTTTGAGAAT 1560CAAGAAGACA CTTGCAAAAA TGGTTGAATC CCAGGATGTA AAGATTTGAC AATTAAACAA 1620TTTTGAGGGA GAATTTAGAC TGCAAGAACT TCTTCACCCA AGGAATGGGT GGGATTAGCA 1680TGGAATAGGA TGTTGACTTG GTTTCCAGAC TCCTTCCTCT ACATCTTCAC AGGCTGCTAA 1740CAGTAAACCT TACCGCACTC TACAGAATAC AAGATTGGAA CTTGGAACTT GGAACTTCAA 1800ACATGTCATT CTTTATATAT GGACAGCTGT GTTTTAAATG TGGGGTTTTT GTGTTTTGCT 1860TTCTTTGTTT TGTTTTGGTT TTGATGCTTT TTTGGTTTTT ATGAACTGCA TCAAGACTCC 1920AATCCTGATA AGAAGTCTCT GGTCAACCTC TGGGTACTCA CTATCCTGTC CATAAAGTGG 1980TGCTTTCTGT GAAAGCCTTA AGAAAATTAA TGAGCTCAGC AGAGATGGAA AAAGGCATAT 2040TTGGCTTCTA CCAGAGAAAA CATCTGTCTG TGTTCTGTCT TTGTAAACAG CCTATAGATT 2100ATGATCTCTT TGGGATACTG CCTGGCTTAT GATGGTGCAC CATACCTTTG ATATACATAC 2160CAGAATTCTC TCCTGCCCTA GGGCTAAGAA GACAAGAATG TAGAGGTTGC ACAGGAGGTA 2220TTTTGTGACC AGTGGTTTAA ATTGCAATAT CTAGTTGGCA ATCGCCAATT TCATAAAAGC 2280CATCCACCTT GTAGCTGTAG TAACTTCTCC ACTGACTTTA TTTTTAGCAT AATAGTTGTG 2340AAGGCCAAAC TCCATGTAAA GTGTCCATAG ACTTGGACTG TTTTCCCCCA GCTCTGATTA 2400CC 2402 1495 amino acids amino acid Not Relevant Not Relevant protein unknown 12Met Glu Thr Thr His Arg Gly Leu Asn Leu Glu Thr Tyr Arg Thr His1 5 10 15Arg Thr Tyr Arg Ile Leu Glu Ala Arg Gly Leu Glu Leu Glu Gly Leu 20 25 30Tyr Ala Leu Ala Cys Tyr Ser Leu Glu Pro His Glu Ile Leu Glu Ile 35 40 45Leu Glu Ser Glu Arg His Ile Ser Val Ala Leu Gly Leu Asn Gly Leu 50 55 60Tyr Gly Leu Asn Ala Ser Asn Leu Glu Ala Ser Pro Ser Glu Arg Met65 70 75 80Glu Thr Leu Glu His Ile Ser Gly Leu Tyr Thr His Arg Gly Leu Tyr 85 90 95Met Glu Thr Leu Tyr Ser Ser Glu Arg Ala Ser Pro Leu Glu Ala Ser 100 105 110Pro Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Pro Arg Gly Leu Ala Ser 115 120 125Asn Gly Leu Tyr Val Ala Leu Thr His Arg Leu Glu Ala Leu Ala Pro 130 135 140Arg Gly Leu Ala Ser Pro Thr His Arg Leu Glu Pro Arg Pro His Glu145 150 155 160Leu Glu Leu Tyr Ser Cys Tyr Ser Thr Tyr Arg Cys Tyr Ser Ser Glu 165 170 175Arg Gly Leu Tyr His Ile Ser Cys Tyr Ser Pro Arg Ala Ser Pro Ala 180 185 190Ser Pro Ala Leu Ala Ile Leu Glu Ala Ser Asn Ala Ser Asn Thr His 195 200 205Arg Cys Tyr Ser Ile Leu Glu Thr His Arg Ala Ser Asn Gly Leu Tyr 210 215 220His Ile Ser Cys Tyr Ser Pro His Glu Ala Leu Ala Ile Leu Glu Ile225 230 235 240Leu Glu Gly Leu Gly Leu Ala Ser Pro Ala Ser Pro Gly Leu Asn Gly 245 250 255Leu Tyr Gly Leu Thr His Arg Thr His Arg Leu Glu Thr His Arg Ser 260 265 270Glu Arg Gly Leu Tyr Cys Tyr Ser Met Glu Thr Leu Tyr Ser Thr Tyr 275 280 285Arg Gly Leu Gly Leu Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly 290 295 300Leu Asn Cys Tyr Ser Leu Tyr Ser Ala Ser Pro Ser Glu Arg Pro Arg305 310 315 320Leu Tyr Ser Ala Leu Ala Gly Leu Asn Leu Glu Ala Arg Gly Ala Arg 325 330 335Gly Thr His Arg Ile Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Ala 340 345 350Arg Gly Thr His Arg Ala Ser Asn Leu Glu Cys Tyr Ser Ala Ser Asn 355 360 365Gly Leu Asn Thr Tyr Arg Leu Glu Gly Leu Asn Pro Arg Thr His Arg 370 375 380Leu Glu Pro Arg Pro Arg Val Ala Leu Val Ala Leu Ile Leu Glu Gly385 390 395 400Leu Tyr Pro Arg Pro His Glu Pro His Glu Ala Ser Pro Gly Leu Tyr 405 410 415Ser Glu Arg Ile Leu Glu Ala Arg Gly Thr Arg Pro Leu Glu Val Ala 420 425 430Leu Val Ala Leu Leu Glu Ile Leu Glu Ser Glu Arg Met Glu Thr Ala 435 440 445Leu Ala Val Ala Leu Cys Tyr Ser Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Met Glu Thr Ile Leu Glu Ile Leu Glu Pro His Glu Ser Glu Arg465 470 475 480Ser Glu Arg Cys Tyr Ser Pro His Glu Cys Tyr Ser Thr Tyr Arg Leu 485 490 495Tyr Ser His Ile Ser Thr Tyr Arg Cys Tyr Ser Leu Tyr Ser Ser Glu 500 505 510Arg Ile Leu Glu Ser Glu Arg Ser Glu Arg Ala Arg Gly Gly Leu Tyr 515 520 525Ala Arg Gly Thr Tyr Arg Ala Ser Asn Ala Arg Gly Ala Ser Pro Leu 530 535 540Glu Gly Leu Gly Leu Asn Ala Ser Pro Gly Leu Ala Leu Ala Pro His545 550 555 560Glu Ile Leu Glu Pro Arg Val Ala Leu Gly Leu Tyr Gly Leu Ser Glu 565 570 575Arg Leu Glu Leu Tyr Ser Ala Ser Pro Leu Glu Ile Leu Glu Ala Ser 580 585 590Pro Gly Leu Asn Ser Glu Arg Gly Leu Asn Ser Glu Arg Ser Glu Arg 595 600 605Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Leu 610 615 620Glu Pro Arg Leu Glu Leu Glu Val Ala Leu Gly Leu Asn Ala Arg Gly625 630 635 640Thr His Arg Ile Leu Glu Ala Leu Ala Leu Tyr Ser Gly Leu Asn Ile 645 650 655Leu Glu Gly Leu Asn Met Glu Thr Val Ala Leu Ala Arg Gly Gly Leu 660 665 670Asn Val Ala Leu Gly Leu Tyr Leu Tyr Ser Gly Leu Tyr Ala Arg Gly 675 680 685Thr Tyr Arg Gly Leu Tyr Gly Leu Val Ala Leu Thr Arg Pro Met Glu 690 695 700Thr Gly Leu Tyr Leu Tyr Ser Thr Arg Pro Ala Arg Gly Gly Leu Tyr705 710 715 720Gly Leu Leu Tyr Ser Val Ala Leu Ala Leu Ala Val Ala Leu Leu Tyr 725 730 735Ser Val Ala Leu Pro His Glu Pro His Glu Thr His Arg Thr His Arg 740 745 750Gly Leu Gly Leu Ala Leu Ala Ser Glu Arg Thr Arg Pro Pro His Glu 755 760 765Ala Arg Gly Gly Leu Thr His Arg Gly Leu Ile Leu Glu Thr Tyr Arg 770 775 780Gly Leu Asn Thr His Arg Val Ala Leu Leu Glu Met Glu Thr Ala Arg785 790 795 800Gly His Ile Ser Gly Leu Ala Ser Asn Ile Leu Glu Leu Glu Gly Leu 805 810 815Tyr Pro His Glu Ile Leu Glu Ala Leu Ala Ala Leu Ala Ala Ser Pro 820 825 830Ile Leu Glu Leu Tyr Ser Gly Leu Tyr Thr His Arg Gly Leu Tyr Ser 835 840 845Glu Arg Thr Arg Pro Thr His Arg Gly Leu Asn Leu Glu Thr Tyr Arg 850 855 860Leu Glu Ile Leu Glu Thr His Arg Ala Ser Pro Thr Tyr Arg His Ile865 870 875 880Ser Gly Leu Ala Ser Asn Gly Leu Tyr Ser Glu Arg Leu Glu Thr Tyr 885 890 895Arg Ala Ser Pro Pro His Glu Leu Glu Leu Tyr Ser Cys Tyr Ser Ala 900 905 910Leu Ala Thr His Arg Leu Glu Ala Ser Pro Thr His Arg Ala Arg Gly 915 920 925Ala Leu Ala Leu Glu Leu Glu Leu Tyr Ser Leu Glu Ala Leu Ala Thr 930 935 940Tyr Arg Ser Glu Arg Ala Leu Ala Ala Leu Ala Cys Tyr Ser Gly Leu945 950 955 960Tyr Leu Glu Cys Tyr Ser His Ile Ser Leu Glu His Ile Ser Thr His 965 970 975Arg Gly Leu Ile Leu Glu Thr Tyr Arg Gly Leu Tyr Thr His Arg Gly 980 985 990Leu Asn Gly Leu Tyr Leu Tyr Ser Pro Arg Ala Leu Ala Ile Leu Glu 995 1000 1005Ala Leu Ala His Ile Ser Ala Arg Gly Ala Ser Pro Leu Glu Leu Tyr 1010 1015 1020Ser Ser Glu Arg Leu Tyr Ser Ala Ser Asn Ile Leu Glu Leu Glu Ile1025 1030 1035 1040Leu Glu Leu Tyr Ser Leu Tyr Ser Ala Ser Asn Gly Leu Tyr Ser Glu 1045 1050 1055Arg Cys Tyr Ser Cys Tyr Ser Ile Leu Glu Ala Leu Ala Ala Ser Pro 1060 1065 1070Leu Glu Gly Leu Tyr Leu Glu Ala Leu Ala Val Ala Leu Leu Tyr Ser 1075 1080 1085Pro His Glu Ala Ser Asn Ser Glu Arg Ala Ser Pro Thr His Arg Ala 1090 1095 1100Ser Asn Gly Leu Val Ala Leu Ala Ser Pro Ile Leu Glu Pro Arg Leu1105 1110 1115 1120Glu Ala Ser Asn Thr His Arg Ala Arg Gly Val Ala Leu Gly Leu Tyr 1125 1130 1135Thr His Arg Leu Tyr Ser Ala Arg Gly Thr Tyr Arg Met Glu Thr Ala 1140 1145 1150Leu Ala Pro Arg Gly Leu Val Ala Leu Leu Glu Ala Ser Pro Gly Leu 1155 1160 1165Ser Glu Arg Leu Glu Ala Ser Asn Leu Tyr Ser Ala Ser Asn His Ile 1170 1175 1180Ser Pro His Glu Gly Leu Asn Pro Arg Thr Tyr Arg Ile Leu Glu Met1185 1190 1195 1200Glu Thr Ala Leu Ala Ala Ser Pro Ile Leu Glu Thr Tyr Arg Ser Glu 1205 1210 1215Arg Pro His Glu Gly Leu Tyr Leu Glu Ile Leu Glu Ile Leu Glu Thr 1220 1225 1230Arg Pro Gly Leu Met Glu Thr Ala Leu Ala Ala Arg Gly Ala Arg Gly 1235 1240 1245Cys Tyr Ser Ile Leu Glu Thr His Arg Gly Leu Tyr Gly Leu Tyr Ile 1250 1255 1260Leu Glu Val Ala Leu Gly Leu Gly Leu Thr Tyr Arg Gly Leu Asn Leu1265 1270 1275 1280Glu Pro Arg Thr Tyr Arg Thr Tyr Arg Ala Ser Asn Met Glu Thr Val 1285 1290 1295Ala Leu Pro Arg Ser Glu Arg Ala Ser Pro Pro Arg Ser Glu Arg Thr 1300 1305 1310Tyr Arg Gly Leu Ala Ser Pro Met Glu Thr Ala Arg Gly Gly Leu Val 1315 1320 1325Ala Leu Val Ala Leu Cys Tyr Ser Val Ala Leu Leu Tyr Ser Ala Arg 1330 1335 1340Gly Leu Glu Ala Arg Gly Pro Arg Ile Leu Glu Val Ala Leu Ser Glu1345 1350 1355 1360Arg Ala Ser Asn Ala Arg Gly Thr Arg Pro Ala Ser Asn Ser Glu Arg 1365 1370 1375Ala Ser Pro Gly Leu Cys Tyr Ser Leu Glu Ala Arg Gly Ala Leu Ala 1380 1385 1390Val Ala Leu Leu Glu Leu Tyr Ser Leu Glu Met Glu Thr Ser Glu Arg 1395 1400 1405Gly Leu Cys Tyr Ser Thr Arg Pro Ala Leu Ala His Ile Ser Ala Ser 1410 1415 1420Asn Pro Arg Ala Leu Ala Ser Glu Arg Ala Arg Gly Leu Glu Thr His1425 1430 1435 1440Arg Ala Leu Ala Leu Glu Ala Arg Gly Ile Leu Glu Leu Tyr Ser Leu 1445 1450 1455Tyr Ser Thr His Arg Leu Glu Ala Leu Ala Leu Tyr Ser Met Glu Thr 1460 1465 1470Val Ala Leu Gly Leu Ser Glu Arg Gly Leu Asn Ala Ser Pro Val Ala 1475 1480 1485Leu Leu Tyr Ser Ile Leu Glu 1490 1495 2252 base pairs nucleic acid single linear DNA (genomic) unknown 13GTTTTCCAGC AGACTGATGC TATAAATGCT CCACAACATG GAGAATGGTT TGGGTTGGAA 60GTAGACTTAA AGACCATCTA TGTGTGGGGA TACCTCCCAC TAGATCAGGC TGCTCAGGGC 120CCCATTCACC ACCTCCAGGG ACGGGGTAGC CACTGCTTCT CTGAGCAACC TGAGCAACTT 180CCTCACAGTG AAGAGTTCCT CCTGTATCCG AGGGTGGAGT TCATTTCTTT TGTCCTTGGA 240AGTTGAATAG CAGAAAGGGA CATTTCAGCT TTTCTTGATA AAGGTTACAT CCATTTTACT 300TAGACTACAA GACGAAGATT TCTGAAAATT GAGATCTTTA GTTTTCTGGA CAAGATGCCC 360TTGCTTAGCT CCAGCAAGTT GAGCATGGAG AGCAGAAAAG AAGATAGTGA GGGCACAGCA 420CCTGCCCCTC CACAGAAGAA GCTGTCATGT CAGTGCCACC ACCATTGTCC TGAGGACTCA 480GTCAACAGCA CCTGCAGCAC TGATGGCTAC TGCTTCACCA TAATAGAAGA AGATGATTCT 540GGTGGACATT TGGTCACCAA AGGATGTCTA GGATTAGAGG GCTCGGACTT CCAGTGTCGG 600GACACTCCTA TTCCACACCA AAGAAGATCT ATTGAATGCT GCACAGGCCA AGATTACTGT 660AACAAACATC TTCACCCAAC GCTGCCACCA CTGAAAAATC GAGACTTTGC TGAAGGAAAC 720ATTCACCATA AGGCCCTGCT GATCTCGGTG ACTGTCTGTA GTATACTACT GGTGCTTATC 780ATCATATTCT GCTACTTCAG GTACAAGCGG CAAGAAGCCA GGCCCCGCTA CAGCATCGGG 840CTGGAGCAGG ACGAGACCTA CATTCCCCCT GGAGAATCCC TGAAGGATCT GATCGAGCAG 900TCCCAGAGCT CAGGCAGCGG CTCCGGGCTC CCTCTCCTGG TTCAAAGGAC CATAGCAAAA 960CAGATTCAGA TGGTAAAACA GATTGGAAAA GGTCGCTATG GGGAAGTCTG GATGGGAAAG 1020TGGCGTGGCG AAAAGGTAGC TGTCAAAGTG TTTTTTACCA CGGAGGAGGC CAGCTGGTTC 1080AGAGAAACAG AAATCTACCA AACTGTCCTG ATGAGGCATG AAAATATTCT CGGATTCATT 1140GCGGCAGACA TTAAAGGCAC AGGCTCTTGG ACCCAACTGT ATCTCATCAC TGACTATCAT 1200GAGAATGGCT CCCTTTACGA TTACCTAAAA TCCACCACCC TGGACACAAA AGGCATGCTA 1260AAATTGGCTT ACTCCTCTGT TAGTGGCTTG TGCCACCTAC ATACAGGGAT CTTCAGTACC 1320CAAGGCAAAC CGGCTATTGC CCACCGTGAT CTAAAAAGTA AGAACATCCT GGTGAAAAAG 1380AACGGAACCT GCTGTATAGC AGATTTGGGC TTGGCTGTTA AATTTATTAG TGATACAAAT 1440GAGGTAGACA TCCCTCCAAA CACCCGCGTA GGAACAAAAC GCTATATGCC TCCTGAGGTG 1500CTGGATGAAA GCTTGAACAG AAATCACTTT CAGTCGTACA TCATGGCTGA TATGTACAGC 1560TTTGGACTCA TCCTTTGGGA GATAGCCAGG AGATGTGTGT CAGGAGGAAT AGTGGAAGAA 1620TACCAGCTCC CATATCACGA CCTTGTCCCC AGTGACCCCT CCTACGAGGA CATGAGGGAG 1680ATTGTGTGCA TCAAAAGGCT ACGTCCTTCA TTCCCCAACA GATGGAGCAG CGATGAGTGC 1740CTGCGGCAGA TGGGGAAGCT CATGATGGAG TGCTGGGCCC ATAACCCTGC ATCCCGGCTC 1800ACAGCCCTAC GAGTCAAAAA AACACTTGCC AAAATGTCAG AGTCGCAGGA CATTAAGCTC 1860TGATGGAGCA AAAACAGCTC CTTCTCGTGA AGACCCATGG AAACAGACTT TCTCTTGCAG 1920GCAGAAGTCA TGGAGAGGTG CTGATAAGTA CCCTGAGTGC AGTCATATTT AAGAGCAACT 1980GTTTGTTTGA CAGCTTTGAG GAGACTGTTC TTGGCAAAAT CAGCTGAATT TTGGCATGCA 2040AGGTTGGGAG AGGCTTATCT GCCCTTGTTT ACACAGGGAT ATACAGTTTT AGTAACTGGT 2100TTAAGGTTAT GCATGTTGCT TTCCGTGAAA GCCACTTATT ATTTTATTAT TATTGTTATT 2160ATTATTATTT TGATTGTTTT AAAAGATACT GCTTTAAATT TTATGAAAAT AAAACCCTTT 2220GGTTAGAAGA AAAAAAGATG TATATTGTTA CA 2252 1399 amino acids amino acid Not Relevant Not Relevant protein unknown 14Met Glu Thr Pro Arg Leu Glu Leu Glu Ser Glu Arg Ser Glu Arg Ser1 5 10 15Glu Arg Leu Tyr Ser Leu Glu Ser Glu Arg Met Glu Thr Gly Leu Ser 20 25 30Glu Arg Ala Arg Gly Leu Tyr Ser Gly Leu Ala Ser Pro Ser Glu Arg 35 40 45Gly Leu Gly Leu Tyr Thr His Arg Ala Leu Ala Pro Arg Ala Leu Ala 50 55 60Pro Arg Pro Arg Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Leu Glu Ser65 70 75 80Glu Arg Cys Tyr Ser Gly Leu Asn Cys Tyr Ser His Ile Ser His Ile 85 90 95Ser His Ile Ser Cys Tyr Ser Pro Arg Gly Leu Ala Ser Pro Ser Glu 100 105 110Arg Val Ala Leu Ala Ser Asn Ser Glu Arg Thr His Arg Cys Tyr Ser 115 120 125Ser Glu Arg Thr His Arg Ala Ser Pro Gly Leu Tyr Thr Tyr Arg Cys 130 135 140Tyr Ser Pro His Glu Thr His Arg Ile Leu Glu Ile Leu Glu Gly Leu145 150 155 160Gly Leu Ala Ser Pro Ala Ser Pro Ser Glu Arg Gly Leu Tyr Gly Leu 165 170 175Tyr His Ile Ser Leu Glu Val Ala Leu Thr His Arg Leu Tyr Ser Gly 180 185 190Leu Tyr Cys Tyr Ser Leu Glu Gly Leu Tyr Leu Glu Gly Leu Gly Leu 195 200 205Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly Leu Asn Cys Tyr Ser 210 215 220Ala Arg Gly Ala Ser Pro Thr His Arg Pro Arg Ile Leu Glu Pro Arg225 230 235 240His Ile Ser Gly Leu Asn Ala Arg Gly Ala Arg Gly Ser Glu Arg Ile 245 250 255Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Thr His Arg Gly Leu Tyr 260 265 270Gly Leu Asn Ala Ser Pro Thr Tyr Arg Cys Tyr Ser Ala Ser Asn Leu 275 280 285Tyr Ser His Ile Ser Leu Glu His Ile Ser Pro Arg Thr His Arg Leu 290 295 300Glu Pro Arg Pro Arg Leu Glu Leu Tyr Ser Ala Ser Asn Ala Arg Gly305 310 315 320Ala Ser Pro Pro His Glu Ala Leu Ala Gly Leu Gly Leu Tyr Ala Ser 325 330 335Asn Ile Leu Glu His Ile Ser His Ile Ser Leu Tyr Ser Ala Leu Ala 340 345 350Leu Glu Leu Glu Ile Leu Glu Ser Glu Arg Val Ala Leu Thr His Arg 355 360 365Val Ala Leu Cys Tyr Ser Ser Glu Arg Ile Leu Glu Leu Glu Leu Glu 370 375 380Val Ala Leu Leu Glu Ile Leu Glu Ile Leu Glu Ile Leu Glu Pro His385 390 395 400Glu Cys Tyr Ser Thr Tyr Arg Pro His Glu Ala Arg Gly Thr Tyr Arg 405 410 415Leu Tyr Ser Ala Arg Gly Gly Leu Asn Gly Leu Ala Leu Ala Ala Arg 420 425 430Gly Pro Arg Ala Arg Gly Thr Tyr Arg Ser Glu Arg Ile Leu Glu Gly 435 440 445Leu Tyr Leu Glu Gly Leu Gly Leu Asn Ala Ser Pro Gly Leu Thr His 450 455 460Arg Thr Tyr Arg Ile Leu Glu Pro Arg Pro Arg Gly Leu Tyr Gly Leu465 470 475 480Ser Glu Arg Leu Glu Leu Tyr Ser Ala Ser Pro Leu Glu Ile Leu Glu 485 490 495Gly Leu Gly Leu Asn Ser Glu Arg Gly Leu Asn Ser Glu Arg Ser Glu 500 505 510Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr 515 520 525Leu Glu Pro Arg Leu Glu Leu Glu Val Ala Leu Gly Leu Asn Ala Arg 530 535 540Gly Thr His Arg Ile Leu Glu Ala Leu Ala Leu Tyr Ser Gly Leu Asn545 550 555 560Ile Leu Glu Gly Leu Asn Met Glu Thr Val Ala Leu Leu Tyr Ser Gly 565 570 575Leu Asn Ile Leu Glu Gly Leu Tyr Leu Tyr Ser Gly Leu Tyr Ala Arg 580 585 590Gly Thr Tyr Arg Gly Leu Tyr Gly Leu Val Ala Leu Thr Arg Pro Met 595 600 605Glu Thr Gly Leu Tyr Leu Tyr Ser Thr Arg Pro Ala Arg Gly Gly Leu 610 615 620Tyr Gly Leu Leu Tyr Ser Val Ala Leu Ala Leu Ala Val Ala Leu Leu625 630 635 640Tyr Ser Val Ala Leu Pro His Glu Pro His Glu Thr His Arg Thr His 645 650 655Arg Gly Leu Gly Leu Ala Leu Ala Ser Glu Arg Thr Arg Pro Pro His 660 665 670Glu Ala Arg Gly Gly Leu Thr His Arg Gly Leu Ile Leu Glu Thr Tyr 675 680 685Arg Gly Leu Asn Thr His Arg Val Ala Leu Leu Glu Met Glu Thr Ala 690 695 700Arg Gly His Ile Ser Gly Leu Ala Ser Asn Ile Leu Glu Leu Glu Gly705 710 715 720Leu Tyr Pro His Glu Ile Leu Glu Ala Leu Ala Ala Leu Ala Ala Ser 725 730 735Pro Ile Leu Glu Leu Tyr Ser Gly Leu Tyr Thr His Arg Gly Leu Tyr 740 745 750Ser Glu Arg Thr Arg Pro Thr His Arg Gly Leu Asn Leu Glu Thr Tyr 755 760 765Arg Leu Glu Ile Leu Glu Thr His Arg Ala Ser Pro Thr Tyr Arg His 770 775 780Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Ser Glu Arg Leu Glu Thr785 790 795 800Tyr Arg Ala Ser Pro Thr Tyr Arg Leu Glu Leu Tyr Ser Ser Glu Arg 805 810 815Thr His Arg Thr His Arg Leu Glu Ala Ser Pro Thr His Arg Leu Tyr 820 825 830Ser Gly Leu Tyr Met Glu Thr Leu Glu Leu Tyr Ser Leu Glu Ala Leu 835 840 845Ala Thr Tyr Arg Ser Glu Arg Ser Glu Arg Val Ala Leu Ser Glu Arg 850 855 860Gly Leu Tyr Leu Glu Cys Tyr Ser His Ile Ser Leu Glu His Ile Ser865 870 875 880Thr His Arg Gly Leu Tyr Ile Leu Glu Pro His Glu Ser Glu Arg Thr 885 890 895His Arg Gly Leu Asn Gly Leu Tyr Leu Tyr Ser Pro Arg Ala Leu Ala 900 905 910Ile Leu Glu Ala Leu Ala His Ile Ser Ala Arg Gly Ala Ser Pro Leu 915 920 925Glu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Ala Ser Asn Ile Leu Glu 930 935 940Leu Glu Val Ala Leu Leu Tyr Ser Leu Tyr Ser Ala Ser Asn Gly Leu945 950 955 960Tyr Thr His Arg Cys Tyr Ser Cys Tyr Ser Ile Leu Glu Ala Leu Ala 965 970 975Ala Ser Pro Leu Glu Gly Leu Tyr Leu Glu Ala Leu Ala Val Ala Leu 980 985 990Leu Tyr Ser Pro His Glu Ile Leu Glu Ser Glu Arg Ala Ser Pro Thr 995 1000 1005His Arg Ala Ser Asn Gly Leu Val Ala Leu Ala Ser Pro Ile Leu Glu 1010 1015 1020Pro Arg Pro Arg Ala Ser Asn Thr His Arg Ala Arg Gly Val Ala Leu1025 1030 1035 1040Gly Leu Tyr Thr His Arg Leu Tyr Ser Ala Arg Gly Thr Tyr Arg Met 1045 1050 1055Glu Thr Pro Arg Pro Arg Gly Leu Val Ala Leu Leu Glu Ala Ser Pro 1060 1065 1070Gly Leu Ser Glu Arg Leu Glu Ala Ser Asn Ala Arg Gly Ala Ser Asn 1075 1080 1085His Ile Ser Pro His Glu Gly Leu Asn Ser Glu Arg Thr Tyr Arg Ile 1090 1095 1100Leu Glu Met Glu Thr Ala Leu Ala Ala Ser Pro Met Glu Thr Thr Tyr1105 1110 1115 1120Arg Ser Glu Arg Pro His Glu Gly Leu Tyr Leu Glu Ile Leu Glu Leu 1125 1130 1135Glu Thr Arg Pro Gly Leu Ile Leu Glu Ala Leu Ala Ala Arg Gly Ala 1140 1145 1150Arg Gly Cys Tyr Ser Val Ala Leu Ser Glu Arg Gly Leu Tyr Gly Leu 1155 1160 1165Tyr Ile Leu Glu Val Ala Leu Gly Leu Gly Leu Thr Tyr Arg Gly Leu 1170 1175 1180Asn Leu Glu Pro Arg Thr Tyr Arg His Ile Ser Ala Ser Pro Leu Glu1185 1190 1195 1200Val Ala Leu Pro Arg Ser Glu Arg Ala Ser Pro Pro Arg Ser Glu Arg 1205 1210 1215Thr Tyr Arg Gly Leu Ala Ser Pro Met Glu Thr Ala Arg Gly Gly Leu 1220 1225 1230Ile Leu Glu Val Ala Leu Cys Tyr Ser Ile Leu Glu Leu Tyr Ser Ala 1235 1240 1245Arg Gly Leu Glu Ala Arg Gly Pro Arg Ser Glu Arg Pro His Glu Pro 1250 1255 1260Arg Ala Ser Asn Ala Arg Gly Thr Arg Pro Ser Glu Arg Ser Glu Arg1265 1270 1275 1280Ala Ser Pro Gly Leu Cys Tyr Ser Leu Glu Ala Arg Gly Gly Leu Asn 1285 1290 1295Met Glu Thr Gly Leu Tyr Leu Tyr Ser Leu Glu Met Glu Thr Met Glu 1300 1305 1310Thr Gly Leu Cys Tyr Ser Thr Arg Pro Ala Leu Ala His Ile Ser Ala 1315 1320 1325Ser Asn Pro Arg Ala Leu Ala Ser Glu Arg Ala Arg Gly Leu Glu Thr 1330 1335 1340His Arg Ala Leu Ala Leu Glu Ala Arg Gly Val Ala Leu Leu Tyr Ser1345 1350 1355 1360Leu Tyr Ser Thr His Arg Leu Glu Ala Leu Ala Leu Tyr Ser Met Glu 1365 1370 1375Thr Ser Glu Arg Gly Leu Ser Glu Arg Gly Leu Asn Ala Ser Pro Ile 1380 1385 1390Leu Glu Leu Tyr Ser Leu Glu 1395 469 base pairs nucleic acid single linear DNA (genomic) unknown 15GAATCAGACA ATGACTCAGC TATACACTTA CATCAGATTA CTGGGAGCCT GTCTGTTCAT 60CATTTCTCAT GTTCAAGGGC AGAATCTAGA TAGTATGCTC CATGGCACTG GTATGAAATC 120AGACTTGGAC CAGAAGAAGC CAGAAAATGG AGTGACTTTA GCACCAGAGG ATACCTTGCC 180TTTCTTAAAG TGCTATTGCT CAGGACACTG CCCAGATGAT GCTATTAATA ACACATGCAT 240AACTAATGGC CATTGCTTTG CCATTATAGA AGAAGATGAT CAGGGAGAAA CCACATTAAC 300TTCTGGGTGT ATGAAGTATG AAGGCTCTGA TTTTCAATGC AAGGATTCAC CGAAAGCCCA 360GCTACGCAGG ACAATAGAAT GTTGTCGGAC CAATTTGTGC AACCAGTATT TGCAGCCTAC 420ACTGCCCCCT GTTGTTATAG GTCCGTTCTT TGATGGCAGC ATCCGATGA 469 425 amino acids amino acid Not Relevant Not Relevant protein unknown 16Met Glu Thr Thr His Arg Gly Leu Asn Leu Glu Thr Tyr Arg Thr His1 5 10 15Arg Thr Tyr Arg Ile Leu Glu Ala Arg Gly Leu Glu Leu Glu Gly Leu 20 25 30Tyr Ala Leu Ala Cys Tyr Ser Leu Glu Pro His Glu Ile Leu Glu Ile 35 40 45Leu Glu Ser Glu Arg His Ile Ser Val Ala Leu Gly Leu Asn Gly Leu 50 55 60Tyr Gly Leu Asn Ala Ser Asn Leu Glu Ala Ser Pro Ser Glu Arg Met65 70 75 80Glu Thr Leu Glu His Ile Ser Gly Leu Tyr Thr His Arg Gly Leu Tyr 85 90 95Met Glu Thr Leu Tyr Ser Ser Glu Arg Ala Ser Pro Leu Glu Ala Ser 100 105 110Pro Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Pro Arg Gly Leu Ala Ser 115 120 125Asn Gly Leu Tyr Val Ala Leu Thr His Arg Leu Glu Ala Leu Ala Pro 130 135 140Arg Gly Leu Ala Ser Pro Thr His Arg Leu Glu Pro Arg Pro His Glu145 150 155 160Leu Glu Leu Tyr Ser Cys Tyr Ser Thr Tyr Arg Cys Tyr Ser Ser Glu 165 170 175Arg Gly Leu Tyr His Ile Ser Cys Tyr Ser Pro Arg Ala Ser Pro Ala 180 185 190Ser Pro Ala Leu Ala Ile Leu Glu Ala Ser Asn Ala Ser Asn Thr His 195 200 205Arg Cys Tyr Ser Ile Leu Glu Thr His Arg Ala Ser Asn Gly Leu Tyr 210 215 220His Ile Ser Cys Tyr Ser Pro His Glu Ala Leu Ala Ile Leu Glu Ile225 230 235 240Leu Glu Gly Leu Gly Leu Ala Ser Pro Ala Ser Pro Gly Leu Asn Gly 245 250 255Leu Tyr Gly Leu Thr His Arg Thr His Arg Leu Glu Thr His Arg Ser 260 265 270Glu Arg Gly Leu Tyr Cys Tyr Ser Met Glu Thr Leu Tyr Ser Thr Tyr 275 280 285Arg Gly Leu Gly Leu Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly 290 295 300Leu Asn Cys Tyr Ser Leu Tyr Ser Ala Ser Pro Ser Glu Arg Pro Arg305 310 315 320Leu Tyr Ser Ala Leu Ala Gly Leu Asn Leu Glu Ala Arg Gly Ala Arg 325 330 335Gly Thr His Arg Ile Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Ala 340 345 350Arg Gly Thr His Arg Ala Ser Asn Leu Glu Cys Tyr Ser Ala Ser Asn 355 360 365Gly Leu Asn Thr Tyr Arg Leu Glu Gly Leu Asn Pro Arg Thr His Arg 370 375 380Leu Glu Pro Arg Pro Arg Val Ala Leu Val Ala Leu Ile Leu Glu Gly385 390 395 400Leu Tyr Pro Arg Pro His Glu Pro His Glu Ala Ser Pro Gly Leu Tyr 405 410 415Ser Glu Arg Ile Leu Glu Ala Arg Gly 420 425 391 base pairs nucleic acid single linear DNA (genomic) unknown 17TCTGGACAAG ATGCCCTTGC TTAGCTCCAG CAAGTTGAGC ATGGAGAGCA GAAAAGAAGA 60TAGTGAGGGC ACAGCACCTG CCCCTCCACA GAAGAAGCTG TCATGTCAGT GCCACCACCA 120TTGTCCTGAG GACTCAGTCA ACAGCACCTG CAGCACTGAT GGCTACTGCT TCACCATAAT 180AGAAGAAGAT GATTCTGGTG GACATTTGGT CACCAAAGGA TGTCTAGGAT TAGAGGGCTC 240GGACTTCCAG TGTCGGGACA CTCCTATTCC ACACCAAAGA AGATCTATTG AATGCTGCAC 300AGGCCAAGAT TACTGTAACA AACATCTTCA CCCAACGCTG CCACCACTGA AAAATCGAGA 360CTTTGCTGAA GGAAACATTC ACCATAAGTG A 391 349 amino acids amino acid Not Relevant Not Relevant protein unknown 18Met Glu Thr Pro Arg Leu Glu Leu Glu Ser Glu Arg Ser Glu Arg Ser1 5 10 15Glu Arg Leu Tyr Ser Leu Glu Ser Glu Arg Met Glu Thr Gly Leu Ser 20 25 30Glu Arg Ala Arg Gly Leu Tyr Ser Gly Leu Ala Ser Pro Ser Glu Arg 35 40 45Gly Leu Gly Leu Tyr Thr His Arg Ala Leu Ala Pro Arg Ala Leu Ala 50 55 60Pro Arg Pro Arg Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Leu Glu Ser65 70 75 80Glu Arg Cys Tyr Ser Gly Leu Asn Cys Tyr Ser His Ile Ser His Ile 85 90 95Ser His Ile Ser Cys Tyr Ser Pro Arg Gly Leu Ala Ser Pro Ser Glu 100 105 110Arg Val Ala Leu Ala Ser Asn Ser Glu Arg Thr His Arg Cys Tyr Ser 115 120 125Ser Glu Arg Thr His Arg Ala Ser Pro Gly Leu Tyr Thr Tyr Arg Cys 130 135 140Tyr Ser Pro His Glu Thr His Arg Ile Leu Glu Ile Leu Glu Gly Leu145 150 155 160Gly Leu Ala Ser Pro Ala Ser Pro Ser Glu Arg Gly Leu Tyr Gly Leu 165 170 175Tyr His Ile Ser Leu Glu Val Ala Leu Thr His Arg Leu Tyr Ser Gly 180 185 190Leu Tyr Cys Tyr Ser Leu Glu Gly Leu Tyr Leu Glu Gly Leu Gly Leu 195 200 205Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly Leu Asn Cys Tyr Ser 210 215 220Ala Arg Gly Ala Ser Pro Thr His Arg Pro Arg Ile Leu Glu Pro Arg225 230 235 240His Ile Ser Gly Leu Asn Ala Arg Gly Ala Arg Gly Ser Glu Arg Ile 245 250 255Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Thr His Arg Gly Leu Tyr 260 265 270Gly Leu Asn Ala Ser Pro Thr Tyr Arg Cys Tyr Ser Ala Ser Asn Leu 275 280 285Tyr Ser His Ile Ser Leu Glu His Ile Ser Pro Arg Thr His Arg Leu 290 295 300Glu Pro Arg Pro Arg Leu Glu Leu Tyr Ser Ala Ser Asn Ala Arg Gly305 310 315 320Ala Ser Pro Pro His Glu Ala Leu Ala Gly Leu Gly Leu Tyr Ala Ser 325 330 335Asn Ile Leu Glu His Ile Ser His Ile Ser Leu Tyr Ser 340 345 706 base pairs nucleic acid single linear DNA (genomic) unknown 19GAATCAGACA ATGACTCAGC TATACACTTA CATCAGATTA CTGGGAGCCT GTCTGTTCAT 60CATTTCTCAT GTTCAAGGGC AGAATCTAGA TAGTATGCTC CATGGCACTG GTATGAAATC 120AGACTTGGAC CAGAAGAAGC CAGAAAATGG AGTGACTTTA GCACCAGAGG ATACCTTGCC 180TTTCTTAAAG TGCTATTGCT CAGGACACTG CCCAGATGAT GCTATTAATA ACACATGCAT 240AACTAATGGC CATTGCTTTG CCATTATAGA AGAAGATGAT CAGGGAGAAA CCACATTAAC 300TTCTGGGTGT ATGAAGTATG AAGGCTCTGA TTTTCAATGC AAGGATTCAC CGAAAGCCCA 360GCTACGCAGG ACAATAGAAT GTTGTCGGAC CAATTTGTGC AACCAGTATT TGCAGCCTAC 420ACTGCCCCCT GTTGTTATAG GTCCGTTCTT TGATGGCAGC ATCCGATGGC TGGTTGTGCT 480CATTTCCATG GCTGTCTGTA TAGTTGCTAT GATCATCTTC TCCAGCTGCT TTTGCTATAA 540GCATTATTGT AAGAGTATCT CAAGCAGGGG TCGTTACAAC CGTGATTTGG AACAGGATGA 600AGCATTTATT CCAGTAGGAG AATCATTGAA AGACCTGATT GACCAGTCCC AAAGCTCTGG 660GAGTGGATCT GGATTGCCTT TATTGGTTCA GCGAACTATT GCCTGA 706 649 amino acids amino acid Not Relevant Not Relevant protein unknown 20Met Glu Thr Thr His Arg Gly Leu Asn Leu Glu Thr Tyr Arg Thr His1 5 10 15Arg Thr Tyr Arg Ile Leu Glu Ala Arg Gly Leu Glu Leu Glu Gly Leu 20 25 30Tyr Ala Leu Ala Cys Tyr Ser Leu Glu Pro His Glu Ile Leu Glu Ile 35 40 45Leu Glu Ser Glu Arg His Ile Ser Val Ala Leu Gly Leu Asn Gly Leu 50 55 60Tyr Gly Leu Asn Ala Ser Asn Leu Glu Ala Ser Pro Ser Glu Arg Met65 70 75 80Glu Thr Leu Glu His Ile Ser Gly Leu Tyr Thr His Arg Gly Leu Tyr 85 90 95Met Glu Thr Leu Tyr Ser Ser Glu Arg Ala Ser Pro Leu Glu Ala Ser 100 105 110Pro Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Pro Arg Gly Leu Ala Ser 115 120 125Asn Gly Leu Tyr Val Ala Leu Thr His Arg Leu Glu Ala Leu Ala Pro 130 135 140Arg Gly Leu Ala Ser Pro Thr His Arg Leu Glu Pro Arg Pro His Glu145 150 155 160Leu Glu Leu Tyr Ser Cys Tyr Ser Thr Tyr Arg Cys Tyr Ser Ser Glu 165 170 175Arg Gly Leu Tyr His Ile Ser Cys Tyr Ser Pro Arg Ala Ser Pro Ala 180 185 190Ser Pro Ala Leu Ala Ile Leu Glu Ala Ser Asn Ala Ser Asn Thr His 195 200 205Arg Cys Tyr Ser Ile Leu Glu Thr His Arg Ala Ser Asn Gly Leu Tyr 210 215 220His Ile Ser Cys Tyr Ser Pro His Glu Ala Leu Ala Ile Leu Glu Ile225 230 235 240Leu Glu Gly Leu Gly Leu Ala Ser Pro Ala Ser Pro Gly Leu Asn Gly 245 250 255Leu Tyr Gly Leu Thr His Arg Thr His Arg Leu Glu Thr His Arg Ser 260 265 270Glu Arg Gly Leu Tyr Cys Tyr Ser Met Glu Thr Leu Tyr Ser Thr Tyr 275 280 285Arg Gly Leu Gly Leu Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly 290 295 300Leu Asn Cys Tyr Ser Leu Tyr Ser Ala Ser Pro Ser Glu Arg Pro Arg305 310 315 320Leu Tyr Ser Ala Leu Ala Gly Leu Asn Leu Glu Ala Arg Gly Ala Arg 325 330 335Gly Thr His Arg Ile Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Ala 340 345 350Arg Gly Thr His Arg Ala Ser Asn Leu Glu Cys Tyr Ser Ala Ser Asn 355 360 365Gly Leu Asn Thr Tyr Arg Leu Glu Gly Leu Asn Pro Arg Thr His Arg 370 375 380Leu Glu Pro Arg Pro Arg Val Ala Leu Val Ala Leu Ile Leu Glu Gly385 390 395 400Leu Tyr Pro Arg Pro His Glu Pro His Glu Ala Ser Pro Gly Leu Tyr 405 410 415Ser Glu Arg Ile Leu Glu Ala Arg Gly Thr Arg Pro Leu Glu Val Ala 420 425 430Leu Val Ala Leu Leu Glu Ile Leu Glu Ser Glu Arg Met Glu Thr Ala 435 440 445Leu Ala Val Ala Leu Cys Tyr Ser Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Met Glu Thr Ile Leu Glu Ile Leu Glu Pro His Glu Ser Glu Arg465 470 475 480Ser Glu Arg Cys Tyr Ser Pro His Glu Cys Tyr Ser Thr Tyr Arg Leu 485 490 495Tyr Ser His Ile Ser Thr Tyr Arg Cys Tyr Ser Leu Tyr Ser Ser Glu 500 505 510Arg Ile Leu Glu Ser Glu Arg Ser Glu Arg Ala Arg Gly Gly Leu Tyr 515 520 525Ala Arg Gly Thr Tyr Arg Ala Ser Asn Ala Arg Gly Ala Ser Pro Leu 530 535 540Glu Gly Leu Gly Leu Asn Ala Ser Pro Gly Leu Ala Leu Ala Pro His545 550 555 560Glu Ile Leu Glu Pro Arg Val Ala Leu Gly Leu Tyr Gly Leu Ser Glu 565 570 575Arg Leu Glu Leu Tyr Ser Ala Ser Pro Leu Glu Ile Leu Glu Ala Ser 580 585 590Pro Gly Leu Asn Ser Glu Arg Gly Leu Asn Ser Glu Arg Ser Glu Arg 595 600 605Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Leu 610 615 620Glu Pro Arg Leu Glu Leu Glu Val Ala Leu Gly Leu Asn Ala Arg Gly625 630 635 640Thr His Arg Ile Leu Glu Ala Leu Ala 645 616 base pairs nucleic acid single linear DNA (genomic) unknown 21TCTGGACAAG ATGCCCTTGC TTAGCTCCAG CAAGTTGAGC ATGGAGAGCA GAAAAGAAGA 60TAGTGAGGGC ACAGCACCTG CCCCTCCACA GAAGAAGCTG TCATGTCAGT GCCACCACCA 120TTGTCCTGAG GACTCAGTCA ACAGCACCTG CAGCACTGAT GGCTACTGCT TCACCATAAT 180AGAAGAAGAT GATTCTGGTG GACATTTGGT CACCAAAGGA TGTCTAGGAT TAGAGGGCTC 240GGACTTCCAG TGTCGGGACA CTCCTATTCC ACACCAAAGA AGATCTATTG AATGCTGCAC 300AGGCCAAGAT TACTGTAACA AACATCTTCA CCCAACGCTG CCACCACTGA AAAATCGAGA 360CTTTGCTGAA GGAAACATTC ACCATAAGGC CCTGCTGATC TCGGTGACTG TCTGTAGTAT 420ACTACTGGTG CTTATCATCA TATTCTGCTA CTTCAGGTAC AAGCGGCAAG AAGCCAGGCC 480CCGCTACAGC ATCGGGCTGG AGCAGGACGA GACCTACATT CCCCCTGGAG AATCCCTGAA 540GGATCTGATC GAGCAGTCCC AGAGCTCAGG CAGCGGCTCC GGGCTCCCTC TCCTGGTTCA 600AAGGACCATA GCATGA 616 554 amino acids amino acid Not Relevant Not Relevant protein unknown 22Met Glu Thr Pro Arg Leu Glu Leu Glu Ser Glu Arg Ser Glu Arg Ser1 5 10 15Glu Arg Leu Tyr Ser Leu Glu Ser Glu Arg Met Glu Thr Gly Leu Ser 20 25 30Glu Arg Ala Arg Gly Leu Tyr Ser Gly Leu Ala Ser Pro Ser Glu Arg 35 40 45Gly Leu Gly Leu Tyr Thr His Arg Ala Leu Ala Pro Arg Ala Leu Ala 50 55 60Pro Arg Pro Arg Gly Leu Asn Leu Tyr Ser Leu Tyr Ser Leu Glu Ser65 70 75 80Glu Arg Cys Tyr Ser Gly Leu Asn Cys Tyr Ser His Ile Ser His Ile 85 90 95Ser His Ile Ser Cys Tyr Ser Pro Arg Gly Leu Ala Ser Pro Ser Glu 100 105 110Arg Val Ala Leu Ala Ser Asn Ser Glu Arg Thr His Arg Cys Tyr Ser 115 120 125Ser Glu Arg Thr His Arg Ala Ser Pro Gly Leu Tyr Thr Tyr Arg Cys 130 135 140Tyr Ser Pro His Glu Thr His Arg Ile Leu Glu Ile Leu Glu Gly Leu145 150 155 160Gly Leu Ala Ser Pro Ala Ser Pro Ser Glu Arg Gly Leu Tyr Gly Leu 165 170 175Tyr His Ile Ser Leu Glu Val Ala Leu Thr His Arg Leu Tyr Ser Gly 180 185 190Leu Tyr Cys Tyr Ser Leu Glu Gly Leu Tyr Leu Glu Gly Leu Gly Leu 195 200 205Tyr Ser Glu Arg Ala Ser Pro Pro His Glu Gly Leu Asn Cys Tyr Ser 210 215 220Ala Arg Gly Ala Ser Pro Thr His Arg Pro Arg Ile Leu Glu Pro Arg225 230 235 240His Ile Ser Gly Leu Asn Ala Arg Gly Ala Arg Gly Ser Glu Arg Ile 245 250 255Leu Glu Gly Leu Cys Tyr Ser Cys Tyr Ser Thr His Arg Gly Leu Tyr 260 265 270Gly Leu Asn Ala Ser Pro Thr Tyr Arg Cys Tyr Ser Ala Ser Asn Leu 275 280 285Tyr Ser His Ile Ser Leu Glu His Ile Ser Pro Arg Thr His Arg Leu 290 295 300Glu Pro Arg Pro Arg Leu Glu Leu Tyr Ser Ala Ser Asn Ala Arg Gly305 310 315 320Ala Ser Pro Pro His Glu Ala Leu Ala Gly Leu Gly Leu Tyr Ala Ser 325 330 335Asn Ile Leu Glu His Ile Ser His Ile Ser Leu Tyr Ser Ala Leu Ala 340 345 350Leu Glu Leu Glu Ile Leu Glu Ser Glu Arg Val Ala Leu Thr His Arg 355 360 365Val Ala Leu Cys Tyr Ser Ser Glu Arg Ile Leu Glu Leu Glu Leu Glu 370 375 380Val Ala Leu Leu Glu Ile Leu Glu Ile Leu Glu Ile Leu Glu Pro His385 390 395 400Glu Cys Tyr Ser Thr Tyr Arg Pro His Glu Ala Arg Gly Thr Tyr Arg 405 410 415Leu Tyr Ser Ala Arg Gly Gly Leu Asn Gly Leu Ala Leu Ala Ala Arg 420 425 430Gly Pro Arg Ala Arg Gly Thr Tyr Arg Ser Glu Arg Ile Leu Glu Gly 435 440 445Leu Tyr Leu Glu Gly Leu Gly Leu Asn Ala Ser Pro Gly Leu Thr His 450 455 460Arg Thr Tyr Arg Ile Leu Glu Pro Arg Pro Arg Gly Leu Tyr Gly Leu465 470 475 480Ser Glu Arg Leu Glu Leu Tyr Ser Ala Ser Pro Leu Glu Ile Leu Glu 485 490 495Gly Leu Gly Leu Asn Ser Glu Arg Gly Leu Asn Ser Glu Arg Ser Glu 500 505 510Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr 515 520 525Leu Glu Pro Arg Leu Glu Leu Glu Val Ala Leu Gly Leu Asn Ala Arg 530 535 540Gly Thr His Arg Ile Leu Glu Ala Leu Ala545 550 613 base pairs nucleic acid single linear DNA (genomic) unknown 23TGGCCCAGGG ATGACTTCCT CGCTGCAGCG GCCCTGGCGG GTGCCCTGGC TACCATGGAC 60CATCCTGCTG GTCAGCACTG CGGCTGCTTC GCAGAATCAA GAACGGCTAT GTGCGTTTAA 120AGATCCGTAT CAGCAAGACC TTGGGATAGG TGAGAGTAGA ATCTCTCATG AAAATGGGAC 180AATATTATGC TCGAAAGGTA GCACCTGCTA TGGCCTTTGG GAGAAATCAA AAGGGGACAT 240AAATCTTGTA AAACAAGGAT GTTGGTCTCA CATTGGAGAT CCCCAAGAGT GTCACTATGA 300AGAATGTGTA GTAACTACCA CTCCTCCCTC AATTCAGAAT GGAACATACC GTTTCTGCTG 360TTGTAGCACA GATTTATGTA ATGTCAACTT TACTGAGAAT TTTCCACCTC CTGACACAAC 420ACCACTCAGT CCACCTCATT CATTTAACCG AGATGAGACA ATAATCATTG CTTTGGCATC 480AGTCTCTGTA TTAGCTGTTT TGATAGTTGC CTTATGCTTT GGATACAGAA TGTTGACAGG 540AGACCGTAAA CAAGGTCTTC ACAGTATGAA CATGATGGAG GCAGCAGCAT CCGAACCCTC 600TCTTGATCTA TGA 613 556 amino acids amino acid Not Relevant Not Relevant protein unknown 24Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu Gly Leu1 5 10 15Asn Ala Arg Gly Pro Arg Thr Arg Pro Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Pro Arg Thr Arg Pro Thr His Arg Ile Leu 35 40 45Glu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Ala Leu 50 55 60Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu Ala Leu Ala Leu Glu Ala 420 425 430Leu Ala Ser Glu Arg Val Ala Leu Ser Glu Arg Val Ala Leu Leu Glu 435 440 445Ala Leu Ala Val Ala Leu Leu Glu Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Leu Glu Cys Tyr Ser Pro His Glu Gly Leu Tyr Thr Tyr Arg Ala465 470 475 480Arg Gly Met Glu Thr Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Pro 485 490 495Ala Arg Gly Leu Tyr Ser Gly Leu Asn Gly Leu Tyr Leu Glu His Ile 500 505 510Ser Ser Glu Arg Met Glu Thr Ala Ser Asn Met Glu Thr Met Glu Thr 515 520 525Gly Leu Ala Leu Ala Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu 530 535 540Pro Arg Ser Glu Arg Leu Glu Ala Ser Pro Leu Glu545 550 555 613 base pairs nucleic acid single linear DNA (genomic) unknown 25TGGCCCAGGG ATGACTTCCT CGCTGCATCG GCCCTTTCGG GTGCCCTGGC TGCTATGGGC 60CGTCCTGCTG GTCAGCACTA CGGCTGCTTC TCAGAATCAA GAACGGCTGT GTGCATTTAA 120AGATCCATAT CAACAAGATC TTGGGATAGG TGAGAGTCGA ATCTCTCATG AAAATGGGAC 180AATATTATGT TCCAAAGGGA GCACGTGTTA TGGTCTGTGG GAGAAATCAA AAGGGGACAT 240CAATCTTGTG AAACAAGGAT GTTGGTCTCA CATCGGTGAT CCCCAAGAGT GCCACTATGA 300AGAGTGTGTA GTAACTACCA CCCCACCCTC AATTCAGAAT GGAACGTACC GCTTTTGCTG 360CTGTAGTACA GATTTATGTA ATGTCAACTT TACTGAGAAC TTTCCACCCC CTGACACAAC 420ACCACTCAGT CCACCTCATT CATTTAATCG AGATGAAACG ATAATCATTG CTTTGGCATC 480AGTTTCTGTG TTAGCTGTTT TGATAGTCGC CTTATGTTTT GGATACAGAA TGTTGACAGG 540AGACCGGAAA CAGGGTCTTC ACAGCATGAA CATGATGGAG GCGGCAGCAG CAGAGCCCTC 600CCTTGACCTG TGA 613 556 amino acids amino acid Not Relevant Not Relevant protein unknown 26Met Glu Thr Thr His Arg Ser Glu Arg Ser Glu Arg Leu Glu His Ile1 5 10 15Ser Ala Arg Gly Pro Arg Pro His Glu Ala Arg Gly Val Ala Leu Pro 20 25 30Arg Thr Arg Pro Leu Glu Leu Glu Thr Arg Pro Ala Leu Ala Val Ala 35 40 45Leu Leu Glu Leu Glu Val Ala Leu Ser Glu Arg Thr His Arg Thr His 50 55 60Arg Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Asn Ala Ser Asn65 70 75 80Gly Leu Asn Gly Leu Ala Arg Gly Leu Glu Cys Tyr Ser Ala Leu Ala 85 90 95Pro His Glu Leu Tyr Ser Ala Ser Pro Pro Arg Thr Tyr Arg Gly Leu 100 105 110Asn Gly Leu Asn Ala Ser Pro Leu Glu Gly Leu Tyr Ile Leu Glu Gly 115 120 125Leu Tyr Gly Leu Ser Glu Arg Ala Arg Gly Ile Leu Glu Ser Glu Arg 130 135 140His Ile Ser Gly Leu Ala Ser Asn Gly Leu Tyr Thr His Arg Ile Leu145 150 155 160Glu Leu Glu Cys Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu Tyr Ser 165 170 175Glu Arg Thr His Arg Cys Tyr Ser Thr Tyr Arg Gly Leu Tyr Leu Glu 180 185 190Thr Arg Pro Gly Leu Leu Tyr Ser Ser Glu Arg Leu Tyr Ser Gly Leu 195 200 205Tyr Ala Ser Pro Ile Leu Glu Ala Ser Asn Leu Glu Val Ala Leu Leu 210 215 220Tyr Ser Gly Leu Asn Gly Leu Tyr Cys Tyr Ser Thr Arg Pro Ser Glu225 230 235 240Arg His Ile Ser Ile Leu Glu Gly Leu Tyr Ala Ser Pro Pro Arg Gly 245 250 255Leu Asn Gly Leu Cys Tyr Ser His Ile Ser Thr Tyr Arg Gly Leu Gly 260 265 270Leu Cys Tyr Ser Val Ala Leu Val Ala Leu Thr His Arg Thr His Arg 275 280 285Thr His Arg Pro Arg Pro Arg Ser Glu Arg Ile Leu Glu Gly Leu Asn 290 295 300Ala Ser Asn Gly Leu Tyr Thr His Arg Thr Tyr Arg Ala Arg Gly Pro305 310 315 320His Glu Cys Tyr Ser Cys Tyr Ser Cys Tyr Ser Ser Glu Arg Thr His 325 330 335Arg Ala Ser Pro Leu Glu Cys Tyr Ser Ala Ser Asn Val Ala Leu Ala 340 345 350Ser Asn Pro His Glu Thr His Arg Gly Leu Ala Ser Asn Pro His Glu 355 360 365Pro Arg Pro Arg Pro Arg Ala Ser Pro Thr His Arg Thr His Arg Pro 370 375 380Arg Leu Glu Ser Glu Arg Pro Arg Pro Arg His Ile Ser Ser Glu Arg385 390 395 400Pro His Glu Ala Ser Asn Ala Arg Gly Ala Ser Pro Gly Leu Thr His 405 410 415Arg Ile Leu Glu Ile Leu Glu Ile Leu Glu Ala Leu Ala Leu Glu Ala 420 425 430Leu Ala Ser Glu Arg Val Ala Leu Ser Glu Arg Val Ala Leu Leu Glu 435 440 445Ala Leu Ala Val Ala Leu Leu Glu Ile Leu Glu Val Ala Leu Ala Leu 450 455 460Ala Leu Glu Cys Tyr Ser Pro His Glu Gly Leu Tyr Thr Tyr Arg Ala465 470 475 480Arg Gly Met Glu Thr Leu Glu Thr His Arg Gly Leu Tyr Ala Ser Pro 485 490 495Ala Arg Gly Leu Tyr Ser Gly Leu Asn Gly Leu Tyr Leu Glu His Ile 500 505 510Ser Ser Glu Arg Met Glu Thr Ala Ser Asn Met Glu Thr Met Glu Thr 515 520 525Gly Leu Ala Leu Ala Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu 530 535 540Pro Arg Ser Glu Arg Leu Glu Ala Ser Pro Leu Glu545 550 555 24 amino acids amino acid Not Relevant Not Relevant peptide unknown 27Leu Asn Thr Arg Val Gly Thr Lys Arg Tyr Met Ala Pro Glu Val Leu1 5 10 15Asp Glu Ser Leu Asn Lys Asn Cys 20 21 base pairs nucleic acid single linear DNA (genomic) unknown 28CTGTGTGAAG ATAAGCCAGT C 21 12 base pairs nucleic acid single linear DNA (genomic) unknown 29CUACUACUAC UA 12 21 base pairs nucleic acid single linear DNA (genomic) unknown 30GGCCACGCGT CGACTAGTAC G 21 15 base pairs nucleic acid single linear DNA (genomic) unknown 31GGNNGGGNNG GGNNG 15 22 base pairs nucleic acid single linear DNA (genomic) unknown 32CAAGAGCTTA CCCAATCACT TG 22 34 base pairs nucleic acid single linear DNA (genomic) unknown 33CACACGCGTC GACCATGACT TCCTCGCTGC ATCG 34 16 base pairs nucleic acid single linear DNA (genomic) unknown 34AACAGCTATG ACCATG 16 24 base pairs nucleic acid single linear DNA (genomic) unknown 35CCTGTCACAT AATAGGCGTG TGCC 24 27 base pairs nucleic acid single linear DNA (genomic) unknown 36CGCGGATCCA TCATACTGAC AGCATCG 27 20 base pairs nucleic acid single linear DNA (genomic) unknown 37GCTGGGTAGT CCCCACCTTT 20 18 base pairs nucleic acid single linear DNA (genomic) unknown 38GAGCAAGTTC AGCCTGGT 18 19 amino acids amino acid Not Relevant Not Relevant peptide unknown 39Ala Arg Pro Arg Tyr Ser Ile Gly Leu Glu Gln Asp Glu Thr Tyr Ile1 5 10 15Pro Pro Cys

Claims

1. A method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex, wherein the complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3, the method comprising:(a) providing a BMP receptor kinase protein complex, a sample comprising the compound, and a labeled BMP; (b) bringing the sample comprising the compound into contact with the BMP receptor kinase protein complex and the labeled BMP; (c) allowing the compound and the labeled BMP to bind to the BMP receptor kinase protein complex under equilibrium conditions; (d) and detecting the binding of the compound to the BMP receptor kinase protein complex by measuring the amount of unbound labeled BMP, and comparing the unbound labeled BMP to a known BMP standard; and wherein said BMP receptor kinase protein BRK-3 is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 24, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 26.

2. The method of claim 1, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence SEQ ID NO: 4.

3. The method of claim 2, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO: 12 or SEQ ID NO: 14.

4. The method of claim 3, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO: 14.

5. The method of claim 1, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence SEQ ID NO: 8.

6. The method of claim 5, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO: 12 or SEQ ID NO: 14.

7. The method of claim 6, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO: 14.