Vaccine vectors and methods of enhancing immune responses

Abstract

Provided herein are vaccine vectors including an antigenic polypeptide and an HMGB1 polypeptide present on the surface of the vaccine vector. Compositions comprising the vaccine vectors are also provided and include a pharmaceutically acceptable carrier, suitably a carrier for oral or nasal administration. Also provided are methods of enhancing immune responses, in particular antibody immune response and suitably an IgA response, by administering the vaccine vectors or compositions disclosed herein to a subject.

Description

INTRODUCTION

Vaccines are used to initiate an adaptive immune response against antigens, in particular antigens from pathogens, tumor cells or the like, in order to ameliorate or prevent disease. Synthetic peptides or killed or attenuated microorganism vaccines are often effective at stimulating a robust immune response that is fully protective. In some cases these vaccines are not protective or only partially protective and other strategies must be used to develop protective vaccines. Attenuated microorganism based vaccines also are associated with risks of gene transfer or mutation repair and may pose risks to immunocompromised individuals. Development of new vaccines that are safe and effective at stimulating lasting protective immune responses is needed.

Influenza virus infection, particularly avian influenza H5N1, presents a mounting health and economic concern. Evidence clearly indicates that H5N1 is continuing to circulate between susceptible birds and swine in widening regions of the world. Many scientists believe that if left unchecked, the current H5N1 avian influenza will mutate to allow for human to human transmission and cause a world-wide pandemic. With a mortality rate of over 50%, such an outbreak would be devastating. Regardless of the ability of the virus to cause human disease, avian influenza H5N1 is already threatening to have a huge economic impact due to the eradication of poultry flocks in affected areas. Therefore, development of a vaccine to protect humans, poultry, swine and other domesticated animals from H5N1 influenza is needed. An influenza vaccine that is capable of protecting against 1H5N1 as well as other influenza viruses, such as H1N1, would be optimal.

SUMMARY

Vaccine vectors and methods of stimulating an immune response and methods of reducing morbidity associated with Influenza infection are provided herein. In one aspect, a vaccine vector including an antigenic polypeptide and an HMGB1 polypeptide or a functional fragment thereof is provided. At least a portion of the antigenic polypeptide and the HMGB1 polypeptide are present on the surface of the vaccine vector. The vaccine vector may include a first polynucleotide encoding the antigenic polypeptide and a second polynucleotide encoding the HMGB1 polypeptide. The HMGB1 polypeptide and the antigenic polypeptide may be linked, such as in a fusion protein. The HMGB1 polypeptide and the antigenic polypeptide may both be inserted within an external loop of a transmembrane protein.

In another aspect, a composition comprising the vaccine vector and a pharmaceutically acceptable carrier is provided. The pharmaceutically acceptable carrier may be acceptable for oral or nasal use. The vaccine vector may be incapable of replication.

In yet another aspect, a Bacillus spp. vaccine vector is provided. The vaccine vector includes a first polynucleotide sequence encoding an antigenic polypeptide expressed on the surface of the vaccine vector and a second polynucleotide sequence encoding an immunostimulatory polypeptide expressed on the surface of the vaccine vector. The antigenic polypeptide may be an Influenza M2e polypeptide, an Influenza HA polypeptide, or an Influenza NP polypeptide or a combination thereof. The immunostimulatory polypeptide may be a CD154 polypeptide or a HMGB1 polypeptide or a combination thereof. The immunostimulatory polypeptide and the antigenic polypeptide may be linked, such as in a fusion protein and may be inserted with an external loop of a transmembrane protein.

In still another aspect, methods of enhancing an immune response in a subject are provided. In the method, the vaccine vectors or compositions provided herein are administered to the subject in an amount effective to enhance the immune response of the subject to the antigenic polypeptide. Suitably, the vaccine vector is administered orally or intranasally.

In a further aspect, methods of enhancing the immune response in a subject by administering a Bacillus spp. vaccine vector as described herein are provided. The vaccine vector includes a first polynucleotide sequence encoding an antigenic polypeptide expressed on the surface of the vaccine vector and a second polynucleotide sequence encoding an immunostimulatory polypeptide expressed on the surface of the vaccine vector. The antigenic polypeptide may be an Influenza M2e polypeptide, an Influenza HA polypeptide, an Influenza NP polypeptide or a combination thereof. The immunostimulatory polypeptide may be a CD154 polypeptide, a HMGB1 polypeptide or a combination thereof.

In a still further aspect, methods of reducing influenza related morbidity in a subject are provided. In the methods, administration of the vaccine vectors or compositions disclosed herein reduces the morbidity associated with a subsequent influenza infection.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a graph showing the S/P (sample to positive control) ratios of the ELISA for M2e specific antibody production by chickens after oral gavage of the indicated dosage of Bacillus subtilis vaccine vector expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with saline.

FIG. 2 is a graph showing the S/P ratios of the ELISA for HA LB specific antibody production by chickens after oral gavage of the indicated dosage of Bacillus subtilis vaccine vector expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with saline.

FIG. 3 is a graph showing the S/P ratios of the ELISA for HA UA specific antibody production by chickens after oral gavage of the indicated dosage of Bacillus subtilis vaccine vector expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with saline.

FIG. 4 is a graph showing the S/P ratios of the ELISA for M2e specific antibody production by chickens after oral gavage of the indicated dosage of live or variously inactivated Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

FIG. 5 is a graph showing the S/P ratios of the ELISA for HA LB specific antibody production by chickens after oral gavage of the indicated dosage of live or variously inactivated Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

FIG. 6 is a graph showing the S/P ratios of the ELISA for HA UA specific antibody production by chickens after oral gavage of the indicated dosage of live or variously inactivated Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and either HMGB1 or CD154 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

FIG. 7 is a graph showing the S/P ratios of the ELISA for M2e specific IgG antibody production by chickens after oral gavage of either 10⁶ live or the various indicated dosages of formalin inactivated Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and HMGB1 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

FIG. 8 is a graph showing the S/P ratios of the ELISA for M2e specific IgA antibody production by chickens vaccinated, either orally or subcutaneously, with 10⁶ live, formalin inactivated or formalin inactivated and lyophilized Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and HMGB1 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

FIG. 9 is a graph showing the S/P ratios of the ELISA for M2e specific IgA antibody production by chickens vaccinated, either orally or subcutaneously, with 10⁶ live, formalin inactivated or formalin inactivated and lyophilized Bacillus subtilis vaccine vectors expressing the Influenza A epitopes and HMGB1 as compared to chickens vaccinated with the Bacillus vector alone (BSBB).

DETAILED DESCRIPTION

Recombinant DNA technologies enable relatively easy manipulation of many bacterial and viral species. Some bacteria and viruses are either naturally or can be selected or engineered to be mildly pathogenic or non-pathogenic, but remain capable of generating a robust immune response. These bacteria and viruses make attractive vaccine vectors for eliciting an immune response to heterologous or foreign antigens. Bacterial or viral vaccine vectors may mimic the natural infection and produce robust and long lasting immunity. Vaccine vectors are often relatively inexpensive to produce and administer. In addition, such vectors can often carry more than one antigen and may provide protection against multiple infectious agents.

Live bacterial or viral vaccine vectors may still pose risks to immunocompromised individuals and require additional regulatory scrutiny. Thus use of vectors that are killed or inactivated or qualify as Generally Regarded As Safe (GRAS) organisms by the Food and Drug Administration (FDA) is desirable. The problem is generating a robust immune response using such vectors. As shown in the Examples, by including HMGB1 (high mobility group box 1) polypeptides on the surface of the vaccine vector we can generate a robust immune response against antigenic polypeptides using a Bacillus spp. vector. In fact, the Examples demonstrate that this vector can be inactivated such that it cannot replicate using a variety of methods and still elicit a robust immune response after administration.

Vaccine vectors including an antigenic polypeptide and an HMGB1 polypeptide or a functional fragment thereof are provided herein. At least a portion of the antigenic polypeptide and at least a portion of the HMGB1 polypeptide or functional fragment thereof are present on the surface of the vaccine vector. The vaccine vector may include a first polynucleotide encoding the antigenic polypeptide and a second polynucleotide encoding the HMGB1 polypeptide. The HMGB1 polypeptide and the antigenic polypeptide may be linked, such as in a fusion protein or may be expressed separately. The HMGB1 polypeptide and the antigenic polypeptide may both be inserted within an external loop of a transmembrane protein.

The vaccine vectors may be bacterial, viral or liposome-based vectors. Potential vaccine vectors include, but are not limited to, Bacillus (Bacillus subtilis), Salmonella (Salmonella enteritidis), Shigella, Escherichia (E. coli), Yersinia, Bordetella, Lactococcus, Streptococcus, Vibrio (Vibrio cholerae), Listeria, adenovirus, poxvirus, herpesvirus, alphavirus, and adeno-associated virus. Suitably, the vaccine vector is a GRAS organism. The vaccine vector may be inactivated or killed such that it is not capable of replicating. Methods of inactivating or killing bacterial or viral vaccine vectors are known to those of skill in the art and include, but are not limited to methods such as those shown in the Examples, namely formalin inactivation, antibiotic-based inactivation, heat treatment and ethanol treatment.

An antigenic polypeptide is a polypeptide that is capable of being specifically recognized by the adaptive immune system. An antigenic polypeptide includes any polypeptide that is immunogenic. The antigenic polypeptides include, but are not limited to, antigens that are pathogen-related, allergen-related, tumor-related or disease-related. Pathogens include viral, parasitic, fungal and bacterial pathogens as well as protein pathogens such as the prions. The antigenic polypeptides may be full-length proteins or portions thereof. It is well established that immune system recognition of many proteins is based on a relatively small number of amino acids, often referred to as the epitope. Epitopes may be only 8-10 amino acids. Thus, the antigenic polypeptides described herein may be full-length proteins, 8 amino acid long epitopes or any portion between these extremes. In fact the antigenic polypeptide may include more than one epitope from a single pathogen or protein.

Multiple copies of the same epitope or multiple epitopes from different proteins may be included in the vaccine vector. It is envisioned that several epitopes or antigens from the same or different pathogens or diseases may be administered in combination in a single vaccine vector to generate an enhanced immune response against multiple antigens. Recombinant vaccine vectors may encode antigens from multiple pathogenic microorganisms, viruses or tumor associated antigens. Administration of vaccine vectors capable of expressing multiple antigens has the advantage of inducing immunity against two or more diseases at the same time.

The antigenic polypeptide may be an Influenza polypeptide, suitably it is an Influenza H5N1 polypeptide or a polypeptide associated with multiple strains of the Influenza virus such as a polypeptide of the Influenza M2 protein. The ectodomain of the Influenza A virus M2 protein, known as M2e, protrudes from the surface of the virus. The M2e portion of the M2 protein contains about 24 amino acids. The M2e polypeptide varies little from one isolate to the next within Influenza. In fact, only a few naturally occurring mutations in M2e have been isolated from infected humans since the 1918 flu epidemic. In addition, influenza viruses isolated from avian and swine hosts have different, yet still conserved, M2e sequences. For reviews of the M2e polypeptide sequences isolated from human, avian and swine hosts see Liu et al., Microbes and Infection 7:171-177 (2005) and Reid et al., J. Virol. 76:10717-10723 (2002) each of which are incorporated herein by reference in its entirety. See also SEQ ID NO: 1-4.

Suitably the entire M2e polypeptide may be inserted into the vaccine vector or only a portion may be used. In the Examples, an eight amino acid polypeptide (LM2 having amino acid sequence: EVETPIRN, SEQ ID NO:5 or its variant M2eA having amino acid sequence EVETPTRN, SEQ ID NO:6) was incorporated into the vaccine vector and demonstrated to produce an antibody response after administration to chickens. Suitably, the portion of the M2e polypeptide inserted into the vaccine vector is immunogenic. An immunogenic fragment is a peptide or polypeptide capable of eliciting a cellular or humoral immune response. Suitably, an immunogenic fragment of M2e may be the full-length M2e polypeptide, or suitably may be 20 or more amino acids, 15 or more amino acids, 10 or more amino acids or 8 or more amino acids of the full-length sequence.

Other suitable epitopes for inclusion in an Influenza A vaccine vector include, but are not limited to, polypeptides of the hemagglutinin (HA) or the nuclear protein (NP) of Influenza A. For example, the peptides of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10 may be included in a vaccine vector. In the Examples, SEQ ID NO: 7 (HAUA) and SEQ ID NO: 8 (HALB) were incorporated into the vaccine vector and demonstrated to produce an antibody response after administration to chickens. See FIGS. 2-3 and 5-6. In addition, the NP epitopes of SEQ ID NO: 9 (NP54) and SEQ ID NO: 10 (NP147) were incorporated into the vaccine vector in the examples. One of skill in the art will appreciate that any of these sequences may be used in combination with any other epitope including epitopes derived from other pathogens or antigens.

The HMGB1 (High Mobility Group Box-1) protein was first identified as a DNA-binding protein critical for DNA structure and stability. It is a ubiquitously expressed nuclear protein that binds DNA with no sequence specificity. The protein is highly conserved and found in plants to mammals. The zebrafish, chicken and human HMGB1 amino acid sequences are provided in SEQ ID NO: 30, SEQ ID NO: 18 and SEQ ID NO: 29, respectively. The sequence throughout mammals is highly conserved with 98% amino acid identity and the amino acid changes are conservative. Thus an HMGB1 protein from one species can likely substitute for that from another species functionally. The full-length HMGB1 protein or a portion thereof may be used as the HMGB1 polypeptide in the vaccine vectors described herein. HMGB1 has two DNA binding regions termed A box as shown in SEQ ID NO: 23 and 24 and B box as shown in SEQ ID NO: 25 and 26. See Andersson and Tracey, Annu. Rev. Immunol. 2011, 29:139-162, which is incorporated herein by reference in its entirety.

HMGB1 is a mediator of inflammation and serves as a signal of nuclear damage, such as from necrotic cells. HMGB1 can also be actively secreted by cells of the monocyte/macrophage lineage in a process requiring acetylation of the protein, translocation across the nucleus and secretion. Extracellular HMGB1 acts as a potent mediator of inflammation by signaling via the Receptor for Advanced Glycated End-products (RAGE) and via members of the Toll-like Receptor family (TLR), in particular TLR4. The RAGE binding activity has been identified and requires the polypeptide of SEQ ID NO: 27. TLR4 binding requires the cysteine at position 106 of SEQ ID NO: 18, which is found in the B box region of HMGB1.

The inflammatory activities of HMGB1 do not require the full-length protein and functional fragments have been identified. The B box has been shown to be sufficient to mediate the pro-inflammatory effects of HMGB1 and thus SEQ ID NO: 25 and 26 are HMGB1 polypeptides or functional fragments thereof within the context of the present invention. In addition, the RAGE binding site and the pro-inflammatory cytokine activity have been mapped to SEQ ID NO: 27 and SEQ ID NO: 28, respectively. Thus, these polypeptides are functional fragments of HMGB1 polypeptides in the context of the present invention.

Those of skill in the art are capable of identifying HMGB1 polypeptides and fragments thereof capable of stimulating pro-inflammatory cytokine activity, using methods such as those in International Publication No. WO02 092004, which is incorporated herein by reference in its entirety. Suitably, the HMGB1 polypeptide includes the RAGE binding domain at amino acids 150-183 of SEQ ID NO:18 (SEQ ID NO: 27 or a homolog thereof) and the pro-inflammatory cytokine activity domain between amino acids 89-109 of SEQ ID NO: 18 (SEQ ID NO: 28 or a homolog thereof). In particular, HMGB1 polypeptides and functional fragments or homologs thereof include polypeptides identical to, or at least 99% identical, at least 98% identical, at least 95% identical, at least 90% identical, at least 85% identical, or at least 80% identical to the HMGB1 polypeptides of SEQ ID NOs: 18 or 23-30.

At least a portion of the antigenic polypeptide and at least a portion of the HMGB1 polypeptide are present on the surface of the vaccine vector. Present on the surface of the vaccine vector includes polypeptides that are comprised within a transmembrane protein, interacting with, covalently or chemically cross-linked to a transmembrane protein, a membrane lipid or membrane anchored carbohydrate. A polypeptide can be comprised within a transmembrane protein by having the amino acids comprising the polypeptide linked via a peptide bond to the N-terminus, C-terminus or anywhere within the transmembrane protein (i.e. inserted between two amino acids of the transmembrane protein or in place of one or more amino acids of the transmembrane protein (i.e. deletion-insertion). Suitably, the polypeptides may be inserted into an external loop of a transmembrane protein. Suitable transmembrane proteins are cotB and lamB, but those of skill in the art will appreciate many suitable transmembrane proteins are available.

Alternatively, the polypeptides may be covalently or chemically linked to proteins, lipids or carbohydrates in the membrane, or capsid if a viral vector is being used through methods available to persons of skill in the art. For example, di-sulfide bonds or biotin-avidin cross-linking could be used to present the antigenic and HMGB1 polypeptides on the surface of a vaccine vector. Suitably, the antigenic polypeptide and the HMGB1 polypeptide are part of a fusion protein. The two polypeptides may be directly linked via a peptide bond or may be separated by a linker or a section of a third protein into which they are inserted.

Polynucleotides encoding the antigenic polypeptide or HMGB1 polypeptide may be inserted into the vaccine vector and expressed to generate the antigenic polypeptide and the HMGB1 polypeptide. The polynucleotides may be inserted into the chromosome of the vaccine vector or encoded on plasmids or other extrachromosomal DNA. Suitably, polynucleotides encoding the antigenic polypeptide and/or the HMGB1 polypeptide may be expressed independently or are inserted into a vaccine vector polynucleotide that is expressed. Suitably, the vaccine vector polynucleotide encodes a polypeptide expressed on the surface of the vaccine vector such as a transmembrane protein. The polynucleotide encoding the antigenic polypeptide and/or the HMGB1 polypeptide may be inserted into the vaccine vector polynucleotide sequence to allow expression of the antigenic polypeptide and/or the HMGB1 polypeptide on the surface of the vector. For example, the polynucleotide encoding the antigenic polypeptide and the HMGB1 polypeptide may be inserted in frame into a bacterial polynucleotide in a region encoding an external loop region of a transmembrane protein such that the bacterial polynucleotide sequence remains in frame. See Example 1.

Alternatively, the polynucleotide encoding the antigenic polypeptide and/or the HMGB1 polypeptide may be inserted into a secreted polypeptide which is displayed or presented on the surface of the vaccine vector through association with a protein, lipid or carbohydrate on the surface of the vaccine vector. Those of skill in the art will appreciate that the polynucleotide encoding the antigenic polypeptide and/or the HMGB1 polypeptide could be inserted in a wide variety of vaccine vector polynucleotides to provide expression and presentation of the antigenic polypeptide and/or the HMGB1 polypeptide to the immune cells of a subject treated with the vaccine vector. In the Examples, several Influenza epitopes including an M2e epitope, a HA epitope and a NP epitope were expressed from a plasmid for vegetative expression in Bacillus subtilis. The resulting recombinant bacteria express the inserted epitopes as demonstrated by the immune response shown in FIGS. 1-6.

In the Examples, the vaccine vectors have the antigenic polypeptides (M2e, HA and NP polypeptides) and the immunostimulatory polypeptide (either CD154 or HMGB1) encoded on the same polynucleotide and in frame with each other. In alternative embodiments, the immunostimulatory polypeptide and the antigenic polypeptide may be encoded by distinct polynucleotides. Those of skill in the art will appreciate that a variety of methods may be used to obtain expression of the antigenic polypeptide and the HMGB1 polypeptide on the surface of the vaccine vector. Such methods are known to those skilled in the art.

Compositions comprising the vaccine vector and a pharmaceutically acceptable carrier are also provided. A pharmaceutically acceptable carrier is any carrier suitable for in vivo administration. Suitably, the pharmaceutically acceptable carrier is acceptable for oral, nasal or mucosal delivery. The pharmaceutically acceptable carrier may include water, buffered solutions, glucose solutions or bacterial culture fluids. Additional components of the compositions may suitably include excipients such as stabilizers, preservatives, diluents, emulsifiers and lubricants. Examples of pharmaceutically acceptable carriers or diluents include stabilizers such as carbohydrates (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein-containing agents such as bovine serum or skimmed milk and buffers (e.g., phosphate buffer). Especially when such stabilizers are added to the compositions, the composition is suitable for freeze-drying or spray-drying. The vaccine vector in the compositions may not be capable of replication, suitably the vaccine vector is inactivated or killed prior to addition to the composition.

The compositions described herein may be used to enhance an immune response such as an antibody response to the antigenic polypeptide. The compositions containing Influenza polypeptides may also be used to decrease the morbidity associated with subsequent Influenza infection. The compositions may prevent Influenza from causing disease or any associated morbidity in a subject to which the compositions or vaccine vectors described herein were administered. The compositions and vaccine vectors described herein may reduce the severity of subsequent disease by decreasing the length of disease, decreasing the morbidity or mortality associated with the disease or reducing the likelihood of contracting the disease. The morbidity or mortality associated with the disease after administration of the vaccine vectors described herein may be reduced by 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% as compared to similar subjects not provided the vaccine vector.

Methods of enhancing immune responses in a subject by administering a vaccine vector are also provided. The vaccine vector may contain a HMGB1 polypeptide capable of stimulating the immune response to the vaccine vector and its associated antigenic polypeptide. The vaccine vector comprising a polypeptide of HMGB1 is administered to a subject in an amount effective to enhance the immune response of the subject to the vaccine and in particular to the antigenic polypeptide. Suitably, the vaccine vector contains a polynucleotide encoding a polypeptide including amino acids 150-183 and 89-109 of the HMGB1 polypeptide (SEQ ID NO: 18) or a homolog thereof. In the Examples, a 190 amino acid polypeptide of HMGB1 was used. Suitably, the polynucleotide encodes a HMGB1 polypeptide from the same species as the subject. Heterologous combinations of HMGB1 polypeptides and subjects (i.e. a human HMGB1 polypeptide for use in a chicken vaccine) may be useful in the methods of the invention because HMGB1 is highly conserved through a wide number of species. The HMGB1 polypeptide may be used to enhance the immune response in the subject to any foreign antigen or antigenic polypeptide present in or on the vaccine vector. One of skill in the art will appreciate that the HMGB1 polypeptide could be used to enhance the immune response to more than one antigenic polypeptide present in a vaccine vector. The polypeptide from HMGB1 stimulates an immune response at least in part by activating dendritic cells and macrophages and thus stimulating production of cytokines such as IL-1, IL-6, IFN-γ and TNF-α. In the Examples, a polypeptide of HMGB1 was expressed on the surface of the vaccine vector.

In addition, methods of enhancing an immune response against influenza A and methods of reducing morbidity associated with subsequent Influenza A infection are disclosed. Briefly, the methods comprise administering to a subject a vaccine vector comprising an Influenza A epitope (an antigenic polypeptide of Influenza) capable of eliciting an immune response in an amount effective to elicit the immune response. The Influenza A epitope may be a M2e polypeptide, an HA polypeptide or a NP polypeptide or another influenza polypeptide as discussed above. The insertion of the antigenic polypeptides into the vaccine vector may be accomplished in a variety of ways known to those of skill in the art, including but not limited to the scarless site-directed mutation system described in International Patent Publication No. WO 2008/036675. The bacterium may also be engineered to express Influenza polypeptides in conjunction with polynucleotides capable of enhancing the immune response as discussed above. In particular, a polypeptide of CD154 or HMGB1 may be expressed by the vaccine vector to enhance the immune response of the subject to the influenza polypeptides. The Examples demonstrate production of a robust IgA and IgG response to vaccination in chickens. We expect that such a robust response will be protective against or at least reduce the morbidity associated with subsequent infection or challenge with the source of the antigenic polypeptide (Influenza virus in the Examples).

The compositions may be administered by a variety of means including, but not limited to, orally, intranasally, and mucosally. For example, the compositions or vaccine vectors may be delivered by aerosol, by spraying, by addition to food or water, by oral gavage, or via eye drops. In some embodiments, the compositions are administered by injection such as intradermally, parenterally, subcutaneously, intraperitoneally, intravenously, intracranially, or intramuscularly. For chickens or other poultry, the compositions may be administered in ovo.

Subjects include, but are not limited to, a vertebrate, suitably a mammal, suitably a human, cows, cats, dogs, pigs, or birds, suitably poultry such as chickens. Other animal models of infection may also be used. Enhancing an immune response includes, but is not limited to, inducing a therapeutic or prophylactic effect that is mediated by the immune system of the subject. Specifically, enhancing an immune response may include enhanced production of antibodies, such as demonstrated in FIGS. 1-3, enhanced class switching of antibody heavy chains such as production of IgA as shown in FIG. 8, maturation of antigen presenting cells, stimulation of helper T cells, stimulation of cytolytic T cells or induction of T and B cell memory.

The useful dosage to be administered will vary depending on the age, weight and species of the subject, the mode and route of administration and the type of pathogen or disease against which an immune response is sought. The composition may be administered in any dose of vaccine vector sufficient to evoke an immune response. It is envisioned that doses ranging from 10³ to 10¹⁰ vector copies (i.e. plaque forming or colony forming units), from 10⁴ to 10⁹ vector copies, or from 10⁵ to 10⁷ vector copies are suitable.

The composition may be administered only once or may be administered two or more times to increase the immune response. For example, the composition may be administered two or more times separated by one week, two weeks, or by three weeks, one month, two months, three months, six months or more. The bacteria may be viable prior to administration, but in some embodiments the bacteria may be killed or inactivated prior to administration. In some embodiments, the bacteria may be able to replicate in the subject, while in other embodiments the bacteria may not be capable of replicating in the subject. As shown in the Examples, bacterial vaccine vectors may be inactivated prior to administration using formalin, ethanol, heat or antibiotics. One skilled in the art would appreciate other means of inactivating vaccine vectors could be used as well.

A Bacillus spp. vaccine vector is also provided herein. The Bacillus vaccine vector includes a first polynucleotide sequence encoding an antigenic polypeptide and a second polynucleotide sequence encoding an immunostimulatory polypeptide. The antigenic polypeptide and the immunostimulatory polypeptide are present on the surface of the Bacillus vaccine vector as described above. The antigenic polypeptide is an Influenza polypeptide as described above and the immunostimulatory polypeptide is a HMGB1 polypeptide as described above or a CD154 polypeptide.

Polynucleotides encoding immunostimulatory polypeptides that are homologous to proteins of the subject and capable of stimulating the immune system to respond to the antigenic polypeptide may also be inserted into a vaccine vector. As described in more detail in the Examples, a vaccine vector may include a CD154 polypeptide that is capable of binding CD40 in the subject and stimulating the subject to respond to the vaccine vector and its associated antigenic polypeptide, similar to HMGB1 described above. The Bacillus vaccine vector may include a HMGB1 polypeptide, a CD154 polypeptide or a combination thereof. As described above, polynucleotides encoding these polypeptides may be inserted into the chromosome of the vaccine vector or maintained extrachromosomally. One of skill in the art will appreciate that these polypeptides can be inserted in a variety of polypeptides of the vaccine vector and expressed in different parts of the vaccine vector or may be secreted.

The polynucleotide encoding an immunostimulatory polypeptide capable of enhancing the immune response to an antigenic polypeptide may also encode the antigenic polypeptide.

The polynucleotide encoding an immunostimulatory polypeptide may be linked to the polynucleotide encoding the antigenic polypeptide, such that in the vaccine vector the immunostimulatory polypeptide and the antigenic polypeptide are encoded by the same polynucleotide. In the Examples, a polynucleotide encoding a polypeptide of CD154, which is capable of binding to CD40, or HMGB1 also encodes an M2e epitope, an HA epitope and a NP epitope of Influenza A. See SEQ ID NOs: 19-22. In the Examples, the polynucleotide encoding the Influenza epitopes and the polynucleotide encoding the immunostimulatory polypeptide are both expressed from a plasmid for vegetative cell expression. In some embodiments, the polynucleotides are inserted in the cotB gene or another gene encoding a protein expressed on the surface of spores. Those of skill in the art will appreciate that bacterial polynucleotides encoding other transmembrane proteins may also be used.

As discussed above, a polynucleotide encoding an immunostimulatory polypeptide homologous to a protein of the subject that is capable of enhancing the immune response to the epitope may be included in the vaccine vector. In the Examples, a Bacillus vaccine vector including a polynucleotide encoding either a CD154 polypeptide capable of binding to CD40 or a polypeptide encoding HMGB1 were demonstrated to enhance the immune response to the M2e epitope and to two distinct HA epitopes as measured by increased antibody production in response to vaccination.

Suitably, the CD154 polypeptide is fewer than 50 amino acids long, more suitable fewer than 40, fewer than 30 or fewer than 20 amino acids in length. The polypeptide may be between 10 and 15 amino acids, between 10 and 20 amino acids or between 10 and 25 amino acids in length. The CD154 sequence and CD40 binding region are not highly conserved among the various species. The CD154 sequences of chicken and human are provided in SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

The CD40 binding regions of CD154 have been determined for a number of species, including human, chicken, duck, mouse and cattle and are shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, respectively. Although there is variability in the sequences in the CD40 binding region between species, the Examples below indicate that the human CD154 polypeptide was able to enhance the immune response in chickens. Therefore, one may practice the invention using species specific CD154 polypeptides or a heterologous CD154 polypeptide. In particular, CD154 polypeptides and functional fragments or homologs thereof include polypeptides identical to, or at least 99% identical, at least 98% identical, at least 95% identical, at least 90% identical, at least 85% identical, or at least 80% identical to the CD154 polypeptides of SEQ ID NOs: 11-17.

The Bacillus vaccine vector described herein may be used in the methods of enhancing an immune response and the methods of reducing Influenza morbidity in a subject as described above. The Bacillus vaccine vector may be used to make compositions for administration to subjects such as those described above as well.

Heterologous polynucleotides encoding antigenic polypeptides can be inserted in the bacterial genome at any non-essential site or alternatively may be carried on a plasmid using methods well known in the art. One suitable site for insertion of polynucleotides is within external portions of transmembrane proteins or coupled to sequences which target the heterologous polynucleotide for secretory pathways. Examples of a suitable transmembrane protein for insertion of polynucleotides are the cotB gene of Bacillus and the lamB gene of Salmonella.

Heterologous polynucleotides include, but are not limited to, polynucleotides encoding antigens selected from pathogenic microorganisms or viruses other than the vaccine vector. Such polynucleotides may be derived from pathogenic viruses such as influenza (e.g., M2e, hemagglutinin, or neuraminidase), herpesviruses (e.g., the genes encoding the structural proteins of herpesviruses), retroviruses (e.g., the gp160 envelope protein), adenoviruses, paramyxoviruses, coronaviruses and the like. Heterologous polynucleotides can also be obtained from pathogenic bacteria, e.g., genes encoding bacterial proteins such as toxins, and outer membrane proteins. Further, heterologous polynucleotides from parasites, such as Eimeria are attractive candidates for use in a vector vaccine.

Additional immunostimulatory polypeptides involved in triggering the immune system may also be included in the vaccine vectors described herein. The polynucleotides may encode immune system molecules known for their stimulatory effects, such as an interleukin, Tumor Necrosis Factor or an interferon, or another polynucleotide involved in immune-regulation.

The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims.

EXAMPLES

Example 1. Construction of HA/NP/M2e/cCD154 and HA/NP/M2e/HMGB1 Bacillus Vectors

Strains and Culture Conditions

All plasmids were first maintained in TOP10 E. coli cells (Invitrogen, Carlsbad, Calif., USA) unless described otherwise. Bacillus spp. was used for introduction of mutations (Bacillus subtilis, Poultry Health Laboratory strain designated as NP122). Bacteria carrying plasmid pDGIEF and pHT10 were grown at 37° C.

Luria-Bertani (LB) media was used for routine growth of cells, and SOC media (Invitrogen, Carlsbad, Calif., USA) was used for phenotypic expression after electroporation. When appropriate, the following were added to the media: Isopropyl-β-D-thiogalactopyranoside (IPTG) at 1 mM, ampicillin (Amp) at 1001 μg/ml, spectinomycin (SP) at 100 μg/ml, and chloramphenicol (Cm) at 5 μg/ml.

Plasmids

Plasmids pDGIEF (Bacillus Genetic Stock Center, Columbus, Ohio) and pHT10 used for the present study were described previously (Zhang et al., Nuc. Acids Research 2006, 34 (9): 1-8 and Nguyen et al., Curr. Micro. 2007, 55:89-93). Plasmid pDGIEF served as a template for amplification of the mazF gene which was used as the counter-selectable marker during Bacillus chromosomal manipulation. Plasmid pHT10 was used to code for and produce the heterologous epitope sequences for Avian Influenza within Bacillus spp. This plasmid contains a CM resistance gene, is induced by the addition of 1 mM IPTG, and is maintained within Bacillus at 37° C.

Production of Heterologous Proteins for Vegetative Cell Expression:

Plasmid pHT10 purchased from MoBioTec/Boca Scientific, Boca Raton, Fla. (Nguyen et al., 2007) was transformed at the multiple cloning site by addition of a Bacillus subtilis codon optimized insertion sequence. DNA sequencing was done to confirm correct sequence insertion. The newly modified plasmid was then transformed into Bacillus. Briefly, Bacillus cultures were grown overnight at 37° C. in HS media (Spizizen's medium supplemented with 0.5% glucose, 50 μg/ml DL-tryptophan, 50 μg/ml uracil, 0.02% casein hydrolysate, 0.1% yeast extract, 8μg/ml arginine, 0.4 μg/ml histidine, 1 mM MgSO₄). The overnight culture (1 ml) was used to inoculate 20 ml LS medium (Spizizen's medium supplemented with 0.5% glucose, 5 μg/ml DL-tryptophane, 5 μg/ml uracil, 0.01% casein hydrolysate, 0.1% yeast extract, 1 mM MgSO₄, 2.5 mM MgCl₂, 0.5 mM CaCl₂) and incubated with shaking for 3-4 hours at 30° C. To 1 ml of the resulting LS culture 10 μl of 0.1M EGTA was added and incubated at room temperature for 5 minutes. Then 1-2 μg plasmid DNA was added, shaken for 2 hours at 37° C., and plated on LB plates with selective antibiotics. These transformed Bacillus spp. now produce heterologous epitope sequences from AI when induced with 1 mM IPTG.

PCR

All primers used for PCR are listed in Table 1. Typical PCR conditions consisted of approximately 0.1 μg of purified genomic, plasmid or PCR-generated DNA (Qiagen, Valencia, Calif., USA), 1× Pfu polymerase buffer, 5 U Pfu polymerase (Stratagene La Jolla, Calif., USA), 1 mM dNTPs (GE Healthcare Bio-Sciences Corp., Piscataway, N.J.), 1.2 μM of each primer in a total volume of 50 μL. The DNA engine thermal cycler (Bio-Rad, Hercules, Calif., USA) was used with the following amplification conditions: 94° C. for 2 minutes; 30 cycles of 94° C. sec for 30 sec, 58° C. for 60 sec, 72° C. for 90 sec per 1 kb; and 72° C. for 10 minutes for final extension. Each PCR product was gel purified (Qiagen, Valencia, Calif., USA) and either eluted in 25 μL EB buffer for preparation of templates used in overlapping extension PCR or in 50 μL EB buffer, ethanol precipitated and suspended in 5 μL of ddH₂O for electroporation into Bacillus spp.

TABLE 1
Primer sequences used to generate the vaccine vector
	Amplified	Primer Sequence
Primer	Region	(SEQ ID NO:)
mazF for	MazF gene	5′ ctaaaatcttcagatgatcaatcatcctcactgcccgctttccagtcgggaaa 3′
		(SEQ ID NO: 31)
mazF rev	MazF gene	5′ tgaacgtgacgaacgaccagatttccccctatgcaagggtttat 3′
		(SEQ ID NO: 32)
Cot B up for	Cot B up	5′ gaaatgctcgatgctgatga 3′ (SEQ ID NO: 33)
Cot B up rev	Cot B up	5′ ggatgattgatcatctgaagattttag 3′ (SEQ ID NO: 34)
Cot B dn for	Cot B down	5′ aaatctggtcgttcgtcacgttca 3′ (SEQ ID NO: 35)
Cot B dn rev	Cot B down	5′ ttacgtttccagtgatagtctatcg 3′ (SEQ ID NO: 36)
BS/AI/	BS/AI/	5′ aaccattctttcaattgtaattgaattttgaatcagtctgcctgatgatgacagttcttcataatcattaaaatc
HMGB1	HMGB1	gcccggatagcacagatcatttgccggatttgctgatgatgaatccatgcctgttctaaccagtgctcttgttc
for	Cot B up	tttgatatgt ggatgattgatcatctgaagattttag 3′ (SEQ ID NO: 37)
BS/AI/	BS/AI/	5′ ttacaattgaaagaatggttctgtcatcatcatcactgctgtcaagaattaatcattttgaaaaaattcaatcat
HMGB1	HMGB1	catcagaagttgaaacaccgattagaaattcatcatcatggatgacaacatcatatgcaccgacatcatcatca
rev	Cot B down	tcagaagttgaaacaccgattagaaataaatctggtcgttcgtcacgttca 3′ (SEQ ID NO: 38)
BS/AI/	BS/AI/	5′ ttcaaaatgattaattcttgacagcagtgatgatgatgacagaaccattctttcaattgtaattgaattttgaat
CD154	CD154	cagtctgcctgatgatgacagttcttcataatcattaaaatcgcccggatagcacagatcatttgccggatttg
for	Cot B up	cggatgattgatcatctgaagattttag 3′ (SEQ ID NO: 39)
BS/AI/	BS/AI/	5′ caagaattaatcattttgaaaaaattcaatcatcatcagaagttgaaacaccgattagaaattcatcatcactgaaa
CD154	CD154	gaaaaatatgaaaaagatattgcagcatatagagcaaaaaggcaaagttgatgcaggcaaaaaagttgttgcaaa
rev	Cot B down	agcagaaaaatcaaaaaaaaaaatctggtcgttcgtcacgttca 3′ (SEQ ID NO: 40)
In Table 1, italicized nucleotides are those which are complementary to eitehr side of the Cot B
gene insertion site of Bacillus subtilis.

Electroporation

Briefly, cells were inoculated into 10 mL of LB broth and grown at 37° C. overnight. Then 100 μL of overnight culture was re-inoculated into 10 mL fresh LB broth at 37° C. for 3-4 hours. Cells were washed five times in ddH₂O water and resuspended in 60 μL of 10% glycerol. Cells were then pulsed at 2.4-2.45 kV for 1-6 ms, incubated in 0.5 ml SOC for 2-3 hours at 37° C. and plated on LB media with appropriate antibiotics.

Chromosomal Integration of Heterologous DNA for Spore Coat Expression:

Recombinant Bacillus strains containing stable integrated copies of selected M2e, HA and NP epitopes were constructed using recently published methods with modification. Briefly, Bacillus strains were transformed with the MazF cassette (Zhang et al., 2006) which generated a strain which was IPTG sensitive and spectomycin resistant. The MazF cassette flanked by approximately 300 bp of homologous DNA on each side was introduced into the CotB gene (Isticato et al., 2001) of the Bacillus vector by electroporation followed by growth on media containing spectomycin for positive clones which now contain the MazF cassette which is spectomycin resistant.

After the MazF mutation was confirmed in CotB, this region was replaced by a codon-optimized DNA sequence coding for the antigenic epitopes of AI again flanked by 300 bp of homologous DNA. This was done by creating a PCR product using overlapping and extension PCR to produce the antigenic sequences flanked by approximately 300 bp on each side homologous to the Bacillus chromosome (Cox et al., 2007). The PCR product was introduced into the Bacillus again by electroporation and replacement of the MazF cassette. Transformants were selected on plates containing IPTG, positive clones should now be unresponsive to IPTG and sensitive to spectomycin. Correct chromosomal sequence insertion was confirmed by DNA sequencing.

Example 2. Vaccination Study 1 and 2

Day-of-hatch (day 0) chicks were obtained from a local commercial hatchery and randomly distributed into treatment groups (n=15/treatment group, Exp 1 and n=20/treatment group, Exp 2). All chicks in each treatment group were tagged and numbered. The chicks were orally infected by gavage with 0.25 ml of saline or 10⁶-10⁸ cfu/ml of the various Bacillus treatments as indicated in Table 2 for study 1 and in Table 3 for study 2.

TABLE 2
Challenge Dose for each treatment group in Vaccination Study 1.
Treatment Group Challenge Dose
Saline only
BS/AI/HMGB1     106 cfu/ml
BS/AI/HMGB1     108 cfu/ml
BS/AI/CD154     106 cfu/ml
BS/AI/CD154     108 cfu/ml

TABLE 3
Challenge Dose for each treatment group in Vaccination Study 2.
Treatment Group                  Challenge Dose
BSBB (Bacillus)                  106 cfu/ml
BS/AI/HMGB1                      106 cfu/ml
BS/AI/CD154                      106 cfu/ml
BS/AI/HMGB1 Heat Inactivated     106 cfu/ml
BS/AI/HMGB1 Formalin Inactivated 106 cfu/ml
BS/AI/HMGB1 Antibiotic Inactivated 106 cfu/ml
BS/AI/HMGB1 Ethanol Inactivated  106 cfu/ml

In study 2, the bacteria were inactivated in several different ways to assess whether replication was necessary for production of an antibody response directed to the antigenic influenza peptides. Several means of inactivation were used because the means of inactivation could result in destruction of the epitope and result in misinterpretation of the data and supporting a need for replication or viability of the Bacillus vector. The bacteria were inactivated by incubation for 10 minutes in 0.022% formalin (formalin inactivated); incubation for 10 minutes at 70° C. (heat inactivated); incubation in 5 μg/ml gentamycin (antibiotic inactivated); or incubation for 10 minutes in 70% ethanol (ethanol inactivated).

Each treatment group was housed in an individual floor pen on fresh pine litter and provided water and feed ad libitum. On days 11 and 21 post-hatch, the birds were given a booster vaccine of the same treatment they received on Day 0. Also on days 21 and 31/32, blood was collected from each of the tagged birds and the serum was removed.

The serum collected from the tagged birds in each treatment group was then used in an antibody capture ELISA to determine specific M2e, HAUA and HALB antibody response. In brief, individual wells of a 96-well plate were coated with 10 μg/ml of the M2e epitope, HAUA epitope or HALB epitope conjugated to BSA. Antigen adhesion was allowed to proceed overnight at 4° C. Plates were rinsed with PBS+0.05% Tween 20, blocked with PBS Superblock (Pierce Chemical Co.) for a minimum of 2 hours and incubated for 2 hours with the serum previously collected from the birds in each of the treatment groups described above. The plates were rinsed with PBS+0.05% Tween 20 followed by incubation with peroxidase conjugated Goat-anti-Chicken IgY secondary antibody (1:7,500 dilution) obtained from Jackson ImmunoResearch Laboratories (West Grove, Pa.) for an additional hour. After subsequent rinsing, the plates were developed using a peroxidase substrate kit obtained from Fisher Scientific and absorbances read on a spectrophotometer at 450 nm and 405 nm.

Pooled serum samples from the groups receiving the vectored vaccine were used as positive controls and pooled serum samples from the unvaccinated groups were used as negative controls on each plate to replace the serum from the treatment groups. The absorbances obtained for the positive control, negative control and experimental samples were used to calculate Sample to Positive control ratios (S/P ratios) using the following calculation:

$S\text{/}P\mathrm{ratio}\mathrm{calculation}\text{:}\frac{\mathrm{sample}\mathrm{mean}-\mathrm{negative}\mathrm{control}\mathrm{mean}}{\mathrm{positive}\mathrm{control}\mathrm{mean}-\mathrm{negative}\mathrm{control}\mathrm{mean}}$

The calculated S/P ratios for each study are shown in FIGS. 1-6. FIGS. 1-3 show the total antibody titers for M2e, HALB and HAUA for study 1, respectively, at days 21 and 31 post-hatch. The results demonstrate that robust immune responses to each of these antigens were generated after oral administration with a Bacillus expressing each of the epitopes with either CD154 of HMGB1 as the immunostimulatory peptide. FIGS. 4-6 show the total antibody titers for M2e, HALB and HAUA for study 2, respectively, at days 21 and 32 post-hatch. The results demonstrate that robust immune responses to each of the epitopes were generated after oral administration of a live Bacillus expressing the epitope and an immunostimulatory peptide. FIGS. 4-6 also demonstrate that similar levels of specific antibodies were generated when the vector (the Bacillus) was inactivated prior to administration.

Example 3. Vaccination Study 3

Day-of-hatch (day 0) chicks were obtained from a local commercial hatchery and randomly distributed into treatment groups (n=20/treatment group). All chicks in each treatment group were tagged and numbered. The chicks were orally infected by gavage with 0.25 ml of saline or 10⁵-10⁸ cfu/ml of the Bacillus vector (BSBB), the Bacillus vector expressing the avian influenza epitopes and HMGB1 (BS/AI/HMGB1), or various amounts of the BS/AI/HMGB1 vector after formalin inactivation (as described above). On day 10 post-hatch, the birds were given a booster vaccine of the same treatment they received on Day 0. Also on days 21 and 32, blood was collected from each of the tagged birds and the serum was removed. The serum IgG M2e specific antibody levels were determined using the method described above with a peroxidase labeled anti-chicken IgG specific secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, Pa.). The results in FIG. 7 show that the formalin inactivated bacteria were able to stimulate production of M2e specific IgG antibodies as well as live bacteria. This result was surprising because it was generally believed that only live bacteria could stimulate a robust immune response after oral administration.

Example 4. Vaccination Study 4

Day-of-hatch (day 0) chicks were obtained from a local commercial hatchery and randomly distributed into treatment groups (n=20-35/treatment group). All chicks in each treatment group were tagged and numbered. The chicks were orally infected by gavage or injected sub-cutaneously with 0.25 ml of 10⁶ cfu/ml of the Bacillus vector (BSBB), the Bacillus vector expressing the avian influenza epitopes and HMGB1 (BSAI), or the BSAI vector after formalin inactivation (as described above) or after formalin inactivation followed by lyophilization (reconstituted with saline immediately prior to administration). On day 10 post-hatch, some of the birds were given a booster vaccine of the same treatment they received on Day 0. On days 11, 14 and 21, blood was collected from each of the tagged birds and the serum was removed. The serum IgA and IgG M2e specific antibody levels were determined using the method described above with a perioxidase labeled anti-chicken IgA (GenTex) or a perioxidase labeled anti-chicken IgG specific secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, Pa.). The results in FIG. 8 show that the formalin inactivated bacteria were able to stimulate production of M2e specific IgA antibodies about as well as live bacteria when given orally. In contrast when given sub-cutaneously the inactivated BSAI vector was not as efficient at stimulating an IgA antibody response and the lyophilized bacteria did not stimulate an IgA response. The results in FIG. 9 show that each of the BSAI administration protocols supported robust IgG formation.

Claims

1. A vaccine vector comprising a surface, a first polynucleotide encoding an antigenic polypeptide, and a second polynucleotide encoding an HMGB1 polypeptide comprising an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 18, 23-30, wherein the antigenic polypeptide and the HMGB1 polypeptide are present on the surface of the vaccine vector.

2. The vaccine vector of claim 1, wherein the antigenic polypeptide is an Influenza specific polypeptide.

3. The vaccine vector of claim 2, wherein the antigenic polypeptide is an M2e, HA or NP Influenza polypeptide.

4. The vaccine vector of claim 3, wherein the Influenza M2e polypeptide is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, an immunogenic fragment of SEQ ID NO:1, an immunogenic fragment of SEQ ID NO:2, an immunogenic fragment of SEQ ID NO:3 and an immunogenic fragment of SEQ ID NO:4.

5. The vaccine vector of claim 3, wherein the antigenic polypeptide is selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and an immunogenic fragment of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.

6. The vaccine vector of claim 1, wherein the vaccine vector is a bacterium.

7. The vaccine vector of claim 6, wherein the bacterium is Bacillus spp.

8. The vaccine vector of claim 1, wherein the antigenic polypeptide and the HMGB1 polypeptide are comprised within a transmembrane protein on the surface of the vaccine vector.

9. The vaccine vector of claim 8, wherein the antigenic polypeptide and the HMGB1 polypeptide are comprised within an external loop of the transmembrane protein.

10. The vaccine vector of claim 8, wherein the transmembrane protein is cotB.

11. The vaccine vector of claim 1, wherein the antigenic polypeptide and the HMGB1 polypeptide are part of a fusion protein.

12. A method of inducing an immune response in a subject comprising administering to the subject the vaccine vector of claim 1 in an amount effective to enhance the immune response of the subject to the antigenic polypeptide.

13. The method of claim 12, wherein the vaccine vector is administered orally or intranasally.

14. The method of claim 13, wherein the immune response is an IgA antibody response to the antigenic polypeptide.

15. The method of claim 14, wherein the vaccine vector is not capable of replication in the subject.

16. The method of claim 12, wherein the subject is a poultry or a mammal.

17. The method of claim 16, wherein the subject is a chicken.