Patent Application
20220370598
The present invention relates to a vaccine for Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) and methods of administering the vaccine.
COVID-19, known previously as 2019-nCoV pneumonia or disease, has rapidly emerged as a global threat to public health, joining severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) in a growing number of coronavirus-associated illnesses which have jumped from animals to people. There is an imminent need for medical countermeasures such as vaccines to combat the spread of such emerging coronaviruses. There are at least seven identified coronaviruses that infect humans, including MERS-CoV and SARS-CoV.
In December 2019, the city of Wuhan in China became the epicenter for a global outbreak of a novel coronavirus. This coronavirus, SARS-CoV-2, was isolated and sequenced from human airway epithelial cells from infected patients (Zhu, et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med. 2020; Wu, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020). Disease symptoms can range from mild flu-like to severe cases with life-threatening pneumonia (Huang, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020). The global situation is dynamically evolving, and on Jan. 30, 2020 the World Health Organization declared COVID-19 as a public health emergency of international concern (PHEIC).
Provided herein are methods of inducing an immune response against Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof. In some embodiments, the methods of inducing an immune response comprise administering an effective amount of pGX9501, INO-4800, or a biosimilar thereof. Also provided herein are methods of protecting a subject in need thereof from infection with SARS-CoV-2, the method comprising administering an effective amount of pGX9501, INO-4800, or a biosimilar thereof to the subject. Further provided are methods of treating SARS-CoV-2 infection in a subject in need thereof, the method comprising administering an effective amount of pGX9501, INO-4800, or a biosimilar thereof to the subject. In any of these methods, the administering may include at least one of electroporation and injection. According to some embodiments, the administering comprises parenteral administration, for example by intradermal, intramuscular, or subcutaneous injection, optionally followed by electroporation. In some embodiments of the disclosed methods, an initial dose of about 1.0 mg to about 2.0 mg of the nucleic acid molecule pGX9501 or a biosimilar thereof is administered to the subject, optionally the initial dose is 1.0 mg or 2.0 mg of the nucleic acid molecule. The methods may further involve administration of a subsequent dose of about 1.0 mg to about 2.0 mg of the nucleic acid molecule pGX9501 or a biosimilar thereof to the subject about four weeks after the initial dose, optionally wherein the subsequent dose is 1.0 mg or 2.0 mg of the nucleic acid molecule. In still further embodiments, the methods involve administration of one or more further subsequent doses of about 1.0 mg to about 2.0 mg of the nucleic acid molecule pGX9501 or a biosimilar thereof to the subject at least twelve weeks after the initial dose, optionally wherein the further subsequent dose is 1.0 mg or 2.0 mg of the nucleic acid molecule. Also provided herein are uses of an effective amount of pGX9501, INO-4800, or a biosimilar thereof in a method of inducing an immune response against Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof. According to some embodiments, the use is effective in treating or protecting against a disease or disorder associated with SARS-CoV-2 infection such as but not limited to Coronavirus Disease 2019 (COVID-19), Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C). Further provided are uses of an effective amount of pGX9501, INO-4800, or a biosimilar thereof in a method of protecting a subject from infection with Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2). According to some embodiments, the use is effective in treating or protecting against a disease or disorder associated with SARS-CoV-2 infection such as but not limited to Coronavirus Disease 2019 (COVID-19), Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C). Also provided herein are uses of an effective amount of pGX9501, INO-4800, or a biosimilar thereof in a method of treating a subject in need thereof against SARS-CoV-2 infection. According to some embodiments, the use is effective in treating or protecting against a disease or disorder associated with SARS-CoV-2 infection such as but not limited to Coronavirus Disease 2019 (COVID-19), Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C). In accordance with any of these uses, pGX9501, INO-4800, or a biosimilar thereof may be administered to the subject by at least one of electroporation and injection. In some embodiments, pGX9501, INO-4800, or a biosimilar thereof is parenterally administered to the subject, for example by intradermal, intramuscular, or subcutaneous injection, optionally followed by electroporation. In some embodiments of the disclosed uses, an initial dose of about 1.0 mg to about 2.0 mg of the nucleic acid molecule pGX9501 or a biosimilar thereof is administered to the subject, optionally the initial dose is 1.0 mg or 2.0 mg of the nucleic acid molecule. The uses may further involve administration of a subsequent dose of about 1.0 mg to about 2.0 mg of the nucleic acid molecule of pGX9501, INO-4800, or a biosimilar thereof to the subject about four weeks after the initial dose, optionally wherein the subsequent dose is 1.0 mg or 2.0 mg of the nucleic acid molecule. In still further embodiments, the uses involve administration of one or more further subsequent doses of about 1.0 mg to about 2.0 mg of the nucleic acid molecule of pGX9501, INO-4800, or a biosimilar thereof to the subject at least twelve weeks after the initial dose, optionally wherein the further subsequent dose is 1.0 mg, or 2.0 mg of the nucleic acid molecule.
Further provided herein are uses of an effective amount of pGX9501 or a biosimilar thereof in the preparation of a medicament for treating or protecting against infection with Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the medicament is for treating or protecting against a disease or disorder associated with SARS-CoV-2 infection. In some embodiments, the medicament is for treating or protecting against Coronavirus Disease 2019 (COVID-19), Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C).
Additionally provided herein are methods of inducing an immune response against Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof, the method comprising administering to the subject an effective amount of: a nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; or INO-4800 drug product or a biosimilar thereof, wherein the subject exhibits an increase in antigen-specific cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay relative to baseline and/or an increase in neutralizing antibody response as measured by a pseudovirus neutralizing assay relative to baseline.
Also provided are methods of protecting a subject in need thereof from infection with Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) or from a disease or disorder associated with infection with Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2), the method comprising administering to the subject an effective amount of: a nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; or INO-4800 drug product or a biosimilar thereof, wherein the subject exhibits an increase in antigen-specific cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay relative to baseline and/or an increase in neutralizing antibody response as measured by a pseudovirus neutralizing assay relative to baseline.
Also provided are methods of treating a subject in need thereof against Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) infection, the method comprising administering to the subject an effective amount of: a nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; or INO-4800 drug product or a biosimilar thereof, wherein the subject exhibits an increase in antigen-specific cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay relative to baseline and/or an increase in neutralizing antibody response as measured by a pseudovirus neutralizing assay relative to baseline. According to some embodiments, the subject is thereby resistant to one or more SARS-CoV-2 strains.
Provided herein are methods of inducing a Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) spike antigen-specific cellular immune response in a subject in need thereof, the method comprising administering to the subject an effective amount of: a nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; or INO-4800 drug product or a biosimilar thereof, wherein the subject exhibits an increase in antigen-specific cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay relative to baseline.
Also provided herein are methods of inducing a neutralizing antibody response against a Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof, the method comprising administering to the subject an effective amount of: a nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; or INO-4800 drug product or a biosimilar thereof, wherein the subject exhibits an increase in neutralizing antibody response as measured by a pseudovirus neutralizing assay relative to baseline.
The increase in antigen-specific cellular immune response and/or the increase in neutralizing antibody response may be measured about 6 weeks after the initial administration.
According to some embodiments of the methods, the administering comprises at least one of electroporation and injection. For example, parenteral administration may be followed by electroporation.
According to some embodiments, an initial dose comprising about 1.0 mg to about 2.0 mg of nucleic acid molecule pGX9501 or a biosimilar thereof may be administered to the subject. For example, the initial dose may comprise 1.0 mg or 2.0 mg of nucleic acid. A subsequent dose comprising about 1.0 mg to about 2.0 mg of nucleic acid molecule pGX9501 or a biosimilar thereof may be administered to the subject about four weeks after the initial dose. For example, the subsequent dose may comprise 1.0 mg or 2.0 mg of nucleic acid molecule. One or more further doses comprising about 1.0 mg to about 2.0 mg of nucleic acid molecule pGX9501 or a biosimilar thereof may be administered to the subject at least twelve weeks after the initial dose, optionally wherein the further dose comprises 1.0 mg or 2.0 mg of nucleic acid molecule.
According to some embodiments, INO-4800 drug product is administered to the subject. In some embodiments, the subject may be administered at least one additional agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. The nucleic acid molecule comprising the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; pGX9501; INO-4800, or a biosimilar thereof may be administered to the subject before, concurrently with, or after the additional agent.
According to some embodiments, the method is clinically proven safe and/or clinically proven effective.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
The term “comprising” is intended to include examples encompassed by the terms “consisting essentially of” and “consisting of”; similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of” The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of” the embodiments or elements presented herein, whether explicitly set forth or not.
It is to be appreciated that certain features of the disclosed materials and methods which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosed materials and methods that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination.
The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise.
The term “about” when used in reference to numerical ranges, cutoffs, or specific values is used to indicate that the recited values may vary by up to as much as 10% from the listed value. Thus, the term “about” is used to encompass variations of ±10% or less, variations of ±5% or less, variations of ±1% or less, variations of ±0.5% or less, or variations of ±0.1% or less from the specified value. When values are expressed as approximations by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. Reference to a particular numerical value includes at least that particular value unless the context clearly dictates otherwise.
“Adjuvant” as used herein means any molecule added to the vaccine described herein to enhance the immunogenicity of the antigen.
“Antibody” as used herein means an antibody of classes IgG, IgM, IgA, IgD or IgE, or fragments, fragments or derivatives thereof, including Fab, F(ab′) 2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof. The antibody can be an antibody isolated from the serum sample of mammal, a polyclonal antibody, affinity purified antibody, or mixtures thereof which exhibits sufficient binding specificity to a desired epitope or a sequence derived therefrom.
The term “biosimilar” (of an approved reference product/biological drug, i.e., reference listed drug) refers to a biological product that is highly similar to the reference product notwithstanding minor differences in clinically inactive components with no clinically meaningful differences between the biosimilar and the reference product in terms of safety, purity and potency, based upon data derived from (a) analytical studies that demonstrate that the biological product is highly similar to the reference product notwithstanding minor differences in clinically inactive components; (b) animal studies (including the assessment of toxicity); and/or (c) a clinical study or studies (including the assessment of immunogenicity and pharmacokinetics or pharmacodynamics) that are sufficient to demonstrate safety, purity, and potency in one or more appropriate conditions of use for which the reference product is licensed and intended to be used and for which licensure is sought for the biosimilar. The biosimilar may be an interchangeable product that may be substituted for the reference product at the pharmacy without the intervention of the prescribing healthcare professional. To meet the additional standard of “interchangeability,” the biosimilar is to be expected to produce the same clinical result as the reference product in any given patient and, if the biosimilar is administered more than once to an individual, the risk in terms of safety or diminished efficacy of alternating or switching between the use of the biosimilar and the reference product is not greater than the risk of using the reference product without such alternation or switch. The biosimilar utilizes the same mechanisms of action for the proposed conditions of use to the extent the mechanisms are known for the reference product. The condition or conditions of use prescribed, recommended, or suggested in the labeling proposed for the biosimilar have been previously approved for the reference product. The route of administration, the dosage form, and/or the strength of the biosimilar are the same as those of the reference product and the biosimilar is manufactured, processed, packed or held in a facility that meets standards designed to assure that the biosimilar continues to be safe, pure and potent. The biosimilar may include minor modifications in the amino acid sequence when compared to the reference product, such as N- or C-terminal truncations that are not expected to change the biosimilar performance.
“Coding sequence” or “encoding nucleic acid” as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered.
“Complement” or “complementary” as used herein means Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.
“Consensus” or “Consensus Sequence” as used herein may mean a synthetic nucleic acid sequence, or corresponding polypeptide sequence, constructed based on analysis of an alignment of multiple subtypes of a particular antigen. The sequence may be used to induce broad immunity against multiple subtypes, serotypes, or strains of a particular antigen. Synthetic antigens, such as fusion proteins, may be manipulated to generate consensus sequences (or consensus antigens).
“Electroporation,” “electro-permeabilization,” or “electro-kinetic enhancement” (“EP”) as used interchangeably herein means the use of a transmembrane electric field pulse to induce microscopic pathways (pores) in a bio-membrane; their presence allows biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions, and water to pass from one side of the cellular membrane to the other.
“Fragment” as used herein means a nucleic acid sequence or a portion thereof that encodes a polypeptide capable of eliciting an immune response in a mammal. The fragments can be DNA fragments selected from at least one of the various nucleotide sequences that encode protein fragments set forth below.
“Fragment” or “immunogenic fragment” with respect to polypeptide sequences means a polypeptide capable of eliciting an immune response in a mammal that cross reacts with a full-length wild type strain SARS-CoV-2 antigen. Fragments of consensus proteins can comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% of a consensus protein. In some embodiments, fragments of consensus proteins can comprise at least 20 amino acids or more, at least 30 amino acids or more, at least 40 amino acids or more, at least 50 amino acids or more, at least 60 amino acids or more, at least 70 amino acids or more, at least 80 amino acids or more, at least 90 amino acids or more, at least 100 amino acids or more, at least 110 amino acids or more, at least 120 amino acids or more, at least 130 amino acids or more, at least 140 amino acids or more, at least 150 amino acids or more, at least 160 amino acids or more, at least 170 amino acids or more, at least 180 amino acids or more, at least 190 amino acids or more, at least 200 amino acids or more, at least 210 amino acids or more, at least 220 amino acids or more, at least 230 amino acids or more, or at least 240 amino acids or more of a consensus protein.
As used herein, the term “genetic construct” refers to the DNA or RNA molecules that comprise a nucleotide sequence which encodes a protein. The coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered. As used herein, the term “expressible form” refers to gene constructs that contain the necessary regulatory elements operable linked to a coding sequence that encodes a protein such that when present in the cell of the individual, the coding sequence will be expressed.
“Identical” or “identity” as used herein in the context of two or more nucleic acids or polypeptide sequences, means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.
“Immune response” as used herein means the activation of a host's immune system, e.g., that of a mammal, in response to the introduction of antigen. The immune response can be in the form of a cellular or humoral response, or both.
“Nucleic acid” or “oligonucleotide” or “polynucleotide” or “nucleic acid molecule” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.
Nucleic acids can be single stranded or double-stranded or can contain portions of both double-stranded and single-stranded sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.
“Operably linked” as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter can be positioned 5′ (upstream) or 3′ (downstream) of a gene under its control. The distance between the promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance can be accommodated without loss of promoter function.
A “peptide,” “protein,” or “polypeptide” as used herein can mean a linked sequence of amino acids and can be natural, synthetic, or a modification or combination of natural and synthetic.
“Promoter” as used herein means a synthetic or naturally derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter can comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of same. A promoter can also comprise distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. A promoter can be derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter can regulate the expression of a gene component constitutively or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, and CMV IE promoter.
“Signal peptide” and “leader sequence” are used interchangeably herein and refer to an amino acid sequence that can be linked at the amino terminus of a SARS-CoV-2 protein set forth herein. Signal peptides/leader sequences typically direct localization of a protein. Signal peptides/leader sequences used herein preferably facilitate secretion of the protein from the cell in which it is produced. Signal peptides/leader sequences are often cleaved from the remainder of the protein, often referred to as the mature protein, upon secretion from the cell. Signal peptides/leader sequences are linked at the N terminus of the protein.
“Subject” as used herein can mean a mammal that wants or is in need of being immunized with a herein described immunogenic composition or vaccine. The mammal can be a human, chimpanzee, guinea pig, dog, cat, horse, cow, mouse, rabbit, or rat.
“Substantially identical” as used herein can mean that a first and second amino acid sequence are at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% over a region of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 or more amino acids. Substantially identical can also mean that a first nucleic acid sequence and a second nucleic acid sequence are at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% over a region of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 or more nucleotides.
“Treatment” or “treating,” as used herein can mean protecting of an animal from a disease through means of preventing, suppressing, repressing, or completely eliminating the disease. Preventing the disease involves administering an immunogenic composition or a vaccine of the present invention to an animal prior to onset of the disease. Suppressing the disease involves administering an immunogenic composition or a vaccine of the present invention to an animal after induction of the disease but before its clinical appearance. Repressing the disease involves administering an immunogenic composition or a vaccine of the present invention to an animal after clinical appearance of the disease.
As used herein, unless otherwise noted, the term “clinically proven” (used independently or to modify the terms “safe” and/or “effective”) shall mean that it has been proven by a clinical trial wherein the clinical trial has met the approval standards of U.S. Food and Drug Administration, EMA or a corresponding national regulatory agency. For example, proof may be provided by the Phase 2 or Phase 3 clinical trial(s) described in the examples provided herein.
The term “clinically proven safe”, as it relates to a dose, dosage regimen, treatment or method with a SARS-CoV-2 antigen (for example, a SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or a biosimilar thereof) refers to a favorable risk:benefit ratio with an acceptable frequency and/or acceptable severity of treatment-emergent adverse events (referred to as AEs or TEAEs) compared to the standard of care or to another comparator. An adverse event is an untoward medical occurrence in a patient administered a medicinal product. One index of safety is the National Cancer Institute (NCI) incidence of adverse events (AE) graded per Common Toxicity Criteria for Adverse Events CTCAE v4.03.
The terms “clinically proven efficacy” and “clinically proven effective” as used herein in the context of a dose, dosage regimen, treatment or method refer to the effectiveness of a particular dose, dosage or treatment regimen. Efficacy can be measured based on change in the course of the disease in response to an agent of the present invention. For example, a SARS-CoV-2 antigen (for example, a SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or a biosimilar thereof) is administered to a patient in an amount and for a time sufficient to induce at least one indicator of a protective immune response against infection by SARS-CoV-2. Various indicators that reflect a protective immune response may be assessed for determining whether the amount and time of the treatment is sufficient. Such indicators include, for example, clinically recognized indicators of protective immune response, such as but not limited to, humoral and cellular immune responses that target the SARS-CoV-2 spike antigen in the subject administered the immunogenic composition; neutralizing antibodies and immunoglobulin G (IgG) antibodies that are reactive with the SARS-CoV-2 spike antigen; and/or CD8+ and/or CD4+ T cell responses that are reactive to the SARS-CoV-2 spike antigen and produce interferon-gamma (IFN-γ), TNF-α and/or IL-2.
“Vector” as used herein means a nucleic acid sequence containing an origin of replication. A vector can be a viral vector, bacteriophage, bacterial artificial chromosome or yeast artificial chromosome. A vector can be a DNA or RNA vector. A vector can be a self-replicating extrachromosomal vector, and preferably, is a DNA plasmid.
For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
Nucleic Acid Molecules, Antigens, and Immunogenic Compositions
Provided herein are immunogenic compositions, such as vaccines, comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen, a fragment thereof, a variant thereof, or a combination thereof. Also provided herein are immunogenic compositions, such as vaccines, comprising a SARS-CoV-2 antigen, a fragment thereof, a variant thereof, or a combination thereof. According to some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; or pGX9501. The immunogenic compositions can be used to protect against and treat any number of strains of SARS-CoV-2, thereby treating, preventing, and/or protecting against SARS-CoV-2-based pathologies. The immunogenic compositions can significantly induce an immune response of a subject administered the immunogenic compositions, thereby protecting against and treating SARS-CoV-2 infection.
The immunogenic composition can be a DNA vaccine, a peptide vaccine, or a combination DNA and peptide vaccine. The DNA vaccine can include a nucleic acid molecule encoding the SARS-CoV-2 antigen. The nucleic acid molecule can be DNA, RNA, cDNA, a variant thereof, a fragment thereof, or a combination thereof. The nucleic acid molecule can also include additional sequences that encode linker, leader, or tag sequences that are linked to the nucleic acid molecule encoding the SARS-CoV-2 antigen by a peptide bond. According to some embodiments, the nucleic acid molecule comprises the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2, the nucleic acid sequence of SEQ ID NO: 2, or the nucleic acid sequence of SEQ ID NO: 3; or pGX9501. The peptide vaccine can include a SARS-CoV-2 antigenic peptide, a SARS-CoV-2 antigenic protein, a variant thereof, a fragment thereof, or a combination thereof. The combination DNA and peptide vaccine can include the above described nucleic acid molecule encoding the SARS-CoV-2 antigen and the SARS-CoV-2 antigenic peptide or protein, in which the SARS-CoV-2 antigenic peptide or protein and the encoded SARS-CoV-2 antigen have the same amino acid sequence.
The disclosed immunogenic compositions can elicit both humoral and cellular immune responses that target the SARS-CoV-2 antigen in the subject administered the immunogenic composition. The disclosed immunogenic compositions can elicit neutralizing antibodies and immunoglobulin G (IgG) antibodies that are reactive with the SARS-CoV-2 spike antigen. The immunogenic composition can also elicit CD8+ and CD4+ T cell responses that are reactive to the SARS-CoV-2 antigen and produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), and interleukin-2 (IL-2).
The immunogenic composition can induce a humoral immune response in the subject administered the immunogenic composition. The induced humoral immune response can be specific for the SARS-CoV-2 antigen. The induced humoral immune response can be reactive with the SARS-CoV-2 antigen. The humoral immune response can be induced in the subject administered the vaccine by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold. The humoral immune response can be induced in the subject administered the vaccine by at least about 1.5-fold, at least about 2.0-fold, at least about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least about 16.0-fold.
The humoral immune response induced by the immunogenic composition can include an increased level of neutralizing antibodies associated with the subject administered the immunogenic composition as compared to a subject not administered the immunogenic composition. The neutralizing antibodies can be specific for the SARS-CoV-2 antigen. The neutralizing antibodies can be reactive with the SARS-CoV-2 antigen. The neutralizing antibodies can provide protection against and/or treatment of SARS-CoV-2 infection and its associated pathologies in the subject administered the immunogenic composition.
The humoral immune response induced by the immunogenic composition can include an increased level of neutralizing antibodies associated with the subject administered the immunogenic composition as compared to baseline. The level of neutralizing antibodies can be increased in the subject administered the vaccine by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold. The humoral immune response can be induced in the subject administered the vaccine by at least about 1.5-fold, at least about 2.0-fold, at least about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least about 16.0-fold. The humoral immune response as measured by virus neutralization assay may be determined about 6 weeks after initial administration of the immunogenic composition.
The humoral immune response induced by the immunogenic composition can include an increased level of IgG antibodies associated with the subject administered the immunogenic composition as compared to a subject not administered the immunogenic composition. These IgG antibodies can be specific for the SARS-CoV-2 antigen. These IgG antibodies can be reactive with the SARS-CoV-2 antigen. The level of IgG antibody associated with the subject administered the immunogenic composition can be increased by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold as compared to the subject not administered the immunogenic composition. The level of IgG antibody associated with the subject administered the immunogenic composition can be increased by at least about 1.5-fold, at least about 2.0-fold, at least about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least about 16.0-fold as compared to the subject not administered the immunogenic composition.
The immunogenic composition can induce a cellular immune response in the subject administered the immunogenic composition. The induced cellular immune response can be specific for the SARS-CoV-2 antigen. The induced cellular immune response can be reactive to the SARS-CoV-2 antigen.
The induced cellular immune response can include an increase in antigen-specific cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay relative to baseline. The cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay associated with the subject administered the immunogenic composition can be increased relative to baseline by at least about 1.5-fold, at least about 2.0-fold, at least about 3.0-fold, at least about 4.0-fold, at least about 5.0-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 16.0-fold, at least about 17.0-fold, at least about 18.0-fold, at least about 19.0-fold, at least about 20.0-fold, at least about 21.0-fold, at least about 22.0-fold, at least about 23.0-fold, at least about 24.0-fold, at least about 25.0-fold, at least about 26.0-fold, at least about 27.0-fold, at least about 28.0-fold, at least about 29.0-fold, or at least about 30.0-fold. The cellular immune response as measured by Interferon-gamma (IFN-γ) Enzyme-linked Immunospot (ELISpot) assay may be determined about 6 weeks after initial administration of the immunogenic composition.
The induced cellular immune response can include eliciting a CD8+ T cell response. The elicited CD8+ T cell response can be reactive with the SARS-CoV-2 antigen. The elicited CD8+ T cell response can be polyfunctional. The induced cellular immune response can include eliciting a CD8+ T cell response, in which the CD8+ T cells produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin-2 (IL-2), or a combination of IFN-γ and TNF-α.
The induced cellular immune response can include an increased CD8+ T cell response associated with the subject administered the immunogenic composition as compared to the subject not administered the immunogenic composition. The CD8+ T cell response associated with the subject administered the immunogenic composition can be increased by about 2-fold to about 30-fold, about 3-fold to about 25-fold, or about 4-fold to about 20-fold as compared to the subject not administered the immunogenic composition. The CD8+ T cell response associated with the subject administered the immunogenic composition can be increased by at least about 1.5-fold, at least about 2.0-fold, at least about 3.0-fold, at least about 4.0-fold, at least about 5.0-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 16.0-fold, at least about 17.0-fold, at least about 18.0-fold, at least about 19.0-fold, at least about 20.0-fold, at least about 21.0-fold, at least about 22.0-fold, at least about 23.0-fold, at least about 24.0-fold, at least about 25.0-fold, at least about 26.0-fold, at least about 27.0-fold, at least about 28.0-fold, at least about 29.0-fold, or at least about 30.0-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce IFN-γ. The frequency of CD3+CD8+IFN-γ+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce TNF-α. The frequency of CD3+CD8+TNF-α+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, or 14-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce IL-2. The frequency of CD3+CD8+IL-2+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 0.5-fold, 1.0-fold, 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, or 5.0-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce both IFN-γ and TNF-α. The frequency of CD3+CD8+IFN-γ+TNF-α+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100-fold, 110-fold, 120-fold, 130-fold, 140-fold, 150-fold, 160-fold, 170-fold, or 180-fold as compared to the subject not administered the immunogenic composition.
The cellular immune response induced by the immunogenic composition can include eliciting a CD4+ T cell response. The elicited CD4+ T cell response can be reactive with the SARS-CoV-2 antigen. The elicited CD4+ T cell response can be polyfunctional. The induced cellular immune response can include eliciting a CD4+ T cell response, in which the CD4+ T cells produce IFN-γ, TNF-α, IL-2, or a combination of IFN-γ and TNF-α.
The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells that produce IFN-γ. The frequency of CD3+CD4+IFN-γ+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells that produce TNF-α. The frequency of CD3+CD4+TNF-α+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, or 22-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells that produce IL-2. The frequency of CD3+CD4+IL-2+ T cells associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 45-fold, 50-fold, 55-fold, or 60-fold as compared to the subject not administered the immunogenic composition.
The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells that produce both IFN-γ and TNF-α. The frequency of CD3+CD4+IFN-γ+TNF-α+ associated with the subject administered the immunogenic composition can be increased by at least about 2-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, 5.0-fold, 5.5-fold, 6.0-fold, 6.5-fold, 7.0-fold, 7.5-fold, 8.0-fold, 8.5-fold, 9.0-fold, 9.5-fold, 10.0-fold, 10.5-fold, 11.0-fold, 11.5-fold, 12.0-fold, 12.5-fold, 13.0-fold, 13.5-fold, 14.0-fold, 14.5-fold, 15.0-fold, 15.5-fold, 16.0-fold, 16.5-fold, 17.0-fold, 17.5-fold, 18.0-fold, 18.5-fold, 19.0-fold, 19.5-fold, 20.0-fold, 21-fold, 22-fold, 23-fold 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, or 35-fold as compared to the subject not administered the immunogenic composition.
The immunogenic composition of the present invention can have features required of effective immunogenic compositions such as being safe so the immunogenic composition itself does not cause illness or death; is protective against illness resulting from exposure to live pathogens such as viruses or bacteria; induces neutralizing antibody to prevent invention of cells; induces protective T cells against intracellular pathogens; and provides ease of administration, few side effects, biological stability, and low cost per dose.
The immunogenic composition can further induce an immune response when administered to different tissues such as the muscle or skin. The immunogenic composition can further induce an immune response when administered via electroporation, or injection, or subcutaneously, or intramuscularly.
a. SARS-CoV-2 Antigen and Nucleic Acid Molecules Encoding the Same
As described above, provided herein are immunogenic compositions comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen, a fragment thereof, a variant thereof, or a combination thereof. Also provided herein are immunogenic compositions comprising a SARS-CoV-2 antigen, a fragment thereof, a variant thereof, or a combination thereof.
Upon binding cell surface proteins and membrane fusion, the coronavirus enters the cell and its singled-stranded RNA genome is released into the cytoplasm of the infected cell. The singled-stranded RNA genome is a positive strand and thus, can be translated into a RNA polymerase, which produces additional viral RNAs that are minus strands. Accordingly, the SARS-CoV-2 antigen can also be a SARS-CoV-2 RNA polymerase.
The viral minus RNA strands are transcribed into smaller, subgenomic positive RNA strands, which are used to translate other viral proteins, for example, nucleocapsid (N) protein, envelope (E) protein, and matrix (M) protein. Accordingly, the SARS-CoV-2 antigen can comprise a SARS-CoV-2 nucleocapsid protein, a SARS-CoV-2 envelope protein, a SARS-CoV-2 matrix protein, or a fragment of the 51 subunit comprising the SARS-CoV-2 Spike Receptor Binding Domain (RBD).
The viral minus RNA strands can also be used to replicate the viral genome, which is bound by nucleocapsid protein. Matrix protein, along with spike protein, is integrated into the endoplasmic reticulum of the infected cell. Together, the nucleocapsid protein bound to the viral genome and the membrane-embedded matrix and spike proteins are budded into the lumen of the endoplasmic reticulum, thereby encasing the viral genome in a membrane. The viral progeny are then transported by golgi vesicles to the cell membrane of the infected cell and released into the extracellular space by endocytosis.
Coronaviruses, including SARS-CoV-2, are encapsulated by a membrane and have a type 1 membrane glycoprotein known as spike (S) protein, which forms protruding spikes on the surface of the coronavirus. The SARS-CoV-2 S protein is a class I membrane fusion protein, which is the major envelope protein on the surface of coronaviruses. The spike protein facilitates binding of the coronavirus to proteins located on the surface of a cell, for example, the metalloprotease amino peptidase N, and mediates cell-viral membrane fusion. In particular, the spike protein contains an S1 subunit that facilitates binding of the coronavirus to cell surface proteins. Accordingly, the S1 subunit of the spike protein controls which cells are infected by the coronavirus. The spike protein also contains a S2 subunit, which is a transmembrane subunit that facilitates viral and cellular membrane fusion. Accordingly, the SARS-CoV-2 antigen can comprise a SARS-CoV-2 spike protein, a S1 subunit of a SARS-CoV-2 spike protein, or a S2 subunit of a SARS-CoV-2 spike protein.
In some embodiments, the SARS-CoV-2 antigen can be a SARS-CoV-2 spike protein, a SARS-CoV-2 RNA polymerase, a SARS-CoV-2 nucleocapsid protein, a SARS-CoV-2 envelope protein, a SARS-CoV-2 matrix protein, a fragment thereof, a variant thereof, or a combination thereof.
The SARS-CoV-2 antigen can be a SARS-CoV-2 spike antigen, a fragment thereof, a variant thereof, or a combination thereof. The SARS-CoV-2 spike antigen is capable of eliciting an immune response in a mammal against one or more SARS-CoV-2 strains. The SARS-CoV-2 spike antigen can comprise an epitope(s) that makes it particularly effective as an immunogen against which an anti-SARS-CoV-2 immune response can be induced.
The SARS-CoV-2 antigen can be a consensus antigen derived from two or more strains of SARS-CoV-2. In some embodiments, the SARS-CoV-2 antigen is a SARS-CoV-2 consensus spike antigen. The SARS-CoV-2 consensus spike antigen can be derived from the sequences of spike antigens from strains of SARS-CoV-2, and thus, the SARS-CoV-2 consensus spike antigen is unique. In some embodiments, the SARS-CoV-2 consensus spike antigen can be an outlier spike antigen, having a greater amino acid sequence divergence from other SARS-CoV-2 spike proteins. Accordingly, the immunogenic compositions of the present invention are widely applicable to multiple strains of SARS-CoV-2 because of the unique sequences of the SARS-CoV-2 consensus spike antigen. These unique sequences allow the vaccine to be universally protective against multiple strains of SARS-CoV-2, including genetically diverse variants of SARS-CoV-2. Nucleic acid molecules encoding the SARS-CoV-2 antigen can be modified for improved expression. Modification can include codon optimization, RNA optimization, addition of a kozak sequence for increased translation initiation, and/or the addition of an immunoglobulin leader sequence to increase the immunogenicity of the SARS-CoV-2 antigen. The SARS-CoV-2 spike antigen can comprise a signal peptide such as an immunoglobulin signal peptide, for example, but not limited to, an immunoglobulin E (IgE) or immunoglobulin (IgG) signal peptide. In some embodiments, the SARS-CoV-2 spike antigen can comprise a hemagglutinin (HA) tag. The SARS-CoV-2 spike antigen can be designed to elicit stronger and broader cellular and/or humoral immune responses than a corresponding codon optimized spike antigen.
In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of residues 19 to 1279 of SEQ ID NO: 1. In some embodiments the SARS-CoV-2 antigen comprises the amino acid sequence set forth in residues 19 to 1279 of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of SEQ ID NO: 1. In some embodiments the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments the nucleic acid molecule encoding the SARS-CoV-2 antigen comprises the nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence set forth in nucleotides 55 to 3837 of SEQ ID NO:2, SEQ ID NO: 2, or SEQ ID NO: 3.
In some embodiments the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of residues 19 to 1279 of SEQ ID NO: 4 or over an entire length of SEQ ID NO: 4. In some embodiments the SARS-CoV-2 antigen comprises the amino acid sequence set forth in residues 19 to 1279 of SEQ ID NO: 4. In some embodiments the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments the nucleic acid molecule encoding the SARS-CoV-2 antigen comprises: a nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of nucleotides 55 to 3837 of SEQ ID NO: 5 or over an entire length of SEQ ID NO: 5; the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 5; the nucleic acid sequence of SEQ ID NO: 5; a nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of SEQ ID NO: 6; or the nucleic acid sequence of SEQ ID NO: 6.
In some embodiments the SARS-CoV-2 antigen is operably linked to an IgE leader sequence. In some such embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen is encoded by the nucleotide sequence set forth in SEQ ID NO:2 or SEQ ID NO: 3. In some embodiments in which the SARS-CoV-2 antigen includes an IgE leader, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in SEQ ID NO: 4. In some such embodiments, the SARS-CoV-2 antigen is encoded by the nucleotide sequence set forth in SEQ ID NO:5 or SEQ ID NO: 6.
Immunogenic fragments of SEQ ID NO:1 can be provided. Immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO:1. In some embodiments, immunogenic fragments include a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, immunogenic fragments are free of a leader sequence.
Immunogenic fragments of proteins with amino acid sequences homologous to immunogenic fragments of SEQ ID NO:1 can be provided. Such immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of proteins that are 95% homologous to SEQ ID NO:1. Some embodiments relate to immunogenic fragments that have 96% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 97% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 98% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 99% homology to the immunogenic fragments of consensus protein sequences herein. In some embodiments, immunogenic fragments include a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, immunogenic fragments are free of a leader sequence.
Some embodiments relate to immunogenic fragments of SEQ ID NO:1. Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO:1. Immunogenic fragments can be at least 95%, at least 96%, at least 97% at least 98% or at least 99% homologous to fragments of SEQ ID NO:1. In some embodiments, immunogenic fragments include sequences that encode a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, fragments are free of coding sequences that encode a leader sequence.
Immunogenic fragments of SEQ ID NO:4 can be provided. Immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO:4. In some embodiments, immunogenic fragments include a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, immunogenic fragments are free of a leader sequence.
Immunogenic fragments of proteins with amino acid sequences homologous to immunogenic fragments of SEQ ID NO:4 can be provided. Such immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of proteins that are 95% homologous to SEQ ID NO:4. Some embodiments relate to immunogenic fragments that have 96% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 97% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 98% homology to the immunogenic fragments of consensus protein sequences herein. Some embodiments relate to immunogenic fragments that have 99% homology to the immunogenic fragments of consensus protein sequences herein. In some embodiments, immunogenic fragments include a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, immunogenic fragments are free of a leader sequence.
Some embodiments relate to immunogenic fragments of SEQ ID NO:4. Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO:4. Immunogenic fragments can be at least 95%, at least 96%, at least 97% at least 98% or at least 99% homologous to fragments of SEQ ID NO:4. In some embodiments, immunogenic fragments include sequences that encode a leader sequence, such as for example an immunoglobulin leader, such as the IgE leader. In some embodiments, fragments are free of coding sequences that encode a leader sequence.
b. Vector
The immunogenic compositions can comprise one or more vectors that include a nucleic acid molecule encoding the SARS-CoV-2 antigen. The one or more vectors can be capable of expressing the antigen. The vector can have a nucleic acid sequence containing an origin of replication. The vector can be a plasmid, bacteriophage, bacterial artificial chromosome or yeast artificial chromosome. The vector can be either a self-replicating extrachromosomal vector or a vector which integrates into a host genome.
The one or more vectors can be an expression construct, which is generally a plasmid that is used to introduce a specific gene into a target cell. Once the expression vector is inside the cell, the protein that is encoded by the gene is produced by the cellular-transcription and translation machinery ribosomal complexes. The plasmid is frequently engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The vectors of the present invention express large amounts of stable messenger RNA, and therefore proteins.
The vectors may have expression signals such as a strong promoter, a strong termination codon, adjustment of the distance between the promoter and the cloned gene, and the insertion of a transcription termination sequence and a PTIS (portable translation initiation sequence).
(1) Expression Vectors
The vector can be a circular plasmid or a linear nucleic acid. The circular plasmid and linear nucleic acid are capable of directing expression of a particular nucleotide sequence in an appropriate subject cell. The vector can have a promoter operably linked to the antigen-encoding nucleotide sequence, which may be operably linked to termination signals. The vector can also contain sequences required for proper translation of the nucleotide sequence. The vector comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter, which initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or stage of development.
(2) Circular and Linear Vectors
The vector may be a circular plasmid, which may transform a target cell by integration into the cellular genome or exist extrachromosomally (e.g., autonomous replicating plasmid with an origin of replication).
The vector can be pVAX, pcDNA3.0, pGX-0001, or provax, or any other expression vector capable of expressing DNA encoding the antigen and enabling a cell to translate the sequence to an antigen that is recognized by the immune system.
Also provided herein is a linear nucleic acid immunogenic composition, or linear expression cassette (“LEC”), that is capable of being efficiently delivered to a subject via electroporation and expressing one or more desired antigens. The LEC may be any linear DNA devoid of any phosphate backbone. The DNA may encode one or more antigens. The LEC may contain a promoter, an intron, a stop codon, and/or a polyadenylation signal. The expression of the antigen may be controlled by the promoter. The LEC may not contain any antibiotic resistance genes and/or a phosphate backbone. The LEC may not contain other nucleic acid sequences unrelated to the desired antigen gene expression.
The LEC may be derived from any plasmid capable of being linearized. The plasmid may be capable of expressing the antigen. The plasmid can be pNP (Puerto Rico/34) or pM2 (New Caledonia/99). The plasmid may be WLV009, pVAX, pcDNA3.0, or provax, or any other expression vector capable of expressing DNA encoding the antigen and enabling a cell to translate the sequence to an antigen that is recognized by the immune system.
The LEC can be perM2. The LEC can be perNP. perNP and perMR can be derived from pNP (Puerto Rico/34) and pM2 (New Caledonia/99), respectively.
(3) Promoter, Intron, Stop Codon, and Polyadenylation Signal
The vector may have a promoter. A promoter may be any promoter that is capable of driving gene expression and regulating expression of the isolated nucleic acid. Such a promoter is a cis-acting sequence element required for transcription via a DNA dependent RNA polymerase, which transcribes the antigen sequence described herein. Selection of the promoter used to direct expression of a heterologous nucleic acid depends on the particular application. The promoter may be positioned about the same distance from the transcription start in the vector as it is from the transcription start site in its natural setting. However, variation in this distance may be accommodated without loss of promoter function.
The promoter may be operably linked to the nucleic acid sequence encoding the antigen and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. The promoter may be a CMV promoter, SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or another promoter shown effective for expression in eukaryotic cells.
The vector may include an enhancer and an intron with functional splice donor and acceptor sites. The vector may contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
c. Excipients and Other Components of the Immunogenic Compositions
The immunogenic compositions may further comprise a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient can be functional molecules such as vehicles, carriers, buffers, or diluents. As used herein. “buffer” refers to a buffered solution that resists changes in pH by the action of its acid-base conjugate components. The buffer generally has a pH from about 4.0 to about 8.0, for example from about 5.0 to about 7.0. In some embodiments, the buffer is saline-sodium citrate (SSC) buffer. In some embodiments in which the immunogenic composition comprises a nucleic acid molecule encoding a SARS-CoV-2 spike antigen as described above, the immunogenic composition comprises 10 mg/ml of vector in buffer, for example but not limited to SSC buffer. In some embodiments, the immunogenic composition comprises 10 mg/mL of the DNA plasmid pGX9501 or pGX9503 in buffer. In some embodiments, the immunogenic composition is stored at about 2° C. to about 8° C. In some embodiments, the immunogenic composition is stored at room temperature. The immunogenic composition may be stored for at least a year at room temperature. In some embodiments, the immunogenic composition is stable at room temperature for at least a year, wherein stability is defined as a supercoiled plasmid percentage of at least about 80%. In some embodiments, the supercoiled plasmid percentage is at least about 85% following storage for at least a year at room temperature.
The pharmaceutically acceptable excipient can be a transfection facilitating agent, which can include surface active agents, such as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents.
The transfection facilitating agent may be a polyanion, polycation, including poly-L-glutamate (LGS), or lipid. The transfection facilitating agent is poly-L-glutamate, and the poly-L-glutamate may be present in the immunogenic composition at a concentration less than 6 mg/ml. The transfection facilitating agent may also include surface active agents such as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs and vesicles such as squalene and squalene, and hyaluronic acid may also be used administered in conjunction with the genetic construct. The DNA plasmid immunogenic compositions may also include a transfection facilitating agent such as lipids, liposomes, including lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture (see for example WO9324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents. The transfection facilitating agent is a polyanion, polycation, including poly-L-glutamate (LGS), or lipid. Concentration of the transfection agent in the immunogenic composition is less than 4 mg/ml, less than 2 mg/ml, less than 1 mg/ml, less than 0.750 mg/ml, less than 0.500 mg/ml, less than 0.250 mg/ml, less than 0.100 mg/ml, less than 0.050 mg/ml, or less than 0.010 mg/ml.
The pharmaceutically acceptable excipient can be an adjuvant. The adjuvant can be other genes that are expressed in an alternative plasmid or are delivered as proteins in combination with the plasmid above in the immunogenic composition. The adjuvant may be selected from the group consisting of: α-interferon (IFN-α), β-interferon (IFN-β), γ-interferon, platelet derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), cutaneous T cell-attracting chemokine (CTACK), epithelial thymus-expressed chemokine (TECK), mucosae-associated epithelial chemokine (MEC), IL-12, IL-15, MHC, CD80, CD86 including IL-15 having the signal sequence deleted and optionally including the signal peptide from IgE. The adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK, platelet derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof.
Other genes that can be useful as adjuvants include those encoding: MCP-1, MIP-la, MIP-1p, IL-8, RANTES, L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1, MadCAM-1, LFA-1, VLA-1, Mac-1, p150.95, PECAM, ICAM-1, ICAM-2, ICAM-3, CD2, LFA-3, M-CSF, G-CSF, IL-4, mutant forms of IL-18, CD40, CD40L, vascular growth factor, fibroblast growth factor, IL-7, IL-22, nerve growth factor, vascular endothelial growth factor, Fas, TNF receptor, Flt, Apo-1, p55, WSL-1, DR3, TRAMP, Apo-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, DR6, Caspase ICE, Fos, c-jun, Sp-1, Ap-1, Ap-2, p38, p65Rel, MyD88, IRAK, TRAF6, IkB, Inactive NIK, SAP K, SAP-1, JNK, interferon response genes, NFkB, Bax, TRAIL, TRAILrec, TRAILrecDRC5, TRAIL-R3, TRAIL-R4, RANK, RANK LIGAND, Ox40, Ox40 LIGAND, NKG2D, MICA, MICB, NKG2A, NKG2B, NKG2C, NKG2E, NKG2F, TAP1, TAP2 and functional fragments thereof.
The immunogenic composition may further comprise a genetic vaccine facilitator agent as described in U.S. Ser. No. 021,579 filed Apr. 1, 1994, which is fully incorporated by reference.
The immunogenic composition can be formulated according to the mode of administration to be used. According to some embodiments, the immunogenic composition is formulated in a buffer, optionally saline-sodium citrate buffer. For example, the immunogenic composition may formulated at a concentration of 10 mg nucleic acid molecule per milliliter of a sodium salt citrate buffer. An injectable immunogenic pharmaceutical composition can be sterile, pyrogen free and particulate free. An isotonic formulation or solution can be used. Additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol, and lactose. The immunogenic composition can comprise a vasoconstriction agent. The isotonic solutions can include phosphate buffered saline. Immunogenic compositions can further comprise stabilizers including gelatin and albumin. The stabilizers can allow the formulation to be stable at room or ambient temperature for extended periods of time, including LGS or polycations or polyanions.
Also provided herein are articles of manufacture comprising the immunogenic composition. In some embodiments, the article of manufacture is a container holding the immunogenic composition. The container may be, for example but not limited to, a syringe or a vial. The vial may have a stopper piercable by a syringe.
The immunogenic composition can be packaged in suitably sterilized containers such as ampules, bottles, or vials, either in multi-dose or in unit dosage forms. The containers are preferably hermetically sealed after being filled with a vaccine preparation. Preferably, the vaccines are packaged in a container having a label affixed thereto, which label identifies the vaccine, and bears a notice in a form prescribed by a government agency such as the United States Food and Drug Administration reflecting approval of the vaccine under appropriate laws, dosage information, and the like. The label preferably contains information about the vaccine that is useful to a health care professional administering the vaccine to a patient. The package also preferably contains printed informational materials relating to the administration of the vaccine, instructions, indications, and any necessary required warnings.
Methods of Vaccination
Also provided herein are methods of treating, protecting against, and/or preventing disease in a subject in need thereof by administering the immunogenic composition to the subject. Administration of the immunogenic composition to the subject can induce or elicit an immune response in the subject. The induced immune response can be used to treat, prevent, and/or protect against disease, for example, pathologies relating to SARS-CoV-2 infection. The induced immune response in the subject administered the immunogenic composition can provide resistance to one or more SARS-CoV-2 strains.
The induced immune response can include an induced humoral immune response and/or an induced cellular immune response. The humoral immune response can be induced by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold. The induced humoral immune response can include IgG antibodies and/or neutralizing antibodies that are reactive to the antigen. The induced cellular immune response can include a CD8+ T cell response, which is induced by about 2-fold to about 30-fold, about 3-fold to about 25-fold, or about 4-fold to about 20-fold.
The vaccine dose can be between 1 μg to 10 mg active component/kg body weight/time, and can be 20 μg to 10 mg component/kg body weight/time. The vaccine can be administered every 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more days or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more weeks. The number of vaccine doses for effective treatment can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.
In one embodiment, the total vaccine dose is 1.0 mg of nucleic acid. In one embodiment, the total vaccine dose is 2.0 mg of nucleic acid, administered as 2×1.0 mg nucleic acid.
a. Administration
The immunogenic composition can be formulated in accordance with standard techniques well known to those skilled in the pharmaceutical art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration. The vaccine may be administered, for example, in one, two, three, four, or more injections. In some embodiments, an initial dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule is administered to the subject. The initial dose may be administered in one, two, three, or more injections. The initial dose may be followed by administration of one, two, three, four, or more subsequent doses of about 0.5 mg to about 2.0 mg of the nucleic acid molecule about one, two, three, four, five, six, seven, eight, ten, twelve or more weeks after the immediately prior dose. Each subsequent dose may be administered in one, two, three, or more injections. In some embodiments, the immunogenic composition is administered to the subject before, with, or after the additional agent. In some embodiments, the immunogenic composition is administered as a booster following administration of an agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the disease or disorder associated with SARS-CoV-2 infection includes, but is not limited to, Coronavirus Disease 2019 (COVID-19) and/or Multisystem inflammatory syndrome in adults (MIS-A) or Multisystem inflammatory syndrome in children (MIS-C).
The subject can be a mammal, such as a human, a horse, a nonhuman primate, a cow, a pig, a sheep, a cat, a dog, a guinea pig, a rabbit, a rat, or a mouse.
The vaccine can be administered prophylactically or therapeutically. In prophylactic administration, the vaccines can be administered in an amount sufficient to induce an immune response. In therapeutic applications, the vaccines are administered to a subject in need thereof in an amount sufficient to elicit a therapeutic effect. An amount adequate to accomplish this is defined as “therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition of the vaccine regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the patient, and the judgment of the prescribing physician.
The vaccine can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)); Felgner et al. (U.S. Pat. No. 5,580,859, issued Dec. 3, 1996); Felgner (U.S. Pat. No. 5,703,055, issued Dec. 30, 1997); and Carson et al. (U.S. Pat. No. 5,679,647, issued Oct. 21, 1997), the contents of all of which are incorporated herein by reference in their entirety. The DNA of the vaccine can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the expression vector.
The vaccine can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous delivery, optionally followed by electroporation as described herein. Other routes include oral administration, intranasal, and intravaginal routes. For the DNA of the vaccine in particular, the vaccine can be delivered to the interstitial spaces of tissues of an individual (Feigner et al., U.S. Pat. Nos. 5,580,859 and 5,703,055, the contents of all of which are incorporated herein by reference in their entirety). The vaccine can also be administered to muscle, or can be administered via intradermal or subcutaneous injections, or transdermally, such as by iontophoresis. Epidermal administration of the vaccine can also be employed. Epidermal administration can involve mechanically or chemically irritating the outermost layer of epidermis to stimulate an immune response to the irritant (Carson et al., U.S. Pat. No. 5,679,647, the contents of which are incorporated herein by reference in its entirety).
The vaccine can also be formulated for administration via the nasal passages. Formulations suitable for nasal administration, wherein the carrier is a solid, can include a coarse powder having a particle size, for example, in the range of about 10 to about 500 microns which is administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. The formulation can be a nasal spray, nasal drops, or by aerosol administration by nebulizer. The formulation can include aqueous or oily solutions of the vaccine.
The vaccine can be a liquid preparation such as a suspension, syrup or elixir. The vaccine can also be a preparation for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as a sterile suspension or emulsion.
The vaccine can be incorporated into liposomes, microspheres or other polymer matrices (Feigner et al., U.S. Pat. No. 5,703,055; Gregoriadis, Liposome Technology, Vols. I to III (2nd ed. 1993), the contents of which are incorporated herein by reference in their entirety). Liposomes can consist of phospholipids or other lipids, and can be nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.
The vaccine can be administered via electroporation, such as by a method described in U.S. Pat. No. 7,664,545, the contents of which are incorporated herein by reference. The electroporation can be by a method and/or apparatus described in U.S. Pat. Nos. 6,302,874; 5,676,646; 6,241,701; 6,233,482; 6,216,034; 6,208,893; 6,192,270; 6,181,964; 6,150,148; 6,120,493; 6,096,020; 6,068,650; and 5,702,359, the contents of which are incorporated herein by reference in their entirety. The electroporation may be carried out via a minimally invasive device.
The minimally invasive electroporation device (“MID”) may be an apparatus for injecting the vaccine described above and associated fluid into body tissue. The device may comprise a hollow needle, DNA cassette, and fluid delivery means, wherein the device is adapted to actuate the fluid delivery means in use so as to concurrently (for example, automatically) inject DNA into body tissue during insertion of the needle into the said body tissue. This has the advantage that the ability to inject the DNA and associated fluid gradually while the needle is being inserted leads to a more even distribution of the fluid through the body tissue. The pain experienced during injection may be reduced due to the distribution of the DNA being injected over a larger area.
The MID may inject the vaccine into tissue without the use of a needle. The MID may inject the vaccine as a small stream or jet with such force that the vaccine pierces the surface of the tissue and enters the underlying tissue and/or muscle. The force behind the small stream or jet may be provided by expansion of a compressed gas, such as carbon dioxide through a micro-orifice within a fraction of a second. Examples of minimally invasive electroporation devices, and methods of using them, are described in published U.S. Patent Application No. 20080234655; U.S. Pat. Nos. 6,520,950; 7,171,264; 6,208,893; 6,009,347; 6,120,493; 7,245,963; 7,328,064; and 6,763,264, the contents of each of which are herein incorporated by reference.
The MID may comprise an injector that creates a high-speed jet of liquid that painlessly pierces the tissue. Such needle-free injectors are commercially available. Examples of needle-free injectors that can be utilized herein include those described in U.S. Pat. Nos. 3,805,783; 4,447,223; 5,505,697; and 4,342,310, the contents of each of which are herein incorporated by reference.
A desired vaccine in a form suitable for direct or indirect electrotransport may be introduced (e.g., injected) using a needle-free injector into the tissue to be treated, usually by contacting the tissue surface with the injector so as to actuate delivery of a jet of the agent, with sufficient force to cause penetration of the vaccine into the tissue. For example, if the tissue to be treated is mucosa, skin or muscle, the agent is projected towards the mucosal or skin surface with sufficient force to cause the agent to penetrate through the stratum corneum and into dermal layers, or into underlying tissue and muscle, respectively.
Needle-free injectors are well suited to deliver vaccines to all types of tissues, particularly to skin and mucosa. In some embodiments, a needle-free injector may be used to propel a liquid that contains the vaccine to the surface and into the subject's skin or mucosa. Representative examples of the various types of tissues that can be treated using the invention methods include pancreas, larynx, nasopharynx, hypopharynx, oropharynx, lip, throat, lung, heart, kidney, muscle, breast, colon, prostate, thymus, testis, skin, mucosal tissue, ovary, blood vessels, or any combination thereof.
The MID may have needle electrodes that electroporate the tissue. By pulsing between multiple pairs of electrodes in a multiple electrode array, for example set up in rectangular or square patterns, provides improved results over that of pulsing between a pair of electrodes. Disclosed, for example, in U.S. Pat. No. 5,702,359 entitled “Needle Electrodes for Mediated Delivery of Drugs and Genes” is an array of needles wherein a plurality of pairs of needles may be pulsed during the therapeutic treatment. In that application, which is incorporated herein by reference as though fully set forth, needles were disposed in a circular array, but have connectors and switching apparatus enabling a pulsing between opposing pairs of needle electrodes. A pair of needle electrodes for delivering recombinant expression vectors to cells may be used. Such a device and system is described in U.S. Pat. No. 6,763,264, the contents of which are herein incorporated by reference. Alternatively, a single needle device may be used that allows injection of the DNA and electroporation with a single needle resembling a normal injection needle and applies pulses of lower voltage than those delivered by presently used devices, thus reducing the electrical sensation experienced by the patient.
The MID may comprise one or more electrode arrays. The arrays may comprise two or more needles of the same diameter or different diameters. The needles may be evenly or unevenly spaced apart. The needles may be between 0.005 inches and 0.03 inches, between 0.01 inches and 0.025 inches; or between 0.015 inches and 0.020 inches. The needle may be 0.0175 inches in diameter. The needles may be 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm, 4.0 mm, or more spaced apart.
The MID may consist of a pulse generator and a two or more-needle vaccine injectors that deliver the vaccine and electroporation pulses in a single step. The pulse generator may allow for flexible programming of pulse and injection parameters via a flash card operated personal computer, as well as comprehensive recording and storage of electroporation and patient data. The pulse generator may deliver a variety of volt pulses during short periods of time. For example, the pulse generator may deliver three 15 volt pulses of 100 ms in duration. An example of such a MID is the Elgen 1000 system by Inovio Biomedical Corporation, which is described in U.S. Pat. No. 7,328,064, the contents of which are herein incorporated by reference.
The MID may be a CELLECTRA® (Inovio Pharmaceuticals, Blue Bell Pa.) device and system, which is a modular electrode system, that facilitates the introduction of a macromolecule, such as a DNA, into cells of a selected tissue in a body or plant. The modular electrode system may comprise a plurality of needle electrodes; a hypodermic needle; an electrical connector that provides a conductive link from a programmable constant-current pulse controller to the plurality of needle electrodes; and a power source. An operator can grasp the plurality of needle electrodes that are mounted on a support structure and firmly insert them into the selected tissue in a body or plant. The macromolecules are then delivered via the hypodermic needle into the selected tissue. The programmable constant-current pulse controller is activated and constant-current electrical pulse is applied to the plurality of needle electrodes. The applied constant-current electrical pulse facilitates the introduction of the macromolecule into the cell between the plurality of electrodes. Cell death due to overheating of cells is minimized by limiting the power dissipation in the tissue by virtue of constant-current pulses. The Cellectra® device and system is described in U.S. Pat. No. 7,245,963, the contents of which are herein incorporated by reference. The CELLECTRA® device may be the CELLECTRA® 2000 device or CELLECTRA® 3PSP device. The CELLECTRA® 2000 device is configured by the manufacturer to support either ID (intradermal) or IM (intramuscular) administration. The CELLECTRA® 2000 includes the CELLECTRA® Pulse Generator, the appropriate applicator, disposable sterile array and disposable sheath (ID only). The DNA plasmid is delivered separately via needle and syringe injection in the area delineated by the electrodes immediately prior to the electroporation treatment.
The MID may be an Elgen 1000 system (Inovio Pharmaceuticals). The Elgen 1000 system may comprise device that provides a hollow needle; and fluid delivery means, wherein the apparatus is adapted to actuate the fluid delivery means in use so as to concurrently (for example automatically) inject fluid, the described vaccine herein, into body tissue during insertion of the needle into the said body tissue. The advantage is the ability to inject the fluid gradually while the needle is being inserted leads to a more even distribution of the fluid through the body tissue. It is also believed that the pain experienced during injection is reduced due to the distribution of the volume of fluid being injected over a larger area.
In addition, the automatic injection of fluid facilitates automatic monitoring and registration of an actual dose of fluid injected. This data can be stored by a control unit for documentation purposes if desired.
It will be appreciated that the rate of injection could be either linear or non-linear and that the injection may be carried out after the needles have been inserted through the skin of the subject to be treated and while they are inserted further into the body tissue.
Suitable tissues into which fluid may be injected by the apparatus of the present invention include tumor tissue, skin or liver tissue but may be muscle tissue.
The apparatus further comprises needle insertion means for guiding insertion of the needle into the body tissue. The rate of fluid injection is controlled by the rate of needle insertion. This has the advantage that both the needle insertion and injection of fluid can be controlled such that the rate of insertion can be matched to the rate of injection as desired. It also makes the apparatus easier for a user to operate. If desired means for automatically inserting the needle into body tissue could be provided.
A user could choose when to commence injection of fluid. Ideally however, injection is commenced when the tip of the needle has reached muscle tissue and the apparatus may include means for sensing when the needle has been inserted to a sufficient depth for injection of the fluid to commence. This means that injection of fluid can be prompted to commence automatically when the needle has reached a desired depth (which will normally be the depth at which muscle tissue begins). The depth at which muscle tissue begins could for example be taken to be a preset needle insertion depth such as a value of 4 mm which would be deemed sufficient for the needle to get through the skin layer.
The sensing means may comprise an ultrasound probe. The sensing means may comprise a means for sensing a change in impedance or resistance. In this case, the means may not as such record the depth of the needle in the body tissue but will rather be adapted to sense a change in impedance or resistance as the needle moves from a different type of body tissue into muscle. Either of these alternatives provides a relatively accurate and simple to operate means of sensing that injection may commence. The depth of insertion of the needle can further be recorded if desired and could be used to control injection of fluid such that the volume of fluid to be injected is determined as the depth of needle insertion is being recorded.
The apparatus may further comprise: a base for supporting the needle; and a housing for receiving the base therein, wherein the base is moveable relative to the housing such that the needle is retracted within the housing when the base is in a first rearward position relative to the housing and the needle extends out of the housing when the base is in a second forward position within the housing. This is advantageous for a user as the housing can be lined up on the skin of a patient, and the needles can then be inserted into the patient's skin by moving the housing relative to the base.
As stated above, it is desirable to achieve a controlled rate of fluid injection such that the fluid is evenly distributed over the length of the needle as it is inserted into the skin. The fluid delivery means may comprise piston driving means adapted to inject fluid at a controlled rate. The piston driving means could for example be activated by a servo motor. However, the piston driving means may be actuated by the base being moved in the axial direction relative to the housing. It will be appreciated that alternative means for fluid delivery could be provided. Thus, for example, a closed container which can be squeezed for fluid delivery at a controlled or non-controlled rate could be provided in the place of a syringe and piston system.
The apparatus described above could be used for any type of injection. It is however envisaged to be particularly useful in the field of electroporation and so it may further comprises means for applying a voltage to the needle. This allows the needle to be used not only for injection but also as an electrode during, electroporation. This is particularly advantageous as it means that the electric field is applied to the same area as the injected fluid. There has traditionally been a problem with electroporation in that it is very difficult to accurately align an electrode with previously injected fluid and so users have tended to inject a larger volume of fluid than is required over a larger area and to apply an electric field over a higher area to attempt to guarantee an overlap between the injected substance and the electric field. Using the present invention, both the volume of fluid injected and the size of electric field applied may be reduced while achieving a good fit between the electric field and the fluid.
Use in Combination
In some embodiments, the present invention provides a method of treating SARS-CoV-2 infection, or treating, protecting against, and/or preventing a disease or disorder associated with SARS-CoV-2 infection in a subject in need thereof by administering a combination of a nucleic acid molecule encoding a SARS-CoV-2 antigen, or fragment or variant thereof in combination with one or more additional agents for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection. In some embodiments, the disease or disorder associated with SARS-CoV-2 infection is Coronavirus Disease 2019 (COVID-19), Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C).
The nucleic acid molecule encoding a SARS-CoV-2 antigen and additional agent may be administered using any suitable method such that a combination of the nucleic acid molecule encoding a SARS-CoV-2 antigen and the additional agent are both present in the subject. In one embodiment, the method may comprise administration of a first composition comprising an agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection and administration of a second composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen less than 1, less than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less than 8, less than 9 or less than 10 days following administration of the first composition comprising the agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the method may comprise administration of a first composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen and administration of a second composition comprising an agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection less than 1, less than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less than 8, less than 9 or less than 10 days following administration of the nucleic acid molecule encoding a SARS-CoV-2 antigen. In one embodiment, the method may comprise administration of a first composition comprising an agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection and a second composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen concurrently. In one embodiment, the method may comprise administration of a single composition comprising an agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection and a nucleic acid molecule encoding a SARS-CoV-2 antigen.
In some embodiments, the agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of disease or disorder associated with SARS-CoV-2 infection is a therapeutic agent. In one embodiment, the therapeutic agent is an antiviral agent. In one embodiment, the therapeutic agent is an antibiotic agent.
Non-limiting examples of antibiotics that can be used in combination with the a nucleic acid molecule encoding a SARS-CoV-2 antigen of the invention include aminoglycosides (e.g., gentamicin, amikacin, tobramycin), quinolones (e.g., ciprofloxacin, levofloxacin), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone, cefpirome, ceftobiprole), antipseudomonal penicillins: carboxypenicillins (e.g., carbenicillin and ticarcillin) and ureidopenicillins (e.g., mezlocillin, azlocillin, and piperacillin), carbapenems (e.g., meropenem, imipenem, doripenem), polymyxins (e.g., polymyxin B and colistin) and monobactams (e.g., aztreonam).
Administration as a Booster
In one embodiment, the immunogenic composition is administered as a booster vaccine following administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including, but not limited to COVID-19, Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C). In one embodiment, the booster vaccine is administered at least once, at least twice, at least 3 times, at least 4 times, or at least 5 times following administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including, but not limited to COVID-19, Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C). In one embodiment, the booster vaccine is administered at least 8 hours, at least 12 hours, at least 16 hours, at least 20 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 4 days, at least 5 days, at least 6 days, at least 1 week at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year or greater than 1 year following administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including, but not limited to COVID-19, Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C).
Use in Assays
In some embodiments, the nucleic acid molecules, or encoded antigens, of the invention can be used in assays in vivo or in vitro. In some embodiments, the nucleic acid molecules, or encoded antigens can be used in assays for detecting the presence of anti-SARS-CoV-2 spike antibodies. Exemplary assays in which the nucleic acid molecules or encoded antigens can be incorporated into include, but are not limited to, Western blot, dot blot, surface plasmon resonance methods, Flow Cytometry methods, various immunoassays, for example, immunohistochemistry assays, immunocytochemistry assays, ELISA, capture ELISA, enzyme-linked immunospot (ELISpot) assays, sandwich assays, enzyme immunoassay, radioimmunoassay, fluorescent immunoassay, and the like, all of which are known to those of skill in the art. See e.g. Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.; Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.
In one embodiment, the SARS-CoV-2 spike antigen, or fragments thereof, of the invention can be used in an assay for intracellular cytokine staining combined with flow cytometry, to assess T-cell immune responses. This assay enables the simultaneous assessment of multiple phenotypic, differentiation and functional parameters pertaining to responding T-cells, most notably, the expression of multiple effector cytokines. These attributes make the technique particularly suitable for the assessment of T-cell immune responses induced by the vaccine of the invention.
In one embodiment, the SARS-CoV-2 spike antigen, or fragments thereof, of the invention can be used in an ELIspot assay. The ELISpot assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody in the presence or absence of stimuli. In one embodiment, the SARS-CoV-2 spike antigen, or fragments thereof, of the invention can be used as the stimulus in the ELISpot assay.
Diagnostic Methods
In some embodiments, the invention relates to methods of diagnosing a subject as having SARS-CoV-2 infection or having SARS-CoV-2 antibodies. In some embodiments, the methods include contacting a sample from a subject with a SARS-CoV-2 antigen of the invention, or a cell comprising a nucleic acid molecule for expression of the SARS-CoV-2 antigen, and detecting binding of an anti-SARS-CoV-2 spike antibody to the SARS-CoV-2 antigen of the invention. In such an embodiment, binding of an anti-SARS-CoV-2 spike antibody present in the sample of the subject to the antigen, or fragment thereof, of the invention would indicate that the subject is currently infected or was previously infected with SARS-CoV-2.
Kits and Articles of Manufacture
Provided herein is a kit, which can be used for treating a subject using the method of vaccination described above. The kit can comprise the immunogenic composition described herein.
The kit can also comprise instructions for carrying out the vaccination method described above and/or how to use the kit. Instructions included in the kit can be affixed to packaging material or can be included as a package insert. While instructions are typically written or printed materials, they are not limited to such. Any medium capable of storing instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” can include the address of an internet site which provides instructions.
Further provided herein are articles of manufacture containing the immunogenic composition described herein. In some embodiments, the article of manufacture is a container, such as a vial, optionally a single-use vial. In one embodiment, the article of manufacture is a single-use glass vial equipped with a stopper, which contains the immunogenic composition described herein to be administered. In some embodiments, the vial comprises a stopper, pierceable by a syringe, and a seal. In some embodiments, the article of manufacture is a syringe.
The present invention has multiple aspects, illustrated by the following non-limiting examples.
Materials & Methods:
Cell lines. Human embryonic kidney (HEK)-293T (ATCC® CRL-3216™) and African green monkey kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, Va.). All cell lines were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin.
In vitro protein expression (Western blot). Human embryonic kidney cells, 293T were cultured and transfected as described previously (Yan, et al. Enhanced cellular immune responses elicited by an engineered HIV-1 subtype B consensus-based envelope DNA vaccine. Mol Ther. 2007; 15(2):411-421.). 293T cells were transfected with pDNA using TurboFectin8.0 (OriGene) transfection reagent following the manufacturer's protocol. Forty-eight hours later, cell lysates were harvested using modified RIPA cell lysis buffer. Proteins were separated on a 4-12% BIS-TRIS gel (ThermoFisher Scientific). Following transfer, blots were incubated with an anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals), and then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (GE Amersham).
Immunofluorescence of transfected 293T cells. For in vitro staining of Spike protein expression, 293T cells were cultured on 4-well glass slides (Lab-Tek) and transfected with 3 μg/well of pDNA using TurboFectin8.0 (OriGene) transfection reagent following the manufacturer's protocol. Cells were fixed 48 hrs after transfection with 10% Neutral-buffered Formalin (BBC Biochemical, Washington State) for 10 min at room temperature (RT) and then washed with PBS. Before staining, chamber slides were blocked with 0.3% (v/v) Triton-X (Sigma), 2% (v/v) donkey serum in PBS for 1 hr at RT. Cells were stained with a rabbit anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) diluted in 1% (w/v) BSA (Sigma), 2% (v/v) donkey serum, 0.3% (v/v) Triton-X (Sigma) and 0.025% (v/v) lg/ml Sodium Azide (Sigma) in PBS for 2 hrs at RT. Slides were washed three times for 5 min in PBS and then stained with donkey anti-rabbit IgG AF488 (Life Technologies, A21206) for 1 hr at RT. Slides were washed again and mounted and covered with DAPI-Fluoromount (SouthernBiotech).
In vitro RNA expression (qRT-PCR). In vitro mRNA expression of the plasmid was demonstrated by transfection of COS-7 with serially diluted plasmids followed by analysis of the total RNA extracted from the cells using reverse transcription and PCR. Transfections of four concentrations of the plasmid were performed using FuGENE® 6 transfection reagent (Promega) which resulted in final masses ranging between 80 and 10 ng/well. The transfections were performed in duplicate. Following 18 to 26 hours of incubation, the cells were lysed with RLT Buffer (Qiagen). Total RNA was isolated from each well using the Qiagen RNeasy kit following the kit instructions. The resulting RNA concentration was determined by OD260/280, and samples of the RNA were diluted to 10 ng/4. One hundred nanograms of RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription (RT) kit (Applied Biosystems) following the kit instructions. RT reactions containing RNA but no reverse transcriptase (minus RT) were included as controls for plasmid DNA or cellular genomic DNA sample contamination. Eight μL of sample cDNA were then subjected to PCR using primers and probes that are specific to the target sequence (pGX9501 Forward—CAGGACAAGAACACACAGGAA (SEQ ID NO: 7); pGX9501 Reverse—CAGGCAGGATTTGGGAGAAA (SEQ ID NO: 8); pGX9501 Probe—ACCCATCAAGGACTTTGGAGG (SEQ ID NO: 9); and pGX9503 Forward—AGGACAAGAACACACAGGAAG (SEQ ID NO: 10); pGX9503 Reverse—CAGGATCTGGGAGAAGTTGAAG (SEQ ID NO: 11); pGX9503 Probe—ACACCACCCATCAAGGACTTTGGA (SEQ ID NO: 12)). In a separate reaction, the same quantity of sample cDNA was subjected to PCR using primers and a probe designed for COS-7 cell line β-actin sequences (β-actin Forward—GTGACGTGGACATCCGTAAA (SEQ ID NO: 13); β-actin Reverse—CAGGGCAGTAATCTCCTTCTG (SEQ ID NO: 14); β-actin Probe—TACCCTGGCATTGCTGACAGGATG (SEQ ID NO: 15)). The primers and probes were synthesized by Integrated DNA Technologies, Inc. and the probes were labeled with 56-FAM and Black Hole Quencher 1. The reaction used ABI Fast Advance 2× (Cat. No. 4444557), with final forward and reverse primer concentrations of 1 μM and probe concentrations of 0.3 μM. Using a QuantStudio™ 7 Flex Real Time PCR Studio System (Applied Biosystems), samples were first subjected to a hold of 1 minute at 95° C. and then 40 cycles of PCR with each cycle consisting of 1 second at 95° C. and 20 seconds at 60° C. Following PCR, the amplifications results were analyzed as follows. The negative transfection controls (NTCs), the minus RT controls, and the NTC were scrutinized for each of their respective indications. The threshold cycle (CT) of each transfection concentration for the INO-4800 SARS-CoV-2 target mRNA and for the β-actin mRNA was generated from the QuantStudio™ software using an automatic threshold setting. The plasmid was considered to be active for mRNA expression if the expression in any of the plasmid-transfected wells compared to the negative transfection controls were greater than 5 CT. Animals. Female, 6 week old C57/BL6 and BALB/c mice were purchased from Charles River Laboratories (Malvern, Pa.) and The Jackson Laboratory (Bar Harbor, Me.). Female, 8 week old Hartley guinea pigs were purchased from Elm Hill Labs (Chelmsford, Mass.). All animals were housed in the animal facility at The Wistar Institute Animal Facility or Acculab Life Sciences (San Diego, Calif.). All animal testing and research complied with all relevant ethical regulations and studies received ethical approval by the Wistar Institute or Acculab Institutional Animal Care and Use Committees (IACUC). For mouse studies, on day 0, doses of 2.5, 10 or 25 μg pDNA were administered to the tibialis anterior (TA) muscle by needle injection followed by CELLECTRA® in vivo electroporation (EP). The CELLECTRA® EP delivery consists of two sets of pulses with 0.2 Amp constant current. Second pulse sets is delayed 3 seconds. Within each set there are two 52 ms pulses with a 198 ms delay between the pulses. On days 0 and 14, blood was collected. Parallel groups of mice were serially sacrificed on days 4, 7, and 10 post-immunization for analysis of cellular immune responses. For guinea pig studies, on day 0, 100 μg pDNA was administered to the skin by Mantoux injection followed by CELLECTRA® in vivo EP.
Antigen binding ELISA. ELISAs were performed to determine sera antibody binding titers. Nunc ELISA plates were coated with 1 μg/ml recombinant protein antigens in Dulbecco's phosphate-buffered saline (DPBS) overnight at 4° C. Plates were washed three times, then blocked with 3% bovine serum albumin (BSA) in DPBS with 0.05% Tween 20 for 2 hours at 37° C. Plates were then washed and incubated with serial dilutions of mouse or guinea pig sera and incubated for 2 hours at 37° C. Plates were again washed and then incubated with 1:10,000 dilution of horse radish peroxidase (HRP)-conjugated anti-guinea pig IgG secondary antibody (Sigma-Aldrich, cat. A7289) or HRP-conjugated anti-mouse IgG secondary antibody (Sigma-Aldrich) and incubated for 1 hour at RT. After final wash, plates were developed using SureBlue™ TMB 1-Component Peroxidase Substrate (KPL, cat. 52-00-03), and the reaction stopped with TMB Stop Solution (KPL, cat. 50-85-06). Plates were read at 450 nm wavelength within 30 minutes using a Synergy™ HTX plate reader (BioTek Instruments, Highland Park, Vt.). Binding antibody endpoint titers (EPTs) were calculated as previously described (Bagarazzi M L, Yan J, Morrow M P, et al. Immunotherapy against HPV16/18 generates potent TH1 and cytotoxic cellular immune responses. Sci Transl Med. 2012; 4(155):155ra138). Binding antigens tested included, SARS-CoV-2 antigens: 51 spike protein (Sino Biological 40591-V08H), S1+S2 ECD spike protein (Sino Biological 40589-V08B1), RBD (University of Texas, at Austin (McLellan Lab.)); SARS-COV antigens: Spike S1 protein (Sino Biological 40150-V08B1), S (1-1190) (Immune Tech IT-002-001P) and Spike C-terminal (Meridian Life Science R18572).
ACE2 Competition ELISA. For mouse studies, ELISAs were performed to determine sera IgG antibody competition against human ACE2 with a human Fc tag. Nunc ELISA plates were coated with 1 μg/mL rabbit anti-His6× in 1×PBS for 4-6 hours at room temperature (RT) and washed 4 times with washing buffer (1×PBS and 0.05% Tween® 20). Plates were blocked overnight at 4° C. with blocking buffer (1×PBS, 0.05% Tween® 20, 5% evaporated milk and 1% FBS). Plates were washed four times with washing buffer then incubated with full length (S1+S2) spike protein containing a C-terminal His tag (Sino Biologics, cat. 40589-V08B1) at 10 μg mL-1 for 1 hour at RT. Plates were washed and then serial dilutions of purified mouse IgG mixed with 0.1 μg mL-1 recombinant human ACE2 with a human Fc tag (ACE2-IgHu) were incubated for 1-2 hours at RT. Plates were again washed and then incubated with 1:10,000 dilution of horse radish peroxidase (HRP) conjugated anti-human IgG secondary antibody (Bethyl, cat. A80-304P) and incubated for 1 hour at RT. After final wash plates were developed using 1-Step Ultra TMB-ELISA Substrate (Thermo, cat. 34029) and the reaction stopped with 1 M Sulfuric Acid. Plates were read at 450 nm wavelength within 30 minutes using a SpectraMax Plus 384 Microplate Reader (Molecular Devices, Sunnyvale, Calif.). Competition curves were plotted and the area under the curve (AUC) was calculated using Prism 8 analysis software with multiple t-tests to determine statistical significance.
For guinea pig studies, 96 well half area assay plates (Costar) were coated with 25 μl per well of 5 μg/mL of SARS-CoV-2 spike S1+S2 protein (Sino Biological) diluted in 1×DPBS (Thermofisher) overnight at 4° C. Plates were washed with 1×PBS buffer with 0.05% TWEEN® 20 (Sigma). 100 μl per well of 3% (w/v) BSA (Sigma) in 1×PBS with 0.05% TWEEN® 20 were added and incubated for 1 hr at 37° C. Serum samples were diluted 1:20 in 1% (w/v) BSA in 1×PBS with 0.05% TWEEN. After washing the assay plate, 25 μl/well of diluted serum was added and incubated 1 hr at 37° C. Human recombinant ACE2-Fc-tag (Sinobiological) was added directly to the diluted serum, followed by 1 hr of incubation at 37° C. Plates were washed and 25 μl per well of 1:10,000 diluted goat anti-hu Fc fragment antibody HRP (Bethyl, A80-304P) was added to the assay plate. Plates were incubated 1 hr at RT. For development the SureBlue/TMB Stop Solution (KPL, MD) was used and O.D. was recorded at 450 nm.
SARS-CoV-2 Pseudovirus neutralization assay. SARS-CoV-2 pseudotyped viruses were produced using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent) at a 1:1 ratio. Forty-eight hours post transfection, transfection supernatant was collected, enriched with FBS to 12% final volume, steri-filtered (Millipore Sigma), and aliquoted for storage at −80° C. SARS-CoV-2 pseudotyped viruses were titered and yielded greater than 50 times the relative luminescence units (RLU) to cells alone after 72 h of infection. Mouse sera from INO-4800 vaccinated and naive groups were heat inactivated for 15 minutes at 56° C. and serially diluted three fold starting at a 1:10 dilution for assay. Sera were incubated with a fixed amount of SARS-CoV-2 pseudotyped virus for 90 minutes. HEK293T cells stably expressing ACE2 were added after 90 minutes and allowed to incubate in standard incubator (37% humidity, 5% CO2) for 72 hours. Post infection, cells were lysed using Britelite™ plus luminescence reporter gene assay system (Perkin Elmer Catalog no. 6066769) and relative luminescence units (RLU) were measured using the Biotek plate reader. Neutralization titers (ID50) were calculated as the serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells.
SARS-CoV-2 wildtype virus neutralization assays. SARS-CoV-2/Australia/VIC01/2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples that had been heat-inactivated at 56° C. for 30 minutes. SARS-CoV-2 (Australia/VIC01/2020 isolate) (Caly et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med. J. Aust. (2020) doi: 10.5694/mja2.50569; Published online: 13 Apr. 2020) was diluted to a concentration of 933 pfu/ml and mixed 50:50 in 1% FCS/MEM containing 25 mM HEPES buffer with doubling serum dilutions from 1:10 to 1:320 in a 96-well V-bottomed plate. The plate was incubated at 37° C. in a humidified box for 1 hour before the virus was transferred into the wells of a twice DPBS-washed 24-well plate that had been seeded the previous day at 1.5×105 Vero E6 cells per well in 10% FCS/MEM. Virus was allowed to adsorb at 37° C. for a further hour and overlaid with plaque assay overlay media (1×MEM/1.5% CMC/4% FCS final). After 5 days incubation at 37° C. in a humidified box, the plates were fixed, stained and plaques counted. Median neutralizing titers (ND50) were determined using the Spearman-Karber formula relative to virus only control wells.
SARS-CoV-2/WH-09/human/2020 isolate neutralization assays were performed at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (CAMS) approved by the National Health Commission of the People's Republic of China. Seed SARS-CoV-2 (SARS-CoV-2/WH-09/human/2020) stocks and virus isolation studies were performed in Vero E6 cells, which are maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 μg/ml streptomycin, and incubated at 36.5° C., 5% CO2. Virus titer were determined using a standard 50% tissue culture infection dose (TCID50) assay. Serum samples collected from immunized animals were inactivated at 56° C. for 30 minutes and serially diluted with cell culture medium in two-fold steps. The diluted samples were mixed with a virus suspension of 100 TCID50 in 96-well plates at a ratio of 1:1, followed by 2 hours incubation at 36.5° C. in a 5% CO2 incubator. 1-2×104 Vero cells were then added to the serum-virus mixture, and the plates were incubated for 3-5 days at 36.5° C. in a 5% CO2 incubator. Cytopathic effect (CPE) of each well was recorded under microscopes, and the neutralizing titer was calculated by the dilution number of 50% protective condition.
Bronchoalveolar lavage collection. Bronchoalveolar lavage (BAL) fluid was collected by washing the lungs of euthanized and exsanguinated mice with 700-1000 ul of ice-cold PBS containing 100 μm EDTA, 0.05% sodium azide, 0.05% Tween® 20, and 1× protease inhibitor (Pierce) (mucosal prep solutions (MPS)) with a blunt-ended needle. Guinea pig lungs were washed with 20 ml of MPS via 16G catheter inserted into the trachea. Collected BAL fluid was stored at −20° C. until the time of assay.
IFN-γ ELISpot. Mice: Spleens from mice were collected individually in RPMI1640 media supplemented with 10% FBS (R10) and penicillin/streptomycin and processed into single cell suspensions. Cell pellets were re-suspended in 5 mL of ACK lysis buffer (Life Technologies, Carlsbad, Calif.) for 5 min at room temperature, and PBS was then added to stop the reaction. The samples were again centrifuged at 1,500 g for 10 min, cell pellets re-suspended in R10, and then passed through a 45 μm nylon filter before use in ELISpot assay. ELISpot assays were performed using the Mouse IFN-γ ELISpotPLus plates (MABTECH). 96-well ELISpot plates pre-coated with capture antibody were blocked with R10 medium overnight at 4° C. 200,000 mouse splenocytes were plated into each well and stimulated for 20 hours with pools of 15-mer peptides overlapping by 9 amino acid from the SARS-CoV-2, SARS-CoV, or MERS-CoV Spike proteins (5 peptide pools per protein). Additionally, matrix mapping was performed using peptide pools in a matrix designed to identify immunodominant responses. Cells were stimulated with a final concentration of 5 μL of each peptide/well in RPMI+10% FBS (R10). The spots were developed based on manufacturer's instructions. R10 and cell stimulation cocktails (Invitrogen) were used for negative and positive controls, respectively. Spots were scanned and quantified by ImmunoSpot™ CTL reader. Spot-forming unit (SFU) per million cells was calculated by subtracting the negative control wells.
Flow cytometry. Intracellular cytokine staining was performed on splenocytes harvested from BALB/c and C57BL/6 mice stimulated with the overlapping peptides spanning the SARS-CoV-2 S protein for 6 hours at 37° C., 5% CO2. Cells were stained with the following antibodies from BD Biosciences, unless stated, with the dilutions stated in parentheses: FITC anti-mouse CD107a (1:100), PerCP-Cy5.5 anti-mouse CD4 (1:100), APC anti-mouse CD8a (1:100), ViViD Dye (1-40) (LIVE/DEAD® Fixable Violet Dead Cell Stain kit; Invitrogen, L34955), APC-Cy7 anti-mouse CD3e (1:100), and BV605 anti-mouse IFN-γ (1:75) (eBiosciences). Phorbol Myristate Acetate (PMA) were used as a positive control, and complete medium only as the negative control. Cells were washed, fixed and, cell events were acquired using an FACS CANTO (BD Biosciences), followed by FlowJo software (FlowJo LLC, Ashland, Oreg.) analysis.
Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, Calif.). These data were considered significant if p<0.05. The lines in all graphs represent the mean value and error bars represent the standard deviation. No samples or animals were excluded from the analysis. Randomization was not performed for the animal studies. Samples and animals were not blinded before performing each experiment.
Results
Design and Synthesis of SARS-CoV-2 DNA Vaccine Constructs
Four spike protein sequences were retrieved from the first four available SARS-CoV-2 full genome sequences published on GISAID (Global Initiative on Sharing All Influenza Data). Three Spike sequences were 100% matched and one was considered an outlier (98.6% sequence identity with the other sequences). After performing a sequence alignment, the SARS-CoV-2 spike glycoprotein sequence (“Covid-19 spike antigen”; SEQ ID NO: 1) was generated and an N-terminal IgE leader sequence was added. The highly optimized DNA sequence encoding SARS-CoV-2 IgE-spike was created as described elsewhere herein to enhance expression and immunogenicity. SARS-CoV-2 spike outlier glycoprotein sequence (“Covid-19 spike-OL antigen”; SEQ ID NO: 4) was generated and an N-terminal IgE leader sequence was added. The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate-early promoter and a bovine growth hormone polyadenylation signal. The resulting plasmids were designated as pGX9501 and pGX9503, designed to encode the SARS-CoV-2 S protein from the 3 matched sequences and the outlier sequence, respectively (
In Vitro Characterization of Synthetic DNA Vaccine Constructs
Expression of the encoded SARS-CoV-2 spike transgene at the RNA level in COS-7 cells transfected with pGX9501 and pGX9503 was measured. Using the total RNA extracted from the transfected COS-7 cells, expression of the spike transgene was confirmed by RT-PCR (
Humoral immune responses in mice. pGX9501 was selected as the vaccine construct to advance to immunogenicity studies, due to the broader coverage it would likely provide compared to the outlier, pGX9503. pGX9501 was subsequently termed INO-4800. The immunogenicity of INO-4800 was evaluated in BALB/c mice, post-administration to the tibialis anterior muscle using the CELLECTRA® delivery device. (Sardesai & Weiner, Curr. Opin. Immunol., 23, 421-429 (2011). The reactivity of the sera from a group of mice immunized with INO-4800 was measured against a panel of SARS-CoV-2 and SARS-CoV antigens (
Neutralization assay. A neutralization assay with a pNL4-3.Luc.R-E-based pseudovirus displaying the SARS-CoV-2 Spike protein was developed. Neutralization titers were detected by a reduction in relative luciferase units (RLU) compared to controls which had no decrease in RLU signal. BALB/c mice were immunized twice with INO-4800, on days 0 and 14, and sera was collected on day 7 post-2nd immunization. The pseudovirus was incubated with serial dilutions of mouse sera and the sera-virus mixture was added to 293T cells stably expressing the human ACE2 receptor (ACE2-293T) for 72 hours. Neutralization ID50 average titers of 92.2 were observed in INO-4800 immunized mice (
The immunogenicity of INO-4800 in the Hartley guinea pig model, an established model for intradermal vaccine delivery (Carter, et al. The adjuvant GLA-AF enhances human intradermal vaccine responses. Sci Adv. 2018; 4(9):eaas9930; Schultheis, et al. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin. Vaccine. 2017; 35(1):61-70), was assessed. 100 μg of pDNA was administered by Mantoux injection to the skin and followed by CELLECTRA® device on day as described in the methods section above. On day 14, anti-spike protein binding of serum antibodies was measured by ELISA. Immunization with INO-4800 revealed an immune response in respect to SARS-CoV-2 S1+2 protein binding IgG levels in the sera (
Inhibition of SARS-CoV-2 S protein binding to ACE2 receptor. The receptor inhibiting functionality of INO-4800-induced antibody responses was examined. An ELISA-based ACE2 inhibition assay was developed as a surrogate for neutralization. As a control in the assay, ACE2 is shown to bind to SARS-CoV-2 Spike protein with an EC50 of 0.025 μg/ml (
In summary, immunogenicity testing in both mice and guinea pigs revealed the SARS-CoV-2 vaccine candidate, INO-4800, was capable of eliciting antibody responses to SARS-CoV-2 spike protein. ACE2 is considered to be the primary receptor for SARS-CoV-2 cellular entry, blocking this interaction suggests INO-4800-induced antibodies may prevent host infection.
Biodistribution of SARS-CoV-2 reactive IgG to the lung. Lower respiratory disease (LRD) is associated with severe cases of COVID-19. The presence of antibodies at the lung mucosa targeting SARS-CoV-2 could potentially mediate protection against LRD. The presence of SARS-CoV-2 specific antibody in the lungs of immunized mice and guinea pigs was evaluated. BALB/c mice and Hartley guinea pigs were immunized, on days 0 and 14 or 0, 14 and 28, respectively, with INO-4800 or pVAX control pDNA. Bronchoalveolar lavage (BAL) fluid was collected following sacrifice, and SARS-CoV-2 S protein ELISAs were performed. In both BALB/c and Hartley guinea pigs which received INO-4800, a statistically significant increase in SARS-CoV-2 S protein binding IgG in BAL fluid compared to animals receiving pVAX control was measured (
Coronavirus cross-reactive cellular immune responses in mice. T cell responses against SARS-CoV-2, SARS-CoV, and MERS-CoV S antigens were assayed by IFN-γ ELISpot. Groups of BALB/c mice were sacrificed at days 4, 7, or 10 post-INO-4800 administration (2.5 or 10 μg of pDNA), splenocytes were harvested, and a single-cell suspension was stimulated for 20 hours with pools of 15-mer overlapping peptides spanning the SARS-CoV-2, SARS-CoV, and MERS-CoV spike protein. Day 7 post-INO-4800 administration, T cell responses of 205 and 552 SFU per 106 splenocytes against SARS-CoV-2 were measured for the 2.5 and 10 μg doses, respectively (
BALB/c SARS-CoV-2 epitope mapping. Epitope mapping was performed on the splenocytes from BALB/c mice receiving the 10 μg INO-4800 dose. Thirty matrix mapping pools were used to stimulate splenocytes for 20 hours and immunodominant responses were detected in multiple peptide pools (
In summary, T cell responses against SARS-CoV-2 S protein epitopes were detected in mice immunized with INO-4800.
Day 0 and 28 intradermal delivery of pDNA. PBMC IFN-γ ELISpot (
Humoral Immune Responses to SARS-CoV-2 Spike Protein Measured in INO-4800 Treated in Rhesus Monkeys.
Day 0 and 28 intradermal delivery of pDNA. Serum IgG binding ELISA. (
Humoral immune responses to SARS and MERS spike protein measured in INO-4800 treated rhesus monkeys. Day 0 and 28 intradermal delivery of pDNA. Serum IgG binding ELISA. (
Cellular immune responses measured by PBMC IFN-γ ELISpot in INO-4800-treated in rhesus monkeys following intradermal delivery of pDNA on days 0 and 28. Results are shown in
The SARS-CoV-2 spike protein is coated onto wells of a 96-well microplate by incubating over night or for up to three days. Blocking buffer is then added to block remaining free binding sites. Human serum samples containing antibodies to SARS-COV-2 spike protein and assay controls are added to the blocked plate and incubated for 1 hour. During the incubation, anti-spike protein antibodies present in the samples and positive controls bind to spike protein immobilized onto the plate. Plates are then washed to remove unbound serum components. Next, a horseradish peroxidase (HRP) labeled anti-human IgG antibody is added to allow for detection of antibody bound to the spike protein. After a one hour incubation, plates are washed to remove unbound HRP detection antibody, and TMB substrate is added to plates. In the presence of horseradish peroxidase, the TMB substrate turns deep blue, proportional to the amount of HRP present in the well. After allowing the reaction to proceed for approximately 10 minutes, an acid-based stop solution is added, which halts the enzymatic reaction and turns the TMB yellow. The yellow color is proportional to the amount of bound anti-spike protein antibodies in each well and is read at 450 nm. The magnitude of the assay response is expressed as titers. Titer values are defined as the greatest serial dilution at which the assay signal is greater than a cutoff value based on the assay background levels for a panel of serum from normal human donors.
ELISA Assay Method Qualification
The INO-4800 SARS-CoV-2 Spike ELISA assay has been qualified and has been found suitable for the its intended use to measure the humoral response in subjects participating in clinical trials involving INO-4800. The formal qualification consisted of 18 plates and was conducted by two operators over the course of four days. The qualification determined the assay sensitivity, specificity, selectivity, and precision. At the time the assay was developed convalescent sera was not available. A monoclonal antibody was therefore used in development. The monoclonal antibody diluted in normal human sera was used to test all parameters in this assay. The overall assay sensitivity was found to be 16.1 ng/mL for 1/20-diluted serum, which is 322 ng/mL for undiluted serum. Specificity was assessed by pre-incubating anti-spike protein antibody with recombinant spike protein prior to assay. Preincubation with the recombinant spike protein resulted in greater than 60% signal reduction, indicating that the antibody was binding specifically to the spike protein coated to the plate and not to a different assay component. Selectivity was investigated by spiking individual human serum samples with positive control anti-spike antibody at a concentration near the limit of detection. Seven out of 10 individuals had signal above the cutoff, and eight out of the ten individuals had assay signal within 20% of the mean signal for the ten individuals, demonstrating that matrix effects are expected to be minor for most human serum samples when diluted 1/20. Assay precision was assessed by assaying a high, low, and medium anti-spike protein antibody positive control six times on each of six plates. Results indicated low intra-assay raw signal variation but high raw signal inter-assay variation. Since each individual plate cutoff is based on the signal of negative controls on each plate, inter-assay variation in raw signal is not expected to influence the precision of final titer calculations. To test this, the precision of plate cutoffs was evaluated in this qualification by titering the HPC (high positive control) six times on each of six plates for a total of thirty-six titer evaluations. Thirty-five out of the thirty-six values were identical (titer of 180), while one of the titer determinations was one step lower than the rest (60 instead of 180). This resulted in an inter-assay CV of 4.6%.
The enzyme-linked immunospot (ELISPOT) assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody in the presence or absence of stimuli. After an appropriate incubation time, cells are removed and the secreted molecule is detected using a detection antibody in a similar procedure to that employed by the ELISA. The detection antibody is biotinylated and followed by a streptavidin-enzyme conjugate. By using a substrate with a precipitating rather than a soluble product, the end result is visible spots on the surface. Each spot corresponds to an individual cytokine-secreting cell. The IFN-γ ELISPOT assay qualification was successfully completed with an assessment of assay specificity, reproducibility and precision (intra-assay precision and inter-assay precision), dynamic range, linearity, relative accuracy, limit of detection and quantitation and assay robustness. The assay has been tested and qualified under GLP/GCLP laboratory guidelines.
ELISPOT Assay Method Qualification. Specificity readings gave a mean value of <10 spot-forming units (SFU) for the assay negative control (medium with DMSO), a mean of 565 SFU for the positive control peptide pool CEF and a mean of 593 SFU in response to stimulation with mitogen (Phorbol Myristate Acetate+lonomycin). The highest reported % CV for intra-assay variation was 7.37%. The highest reported % CV for inter-assay variation was 17.23%. The highest observed % CV for inter-operator variability was 8.11%. These values fall below the FDA-recommended standard acceptance criteria of 20%.
Linearity of the dilution curve was demonstrated with a slope of 0.15 and an R2 value of 0.99. Assay accuracy was >90% over the listed dynamic range (156-5000 cells/well), falling within the acceptance criteria of 80-120%. Limit of detection was determined to be 11 SFU/1×106 PBMCs, limit of quantitation was observed at 20 SFU/1×106 PBMCs. Robustness of the assay was evaluated by varying (i) peptide concentration; (ii) secondary antibody concentration; (iii) incubation times, and (iv) drying-out of plate membranes.
Based on the results of this qualification, the IFN-γ ELISPOT is considered qualified and ready for use in clinical trials.
This is a Phase 1, open-label, multi-center trial (clinicaltrials_gov identifier NCT04336410) to evaluate the safety, tolerability and immunological profile of INO-4800 (pGX9501) administered by intradermal (ID) injection followed by electroporation (EP) using CELLECTRA® 2000 device in healthy adult volunteers. Approximately 40 healthy volunteers will be evaluated across two (2) dose levels: Study Group 1 and Study Group 2 as shown in Table 2. A total of 20 subjects will be enrolled into each Study Group.
2a
aINO-4800 will be injected ID followed by EP in an acceptable location on two different limbs at each dosing visit
All subjects are followed for 24 weeks following the last dose. Week 28 is the End of Study (EOS) visit.
Primary Objectives:
Primary Safety Endpoints:
Primary Immunogenicity Endpoints:
Exploratory Objective:
Exploratory Endpoint:
Safety Assessment:
Subjects are followed for safety for the duration of the trial through the end of study (EOS) or the subject's last visit. Adverse events are collected at every visit (and a Day 1 phone call). Laboratory blood and urine samples are drawn at Screening, Day 0 (pregnancy test only), Week 1, Week 4 (pregnancy test only), Week 6, Week 8, Week 12 and Week 28, according to the Schedule of Events (Table 3). All adverse events, regardless of relationship, are collected from the time of consent until EOS. All serious adverse events, adverse events of special interest and treatment-related adverse events are followed to resolution or stabilization.
Xh
Xh
aScreening assessment occurs from −30 days to −1 day prior to Day 0.
bFull physical examination at screening and Week 28 (or any other study discontinuation visit) only. Targeted physical exam at all other visits.
cIncludes Na, K, Cl, HCO3, Ca, PO4, glucose, BUN, and Cr.
dHIV antibody or rapid test, HBsAg, HCV antibody.
eDipstick for glucose, protein, and hematuria. Microscopic examination should be performed if dipstick is abnormal.
fSerum pregnancy test at screening. Urine pregnancy test at other visits.
gAll doses delivered via intradermal injection followed by EP.
hFor Study Group 1, one injection in skin preferably over deltiod muscle at Day 0 and Week 4. For Study Group 2, two injections in skin with each injection over a different deltoid or lateral quadriceps; preferably over the deltoid muscles, at Day 0 and Week 4.
iFollowing administration of INO-4800, EP data will be downloaded from the CELLECTRA ® 2000 device and provided to Inovio.
jIncludes AEs from the time of consent and all injection site reactions that qualify as an AE.
kFollow-up phone call to collect AEs.
l4 × 8.5 mL (34 mL) whole blood in 10 mL Acid Citrate Dextrose (ACD, Yellow top) tubes per time point. Note: Collect a total of 68 mL whole blood prior to 1st dose (screening and prior to Day 0 dosing).
m1 × 8 mL blood in 10 mL red top serum collection tube per time point. Note: Collect four aliquots of 1 mL each (total 4 mL) serum at each time point prior to 1st dose (Screening and prior to Day 0 dosing).
Immunogenicity Assessment:
Immunology blood samples are collected at Screening, Day 0 (prior to dose), Week 4 (prior to dose), Week 6, Week 8, Week 12 and Week 28. Determination of analysis of collected samples for immunological endpoints are determined on an ongoing basis throughout the study.
Clinical Trial Population:
Healthy adult volunteers between the ages of 18-50 years, inclusive.
Inclusion Criteria:
Exclusion Criteria:
Clinical Trial Treatment: The INO-4800 drug product contains 10 mg/mL of the DNA plasmid pGX9501 in 1×SSC buffer (150 mM sodium chloride and 15 mM sodium citrate). A volume of 0.4 mL is filled into 2-mL glass vials that are fitted with rubber stoppers and sealed aluminum caps. INO-4800 is stored at 2-8° C.
Study Group 1 is administered one 1.0 milligram (mg) intradermal (ID) injection of INO-4800 followed by electroporation (EP) using the CELLECTRA® 2000 device per dosing visit at Day 0 and Week 4. Study Group 2 is administered two 1.0 mg ID injections (total 2.0 mg per dosing visit) (in an acceptable location on two different limbs) of INO-4800 followed by EP using the CELLECTRA® 2000 device at Day 0 and Week 4.
Peripheral Blood Immunogenicity Assessments
Whole blood and serum samples are obtained. Immunology blood and serum samples are collected at Screening and at visits specified in the Schedule of Events (Table 3). Both Screening and Day 0 immunology samples are required to enable all immunology testing. The T and B cell immune responses to INO-4800 are measured using assays that may include but are not limited to ELISA, neutralization, assessment of immunological gene expression, assessment of immunological protein expression, flow cytometry and ELISPOT. The ELISA binding assay is a standard plate-based ELISA using 96-well ELISA plates. Plates are coated with SARS-CoV-2 spike protein and blocked. Following blocking, sera from vaccinated subjects are serially diluted and incubated on the plate. A secondary antibody that is able to bind human IgG is used to assess the level of vaccine specific antibodies in the sera. T-cell response is assessed by an IFN-gamma ELISPOT assay. PBMCs isolated from study volunteers are incubated with peptide fragments of the SARS-CoV-2 spike protein. The cells and peptides are placed in a MabTech plates coated with an antibody that captures IFN-gamma. Following 24 hours of stimulation, cells are washed out and a secondary antibody that binds IFN-gamma is added. Each vaccine specific cell creates a spot that can be counted to determine the level of cellular responses induced. In addition, humoral responses to SARS-CoV-2 Nucleocapsid Protein (NP) may also be assessed to rule out potential infection by wild-type SARS-CoV-2 post INO-4800 treatment during the study. Determination of analysis of collected samples for immunological endpoints is determined on an ongoing basis throughout the study.
Primary Outcome Measure:
The safety of INO-4800 is measured and graded in accordance with the “Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials”, issued September 2007 (Appendix A). An adverse event of special interest (AESI) (serious or non-serious) is one of scientific and medical concern specific to the product or program. AESIs include those listed in Table 4.
Dose Limiting Toxicity (DLT)
For the purpose of this clinical trial, the following are dose limiting toxicities:
aIn addition to grading the measured local reaction at the greatest single diameter, the measurement should be recorded as a continuous variable
bShould be evaluated and graded using the functional scale as well as the actual measurement.
Analytical Populations
Analysis populations are:
The safety analysis population includes all subjects who receive at least one dose of INO 4800 administered by ID injection. Subjects for this population are grouped in accordance with the dose of INO-4800 that they received. This population is used for all safety analyses in the study.
Primary Safety Analyses
The primary analyses for this trial are safety analyses of treatment emergent adverse events (TEAEs), administration site reactions and clinically significant changes in safety laboratory parameters from baseline.
TEAEs are defined for this trial as any adverse events, adverse events of special interest, or serious adverse events that occur on or after Day 0 following IP administration. All TEAEs are summarized by frequency, percentage and associated 95% Clopper-Pearson confidence interval. The frequencies are presented separately by dose number and are depicted by system order class and preferred term. Additional frequencies are presented with respect to maximum severity and relationship to IP. Multiple occurrences of the same AE in a single subject are counted only once following a worst-case approach with respect to severity and relationship to IP. All serious TEAEs are summarized as above. AE duration is calculated as AE stop date−AE start date+1 day. AEs and SAEs that are not TEAEs or serious TEAEs are presented in listings.
All of these primary safety analyses are conducted on the subjects in the safety population.
Primary Immunogenicity Analyses
SARS-CoV-2 Spike glycoprotein antigen specific binding antibody titers, and specific cellular immune responses are analyzed by Study Group within age strata. Binding antibody titer is analyzed for each Study Group using the geometric mean and associated 95% confidence intervals. Antigen specific cellular immune response increases are analyzed for each Study Group using medians, inter-quartile range and 95% confidence intervals. Change from baseline for both binding antibody titer and antigen specific cellular response increases are analyzed using Geometric Mean Fold Rise and 95% confidence intervals. Binding antibody titers are analyzed between each Study Group pair within age strata using the geometric mean ratio and associated 95% confidence intervals. Antigen specific cellular immune responses are analyzed between each Study Group pair within age strata using median differences and associated 95% confidence intervals. All of these primary immunogenicity analyses are conducted on the subjects in the mITT and PP populations.
Exploratory Analyses
T and B post baseline cell number will be analyzed descriptively by Study Group with means/medians and associated 95% confidence intervals. Percent neutralizing antibodies will be analyzed for each Study Group using medians, inter-quartile range and 95% confidence intervals.
The safety and immunogenicity of the optional booster dose of INO-4800 following a prior two-dose regimen will be analyzed as described below. Live neutralization reciprocal antibody titer and pseudoneutralization reciprocal antibody titer will be analyzed for each Study Group within age strata using the geometric mean and associated 95% confidence intervals. Fold rise from baseline will tabulated for each immunogenic biomarker. If there is sufficient data for analysis, exploratory between group immunogenic comparisons between subjects who opt for just 2 administrations and subjects who opt for 2 administrations plus the booster administration will be undertaken.
Further exploration of the effect of age and other potential confounders on the relationship between immune biomarkers and INO-4800 dose may involve the use of ANCOVA and/or Logistic regression models.
Preliminary Base Study Results
All 8 adverse events reported were Grade 1; 5 due to local injection site reactions. No serious adverse events, adverse events of special interest, or dose limiting toxicities were reported.
Preliminary Binding ELISA Analysis demonstrated 7/9 (78%) subjects had positive antibody responses. Responders had a four-fold increase in titer.
At week six, multiple immunology assays, including those for humoral and cellular immune response, were conducted for both 1.0 mg and 2.0 mg dose cohorts after two doses. Analyses at that point showed that 94% (34 out of 36 total trial participants) demonstrated overall immunological response rates based on preliminary data assessing humoral (binding and neutralizing) and T cell immune responses. One participant in the 1 mg dose cohort and two participants in the 2 mg dose cohort were excluded from the immune analyses as they tested positive for COVID-19 immune responses at study entry, indicating prior infection. One participant in the 2 mg dose cohort discontinued the study for reasons unrelated to safety or tolerability.
Through week eight, INO-4800 was generally safe and well-tolerated in all participants in both cohorts. All ten reported adverse events (AEs) were grade 1 in severity, with most being injection site redness. There were no reported serious adverse events (SAEs).
Initial Phase I Results
Study Population Demographics
A total of 55 participants were screened and 40 participants were enrolled into the initial two groups (
The vaccine was administered in 0.1 ml intradermal injections followed by EP at the site of vaccination. EP was performed using CELLECTRA® 2000 with four 52-msec pulses at 0.2 A (40 to 200 V, depending on tissue resistance) per season. The first two pulses were spaced 0.2 seconds apart followed by a 3-second pause before the final two pulses that were also spaced by 0.2 seconds. The dose groups were enrolled sequentially with a safety run-in for each. Participants were and will be evaluated clinically and for safety on Day 1 and at Weeks 1, 4 (Dose 2), 6, 8, 12, 28, 40 and 52. Safety laboratory testing (complete blood count, comprehensive metabolic panel and urinalysis) were and will be conducted on all follow-up visits except for Day 0, Day 1 and Week 4. Immunology specimens were obtained at all time points post-dose 1 except Day 1 and Week 1. Local and systemic AEs, regardless of relationship to the vaccine, were recorded and graded by the investigator. AEs were graded according to the Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines that were issued by the Food and Drug Administration in September 2007.
Vaccine Safety and Tolerability
39 (97.5%) completed both doses and 1 subject in the 2.0 mg group discontinued trial participation prior to receiving the second dose due to lack of transportation to the clinical sites, unrelated to the study or the dosing. All 39 remaining subjects completed the visit 8 weeks post-dose 1. There were a total of 11 local and systemic AEs reported by 8 weeks post-dose 1, six of these were deemed related to vaccine. All AEs were mild or Grade 1 in severity. The most frequent AEs were injection site reactions including injection site pain (3) and erythema (2). One systemic AE related to the vaccine was nausea. There were no febrile reactions. No subjects discontinued the trial due to an AE. No serious adverse events (SAEs) nor AESIs were reported. There were no abnormal laboratory values of clinical concern throughout the initial 8-week follow-up period. There was no increase in the number of participants who experienced AEs related to the vaccine in the 2.0 mg group (10% of subjects), compared to that in the 1.0 mg group (15% of subjects). In addition, there was no increase in frequencies of AEs with the second dose over the first dose in both dose level groups. The INO-4800 Phase 1 safety data thus suggests that the vaccine is likely a safe booster as there was no increase frequency of side effects after the second vaccine administration compared to the first dose.
Immunogenicity: Thirty-eight subjects were included in the immunogenicity analysis. In addition to one subject in the 2.0 mg group who discontinued prior to completing dosing, one subject in the 1.0 mg group was deemed seropositive at baseline and was excluded.
Humoral Immune Responses: Serum samples were used to measure neutralizing antibody titers against SARS-CoV-2/Australia/VIC01/2020 isolate and binding antibodies to RBD and whole spike 51+S2 protein.
S1+S2 Enzyme-Linked Immunosorbent Assay (ELISA): A standard binding ELISA was used to detect serum binding anti-SARS-CoV-2 spike antibodies. ELISA plates were coated with recombinant S1+S2 SARS-CoV-2 spike protein (Sino Biological) and incubated overnight and blocked. Samples were serially diluted and incubated on the blocked assay plates for one hour. The magnitude of the assay response was expressed as titers which were defined as the greatest serial dilution at which the optical density 3 SD above background Day 0. 68% of participants in the 1.0 mg group and 70% of participants in the 2.0 mg group had at least an increase in serum IgG binding titers to S1+S2 spike protein when compared to their pre-vaccination time point (Day 0), with the responder GMT of 320.0 (95% CI: 160.5, 638.1) and 508.0 (95% CI: 243.6, 1059.4) in the 1.0 mg and 2.0 mg groups, respectively (
Sera was also tested for the ability to neutralize live virus in SARS-CoV-2 wildtype virus neutralization assays. SARS-CoV-2/Australia/VIC01/2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples that had been heat-inactivated at 56° C. for 30 min. SARS-CoV-2 (Australia/VIC01/2020 isolate44) was diluted to a concentration of 933 pfu ml-1 and mixed 50:50 in 1% FCS/MEM containing 25 mM HEPES buffer with doubling serum dilutions. After 5 days incubation at 37° C. in a humidified box, the plates were fixed, stained and plaques counted. Virus titer were determined using a standard 50% tissue culture infection dose (TCID50) assay. After the second vaccination at week 6, the responder geometric mean titer (GMT) by live virus PRNT IC50 neutralization assay were 82.4 and 63.5 in the 1.0 mg and 2.0 mg groups, respectively. The percentage of responders (post vaccination PRNT IC50 ≥10) were 83% and 84% in the 1.0 mg and 2.0 mg groups, respectively (
RBD Enzyme-Linked Immunosorbent Assay (ELISA): MaxiSorp 96-well plates (ThermoFisher, 439454) were coated with 50 ul/well of 1 ug/ml of SARS-CoV-2 RBD (SinoBiological, 40592-V08H), protein diluted in PBS and incubated at 4° C. overnight. Plates were washed 4 times with PBST (PBS with 0.05% Tween-20) and blocked with 200 ul/well of blocking buffer (PBS with 5% non-fat dry milk and 0.1% Tween-20) at room temperature for 2 hr. After washing with PBST, 50 ul/well of sera sample serially diluted in blocking buffer was added to the plate in duplicate and incubated at room temperature for 2 hr. After washing with PBST, 50 ul/well of anti-human-IgG-HRP detection antibody (BD Pharmingen, 555788) diluted 500-fold in blocking buffer was added and incubated at room temperature for 1 hr. After washing with PBST, 50 ul/well of 1-Step Ultra TMB (Thermo, 34028) was added and incubated at room temperature for 5 min. 50 ul/well of 2M sulfuric acid was added to stop the color change reaction and optical absorbance was measured at 450 and 570 nm on a Synergy 2 microplate reader (Biotek). Endpoint titers were defined as the greatest serial dilution at which the OD450-570 values were 3 standard deviations above the matched Day 0 signal. At week 6, the responder GMT were 385.6 (95% CI: 69.0, 2154.9) and 222.1 (95% CI: 87.0, 566.8) in the 1.0 mg and 2.0 mg groups, respectively (
Overall seroconversion (defined as those participants who respond with neutralization or binding antibodies to S protein or RBD) after 2 vaccine doses in 1.0 mg and 2.0 mg dose group were 89% and 95%, respectively.
Cellular Responses: Peripheral Blood Mononuclear Cells (PBMCs) were isolated from blood samples, frozen and stored in liquid nitrogen for subsequent analyses.
INO-4800 SARS-CoV-2 Spike ELISPOT. Peripheral mononuclear cells (PBMCs) were isolated pre- and post-vaccination. Cells were stimulated in vitro with a pool of 15-mer peptides (overlapping by 9 residues) spanning the full-length consensus spike protein sequence. Cells were incubated overnight (18-22 h, 37 C, 5% CO2) with peptide pools (225 μg/ml), DMSO alone (0.5%, negative control) or PMA and Ionomycin (positive controls). The next day, cells were washed off, and the plates were developed: The detection antibody is biotinylated and followed by a streptavidin-enzyme conjugate. By using a substrate with a precipitating rather than a soluble product, resulting in visible spots. Each spot corresponds to an individual cytokine-secreting cell. After plates were developed, spots were scanned and quantified using the CTL S6 Micro Analyzer (CTL) with ImmunoCapture™ and ImmunoSpot™ software. Values are shown as background-subtracted average of measured triplicates.
The percentage of responders at week 8 was 74% in the 1.0 mg dose group, and 100% in the 2.0 mg dose group (Table 8). The Median SFU per 106 PBMC was 46 and 71 for the responders in 1.0 mg and 2.0 mg dose groups, respectively. In each group, there were statistically significant increases in the numbers of interferon-γ-secreting cells (SFU) obtained per million PBMCs over baseline (P=0.001 and P<0.0001, respectively, Wilcoxon matched-pairs signed rank test, post-hoc analysis),
‡Response criteria: Neutralization-Week 6 PRNT IC50 ≥ 10, or ≥4 if binding ELISA activity is seen RBD Binding-Week 6 value >1 ELISpot − Value ≥ 12 SFU over Week 0
μResponders generated using Week 6 and Week 8 data
INO-4800 SARS-CoV-2 Spike Flow Cytometry Assay: The contribution of CD4+ and CD8+ T cells to the cellular immune response against INO-4800 was assessed by intracellular cytokine staining (ICS). PBMCs were also used for Intracellular Cytokine Staining (ICS) analysis using flow cytometry. One million PMBCs in 200 uL complete RPMI media were stimulated for six hours (37° C., 5% CO2) with DMSO (negative control), PMA and Ionomycin (positive control, 100 ng/mL and 2 μg/mL, respectively), or with the indicated peptide pools (225 μg/mL). After one hour of stimulation, Brefeldin A and Monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of expressed cytokines. After stimulation the cells were moved to 4° C. overnight. Next, cells were washed in PBS for live/dead staining (Life Technologies Live/Dead aqua fixable viability dye, as previously described), and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Next, cells were stained for extracellular markers, fixed and permeabilized, and then stained for the indicated cytokines (Table 9) for antibodies used for flow cytometry.
CD8+ T cells producing IFN-γ, TNF-α and/or IL-2 (any response) were statistically significantly increased post vaccination in the 2.0 mg dose group (
CD4+ and CD8+ T cells were explored following vaccination. Nearly half (47%) of the CD8+ T cells in the 2.0 mg dose group were dual producing IFN-γ and TNF-α (
The composition of CD4+ or CD8+ T cells producing any cytokine (any response, IFN-γ or TNF-α or IL-2 following vaccination) was also assessed for surface markers CCR7 and CD45RA to characterize effector (CCR7−CD45RA+), effector memory (CCR7−CD45RA−), and central memory (CCR7+CD45RA−) cells (
Th2 responses were also measured by assessing IL-4 production, and no statistically significant increases (Wilcoxon matched-pairs signed rank test, post-hoc analysis) were observed in either group post vaccination (
In this Phase 1 trial, INO-4800 vaccination led to potent T cell responses with increased Th1 phenotype, demonstrated by both IFN-γ ELISpot as well as multiparametric flow cytometry, as evidenced by increased expression of Th1-type cytokines IFN-γ, TNF-α. and IL-2 (
Phase 1 Update
This was designed as a Phase 1, open-label, multicenter trial (COVID19-001; Clinicaltrials_gov identifier NCT04336410) to evaluate the safety, tolerability and immunogenicity of INO-4800 administered intradermally (ID) followed by electroporation using the CELLECTRA 2000 device. Healthy participants 18 to 50 years of age without a known history of COVID-19 illness received either a 1.0 mg or 2.0 mg dose of INO-4800 in a 2-dose regimen (Weeks 0 and 4).
DNA vaccine INO-4800. The vaccine was produced according to current Good Manufacturing Practices. INO-4800 contains plasmid pGX9501 expressing a synthetic, optimized sequence of the SARS-CoV-2 full length spike glycoprotein which was optimized as previously described at a concentration of 10 mg/ml in a saline sodium citrate buffer.
Endpoints. Safety endpoints included systemic and local administration site reactions up to 8 weeks post-dose 1. Immunology endpoints include antigen-specific binding antibody titers, neutralization titers and antigen-specific interferon-gamma (IFN-γ) cellular immune responses after 2 doses of vaccine. For Live Virus Neutralization, a responder is defined as Week 6 PRNT IC50 >10, or >4 if a subject is a responder in ELISA. For S1+S2 ELISA, a responder is defined as a Week 6 value >1. For the ELISpot assay, a responder is defined as a Week 6 or Week 8 value that is >12 spot forming units per 106 PBMCs above Week 0.
Study Procedures.
Forty participants were enrolled into two groups; 20 participants in each of 1.0 mg and 2.0 mg dose groups that received their doses on Weeks 0 and 4. The vaccine was administered in 0.1 ml intradermal injections in the arm followed by EP at the site of vaccination. Subjects in the 1.0 mg dose group received one injection on each dosing visit. The second dose of the vaccine could be injected in the same arm or a different arm relative to the first dose. Subjects in the 2.0 mg dose group received one injection in each arm at each dosing visit. EP was performed using CELLECTRA® 2000 as previously described. The device delivers total four electrical pulses, each 52 ms in duration at strengths of 0.2 A current and voltage of 40-200 V per pulse. The dose groups were enrolled sequentially with a safety run-in for each. The 1.0 mg dose group enrolled a single participant per day for 3 days. An independent Data Safety Monitoring Board (DSMB) reviewed the Week 1 safety data and based on a favorable safety assessment, made a recommendation to complete enrollment of the additional 17 participants into that dose group. In a similar fashion, the 2.0 mg dose group was subsequently enrolled. Participants were assessed for safety and concomitant medications at all time points, including screening, Week 0 (Dose 1), post dose next day phone call, Week 1, 4 (dose 2), 6, 8, 12, 28, 40 and 52 post-dose 1. Local and systemic AEs, regardless of relationship to the vaccine, were recorded and graded by the investigator. Safety laboratory testing (complete blood count, comprehensive metabolic panel and urinalysis) were and will continue to be conducted at screening, Week 1, 6, 8, 12, 28 and 52 post-dose 1. Immunology specimens were obtained at all time points post-dose 1 except at Day 1 and Week 1. AEs were graded according to the Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines that were issued by the Food and Drug Administration in September 2007. The DSMB reviewed laboratory and AE data for the participants up to 8 weeks included in this report. There were protocol-specified safety stopping rules and adverse events of special interest (AESIs). For the purpose of this report, clinical and laboratory safety assessments up to 8 weeks post the first dose are presented.
Protocol eligibility. Eligible participants must have met the following criteria: healthy adults aged between 18 and 50 years; able and willing to comply with all study procedures; Body Mass Index of 18-30 kg/m2 at screening; negative serological tests for Hepatitis B surface antigen, Hepatitis C antibody and Human Immunodeficiency Virus antibody; screening electrocardiogram (ECG) deemed by the Investigator as having no clinically significant findings; use of medically effective contraception with a failure rate of <1% per year when used consistently be post-menopausal, or surgically sterile or have a partner who is sterile. Key exclusion criteria included the following: individuals in a current occupation with high risk of exposure to SARS-CoV-2; previous known exposure to SARS-CoV-2 or receipt of an investigational product for the prevention or treatment of COVID-19; autoimmune or immunosuppression as a result of underlying illness or treatment; hypersensitivity or severe allergic reactions to vaccines or drugs; medical conditions that increased risk for severe COVID-19; reported smoking, vaping, or active drug, alcohol or substance abuse or dependence; and fewer than two acceptable sites available for intradermal injection and electroporation.
Clinical Trial Population:
Healthy adult volunteers between the ages of 18-50 years, inclusive.
Inclusion Criteria:
a. Adults aged 18 to 50 years, inclusive;
b. Judged to be healthy by the Investigator on the basis of medical history, physical examination and vital signs performed at Screening;
c. Able and willing to comply with all study procedures;
d. Screening laboratory results within normal limits or deemed not clinically significant by the Investigator;
e. Negative serological tests for Hepatitis B surface antigen (HBsAg), Hepatitis C antibody and Human Immunodeficiency Virus (HIV) antibody screening;
f. Screening electrocardiogram (ECG) deemed by the Investigator as having no clinically significant findings (e.g. Wolff-Parkinson-White syndrome);
g. Use of medically effective contraception with a failure rate of <1% per year when used consistently and correctly from screening until 3 months following last dose, be post-menopausal, be surgically sterile or have a partner who is sterile.
Exclusion Criteria:
a. Pregnant or breastfeeding, or intending to become pregnant or father children within the projected duration of the trial starting with the screening visit until 3 months following last dose;
b. Is currently participating in or has participated in a study with an investigational product within 30 days preceding Day 0;
c. Previous exposure to SARS-CoV-2 (laboratory testing at the Investigator's discretion) or receipt of an investigational vaccine product for prevention of COVID-19, MERS or SARS;
d. Current or history of the following medical conditions:
Immunogenicity Assessment Methods
Samples collected at screening, Week 0 (prior to dose) and at Weeks 6 and 8 were analyzed. Peripheral Blood Mono-nuclear Cells (PBMCs) were isolated from blood samples by a standard overlay on ficoll hypaque followed by centrifugation. Isolated cells were frozen in 10% DMSO and 90% fetal calf serum. The frozen PBMCs were stored in liquid nitrogen for subsequent analyses. Serum samples were stored at −80° C. until used to measure binding and neutralizing antibody titers.
SARS-CoV-2 Wildtype Virus Neutralization Assays
SARS-CoV-2/Australia/VIC01/2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples that had been heat-inactivated at 56° C. for 30 min. SARS-CoV-2 (Australia/VIC01/2020 isolate44) was diluted to a concentration of 933 pfu/m land mixed 50:50 in 1% FCS/MEM containing 25 mM HEPES buffer with doubling serum dilutions. After a 1 h incubation at 37° C., the virus-antibody mixture was transferred to confluent monolayers of Vero E6 cells (ECACC 85020206; PHE, UK). Virus was allowed to adsorb onto cells at 37° C. for a further hour in an incubator, and the cell monolayer was overlaid with MEM/4% FBS/1.5% CMC. After 5 days incubation at 37° C., the plates were fixed, stained, with 0.2% crystal violet solution (Sigma) in 25% methanol (v/v). Plaques were counted.
S1+S2 Enzyme-Linked Immunosorbent Assay (ELISA)
ELISA plates were coated with 2.0 mg/mL recombinant SARS-CoV-2 S1+S2 spike protein (Acro Biosystems; SPN-052H8) and incubated overnight at 2-8° C. The S1+S2 contains amino acids residues Val 16-Pro 1213 of the full length spike protein, GenBank #QHD43416.1. It contains two mutations to stabilize the protein to the trimeric pre-fusion state (R683A, R685A) and also contains a C-terminal 10×His tag (SEQ ID NO: 24). The plates were then washed with PBS with 0.05% Tween-20 (Sigma; P3563) and blocked (Starting Block, Thermo Scientific; 37,538) for 1-3 h at room temperature. Samples were serially diluted using blocking buffer and were added in duplicate, along with prepared controls, to the washed and blocked assay plates. The samples were incubated on the blocked assay plates for one hour at room temperature. Following sample and control incubation, the plates were washed and a 1/1000 preparation of anti-human IgG HRP conjugate (BD Pharmingen; 555,788) in blocking buffer was then added to each well and allowed to incubate for 1 h at room temperature. The plates were washed and TMB substrate (KPL; 5120-0077) was then added and allowed to incubate at room temperature for approximately 10 min. TMB Stop Solution (KPL; 5150-0021) was next added and the plates read at 450 nm and 650 nm on a Synergy HTX Micro-plate Reader (BioTek). The magnitude of the assay response was expressed as titers which were defined as the greatest reciprocal dilution factor of the greatest dilution serial dilution at which the plate corrected optical density is 3 SD above background a subject's corresponding Week 0.
SARS-CoV-2 Spike ELISpot Assay
Peripheral mononuclear cells (PBMCs) pre- and post-vaccination were stimulated in vitro with 15-mer peptides (overlapping by 9 residues) spanning the full-length consensus spike protein sequence. Cells were incubated overnight in an incubator with peptide pools at a concentration of 5 mg per ml in a precoated ELISpot plate, (Mab-Tech, Human IFN-g ELISpot Plus). The next day, cells were washed off, and the plates were developed via a biotinylated anti-IFN-g detection antibody followed by a streptavidin-enzyme conjugate resulting in visible spots. Each spot corresponds to an individual cytokine-secreting cell. After plates were developed, spots were scanned and quantified using the CTL S6 Micro Analyzer (CTL) with Immuno-Capture and ImmunoSpot software. Values are shown as the background-subtracted average of measured triplicates. The ELISpot assay qualification determined that 12 spot forming units was the lower limit of detection. Thus, anything above this cutoff is considered to be a signal of an antigen specific cellular response.
INO-4800 SARS-CoV-2 Spike Flow Cytometry Assay
PBMCs were also used for Intracellular Cytokine Staining (ICS)analysis using flow cytometry. One million PMBCs in 200 mL complete RPMI media were stimulated for six hours (37° C., 5% CO2) with DMSO (negative control), PMA and Ionomycin (positive control, 100 ng/mL and 2 mg/mL, respectively), or with the indicated peptide pools (225 μg/mL). After one hour of stimulation, Brefeldin A and Monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of expressed cytokines. After stimulation the cells were moved to 4° C. overnight. Next, cells were washed in PBS for live/dead staining (Life Technologies Live/Dead aqua fixable viability dye), and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Next, extracellular markers were stained, the cells were fixed and permeabilized (eBioscience™ Foxp3Kit) and then stained for the indicated cytokines (Table 9) using fluorescently conjugated antibodies.
Statistical Analysis
No formal power analysis was applicable to this trial. Descriptive statistics were used to summarize the safety end-points: proportions with AEs, administration site reactions, and AESIs through 8 weeks. Descriptive statistics were also used to summarize the immunogenicity endpoints: median responses (with 95% confidence intervals) and percentage of responders for cellular results, and geometric mean titers (with 95% confidence intervals) and percentage of responders for humoral results. Post-hoc analyses of post-vaccination minus pre-vaccination paired differences in SARS-CoV-2 neutralization responses (on the natural log-scale, with a paired t-test), ELISpot responses (with Wilcoxon signed-rank tests), and Intracellular Flow Assay responses (with Wilcoxon signed-rank tests) were performed.
Results
Study Population Demographics
A total of 55 participants were screened and 40 participants were enrolled into the initial two groups (
Vaccine Safety and Tolerability
A total of 39 of 40 (97.5%) participants completed both doses; one participant in the 2.0 mg group discontinued trial participation prior to receiving the second dose due to lack of transportation to the clinical sites, and discontinuation was unrelated to the study or the dosing (
Immunogenicity
Thirty-eight subjects were included in the immunogenicity analyses. In addition to one subject in the 2.0 mg group who discontinued prior to completing dosing, one subject in the 1.0 mg group was deemed seropositive at baseline and was excluded. Data for this subject can be found in Table 11.
Humoral Immune Responses
Sera was tested for the ability to bind S1+S2 spike protein. 89%(17/19) of participants in the 1.0 mg group and 95% (18/19) of participants in the 2.0 mg group had an increase in serum IgG binding titers to S1+S2 spike protein when compared to their pre-vaccination timepoint (Week 0), with the responder GMT of 655.5 (95% CI:255.6, 1681.0) and 994.2 (95% CI: 395.3, 2500.3) in the 1.0 mg and 2.0 mg groups, respectively (
Enzyme-Linked Immunospot (ELISpot)
The percentage of responders at week 8 was 74% (14/19) in the 1.0 mg dose group, and 100% (19/19) in the 2.0 mg dose group. These data taken with the seroconversion data result in a 100% (19/19) overall immune response in each group (Table 13,
Intracellular Flow Assay
The contribution of CD4+ and CD8+ T cells to the cellular immune response against INO-4800 was assessed by intracellular cytokine staining (ICS). In the 2.0 mg dose group, the median change from baseline to Week 6 in CD8+ T cells producing IFN-γ, TNF-α and/or IL-2 (Any Response) was 0.11 with a 95% CI of (−0.02, 0.23); the change was significantly increased (P=0.0181, Wilcoxon matched-pairs signed rank test, post-hoc analysis). owing chiefly to significant increases in IFN-γ as well as TNF-α production (
INO-4800 was well tolerated with a frequency of product-related Grade 1 AEs of 15% (3/20 subjects) and 10% (2/20 subjects) of the participants in 1.0 mg and 2.0 mg dose group, respectively. Only Grade 1 AEs were noted in the study, which compares favorably with existing licensed vaccines. The safety profile of a successful COVID-19 vaccine is important and supports broad development of INO-4800 in at-risk populations who are at more serious risk of complications from SARS-CoV-2 infection, including the elderly and those with comorbidities. INO-4800 also generated balanced humoral and cellular immune responses with all 38 evaluable participants displaying either or both antibody or T cell responses following two doses of INO-4800. Humoral responses measured by binding or neutralizing antibodies were observed in 95% (18/19) of the participants in each dose group. The neutralizing antibodies, measured by live virus neutralization assay, were seen in 78% (14/18) and 84% (16/19) of participants, and the corresponding GMTs were 102.3 [95% CI (37.4, 280.3)] and 63.5[95% CI (39.6, 101.8)] for the 1.0 mg and 2.0 mg dose groups, respectively. The range overlaps that of the PRNT IC50 titers reported from convalescent patients as well as the PRNT IC50 titers in NHPs which were protected in a SARS-CoV-2 challenge. Furthermore, there was a statistically significant increase in titers. It is important to note that all but one vaccine recipient that did not develop neutralizing antibody titers responded positively in the T cell ELISpot assay, suggesting that the immune responses generated by the vaccine are registering differentially in these assays. Cellular immune responses were observed in 74% (14/19) and 100% (19/19) of 1.0 mg and 2.0 mg dose groups, respectively. Importantly, INO-4800 generated T cell responses that were more frequent and with higher responder median responses (46 [95% CI (21.1, 142.2)] vs. 71 [95% CI (32.2, 194.4)] SFU 106 PBMC) in the 1.0 mg and 2.0 mg dose groups respectively. These T cell responses in the 2.0 mg dose group were higher in magnitude than convalescent samples tested (
In this Phase 1 trial, INO-4800 vaccination led to substantial T cell responses with increased Th1 phenotype, measured by both IFN-γ ELISpot as well as multiparametric flow cytometry, as evidenced by increased expression of Th1-type cytokines IFN-γ, TNF-α, and IL-2 (
Percents listed are the contributions of each output to the total cytokine response
‡Response criteria: Live Neutralization—Week 6 PRNT IC50 ≥ 10, or ≥ 4 if binding ELISA activity is seen;
μ Responders gener ated using Week 6 or Week 8 data
Expanded Phase I Study
120 healthy volunteers were evaluated across three (3) dose levels (Study Groups). A total of 40 subjects were enrolled into each Study Group. Enrollment into each Study Group was stratified by age; n=20 for 18-50 years, n=10 for 51-64 years, and n=10>65 years (Table 14).
Subjects were adults aged at least 18 years; judged to be healthy by the Investigator on the basis of medical history, physical examination and vital signs performed at Screening; able and willing to comply with all study procedures; screening laboratory results within normal limits for testing laboratory or deemed not clinically significant by the Investigator; Body Mass Index of 18-30 kg/m2, inclusive, at Screening; negative serological tests for Hepatitis B surface antigen (HBsAg), Hepatitis C antibody and Human Immunodeficiency Virus (HIV) antibody at screening; screening ECG deemed by the Investigator as having no clinically significant findings (e.g. Wolff-Parkinson-White syndrome); and must have met one of the following criteria with respect to reproductive capacity: women who are post-menopausal as defined by spontaneous amenorrhea for ≥12 months; surgically sterile or have a partner who is sterile; use of medically effective contraception. Exclusion criteria were as follows: pregnant or breastfeeding, or intending to become pregnant or father children within the projected duration of the trial starting with the screening visit until 3 months following last dose; positive serum pregnancy test during screening or positive urine pregnancy test prior to dosing; currently participating in or has participated in a study with an investigational product within 30 days preceding Day 0; previous exposure to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or receipt of an investigational product for the prevention or treatment of COVID-19, middle east respiratory syndrome (MERS), or severe acute respiratory syndrome (SARS); in a current occupation with high risk of exposure to SARS-CoV-2 (e.g., health care workers or emergency response personnel having direct interactions with or providing direct care to patients); current or history of respiratory disease, hypersensitivity or severe allergic reactions to vaccines or drugs, diagnosis of diabetes mellitus, hypertension, malignancy within 5 years of screening, or cardiovascular disease; immunosuppression as a result of underlying illness or treatment, including primary immunodeficiencies, long term use (≥7 days) of oral or parenteral glucocorticoids, current or anticipated use of disease-modifying doses of anti-rheumatic drugs and biologic disease-modifying drugs, history of solid organ or bone marrow transplantation, and prior history of other clinically significant immunosuppressive or clinically diagnosed autoimmune disease; fewer than two acceptable sites available for ID injection and EP considering the deltoid and anterolateral quadriceps muscles; or reported smoking, vaping, or active drug, alcohol or substance abuse or dependence; or any physical examination findings and/or history of any illness that, in the opinion of the study investigator, might confound the results of the study or pose an additional risk to the patient by their participation in the study.
All subjects received dosing on Day 0 and Week 4 (Table 15). Subjects who consented to receive the booster dose (Table 16) received the booster dose no earlier than Week 12 in their dosing schedule with the same dose previously received for their two-dose regimen (Day 0 and Week 4). Safety and immunogenicity were evaluated at 2 weeks following the booster dose.
2a
aINO-4800 will be injected ID followed by EP in an acceptable location on two different limbs at each dosing visit
bOptional booster dose delivered no earlier than Week 12 in their dosing schedule with the same dose previously received for their two-dose regimen.
Subjects not receiving an optional booster dose will be followed to the End of Study (EOS) visit at Week 52 (Table 15). For subjects receiving an optional booster dose, the 48 Week Post-Booster Dose Visit will be the EOS visit (Table 16).
Primary Objectives:
Primary Safety Endpoints:
Primary Immunogenicity Endpoints:
Exploratory Objectives:
Safety Assessment:
Subjects will be followed for safety for the duration of the trial through EOS or the subject's last visit. Adverse events will be collected at every visit (including the Day 1 and 36 Week Post-Booster Dose phone calls). Laboratory blood and urine samples will be drawn according to the Schedule of Events (Table 15 and Table 16).
Xh
Xh
aScreening assessment occurs from −30 days to −1 day prior to Day 0.
bFull physical examination at screening and Week 52 (or any other study discontinuation visit) only. Targeted physical exam at all other visits.
cIncludes Na, K, CI, HCO3, Ca, PO4, glucose, BUN, Cr, AST, ALT and TBili.
dHIV antibody or rapid test, HBsAg, HCV antibody.
eDipstick for glucose, protein, and hematuria. Microscopic examination should be performed if dipstick is abnormal.
fSerum pregnancy test at screening. Urine pregnancy test at other visits.
gAll doses delivered via intradermal injection followed by EP.
hFor Study Groups Groups 1 and 3, one injection in skin preferably over deltiod muscle at Day 0 and Week 4. For Study Group 2, two injections in skin with each injection over a different deltoid or lateral quadriceps; preferably over the deltoid muscles, at Day 0 and Week 4.
iFollowing administration of INO-4800 + EP, EP data will be downloaded from the CELLECTR A® 2000 device and provided to Inovio.
jIncludes AEs from the time of consent and all injection site reactions that qualify as an AE.
kFollow-up phone call to collect AEs.
l4 × 8.5 mL (34 mL) whole blood in 10 mL Acid Citrate Dextrose (ACD, Yellow top) tubes per time point. Note: Collect a total of 68 mL whole blood prior to 1st dose (screening and prior to Day 0 dosing).
m1 × 8 mL blood in 10 mL red top serum collection tube per time point. Note: Collect four aliquots of 1 mL each (total 4 mL) serum at each time point prior to 1st dose (Screening and prior to Day 0 dosing).
Xf
aFull physical examination at the 48 Week Post-Booster Dose Visit (or any other study discontinuation visit) only. Targeted physical exam at all other visits.
bIncludes Na, K, CI, HCO3, Ca, PO4, glucose, BUN, Cr, AST, ALT and TBili.
cDipstick for glucose, protein, and hematuria. Microscopic examination should be performed if dipstick is abnormal.
dUrine pregnancy test must be negative prior to receiving booster dose.
eAll doses delivered via intradermal injection followed by EP.
fFor Study Groups 1 and 3, one injection in skin preferably over deltiod muscle (or alternatively, lateral quadriceps) at the Booster Dose Visit. For Study Group 2, two injections in skin with each injection over a different deltoid or lateral quadriceps; preferably over the deltoid muscles, at the Booster Dose Visit.
gFollowing administration of INO-4800 + EP, EP data will be downloaded from the CELLECTRA ® 2000 device and provided to Inovio.
hIncludes AEs from the time of consent and all injection site reactions that qualify as an AE.
iFollow-up phone call to collect AEs.
j4 × 8.5 mL (34 mL) whole blood in 10 mL Acid Citrate Dextrose (ACD, Yellow top) tubes per time point.
k1 × 8 mL blood in 10 mL red top serum collection tube per time point.
Immunogenicity Assessment:
Immunology blood samples will be collected according to the Schedule of Events (Table 15 and Table 16).
SARS-CoV-2 Pseudovirus Neutralization Assay: Serum samples from INO-4800 vaccines were measured using a pseudovirus neutralization assay as described above. Data was reported as ID50, which is the reciprocal serum dilution resulting in 50% inhibition of infectivity by comparison to control wells with no serum samples added.
SARS-CoV-2 Spike Enzyme-Linked Immunosorbent Assay (ELISA): Binding antibodies to SARS-CoV-2 spike protein were measured by ELISA as described above. SARS-CoV-2 spike antibody concentrations were determined by interpolation from a dilution curve of SARS-CoV-2 convalescent plasma with an assigned concentration of 20,000 Units per mL.
SARS-CoV-2 Spike ELISpot Assay: The SARS-CoV-2 spike antigen-specific IFN-γ T-cell response was measured as described above. Values were reported as the mean spot-forming units per million PBMCs across three triplicate wells after background subtraction using DMSO-only negative control wells.
INO-4800 SARS-CoV-2 Spike Flow Cytometry Assays:
PBMCs were used for Intracellular Cytokine Staining (ICS) analysis using flow cytometry. One million PMBCs in 200 mL complete RPMI media were stimulated for six hours (37° C., 5% CO2) with DMSO (negative control), PMA and Ionomycin (positive control, 100 ng/mL and 2 mg/mL, respectively), or with the indicated peptide pools (225 ug/mL). After one hour of stimulation, Brefeldin A and Monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of expressed cytokines. After stimulation the cells were moved to 4° C. overnight. Next, cells were washed in PBS for live/dead staining (Life Technologies Live/Dead aqua fixable viability dye), and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Next, extracellular markers were stained, the cells were fixed and permeabilized (eBioscience™ Foxp3 Kit) and then stained for the cytokines IFNγ, TNFα, and IL-2 using fluorescently-conjugated antibodies.
PBMCs were also assessed in Lytic Granule Loading (LGL) assays. The LGL assay was also performed as reported previously (Aggarwal, et al. Immune Therapy Targeting E6/E7 Oncogenes of Human Paillomavirus Type 6 (HPV-6) Reduces or Eliminates the Need for Surgical Intervention in the Treatment of HPV-6 Associated Recurrent Respiratory Papillomatosis. Vaccines (Basel) 2020; 8) following stimulation with overlapping peptides to the full-length spike protein to measure CD8+ T cell activation (CD38, CD69, CD137, Ki67) and capacity to produce lytic proteins (granzymes A and B, perforin and granulysin).
Statistical Analysis. No formal power analysis was applicable to this trial. Descriptive statistics were used to summarize the safety endpoints based on the safety population: proportions of participants with AEs, through 6 months following dose 2 (non-boosted participants) or 2 weeks following booster dose. The safety population included all participants who received at least one dose of INO-4800 and were grouped by age and the dose of INO-4800. Post-hoc within subject analyses of post-vaccination minus pre-vaccination paired differences in SARS-CoV-2 neutralization and ELISA spike responses (on the natural log-scale, with a paired t-test), ELISpot responses (with Wilcoxon signed-rank tests), and flow assay responses (with Wilcoxon signed-rank tests) were performed.
Results
The majority of adverse events (AEs) related to INO-4800 were mild in severity and did not increase in frequency with age and subsequent dosings. In Phase 1, 78% (14/18) and 84% (16/19) of subjects generated neutralizing antibody responses with geometric mean titers (GMTs) of 17.4 (95% CI 8.3, 36.5) and 62.3 (95% CI 36.4, 106.7) in the 1.0 and 2.0 groups, respectively. By week 8, 74% (14/19) and 100% (19/19) subjects generated T cell responses by Th1-associated IFNγ ELISPOT assay. Following a booster dose, neutralizing GMTs rose to 82.2 (95% CI 38.2, 176.9) and 124.7 (95% CI 62.8, 247.7) in the 1.0 mg and 2.0 mg groups, respectively, demonstrating the ability of INO-4800 to boost.
Immunogenicity Assessment: After isolation, PBMCs were stored in the vapor phase of a liquid nitrogen freezer until analysis, while serum samples were stored at −80° C. Eight participants were excluded from the immunogenicity analyses due to a seropositive response, as determined by a positive ELISA titer to the SARS-CoV-2 nucleoprotein, indicating SARS-CoV-2 infection.
Trial Population Demographics
154 participants were screened and 120 enrolled into the trial (
Vaccine Safety and Tolerability
A total of 117 of 120 (97.5%) participants received both doses. One participant in the 2.0 mg group discontinued trial participation prior to receiving the second dose solely due to lack of transportation to the clinical site. Two participants in the 0.5 mg group did not receive the second dose due to exclusionary eligibility criteria (hypertension) having been determined following Dose 1 (
Ninety-nine of 120 (82.5%) participants consented to and received the booster dose, approximately 6 to 10.5 months following the second dose.
There were a total of 34 treatment-related local and systemic AEs reported by 18 participants. 31 AEs were Grade 1 (mild) in severity and comprised mostly injection site reactions. Three treatment-related Grade 2 (moderate) AEs were reported as lethargy, abdominal pain, and injection site pruritus. There were no febrile reactions reported. No participants discontinued due to AEs. No treatment-related SAEs were reported. There were no abnormal laboratory values that were deemed treatment-related and clinically significant. There was no increase in the number of participants who experienced AEs related to the vaccine in the 2.0 mg group (12.5%, 5/40), compared to that in the 1.0 mg group (15%, 6/40) or the 0.5 mg group (17.5%, 7/40). In addition, there was no appreciable increase in the frequency of AEs with the second or booster doses when compared to the first dose (
INO-4800 induces durable humoral immune responses capable of being boosted. The generation of antibodies against SARS-CoV-2 following vaccination with INO-4800 was measured from the sera of trial participants. The functional ability of antibodies was assessed using a pseudovirus neutralization assay. All three dose groups induced neutralizing antibodies that peaked two weeks following the second dose (GMTs-14.9, 19.1, 54.1 in the 0.5 mg, 1.0 mg and 2.0 mg dose groups, respectively) (
Antibodies to the spike trimer protein were measured in a binding ELISA. All three dose groups induced binding antibodies that peaked four weeks following dose 2 (GMTs-428.5, 595.9, 678.0 in the 0.5 mg, 1.0 mg and 2.0 mg dose groups, respectively) (
INO-4800 induces cellular immune responses capable of being boosted.
Interferon-gamma (IFNγ) Enzyme-linked immunospot (ELISpot) was performed on PBMCs. Increases in spot forming units (SFU) per million PBMCs over baseline are shown in
INO-4800 induces cytokine producing T cells and activated CD8+ T cells with lytic potential.
Further exploration of the T cell response was performed on participants following 2 doses. The contribution of SARS-CoV-2 specific CD4+ and CD8+ T cells was assessed by intracellular cytokine staining (ICS),
SARS-CoV-2 specific CD8+T cells were also characterized on a subset of participants with remaining sample following 3 doses by a lytic granule loading flow cytometry assay that included T cell receptor activation induced markers, CD69 and CD137. The median frequency of CD8+CD69+CD137+ cells increased following immunization with 2.0 mg of INO-4800, with a difference in the medians of 0.072 (
Conclusions. INO-4800 appeared to be well-tolerated at all three dose levels, with no treatment-related serious adverse events reported. Most adverse events were mild in severity and did not increase in frequency with age and subsequent dosing.
Induction of both humoral and cellular responses were observed across all three dose groups in the current trial, inclusive of binding and neutralizing antibodies and cytokine producing T cells as well as exhibiting lytic potential in response to SARS-CoV-2 spike antigen. Immunization with the 2.0 mg dose of INO-4800 resulted in the highest GMTs of neutralizing and binding antibodies as well as the highest magnitudes of IFNγ production to SARS-CoV-2 of any dose in all age groups tested, and the increase in antibody levels were statistically significant above baseline out to 6 months following dose 2. Importantly, increases in both humoral and cellular immune responses were statistically significant following the booster dose.
This is a Phase 2/3, randomized, placebo-controlled, multi-center trial to evaluate the safety, immunogenicity and efficacy of INO-4800 administered by intradermal (ID) injection followed by electroporation (EP) using CELLECTRA® 2000 device to prevent COVID-19 in adult participants at high risk of exposure to SARS-CoV-2. The Phase 2 segment will evaluate immunogenicity and safety in approximately 400 participants at two dose levels across three age groups. Safety and immunogenicity information from the Phase 2 segment will be used to determine the dose level for the Phase 3 efficacy segment of the study involving approximately 7116 participants.
Primary Outcome Measure:
3. Phase 3: Percentage of Participants (SARS-CoV-2 seronegative at baseline) With Virologically Confirmed COVID-19 Disease [Time Frame: From 14 days after completion of the 2-dose regimen up to 12 months post-dose 2 (i.e. Day 42 up to Day 393)]
Secondary Outcome Measures:
1. Phase 2 and 3: Percentage of Participants with Solicited and Unsolicited Injection Site Reactions [Time Frame: From time of consent up to 28 days post-dose 2 (up to Day 56)]
2. Phase 2 and 3: Percentage of Participants with Solicited and Unsolicited Systemic Adverse Events (AEs) [Time Frame: From time of consent up to 28 days post-dose 2 (up to Day 56)]
3. Phase 2 and 3: Percentage of Participants with Serious Adverse Events (SAEs) [Time Frame: Baseline up to Day 393]
4. Phase 2 and 3: Percentage of Participants with Adverse Events of Special Interest (AESIs) [Time Frame: Baseline up to Day 393]
5. Phase 3: Percentage of Participants With Death from All Causes [Time Frame: Baseline up to Day 393]
6. Phase 3: Percentage of Participants (SARS-CoV-2 seronegative at baseline) With Non-Severe COVID-19 Disease [Time Frame: From 14 days after completion of the 2-dose regimen up to 12 months post-dose 2 (i.e. Day 42 up to Day 393)]
7. Phase 3: Percentage of Participants (SARS-CoV-2 seronegative at baseline) With Severe COVID-19 Disease [Time Frame: From 14 days after completion of the 2-dose regimen up to 12 months post-dose 2 (i.e. Day 42 up to Day 393)]
8. Phase 3: Percentage of Participants (SARS-CoV-2 seronegative at baseline) With Death from COVID-19 Disease [Time Frame: From 14 days after completion of the 2-dose regimen up to 12 months post-dose 2 (i.e. Day 42 up to Day 393)]
9. Phase 3: Percentage of Participants (SARS-CoV-2 seropositive at baseline) With Virologically-Confirmed COVID-19 Disease [Time Frame: From 14 days after completion of the 2-dose regimen up to 12 months post-dose 2 (i.e. Day 42 up to Day 393)]
Eligibility Criteria
Ages Eligible for Study: 18 Years and older
Key Inclusion Criteria:
Key Exclusion Criteria:
Study Design and Participants: The clinical trial was designed as a Phase 2/3, randomized, placebo-controlled, multi-center trial (NCT04642638; other study identifiers: COVID19-311, INNOVATE) to evaluate the safety, immunogenicity, and efficacy of INO-4800 administered intradermally (ID) followed by electroporation (EP). The Phase 2 segment is designed to further evaluate the safety and immunogenicity of two doses of INO-4800 (1.0 mg and 2.0 mg) in a 2-dose regimen in SARS-CoV-2 seronegative adults to select the dose for efficacy evaluation in the Phase 3 segment. The findings reported here are applicable to the Phase 2 segment. The clinical trial protocol was approved by a central and site-specific institutional review board. The conduct of the study was performed under current Good Clinical Practices. All participants provided written informed consent before enrollment. Healthy participants at least 18 years of age with a high risk of exposure to SARS-CoV-2 were randomized as described below.
The primary endpoints for the Phase 2 segment were immunologic in nature and comprised antigen-specific cellular immune responses measured by IFN-gamma ELISpot assay and neutralizing antibody responses as measured by a pseudovirus-based neutralization assay. The secondary endpoints focused on safety and tolerability, measuring the incidence of solicited and unsolicited local and systemic reactions, including serious adverse events (SAEs) and adverse events of special interest (AESIs). For the purposes of this example, immunology endpoints were assessed at Week 6 (2 weeks post-dose 2) and safety and tolerability endpoints were assessed at Week 8. As specified in the clinical trial protocol, group-level unblinded interim summaries of the immunogenicity and safety data were produced, while maintaining subject-level blinding. Long-term follow-up data will continue to be collected for all subjects who have not discontinued with remaining visits through the final visit. Because subject-level blinding was to be maintained, not all of the adverse events can be displayed in by-treatment group summary tables.
DNA Vaccine INO-4800
The vaccine was produced according to current Good Manufacturing Practices. INO-4800 contains plasmid pGX9501 expressing a synthetic, full-length sequence of the SARS-CoV-2 Spike glycoprotein of the original Wuhan strain. The placebo group received equivalent volumes of saline sodium citrate buffer.
Electroporation following ID administration of INO-4800 is delivered using the CELLECTRA® 2000 device that generates a controlled electric field at the injection site to enhance the cellular uptake and expression of the DNA plasmid. The device delivers a total of four electrical pulses per EP, each pulse of 52 msec in duration, at strengths of 0.2 Amp current and voltage of 40-200 V per pulse.
Study Procedures
Eligible participants were randomized at a 3:3:1:1 ratio to receive one or two 1.0 mg ID injection(s) of INO-4800 or one or two ID injection(s) of placebo, followed by EP, administered at Days 0 and 28. The injection was administered in 0.1 mL volume over the deltoid or anterolateral quadriceps muscles followed by EP using CELLECTRA® 2000 as previously described (Gary E N, Weiner D B. DNA vaccines: prime time is now. Current Opinion in Immunology 2020; 65: 21-7). Participants in the 1.0 mg (or placebo) dose group received a single ID injection at each dosing visit with the second dose being administered similarly in a different limb (arm or leg) from the first dose. Participants in the 2.0 mg (or placebo) dose group received a single injection in 2 different limbs at each dosing visit.
Participants were assessed for safety and tolerability at screening, Days 0 (dose 1), 7, 28 (dose 2), 35, 42, 56, 210, and 392 post-dose 1. A participant diary was administered in the Phase 2 segment to collect solicited local and systemic AEs on the day of dosing and for 6 days following each dose. Local and systemic AEs, regardless of relationship to the vaccine, were assessed, recorded and graded by the Investigator. Safety laboratory testing (complete blood count, comprehensive metabolic panel, and urinalysis) were collected at screening, Days 0, 28, 42, and 392 post-dose 1. AEs were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 5.0. Injection site reactions were graded per the Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines that were issued by the Food and Drug Administration in September 2007. An independent Data Safety Monitoring Board (DSMB) was chartered to review AE and laboratory data on a regular basis and reviewed the Day 56 (Week 8) safety data presented in this report. There were protocol-specified safety stopping rules.
If participants developed any symptoms suggestive of COVID-19, they were evaluated by the Investigator to include RT-PCR testing for SARS-CoV-2. Participants developing COVID-19 prior to receiving dose 2 were not permitted to receive dose 2.
Immunology specimens (cellular and humoral samples) were collected pre-dose at Week 0, at Week 6, 30, and 56.
Immunogenicity Assessment Methods
Samples collected at Week 0 and Week 6 were analyzed. Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples by a standard overlay on Ficoll Hypaque followed by centrifugation. Isolated cells were frozen in 10% DMSO and 90% fetal calf serum. The frozen PBMCs were stored in liquid nitrogen for subsequent analyses. Serum samples were obtained from whole blood collection and stored at −80° C. until used to measure binding and neutralizing antibody titers.
SARS-CoV-2 Pseudovirus Neutralization Assay: SARS-CoV-2-DeltaCT pseudovirus was produced from HEK 293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent) at a 1:1 ratio. SARS-CoV-2-DeltaCT pseudovirus was titered to yield greater than 20 times the cells only control relative luminescence units (RLU) after 72 h of infection. The assay was performed in a 96 well plate using 10,000 CHO cells stably expressing human ACE2 as target cells (Creative Biolabs, Catalog No. VCeL-Wyb019) in 100 μl D10 (DMEM supplemented with 10% FBS and 1× Penicillin-Streptomycin) media. On the following day, heat inactivated sera from INO-4800 vaccinated subjects were serially diluted as desired and incubated with a fixed amount of SARS CoV-2-DeltaCT pseudovirus for 90 minutes at room temperature. The sera and pseudovirus mix were transferred to the plated cells and incubated for 72 h. Cells were then lysed using britelite plus luminescence reporter gene assay system (Perkin Elmer Catalog no. 6066769) and RLU were measured using the Biotek plate reader. Neutralization titers (ID50) were defined as the reciprocal serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells. Data for percent neutralization vs serum dilution was fitted to nonlinear regression i.e., log(inhibitor) vs. normalized response—Variable slope Least squares fit to obtain an ID50 value. All calculations were done using GraphPad Prism 8. S1+S2 Enzyme-Linked Immunosorbent Assay (ELISA): ELISA plates were coated with 2.0 μg/mL recombinant SARS-CoV-2 S1+S2 spike trimer protein (Acro Biosystems; SPN-052H9) containing a C-terminal His tag, seven proline substitutions for trimer stabilization (F817P, A892P, A899P, A942P, K986P, V987P) and two mutations (R683A and R685A) to remove the furin cleavage sequence. The plates were then washed 4× with PBS with 0.05% Tween-20 (Sigma; P3563) and blocked (Starting Block, Thermo Scientific; 37538) for 1-3 hours. Serum samples were diluted a minimum of 1/20 in Starting Block and were added in duplicate to the washed and blocked assay plates. The samples were incubated for 2 hours at room temperature on a plate shaker set at 600 rpm. After washing three times in PBS containing 0.05% Tween-20, anti-human IgG HRP conjugate (BD Pharmingen; 555,788), diluted 1/1000 in Starting Block, was added to plates and incubated for 60 minutes at room temperature on a plate shaker set at 600 rpm. Plates were then washed three times in PBS containing 0.05% Tween-20, and TMB substrate (KPL; 5120-0077) was added to plates incubated for approximately nine minutes. Stop solution was added (KPL; 5150-0021), and optical density at 450 nm with background correction at 650 nm was read using a Synergy HTX Microplate Reader (BioTek). Antibody concentration in Units per mL (U/mL) were determined by interpolation from a four-parameter logistic model fit to a standard curve of reference convalescent plasma obtained >28 days after symptom onset from a PCR-confirmed SARS-CoV-2-recovered donor and arbitrarily assigned a concentration of 20,000 U/mL.
SARS-CoV-2 Spike ELISpot Assay Description: The ELISpot assay was performed as described previously (Tebas P, Yang S, Boyer J D, et al. Safety and immunogenicity of INO-4800 DNA vaccine against SARS-CoV-2: A preliminary report of an open-label, Phase 1 clinical trial. EClinicalMedicine 2021; 31: 100689.) Peripheral mononuclear cells (PBMCs) obtained at pre- and post-vaccination were stimulated overnight on precoated interferon-γ ELISpot plates (MabTech, Human IFN-γ ELISpot Plus) using overlapping 15-mer peptides comprising the entire spike protein sequence. Following overnight stimulation, ELISpot plates were processed for the detection of cellular IFN-γ production as according to the manufacturer's instructions. Following the development of spots corresponding to cellular IFN-γ secretion, plates were scanned using a CTL S6 Micro Analyzer (CTL). Spots on the 96-well plates were counted using ImmunoCapture and ImmunoSpot software (CTL). Counts from negative control wells containing PBMCS with media only were subtracted from the counts of wells containing peptide stimulation. Reported values consisted of the mean counts across triplicate wells and were expressed as the number of spot forming units per million PBMCs. The ELISpot assay qualification determined that 12 spot-forming units (SFU) was the lower limit of detection. Thus, anything above this cutoff is considered to be a signal of an antigen-specific cellular response.
Statistical Analysis
No formal power analysis was applicable to this trial. Descriptive statistics were used to summarize the safety endpoints: proportions with AEs, administration site reactions, and AESIs through 8 weeks. Descriptive statistics were also used to summarize the immunogenicity endpoints: post-baseline increases from baseline in interferon-γ ELISpot response magnitudes were compared between treatment groups using differences in medians and associated nonparametric 95% CIs for cellular results, and post-baseline increases from baseline in neutralizing antibody response titers were compared between treatment groups using ratios of geometric mean fold rises (GMFR) and associated t-distribution based 95% CIs.
Results
Study Population Demographics
A total of 619 participants were screened, with a 35% screen-fail rate; and 401 participants were randomized by sixteen U.S. sites, each enrolling 6 to 55 participants. A total of 259 enrolled participants were 18-50 years of age. 142 were >51 years of age (32 were 65 years or older). A total of 201 participants were randomized to receive either INO-4800 as a 1.0 mg dose or placebo (both as single injections) and 200 participants were randomized to receive INO-4800 as a 2.0 mg dose or placebo (both as 2 injections per visit) with each injection followed by EP in a 2-dose regimen (Days 0 and 28) (
A total of 399 of 401 (99.5%) randomized participants were dosed and contributed to the safety population. Two randomized participants were not dosed due to the loss to follow-up. Of the 399 participants who were dosed, 374 (93.3%) completed both doses. The reasons for not receiving the 2nd dose were mainly due to opting to receive an emergency use authorized vaccine. A total of 374 participants completed a minimum follow-up of 28 days post-dose 2. A total of 23 participants were discontinued prior to Week 8 due to withdrawal by subject and lost to follow-up.
Of a total of 1153 ID injections administered to 399 participants, 1131 (98%) were administered in the arm and 22 in the leg (10 participants).
Vaccine Safety and Tolerability
There were a total of 1,679 AEs recorded in 300 subjects through week 8. Of these, 1,446 treatment-related AEs were recorded in 281 subjects. The most common treatment-related (i.e., related to either investigational product or EP) AEs observed in greater than 5% of participants (Table 21) were injection site reactions (pruritis, 42 participants in 1.0 mg dose and 65 participants in 2.0 mg dose; pain, 35 participants in 1.0 mg dose and 41 participants in 2.0 mg dose; erythema, 25 participants in 1.0 mg dose and 36 participants in 2.0 mg dose; and swelling, 16 participants in 1.0 mg dose and 23 participants in 2.0 mg dose), fatigue (37 participants in 1.0 mg dose and 48 participants in 2.0 mg dose), headache (34 participants in 1.0 mg dose and 43 participants in 2.0 mg dose), myalgia/arthralgia (37 participants in 1.0 mg dose and 67 participants in 2.0 mg dose), and nausea (11 participants in 1.0 mg dose and 11 participants in 2.0 mg dose).
The majority of AEs were Grade 1 and Grade 2 in severity and did not appear to increase in frequency with the second dose. Three Grade 3 AEs were reported: arthralgia (related to treatment), and cervical dysplasia and skin laceration (both not related to treatment). The single case of Grade 3 arthralgia occurred in a participant with a history of shoulder arthroscopy and in whom the arthralgia was limited to the previously injured shoulder. There were no Grade 4 AEs, no AESIs and no related SAEs. A single SAE of spontaneous abortion was assessed as not related to treatment. The number of participants experiencing each of the most common AEs did not differ appreciably between the two dosing groups. (Table 21). The clinical plan is to follow the current Phase 2 participants for 12 months post-dose 2 for long-term safety.
The majority of AEs were Grade 1 in severity and did not appear to increase in frequency with the second dose (
Immunogenicity
Immunogenicity analyses included evaluating changes from baseline to Week 6 of binding antibody titers by ELISA, pseudovirus neutralizing antibody titers, and Interferon-γ ELISpot spot forming units (SFU). Subjects that completed two doses with Dose 2 at least 25 days after Dose 1, and who were not NP-positive were included in the analyses. Evaluable baseline samples and evaluable Week 6 samples that were at least 6 and at most 30 days after Dose 2 were included in the analyses.
Humoral Immune Responses
Sera from placebo and INO-4800 participants were tested blindly for the ability to bind S1+S2 spike protein of SARS-CoV-2. At week 6, the geometric mean titers (GMT) (SD of log 10) of binding antibody in the 1.0 mg and 2.0 mg dose groups were 938.8 (0.76) and 2210.0 (0.75) Units/ml (U/ml), respectively, compared with baseline GMT (SD) of 123.3 (0.68) and 93.5 (0.48) U/ml, respectively; the GMT (SD) of binding antibody in the 1- and 2-injection placebo groups at this timepoint were 92.8 (0.43) and 145.6 (0.54) U/ml, respectively, compared with baseline GMT (SD) of 110.2 (0.51) and 123.8 (0.52) U/ml, respectively (Table 22). The geometric mean fold rise (GMFR)(95% CI) was statistically significantly greater in the 1.0 mg dose group versus the 1 injection placebo group 8.34 (4.92, 14.14) as well as in the 2.0 mg dose group versus the 2 injection placebo group 19.99 (11.74, 34.03). The geometric mean fold rise (GMFR)(95% CI) was statistically significantly greater in the 2.0 mg dose group versus the 1.0 mg dose group 3.03 (2.04, 4.44).
aStandard Deviation (SD) of the log10 titer values
Sera were also tested for the ability to neutralize SARS-CoV-2-DeltaCT pseudovirus. At week 6, the geometric mean titers (GMT) (SD of log 10) of neutralizing antibody in the 1.0 mg and 2.0 mg dose groups were 93.6 (0.47) and 150.6 (0.46), respectively, compared with baseline GMT (SD) of 32.2 (0.38) and 35.8 (0.45), respectively (Table 23). The GMFR (SD) of neutralizing antibody at Week 6 relative to baseline in the 1.0 mg and 2.0 mg dose groups were 2.9 (0.45) and 4.3 (0.53), respectively; the GMFR (SD) of neutralizing antibody in the 1- and 2-injection placebo groups at this timepoint were 1.2 (0.32) and 1.0 (0.34), respectively (Table 23). The GMFR (95% CI) was statistically significantly greater in the 2.0 mg dose group versus the 1.0 mg dose group 1.47 (1.12, 1.92). The binding antibody and neutralizing antibody responses were similar among different age groups. Tables are provided for binding antibody responses by ELISA in 18- to 50-year-olds (Table 24), ≥51-year-olds (Table 25), and >65-year-olds (Table 26) and for pseudo neutralization data in 18- to 50 year-olds (Table 27), ≥51-year-olds (Table 28), and >65-year-olds (Table 29).
aStandard Deviation (SD) of the log10 titer values
aStandard Deviation (SD) of the log10 titer values
aStandard Deviation (SD) of the log10 titer values
aStandard Deviation (SD) of the log10 titer values
aStandard Deviation (SD) of the log10 titer values
aStandard Deviation (SD) of the log10 titer values
Enzyme-Linked Immunospot (ELISpot)
Peripheral blood mononuclear cells (PBMCs) collected from study participants were tested blindly to measure T cell immune responses using the IFN-γ ELISpot assay. The median increase from baseline to Week 6 was 0.00 in both the 1- and 2-injection placebo groups, with max increases of 47.7 and 35.5 spot forming units (SFU) per 106 PBMC observed in the 1- and 2-injection groups, respectively (Table 30). In the INO-4800 vaccinated groups, the median (min-max) increase from baseline to Week 6 was 3.40 (0.0-90.0) SFU per 106 PBMC in the 1.0 mg dose group and 12.75 (0.0-465.0) SFU per 106 PBMC in the 2.0 mg dose group Table 30). Magnitudes of IFN-γ trended higher in the 1.0 mg INO-4800 group compared to the 1-injection placebo group and were statistically significantly higher in the 2.0 mg INO-4800 group compared to the 2-injection placebo group. T cell immune responses were similar across different age groups. Supplementary tables are provided for T-cell responses by ELISpot in 18- to 50-year-olds (Table 31), ≥51-year-olds (Table 32), and >65-year-olds (Table 33).
aIf post-value is less than or equal to pre-value then increase = 0.
aIf post-value is less than or equal to pre-value then increase = 0.
aIf post-value is less than or equal to pre-value then increase = 0.
aIf post-value is less than or equal to pre-value then increase = 0.
Discussion
The majority of adverse events (AEs) were Grade 1 and Grade 2 in severity and did not appreciably appear to increase in frequency with the second dose. The majority of AEs were Grade 1 in severity, and importantly, did not appear to increase in frequency with the second dose. The one case of treatment-related Grade 3 AE was arthralgia. A single SAE of spontaneous abortion was deemed not related to treatment.
INO-4800 generated balanced humoral and cellular immune responses in both 1.0 mg and 2.0 mg dose levels measured at Week 6 compared to the baseline levels at Day 0 (pre-dose) or compared to the placebo subjects at week 6 in all age groups tested. INO-4800 induced antibody responses in each INO-4800 dose group, which were capable of both binding and neutralization (Tables 22 and 23). At Week 6, both the 1.0 mg and 2.0 mg dose groups had GMFR values which were statistically significantly greater than each respective placebo group, and the 2.0 mg dose group was statistically higher than the 1.0 mg dose group.
The results were similar for the neutralizing antibody at Week 6, with the GMFR statistically significantly greater for both 1.0 mg and 2.0 mg dose groups versus the 1 injection and the 2 injection placebo groups, respectively. The GMFR of neutralizing antibody levels was statistically significantly greater in the 2.0 mg dose group versus the 1.0 mg dose group. The T cell immune responses measured by the ELISpot assay were also higher in the 2.0 mg dose group compared to the 1.0 mg dose group (Table 30). Overall in Phase 2, the 2.0 mg dose group generated both binding and neutralizing antibody responses statistically significantly greater than those of 1.0 mg dose group while the T cell responses observed in the 2.0 mg dose group trended higher than those observed in the 1.0 mg dose group.
The safety, immunogenicity and efficacy of the intradermal delivery of INO-4800, a synthetic DNA vaccine candidate encoding a SARS-CoV-2 spike antigen, was evaluated in the rhesus macaque model. Single and two dose vaccination regimens were evaluated. Vaccination induced both binding and neutralizing antibodies, along with IFN-γ-producing T cells against SARS-CoV-2. A high dose of SARS-CoV-2 Victoria01 strain (5×10{circumflex over ( )}6 pfu) was used to specifically assess the impact of INO-4800 vaccination on lung disease burden to provide both vaccine safety and efficacy data. A broad range of lower respiratory tract disease parameters were measured by applying histopathology, lung disease scoring metric system, in situ hybridization, viral RNA RT-PCR and computed tomography (CT) scans to provide an understanding of the impact of vaccine induced immunity on protective efficacy and potential vaccine enhanced disease (VED).
This example describes the immunogenicity, efficacy and safety assessment of the SARS-CoV-2 DNA vaccine INO-4800 in a stringent high dose nonhuman primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces humoral and T cell responses against the SARS-CoV-2 spike antigen in both a 2-dose regimen and a suboptimal 1 dose regimen. Throughout the study no overt clinical events were recorded in the animals. After a high dose SARS-CoV-2 challenge, a reduction in viral loads was observed and lung disease burden in both the 1 and 2 dose vaccine groups supporting the efficacy of INO-4800. Importantly, vaccine enhanced disease (VED) was not observed, even with the 1 dose group.
Methods
Vaccine. The optimized DNA sequence encoding SARS-CoV-2 IgELS-spike was created using Inovio's proprietary in silico Gene Optimization Algorithm to enhance expression and immunogenicity. The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate-early promoter and a bovine growth hormone polyadenylation signal.
Animals. Eighteen rhesus macaques of Indian origin (Macaca mulatta) were used in this study. Study groups comprised three males and three females of each species and all were adults aged between 2.5 and 3.5 years of age and weighing >4 Kg at time of challenge. Prior to the start of the experiment, socially compatible animals were randomly assigned to challenge groups, to minimize bias. Animals were housed in compatible social groups, in cages in accordance with the UK Home Office Code of Practice for the Housing and Care of Animals Bred, Supplied or Used for Scientific Procedures (2014) and National Committee for Refinement, Reduction and Replacement (NC3Rs) Guidelines on Primate Accommodation, Care and Use, August 2006. Housing prior and for the duration of challenge is described in [Salguero, F. J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093]. All experimental work was conducted under the authority of a UK Home Office approved project license (PDC57C033) that had been subject to local ethical review at PHE Porton Down by the Animal Welfare and Ethical Review Body (AWERB) and approved as required by the Home Office Animals (Scientific Procedures) Act 1986. Animals were sedated by intramuscular (IM) injection with ketamine hydrochloride (Ketaset, 100 mg/ml, Fort Dodge Animal Health Ltd, Southampton, UK; 10 mg/kg) for procedures requiring removal from their housing. None of the animals had been used previously for experimental procedures.
Vaccine administration. Animals received 1 mg of SARS-CoV-2 DNA vaccine, INO-4800, by intradermal injection at day 28 only (1 dose group) or 0 and 28 (2 dose group) followed by an EP treatment using the CELLECTRA 2000® Adaptive Constant Current Electroporation Device with a 3P array (Inovio Pharmaceuticals).
Serum and heparinised whole blood were collected whilst animals were sedated at bi-weekly intervals during the vaccination phase. Nasal and throat swabs were also collected on the day of challenge on D56. After challenge, nasal swabs, throat swabs and serum were collected at 1, 3, 5 dpc and at cull (6, 7 or 8 dpc—staggered due to the high level of labor involved in procedures), with heparinised whole blood collected at 3 dpc and at cull. Nasal and throat swabs were obtained as described [Salguero, F. J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093.].
Clinical observations. Animals were monitored multiple times per day for behavioral and clinical changes. Behavior was evaluated for contra-indicators including depression, withdrawal from the group, aggression, changes in feeding patterns, breathing pattern, respiration rate and cough. Animals were observed and scored as follows for activity and health throughout the study. Key: Activity Level: A0=Active & Alert; A1=Only active when stimulated by operator; A2=Inactive even when stimulated/Immobile; H=Healthy; S=Sneeze, C=Cough, Nd=Nasal Discharge, Od=Ocular Discharge, Rn=Respiratory Noises, Lb=Laboured breathing, L=Lethargy, Di=Diarrhoea, Ax=Loss of Appetite, Dx=Dehydration, RD=Respiratory Distress. Animal body weight, temperature and haemoglobin levels were measured and recorded throughout the study.
Viruses and Cells
SARS-CoV-2 Victoria/01/2020 [Caly, L., et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med J Aust, 2020. 212(10): p. 459-462] was generously provided by The Doherty Institute, Melbourne, Australia at P1 after primary growth in Vero/hSLAM cells and subsequently passaged twice at PHE Porton Down in Vero/hSLAM cells [ECACC 04091501]. Infection of cells was with ˜0.0005 MOI of virus and harvested at day 4 by dissociation of the remaining attached cells by gentle rocking with sterile 5 mm borosilicate beads followed by clarification by centrifugation at 1,000×g for 10 mins. Whole genome sequencing was performed, on the P3 challenge stock, using both Nanopore and Illumina as described in Lewandowski, K., et al., Metagenomic Nanopore Sequencing of Influenza Virus Direct from Clinical Respiratory Samples. J Clin Microbiol, 2019. 58(1). Virus titer of the challenge stocks was determined by plaque assay on Vero/E6 cells [ECACC 85020206]. Cell lines were obtained from the European Collection of Authenticated Cell Cultures (ECACC) PHE, Porton Down, UK. Cell cultures were maintained at 37° C. in Minimum essential medium (MEM) (Life Technologies, California, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma, Dorset, UK) and 25 mM HEPES (Life Technologies, California, USA). In addition, Vero/hSLAM cultures were supplemented with 0.4 mg/ml of geneticin (Invitrogen) to maintain the expression plasmid. Challenge substance dilutions were conducted in phosphate buffer saline (PBS). Inoculum (5×106 PFU) was delivered by intratracheal route (2 ml) and intranasal instillation (1.0 ml total, 0.5 ml per nostril).
Clinical Signs and In-Life Imaging by Computerized Tomography
CT scans were performed two weeks before and five days after challenge with SARS-CoV2. CT imaging was performed on sedated animals using a 16 slice Lightspeed CT scanner (General Electric Healthcare, Milwaukee, Wis., USA) in both the prone and supine position and scans evaluated by a medical radiologist expert in respiratory diseases (as described previously [Salguero, F. J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. 2020: p. 2020.09.17.301093.]). To provide the power to discriminate differences between individual NHP's with low disease volume (i.e. <25% lung involvement), a refined score system was designed in which scores were attributed for possession of abnormal features characteristic of COVID in human patients (COVID pattern score) and for the distribution of features through the lung (Zone score). The COVID pattern score was calculated as sum of scores assigned for the number of nodules identified, and the possession and extent of GGO and consolidation according to the following system: Nodule(s): Score 1 for 1, 2 for 2 or 3, 3 for 4 or more; GGO: each affected area was attributed with a score according to the following: Score 1 if area measured <1 cm, 2 if 1 to 2 cm, 3 if 2-3 cm, 4 if >3 cm and scores for each area of GGO were summed to provide a total GGO score; Consolidation: each affected area was attributed with a score according to the following: 1 if area measured <1 cm, 2 if 1 to 2 cm, 3 if 2-3 cm, 4 if >3 cm. Scores for each area of consolidation are summed to provide a total consolidation score. To account for estimated additional disease impact on the host of consolidation compared to GGO, the score system was weighted by doubling the score assigned for consolidation. To determine the zone score, the lung was divided into 12 zones and each side of the lung divided (from top to bottom) into three zones: the upper zone (above the carina), the middle zone (from the carina to the inferior pulmonary vein), and the lower zone (below the inferior pulmonary vein). Each zone was further divided into two areas: the anterior area (the area before the vertical line of the midpoint of the diaphragm in the sagittal position) and the posterior area (the area after the vertical line of the mid-point of the diaphragm in the sagittal position). This results in 12 zones in total where a score of one is attributed to each zone containing structural changes. The COVID pattern score and the zone are summed to provide the Total CT score.
Post-mortem examination and histopathology. Animals were euthanized at 3 different time-points, in groups of six (including one animal from each species and sex) at 6, 7 and 8 dpc. The bronchial alveolar lavage fluid (BAL) was collected at necropsy from the right lung. The left lung was dissected prior to BAL collection and used for subsequent histopathology and virology procedures. At necropsy nasal and throat swabs, heparinised whole blood and serum were taken alongside tissue samples for histopathology. Samples from the left cranial and left caudal lung lobe together with spleen, kidney, liver, mediastinal and axillary lymph nodes, small intestine (duodenum), large intestine (colon), trachea, larynx inoculation site and draining lymph node, were fixed by immersion in 10% neutral-buffered formalin and processed routinely into paraffin wax. Four μm sections were cut and stained with hematoxylin and eosin (H&E) and examined microscopically. A lung histopathology scoring system [Salguero, F. J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093] was used to evaluate lesions affecting the airways and the parenchyma. Three tissue sections from each left lung lobe were used to evaluate the lung histopathology. In addition, samples were stained using the RNAscope technique to identify the SARS-CoV-2 virus RNA in lung tissue sections. Briefly, tissues were pre-treated with hydrogen peroxide for 10 mins (RT), target retrieval for 15 mins (98-102° C.) and protease plus for 30 mins (40° C.) (Advanced Cell Diagnostics). A V-nCoV2019-S probe (SARS-CoV-2 Spike gene specific) was incubated on the tissues for two hours at 40° C. In addition, samples were stained using the RNAscope technique to identify the SARS-CoV-2 virus RNA. Amplification of the signal was carried out following the RNAscope protocol using the RNAscope 2.5 HD Detection kit—Red (Advanced Cell Diagnostics, Biotechne). All H&E and ISH stained slides were digitally scanned using a Panoramic 3D-Histech scanner and viewed using CaseViewer v2.4 software. The presence of viral RNA by ISH was evaluated using the whole lung tissue section slides. Digital image analysis was performed in RNAscope labelled slides to ascertain the percentage of stained cells within the lesions, by using the Nikon-NIS-Ar software package.
Viral load quantification by RT-qPCR. RNA was isolated from nasal swabs and throat swabs. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream extraction was then performed using the BioSprint™96 One-For-All vet kit (Indical) and Kingfisher Flex platform as per manufacturer's instructions. Tissues were homogenized in Buffer RLT+ betamercaptoethanol (Qiagen). Tissue homogenate was then centrifuged through a QIAshredder homogenizer (Qiagen) and supplemented with ethanol as per manufacturer's instructions. Downstream extraction from tissue samples was then performed using the BioSprint™96 One-For-All vet kit (Indical) and Kingfisher Flex platform as per manufacturer's instructions.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™) 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5′ GACCCCAAAATCAGCGAAAT 3′ (SEQ ID NO: 18); 2019-nCoV_N1-reverse, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′(SEQ ID NO: 19); 2019-nCoV_N1-probe, 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′(SEQ ID NO: 20). The cycling conditions were: 25° C. for 2 minutes, 50° C. for 15 minutes, 95° C. for 2 minutes, followed by 45 cycles of 95° C. for 3 seconds, 55° C. for 30 seconds. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC_045512.2) with quantification between 1 and 6 log copies/W. Positive swab and fluid samples detected below the limit of quantification (LoQ) of 4.11 log copies/ml, were assigned the value of 5 copies/μl, this equates to 3.81 log copies/ml, whilst undetected samples were assigned the value of <2.3 copies/μl, equivalent to the assay's lower limit of detection (LoD) which equates to 3.47 log copies/ml. Positive tissue samples detected below the limit of quantification (LoQ) of 4.76 log copies/ml were assigned the value of 5 copies/μl, this equates to 4.46 log copies/g, whilst undetected samples were assigned the value of <2.3 copies/μl, equivalent to the assay's lower limit of detection (LoD) which equates to 4.76 log copies/g.
Subgenomic RT-qPCR was performed on the QuantStudio™ 7 Flex Real-Time PCR System using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) and oligonucleotides as specified by Wölfel, et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020), with forward primer, probe and reverse primer at a final concentration of 250 nM, 125 nM and 500 nM respectively. Sequences of the sgE primers and probe were:
Cycling conditions were 50° C. for 10 minutes, 95° C. for 2 minutes, followed by 45 cycles of 95° C. for 10 seconds and 60° C. for 30 seconds. RT-qPCR amplicons were quantified against an in vitro transcribed RNA standard of the full length SARS-CoV-2 E ORF (accession number NC_045512.2) preceded by the UTR leader sequence and putative E gene transcription regulatory sequence described by Wolfel et al [Wölfel, R., Corman, V. M., Guggemos, W. et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020).]. Positive samples detected below the lower limit of quantification (LLOQ) were assigned the value of 5 copies/μl, whilst undetected samples were assigned the value of ≤0.9 copies/μl, equivalent to the assays lower limit of detection (LLOD). For nasal swab, throat swab and BAL samples extracted samples this equates to an LLOQ of 4.11 log copies/mL and LLOD of 3.06 log copies/mL. For tissue samples this equates to an LLOQ of 4.76 log copies/g and LLOD of 3.71 log copies/g.
Plaque reduction neutralization test. Neutralizing virus titers were measured in heat-inactivated (56° C. for 30 minutes) serum samples. SARS-CoV-2 was diluted to a concentration of 1.4×103 pfu/ml (70 pfu/50 μl) and mixed 50:50 in 1% FCS/MEM with doubling serum dilutions from 1:10 to 1:320 in a 96-well V-bottomed plate. The plate was incubated at 37° C. in a humidified box for one hour to allow the antibody in the serum samples to neutralize the virus. The neutralized virus was transferred into the wells of a washed plaque assay 24-well plate (see plaque assay method), allowed to adsorb at 37° C. for a further hour, and overlaid with plaque assay overlay media. After five days incubation at 37° C. in a humified box, the plates were fixed, stained and plaques counted.
Antigen Binding ELISA. Recombinant SARS-CoV-2 Spike- and RBD-specific IgG responses were determined by ELISA. A full-length trimeric and stabilized version of the SARS-CoV-2 Spike protein was supplied by Lake Pharma (#46328). Recombinant SARS-CoV-2 Receptor-Binding-Domain (319-541) Myc-His was developed and kindly provided by MassBiologics. High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2 μg/ml Spike trimer (S1+S2) or RBD in 1×PBS (Gibco) and incubated overnight at 4° C. The ELISA plates were washed and blocked with 5% Fetal Bovine Serum (FBS, Sigma, F9665) in 1×PBS/0.1% Tween 20 for 1 hour at room temperature. Serum collected from animals after vaccination had a starting dilution of 1/50 followed by 8 two-fold serial dilutions. Post-challenge samples were inactivated in 0.5% triton and had a starting dilution of 1/100 followed by 8 three-fold serial dilutions. Serial dilutions were performed in 10% FBS in 1×PBS/0.1% Tween 20. After washing the plates, 50 μl/well of each serum dilution was added to the antigen-coated plate in duplicate and incubated for 2 hours at room temperature. Following washing, anti-monkey IgG conjugated to HRP (Invitrogen, PA1-84631) was diluted (1:10,000) in 10% FBS in 1×PBS/0.1% Tween 20 and 100 μl/well was added to the plate. Plates were then incubated for 1 hour at room temperature. After washing, 1 mg/ml 0-Phenylenediamine dihydrochloride solution (Sigma P9187) was prepared and 100 μl per well were added. The development was stopped with 50 μl per well 1M Hydrochloric acid (Fisher Chemical, J/4320/15) and the absorbance at 490 nm was read on a Molecular Devices versamax plate reader using Softmax (version 7.0). Titers were determined using the endpoint titer determination method. For each sample, an endpoint titer is defined as the reciprocal of the highest sample dilution that gives a reading (OD) above the cut-off. The cut-off was determined for each experimental group as the mean OD+3SD of naïve samples.
Peripheral blood mononuclear cell isolation and resuscitation. PBMCs were isolated from whole blood anticoagulated with heparin (132 Units per 8 720 ml blood) (BD Biosciences, Oxford, UK) using standard methods. PBMCs isolated from tissues were stored at −180° C. For resuscitation PBMCs were thawed, washed in R10 medium (consisting of RPMI 1640 supplemented with 2 mM L-glutamine, 50 U/ml penicillin-50 μg/ml streptomycin, and 10% heat-inactivated FBS) with 1 U/ml of DNase (Sigma), and resuspended in R10 medium and incubated at 37° C. 5% CO2 overnight.
ELISpot. An IFNγ ELISpot assay was used to estimate the frequency and IFNγ production capacity of SARS-CoV-2-specific T cells in PBMCs using a human/simian IFNγ kit (MabTech, Nacka. Sweden), as described previously [Sibley, L. S., et al., ELISPOT Refinement Using Spot Morphology for Assessing Host Responses to Tuberculosis. Cells, 2012. 1(1): p. 5-14.]. The cells were assayed at 2×105 cells per well. Cells were stimulated overnight with SARS-CoV-2 peptide pools spanning the ECD spike protein. Five peptide pools were 748 used, comprising of 15mer peptides, overlapping by 9 amino acids. Phorbol 12-myristate (Sigma) (100 ng/ml) and ionomycin (CN Biosciences, 753 Nottingham, UK) (1 mg/ml) were used as a positive control. Results were calculated and reported as spot forming units (SFU) per million cells. All SARS-CoV-2 peptides were assayed in duplicate and media only wells subtracted to give the antigen-specific SFU. ELISPOT plates were analyzed using a CTL scanner and software (CTL, Germany) and further analysis carried out using GraphPad Prism (GraphPad Software, USA).
Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, Calif.). These data were considered significant if p<0.05. The type of statistical analysis performed is detailed in the figure legend. No samples or animals were excluded from the analysis.
Results:
Immunogenicity of one and two dose regimens of INO-4800. Twelve (6 male and 6 female) rhesus macaques were vaccinated with 1 dose (6 animals) or 2 doses (6 animals) of INO-4800 on day 28 or 0 and 28, respectively (
Viral Loads in the Upper and Lower Respiratory Tracts after SARS-CoV-2 Challenge
On day 56 all animals were challenged with a total of 5×10{circumflex over ( )}6 pfu SARS-CoV-2 delivered to both the upper and lower respiratory tract. No overt clinical symptoms were observed throughout the duration (6-8 days) of the challenge in any of the animals (
At the time of necropsy (6-8 days post challenge), BAL fluid was collected from each animal. Measurement of the levels of SARS-CoV-2 viral RNA and sgmRNA revealed a reduction of the average virus in vaccinated groups, even though the levels were variable within each group dependent on the day of necropsy (
In summary data showed a significant reduction of viral load in the throat, and a trend for a reduction of viral loads in the lungs of the vaccinated groups. The collection of BAL and lung tissue samples at different timepoints (days 6, 7 or 8) after challenge likely added to the intragroup variability observed impacting statistical analysis. RT-qPCR viral load data indicate INO-4800 vaccination has a positive effect in reducing viral loads in rhesus macaques challenged with high dose SARS-CoV-2, in general, lower viral levels were measured in the 2 dose vaccine group compared to one dose vaccine group.
Disease Burden in the Lungs after SARS-CoV-2 Challenge.
The pulmonary disease burden was assessed on harvested lung tissues collected at necropsy 6 to 8 days after challenge. Analysis was performed on all animals in the study in a double blinded manner. Histopathological analysis of lung tissue was performed on multiple organ tissues, but only the lungs showed remarkable lesions, compatible with SARS-CoV-2 infection. Pulmonary lesions consistent with infection with SARS-CoV-2 were observed in the lungs of animals from the unvaccinated control and at a reduced level in vaccinated groups. Representative histopathology images are provided in
The histopathology score and percent tissue area of SARS-CoV-2 RNA positivity were applied to quantify the disease burden. The unvaccinated group showed the highest histopathological scores in the lung when compared with the vaccinated groups (
CT scans were performed to provide an in-life, unbiased, and quantifiable metric of lung disease. Results from lung CT imaging performed 5 days after challenge with SARS-CoV-2 were evaluated for the presence of COVID-19 disease features: ground glass opacity (GGO), consolidation, crazy paving, nodules, peri-lobular consolidation; distribution—upper, middle, lower, central 2/3, peripheral, bronchocentric, and for pulmonary embolus. The medical radiologist was blinded to the animal's treatment and clinical status. The extent of lung involvement was evaluated and quantified using a scoring system developed for COVID disease. The score system parameters are provided in materials and methods section. Pulmonary abnormalities characteristic of COVID-19 disease where observed in 3 out of 6 and 2 out of 6 animals in the INO-4800 one dose or two dose groups, respectively, and in 5 out of 6 unvaccinated animals in the control group (representative CT scan images are provided in
In summary, after high dose SARS-CoV-2 challenge of nonhuman primates the disease burden was reduced in the animals receiving a single of two dose regimen of INO-4800 vaccine. There was no indication of vaccine enhanced disease, even in animals receiving a suboptimal one dose vaccination regimen.
Discussion
This example describes the safety, immunogenicity, and efficacy assessments of the SARS-CoV-2 DNA vaccine INO-4800 in a stringent high dose nonhuman primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces both humoral and T cell responses against the SARS-CoV-2 spike antigen in both a 2-dose regimen and a 1 dose regimen. Throughout the study no overt clinical events were recorded in the animals. After a high dose SARS-CoV-2 challenge, a reduction in viral loads was observed and lung disease burden in both the 1 and 2 dose vaccine groups supporting the efficacy of INO-4800. Importantly, vaccine enhanced disease (VED) was not observed, even with the 1 dose group.
The rhesus macaque model has become a widely employed model for assessing medical countermeasures against SARS-CoV-2. Importantly, wildtype non-adapted SARS-CoV-2 replicates in the respiratory tract of rhesus macaques, and the animal presents with some of the characteristics observed in humans with mild COVID-19 symptoms [Salguero, F. J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. 2020: p. 2020.09.17.301093; Muñoz-Fontela, C., et al., Animal models for COVID-19. Nature, 2020. 586(7830): p. 509-515]. Here, focus was placed on the lung disease burden in SARS-CoV-2 challenged rhesus macaques which had been vaccinated with INO-4800. While the level of lung disease burden measured in the animals was mild, a significant reduction in of histopathology and viral detection scores in the lungs of vaccinated animals was observed (
Importantly, the data indicated that enhanced respiratory disease (ERD) was not associated with INO-4800 immunization in either the 1 dose or 2 dose regimen. In the INO-4800 X1 dose group, one animal (10A) did present with the highest lung histopathology score and CT scan score. However, the multifocal lesions in animal 10A showed a similar histopathological pattern as those observed in the animals from the nonvaccinated group, with no apparent influx of different inflammatory cell subpopulations in the infiltrates. A potential hallmark of vaccine enhanced disease is the increased influx of inflammatory cells such as eosinophils [Bolles, M., et al., A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge. J Virol, 2011. 85(23): p. 12201-15; Yasui, F., et al., Prior Immunization with Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe Pneumonia in Mice Infected with SARS-CoV. The Journal of Immunology, 2008. 181(9): p. 6337-6348.]. The CT scan and histopathology data for animal 10A are believed not to be associated with ERD, but rather a disease score and pattern similar to that of nonvaccinated animals. Similar lung histopathology inflammation scores ranging from minimal-mild to mild-moderate were reported in samples analyzed 7 or 8 days after challenge in rhesus macaques receiving other vaccine candidates [Corbett, K. S., et al., Evaluation of the mRNA-1273 Vaccine against SARS-CoV-2 in Nonhuman Primates. New England Journal of Medicine, 2020. 383(16): p. 1544-1555]. Currently, VED remains a theoretical concern with SARS-CoV-2 vaccination and attempts to induce enhanced disease using a formalin inactivated whole virus preparation of SARS-CoV-2 have failed to repeat the lung pathology previously reported for other inactivated respiratory viral vaccines [Bewley, K. R., et al., Immunological and pathological outcomes of SARS-CoV-2 challenge after formalin-inactivated vaccine immunization of ferrets and rhesus macaques. 2020: p. 2020.12.21.423746].
This data compliments the NHP SARS-CoV-2 challenge study which demonstrated reduction in LRT viral loads several months after INO-4800 immunization (Example 9). However, there are distinct differences between the studies, including different doses and variants used for the challenge stock, and the timing of the challenge. In the study described in this example, the animal was challenged four weeks after the last vaccination, at a timepoint when high levels of circulating neutralizing antibodies were present. In the other study, the level of serum SARS-CoV-2 neutralizing antibody was low at the time of challenge, protection appeared to be dependent on the recall of a memory response, with a strong humoral and cellular response against SARS-CoV-2 spike antigen detected in the animals. Here, an anamnestic response of a similar magnitude was not observed, suggesting protection may have been mediated by the antibodies present in circulation at time of challenge which is supported by the correlation between serum SARS-CoV-2 targeting antibody levels and reductions in viral loads (
In conclusion, the results here in a stringent preclinical SARS-CoV-2 animal model provide further support for the efficacy and safety of the DNA vaccine INO-4800 as a prophylactic countermeasure against COVID-19. Importantly, tested as a single dose immunization we observed a positive impact on the lung disease burden and no VED. Taken together with INO-4800 clinical data, INO-4800 has many attributes in terms of safety, efficacy and logistical feasibility due its high stability, negating the need for challenging cold chain distribution requirements for global access. Furthermore, synthetic DNA vaccine technology is amenable to highly accelerated developmental timelines, permitting rapid design and testing of candidates against new SARS-CoV-2 variants which display potential for immune escape [Wibmer, C. K., et al., SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma. 2021: p. 2021.01.18.427166; Moore, J. P. and P. A. Offit, SARS-CoV-2 Vaccines and the Growing Threat of Viral Variants. JAMA, 2021.]
The immunogenicity of a synthetic DNA vaccine encoding the SARS-CoV-2 Spike protein was previously demonstrated in both mice and guinea pigs (Example 1). In this example, the durability of INO-4800-induced immune responses in rhesus macaques is demonstrated. ID-EP administration in rhesus macaques induced cellular and humoral responses to SARS-Cov-2 S protein, with additional cross reactivity to the SARS-CoV-1 S protein. Protective efficacy is demonstrated more than 3 months post-final immunization, demonstrating establishment of amamnestic immune responses and reduced viral loads in vaccinated macaques. After viral challenge, a reduction in subgenomic messenger RNA (sgmRNA) BAL viral loads was observed compared to control animals with 1 mg (⅕th the DNA dose) administered via intradermal (ID) delivery. This was associated with induction of a rapid recall response in both cellular and humoral immune arms, supporting the potential for the INO-4800 candidate to moderate disease. No adverse events or evidence of vaccine enhanced disease (VED) were observed in animals in the vaccine group. Reduced viral subgenomic RNA loads in the lower lung and lower VL were observed. In the nose, a trend of lower VL was observed. These data support that immunization with this DNA vaccine candidate limits active viral replication and has the potential to reduce severity of disease, as well as reduced viral shedding in the nasal cavity.
It is important to note that the initial viral loads detected in control animals in this study were on average 1-2 logs higher (109 PFU/swab in 4/5 NHPs on day 1 post-challenge) than in similar published studies performed under identical conditions (˜107 PFU/swab) (Yu et al., 2020, Science, eabc6284). Only two of the prior reported NHP studies included intranasal delivery as inoculation route for challenge (van Doremalen et al., 2020, bioRxiv 2020.05.13.093195; Yu et al., 2020, Science, eabc6284). High-dose challenge inoculums are frequently employed to ensure take of infection, however non-lethal systems such as this SARS-CoV-2 rhesus macaque model may artificially reduce the impact of potentially protective vaccines and interventions (Durudas et al., 2011, Curr HIV Res 9, 276-288; Innis et al., 2019, Vaccine 37, 4830-4834). Despite these limitations, this study demonstrated significant reduction in peak BAL sgmRNA and overall viral RNA, likely induced by rapid induction of immunological memory mediated by both B and T cell compartments. Wolfel et al reported nasal titers in patients average 6.5×105 copies/swab days 1-5 following onset of symptoms (Wolfel et al., 2020, Nature 581, 465-469). These titers are significantly lower than the challenge dose and support potential for the vaccine candidate to control early during SARS-CoV-2 infection.
This study shows that DNA vaccination with a vaccine candidate targeting the full-length SARS-CoV-2 spike protein likely increases the availability T cell immunodominant epitopes leading to a broader and more potent immune response, compared to partial domains and truncated immunogens. In this study, T cell cross-reactivity was observed to SARS-CoV-1.
In addition to T cells, INO-4800 induced durable antibody responses that rapidly increased following SARS-CoV-2 challenge. It is further demonstrated that INO-4800 induced robust neutralizing antibody responses against both D614 and G614 SARS-CoV-2 variants. While the D/G 614 site is outside the RBD, it has been suggested that this shift has the potential to impact vaccine-elicited antibodies (Korber B et al., 2020, Cell 182:1-16). Other studies report that the G614 variant exhibits increased SARS-CoV-2 infectivity (Hu et al., 2020, bioRxiv 2020.06.20.161323; Ozono S, 2020, bioRxiv 2020.06.15.151779). The data shows induction of comparable neutralization titers between D614 and G614 variants and that these responses are similarly recalled following SARS-CoV-2 challenge.
Materials & Methods
Non-Human Primate Immunizations, IFNγ ELISpot and ELISA
DNA vaccine, INO-4800: The highly optimized DNA sequence encoding SARS-CoV-2 IgE-spike was created using Inovio's proprietary in silico Gene Optimization Algorithm to enhance expression and immunogenicity (Smith et al., 2020, Nat Commun 11, 2601). The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate-early promoter and a bovine growth hormone polyadenylation signal.
Animals: All rhesus macaque experiments were approved by the Institutional Animal Care and Use Committee at Bioqual (Rockville, Md.), an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International accredited facility. Blood was collected for blood chemistry, PBMC isolation, serological analysis. BAL was collected on Week 8 to assay lung antibody levels and on Days 1, 2, 4, 7 post challenge to assay lung viral loads.
Immunizations, sample collection and viral challenge. Ten Chinese rhesus macaques (ranging from 4.55 kg-5.55 kg) were randomly assigned in study immunized (3 males and 2 females) or naïve (2 males and 3 females). Immunized macaques received two 1 mg injections of SARS-CoV-2 DNA vaccine, INO-4800 at week 0 and 4 by ID-EP administration using the CELLECTRA 2000® Adaptive Constant Current Electroporation Device with a 3P array (Inovio Pharmaceuticals). Blood was collected at indicated time points to analyse blood chemistry, peripheral blood mononuclear cells (PBMC) isolation, and serum was collected for serological analysis. Bronchoalveolar lavage was collected at Week 8 to assay lung antibody levels. BAL from naïve animals was run as control. At week 17, all animals were challenged with 1.2×108 VP (1.1×104 PFU) SARS-CoV-2. Virus was administered as 1 ml by the intranasal (IN) route (0.5 ml in each nostril) and 1 ml by the intratracheal (IT) route.
Peripheral blood mononuclear cell isolation. Blood was collected from each macaque into sodium citrate cell preparation tubes (CPT, BD Biosciences). The tubes were centrifuged to separate plasma and lymphocytes, according to the manufacturer's protocol. Samples were transported by same-day shipment on cold-packs from Bioqual to The Wistar Institute for PBMC isolation. PBMCs were washed and residual red blood cells were removed using ammonium-chloride-potassium (ACK) lysis buffer. Cells were counted using a ViCell counter (Beckman Coulter) and resuspended in RPMI 1640 (Corning), supplemented with 10% fetal bovine serum (Atlas), and 1% penicillin/streptomycin (Gibco). Fresh cells were then plated for IFNγ ELISpot Assays and flow cytometry.
IFN-γ Enzyme-linked immunospot (ELISpot). Monkey interferon gamma (IFN-γ) ELISpot assay was performed to detect cellular responses. Monkey IFN-γ ELISpotPro (alkaline phosphatase) plates (Mabtech, Sweeden, Cat #3421M-2APW-10) were blocked for a minimum of 2 hours with RPMI 1640 (Corning), supplemented with 10% FBS and 1% perm/strep (R10). Following PBMC isolation, 200000 cells from macaques were added to each well in the presence of 1) overlapping peptide pools (15-mers with 9-mer overlaps) corresponding to the SARS-CoV-1, SARS-CoV-2, or MERS-CoV Spike proteins (5 μg/mL/well final concentration), 2) R10 with DMSO (negative control), 3) or anti-CD3 positive control (Mabtech, 1:1000 dilution). All samples were plated in triplicate. Plates were incubated overnight at 37° C., 5% CO2. After 18-20 hours, the plates were washed in PBS and spots were developed according to the manufacturer's protocol. Spots were imaged using a CTL Immunospot plate reader and antigen-specific responses were determined by subtracting the number of spots in the R10+DMSO negative control well from the wells stimulated with peptide pools.
Antigen Binding ELISA. Serum and BAL was collected at each time point was evaluated for binding titers as indicated. Ninety-six well immunosorbent plates (NUNC) were coated with 1 ug/mL recombinant SARS-CoV-2 S1+S2 ECD protein (Sino Biological 40589-V08B1), S1 protein (Sino Biological 40591-V08H), S2 protein (Sino Biological 40590-V08B), or receptor-binding domain (RBD) protein (Sino Biological 40595-V05H) in DPBS overnight at 4° C. ELISA plates were also coated with 1 ug/mL recombinant SARS-CoV S1 protein (Sino Biological 40150-V08B1) and RBD protein (Sino Biological 40592-V08B) or MERS-CoV Spike (Sino Biological 40069-V08B). Plates were washed four times with PBS+0.05% Tween20 (PBS-T) and blocked with 5% skim milk in PBS-T (5% SM) for 90 minutes at 37° C. Sera or BAL from INO-4800 vaccinated macaques were serially diluted in 5% SM, added to the washed ELISA plates, and incubated for 1 hour at 37° C. Following incubation, plates were washed 4 times with PBS-T and an anti-monkey IgG conjugated to horseradish peroxidase (Southern Biotech 4700-5). Plates were washed 4 times with PBS-T and one-step TMB solution (Sigma) was added to the plates. The reaction was stopped with an equal volume of 2N sulfuric acid. Plates were read at 450 nm and 570 nm within 30 minutes of development using a Biotek Synergy2 plate reader.
ACE2 Competition ELISA-Non-human primates. 96-well half area plates (Corning) were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1×PBS, 5% skim milk, 1% FBS, and 0.2% Tween-20. The plates were then incubated with 10 μg/mL of His6×-tagged SARS-CoV-2 (“His6×” disclosed as SEQ ID NO: 25), S1+S2 ECD (Sinobiological, 40589-V08B1) at room temperature for 1-2 hours. NHP sera (Day0 or Week 6) was serially diluted 3-fold with 1×PBS containing 1% FBS and 0.2% Tween and pre-mixed with huACE2-IgMu at constant concentration of 0.4 ug/ml. The pre-mixture was then added to the plate and incubated at RT for 1-2 hours. The plates were further incubated at room temperature for 1 hour with goat anti-mouse IgG H+L HRP (A90-116P, Bethyl Laboratories) at 1:20,000 dilution followed by addition of one-step TMB ultra substrate (ThermoFisher) and then quenched with 1M H2SO4. Absorbance at 450 nm and 570 nm were recorded with BioTEK plate reader.
Flow cytometry-based ACE2 receptor binding inhibition assay. HEK-293T cells stably expressing ACE2-GFP were generated using retroviral transduction. Following transduction, the cells were flow sorted based on GFP expression to isolate GFP positive cells. Single cell cloning was done on these cells to generate cell lines with equivalent expression of ACE2-GFP. To detect inhibition of Spike binding to ACE2, S1+S2 ECD-his tagged (Sino Biological, Catalog #40589-V08B1) was incubated with serum collected from vaccinated animals at indicated time points and dilutions at concentration of 2.5 μg/ml on ice for 60 minutes. This mixture was then transferred to 150,000 293T-ACE2-GFP cells and incubated on ice for 90 minutes. Following this, the cells were washed 2× with PBS followed by staining for Surelight® APC conjugated anti-his antibody (Abcam, ab72579) for 30 min on ice. As a positive control, Spike protein was pre-incubated with recombinant human ACE2 before transferring to 293T-Ace2-GFP cells. Data was acquired using a BD LSRII and analyzed by FlowJo (version 10).
Pseudovirus Neutralization Assay. SARS-CoV-2 pseudovirus were produced using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent) at a 1:1 ratio. Forty-eight hours post transfection, transfection supernatant was collected, enriched with FBS to 12% final volume, steri-filtered (Millipore Sigma), and aliquoted for storage at −80° C. SARS-Cov-2 pseudovirus neutralization assay was set up using D10 media (DMEM supplemented with 10% FBS and 1× Penicillin-Streptomycin) in a 96 well format. CHO cells stably expressing Ace2 were used as target cells (Creative Biolabs, Catalog No. VCeL-Wyb019). SARS-Cov-2 pseudovirus were titered to yield greater than 20 times the cells only control relative luminescence units (RLU) after 72 h of infection. For setting up neutralization assay, 10,000 CHO-ACE2 cells were plated in 96-well plates in 100 ul D10 media and rested overnight at 37° C. and 5% CO2 for 24 hours. Following day, Monkey and Rabbit sera from INO-4800 vaccinated and control groups were heat inactivated and serially diluted as desired. Sera were incubated with a fixed amount of SARS-Cov-2 pseudovirus for 90 minutes at RT. 50 ul media was removed from the plated CHO-Ace2 cell containing wells. Post 90 minutes, the mix was added to plated CHO-Ace2 cells and allowed to incubate in a standard incubator (37% humidity, 5% CO2) for 72 h. Post 72 h, cells were lysed using britelite plus luminescence reporter gene assay system (Perkin Elmer Catalog no. 6066769) and RLU were measured using the Biotek plate reader. Neutralization titers (ID50) were calculated using GraphPad Prism 8 and defined as the reciprocal serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells.
Viral RNA assay. RT-PCR assays were utilized to monitor viral loads, essentially as previously described (Abnink P et al 2019 Science). Briefly, RNA was extracted using a QIAcube HT (Qiagen, Germany) and the Cador pathogen HT kit from bronchoalveolar lavage (BAL) supernatant and nasal swabs. RNA was reverse transcribed using superscript VILO (Invitrogen) and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to manufacturer's specifications. Viral loads were calculated of viral RNA copies per mL or per swab and the assay sensitivity was 50 copies. The target for amplification was the SARS-CoV2 N (nucleocapsid) gene. The primers and probes for the targets were: 2019-nCoV_N1-F:5′-GACCCCAAAATCAGCGAAAT-3′ (SEQ ID NO:18); 2019-nCoV_N1-R: 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (SEQ ID NO:19); 2019-nCoV_N1-P: 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′ (SEQ ID NO:20).
Subgenomic mRNA assay. SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was assessed by RT-PCR using an approach similar to previously described (Wolfel R et al. 2020, Nature, 581, 465-469). To generate a standard curve, the SARS-CoV-2 E gene sgmRNA was cloned into a pcDNA3.1 expression plasmid; this insert was transcribed using an AmpliCap-Max T7 High Yield Message Maker Kit (Cellscript) to obtain RNA for standards. Prior to RT-PCR, samples collected from challenged animals or standards were reverse-transcribed using Superscript III VILO (Invitrogen) according to the manufacturer's instructions. A Taqman custom gene expression assay (ThermoFisher Scientific) was designed using the sequences targeting the E gene sgmRNA (18). Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer's specifications. Standard curves were used to calculate sgmRNA in copies per ml or per swab; the quantitative assay sensitivity was 50 copies per ml or per swab.
Results
Induction of memory humoral and cellular immune responses in INO-4800 immunized non-human primates. Non-human primates (NHP) are a valuable model in the development of COVID-19 vaccines and therapeutics as they can be infected with wild-type SARS-CoV-2, and present with similar pathology to humans (Chandrashekar et al., 2020, Science, eabc4776; Qin et al., 2005, J Pathol 206, 251-259; Yao et al., 2014, J Infect Dis 209, 236-242; Yu et al., 2020, Science, eabc6284). Rhesus macaques (n=5) received two immunizations of INO-4800 (1 mg), at Week 0 and Week 4 (
In serum samples of the animals SARS-CoV-2 pseudovirus neutralization activity was detected for >4 months following immunization (
To further investigate the neutralizing activities, the sera was also tested using an ACE2 competition ELISA, where sera from 80% of immunized NHPs inhibited the SARS-CoV-2 Spike-ACE2 interaction (
INO-4800 immunization also induced SARS-CoV-2 S antigen reactive T cell responses against all 5 peptide pools with T cells responses peaking at Week 6, two weeks following the second immunization (0-518 SFU/million cells) (
Vaccine induced memory recall responses upon SARS-CoV-2 challenge in non-human primates. Vaccine immunized macaques along with unvaccinated controls were challenged with SARS-CoV-2 13 weeks (˜3 months) post-final immunization (Study Week 17,
Cellular responses were evaluated before and after challenge. At week 15, IFN-γ ELISpot responses had contracted significantly since the peak responses observed at week 6. T cell responses increased in the vaccinated group following challenge (˜218.36 SFU/million cells) implying recall of immunological T cell memory (
Protective efficacy following SARS-CoV-2 challenge. At earlier time points post virus input at challenge, viral mRNA detection does not discriminate between input challenge inoculum and active infection, while sgmRNA levels are more likely representative of active cellular SARS-CoV-2 replication (Wolfel et al., 2020, Nature, 581, 465-469; Yu et al., 2020, Science, eabc6284). SARS-CoV-2 subgenomic mRNA (sgmRNA) was measured in nonvaccinated control and INO-4800 vaccinated macaques following challenge with 1.1×104 PFU of SARS-CoV-2 Isolate USA-WA1/2020 (
It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations upon the scope of the invention, which is defined solely by the appended claims and their equivalents.
Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including without limitation those relating to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations, or methods of use of the invention, may be made without departing from the spirit and scope thereof
MDWTWILFLV AAATRVHSSQ CVNLTTRTQL PPAYTNSFTR GVYYPDKVFR SSVLHSTQDL
ATGGATTGGA CTTGGATTCT CTTTCTCGTT GCTGCAGCCA CACGCGTTCA TAGCAGCCAG
MDWTWILFLV AAATRVHSSQ CVNLTTRTQL PPAYTNSFTR GVYYPDKVFR SSVLHSTQDL
ATGGATTGGA CCTGGATTCT TTTTCTCGTT GCAGCTGCTA CACGCGTTCA TAGCAGCCAG
The present application claims the benefit of U.S. Provisional Application No. 63/184,678, filed May 5, 2021; U.S. Provisional Application No. 63/248,927, filed Sep. 27, 2021; U.S. Provisional Application No. 63/252,407, filed Oct. 5, 2021; and U.S. Provisional Application No. 63/275,149, filed Nov. 3, 2021. The contents of each of these applications are incorporated herein by reference in the entirety. The present application relates to U.S. application Ser. No. 17/185,458, filed Feb. 25, 2021 and International Patent Application No. PCT/US2021/019662, filed Feb. 25, 2021, each of which claims benefit of U.S. Provisional Appl. No. 62/981,451, filed Feb. 25, 2020; U.S. Provisional Appl. No. 63/004,380, filed Apr. 2, 2020; U.S. Provisional Appl. No. 63/028,404, filed May 21, 2020; U.S. Provisional Appl. No. 63/033,349, filed Jun. 2, 2020; U.S. Provisional Appl. No. 63/040,865, filed Jun. 18, 2020; U.S. Provisional Appl. No. 63/046,415, filed Jun. 30, 2020; U.S. Provisional Appl. No. 63/062,762, filed Aug. 7, 2020; U.S. Provisional Appl. No. 63/114,858, filed Nov. 17, 2020; U.S. Provisional Appl. No. 63/130,593 filed Dec. 24, 2020; U.S. Provisional Appl. No. 63/136,973 filed Jan. 13, 2021; U.S. Provisional Appl. No. 62/981,168, filed Feb. 25, 2020; U.S. Provisional Appl. No. 63/022,032, filed May 8, 2020; U.S. Provisional Appl. No. 63/056,996, filed Jul. 27, 2020; and U.S. Provisional Appl. No. 63/063,157, filed Aug. 7, 2020. The contents of each of these applications are incorporated herein by reference in the entirety. This application further relates to U.S. application Ser. No. 17/720,025, filed Apr. 13, 2022; International Application No. PCT/US2022/071691, filed Apr. 13, 2022; U.S. provisional application No. 63/174,375, filed Apr. 13, 2021; U.S. provisional application No. 63/215,172, filed Jun. 25, 2021; U.S. provisional application No. 63/247,707, filed Sep. 23, 2021; U.S. provisional application No. 63/309,387, filed Feb. 11, 2022; and U.S. provisional application No. 63/314,074 filed Feb. 25, 2022. The contents of each of these applications are incorporated herein by reference in the entirety.
| Number | Date | Country | |
|---|---|---|---|
| 63184678 | May 2021 | US | |
| 63248927 | Sep 2021 | US | |
| 63252407 | Oct 2021 | US | |
| 63275149 | Nov 2021 | US |
