Water-soluble tetraazaporphins and fluorochrome for labeling

BACKGROUND OF THE INVENTION
This invention relates to a water-soluble tetraazaporphin, a fluorochrome for labeling, a substance derived from an organism which has been labeled with the fluorochrome for labeling, a reagent comprising any of them, and a fluorescence analysis process using any of them.
Since early times, label methods have been utilized for investigation of various substances such as molecules, cells, antigens, antibodies, DNA, RNA, polypeptides, etc. A label method using a radioisotope (RI) has heretofore been widely utilized because it has been studied for a long period of time. Since RI entails a severe exposure hazard, employment of RI requires both a special license and a special laboratory, and has been possible only for specified persons in specified facilities.
On the other hand, a method using a coloring substance, chemiluminescence method, fluorescence method, etc. are noted as label methods free from danger because they need not use RI. The method using a coloring substance cannot have a high detection sensitivity and hence is not so useful as to replace the RI method thereby. On the other hand, the chemiluminescence method and the fluorescence method are considered safe label methods which can replace the RI method, because their detection sensitivity can be enhanced. However, in the chemiluminescence method, luminescence is caused by combination of two or more chemical reactions, so that a complicated procedure is required. Therefore, fluorescence label method is the most excellent label method from the viewpoint Of safety, simplicity and high sensitivity.
There have been known only dyes which emit fluorescence in the ultraviolet region, but Rhodamine dyes and oxazine dyes have recently come to be known to the art as dyes which can be excited by means of an argon laser or a He--Ne laser.
As a light source, a compact semiconductor laser (670 to 840 nm) has recently become available at a low price. It is likely to become a leading light source because of the demand for an inexpensive, small and light instrument. However, there is a problem in that conventional Rhodamine dyes, oxazine dyes and the like cannot be used when the semiconductor laser is used.
It has recently been proposed that phthalocyanine capable of showing a proper fluorescence quantum yield and a high water-solubility is used as a fluorochrome for labeling (International Publication Nos. WO 88/04777 and WO 90/02747). However, the absorption maximum wavelength region and fluorescence emission wavelength region in Q-band of phthalocyanine derivatives are in a range of 670 to 690 nm, so that the phthalocyanine derivatives cannot be excited by means of a semiconductor laser emitting a wavelength of 700 nm or more. Moreover, when a semiconductor laser emitting a wavelength of 670 to 680 nm is used, its emitting wavelength region and the fluorescence emission wavelength region-overlap each other, so that it is impossible to judge whether light detected is derived from fluorescent radiation emitted or laser beam scattered. Therefore, the phthalocyanine derivatives cannot be utilized. In short, the phthalocyanine derivatives have a fatal defect in that they cannot be used at all in a system using a semiconductor laser which is a leading system.
Furthermore, in a system in which a substance in a living body, for example, a heme in blood is present together with an analyte to be measured, measurement of the analyte is restricted by the substance in the living body because the heme has an absorption wavelength region of 700 nm or less which overlaps with that of phthalocyanine.
SUMMARY OF THE INVENTION
This invention provides a novel compound, a fluorochrome for labeling, a reagent, a reagent for clinical examination, and a fluorescence analysis process which are not affected by substances in a living body, such as hemes present in blood, can be used for measurement by means of an inexpensive and compact semiconductor laser (670 to 840 nm), and are useful for assay of various antigens, drugs, DNA's, etc. and analysis of the base sequence of DNA.
This invention provides the following items (1) to (12).
(1) A water-soluble tetraazaporphin represented by the general formula (I): ##STR2## wherein M is Al, Si, P, Ga, Ge or Sc; k is zero or an integer of 1; in the case of k being 1, L is
--Si(CH.sub.3).sub.2 (CH.sub.2).sub.a NH--,
--Si(CH.sub.3).sub.2 (CH.sub.2).sub.b NH.COO--,
--Si(CH.sub.3).sub.2 O-- or
--Si(CH.sub.3).sub.2 NH--
wherein a and b are independently an integer of 1 to 6; x is an integer of i to 6; y is an integer of 1 to 200; R.sup.1 is a hydrogen atom, a linear, branched or cyclic alkyl group, an aryl group, a heterocyclic group or an aralkyl group; p is an integer of 1 or 2 indicating the number of groups represented by the formula --OL.sub.K --(C.sub.X H.sub.2X O).sub.y --R.sup.1 which are bonded to M; four A's, which may be the same or different, are independently a fused polycyclic aromatic ring formed from two or more aromatic rings, which may have substituents XQ's or Q's in a number of m (X is an oxygen atom, a sulfur atom, a nitrogen atom, a phosphorus atom, a silicon atom, a selenium atom, NH.CO, NH.PO.sub.2, NH.SO.sub.2, O.CO, O.SO.sub.2, O.PO.sub.2, S.CO, S.SO.sub.2, S.PO.sub.2, CO, SO.sub.2 or PO.sub.2 ; Q is a saturated or unsaturated hydrocarbon group or a heterocyclic group; and each m is the same or different and independently an integer of 1 to 4; each n is the same or different and independently zero or an integer of 1 or more, 4n (the sum of four n's, namely, the total number of EZ's) being an integer of 1 or more; each substituent (EZ) in a number of n is the same or different and independently bonded to the fused polycyclic aromatic ring A and/or Q; and E is a cationic group in the case of Z being an anion, E is an anionic group in the case of Z being a cation, and E is a bonded group containing a polyethylene glycol residue, a polyether residue, a polyamine residue, a polyalcohol residue or a polycarboxylic acid residue in the case of z being absent.
(2) A fluorochrome for labeling comprising the water-soluble tetraazaporphin of the above item (1).
(3) A reagent comprising the fluorochrome for labeling of the above item (2).
(4) A reagent comprising the fluorochrome for labeling of the above item (2) and a nonionic surfactant.
(5) A substance derived from an organism which has been labeled with the fluorochrome for labeling of the above item (2).
(6) A reagent comprising the labeled substance derived from an organism of the above item (5).
(7) A reagent comprising the labeled substance derived from an organism of the above item (5) and a non-ionic surfactant.
(8) A substance derived from an organism according to the above item (5) or a reagent according to the above item (6) or (7), wherein the substance derived from an organism is an antigen, an antibody or a nucleotide.
(9) A substance derived from an organism or a reagent according to the above item (8), wherein the antigen is a drug.
(10) A substance derived from an organism or a reagent according to the above item (8), wherein the antibody is a monoclonal antibody.
(11) A substance derived from an organism or a reagent according to the above item (8), wherein the nucleotide is an oligonucleotide or a polynucleotide.
(12) A substance derived from an organism or a reagent according to the above item (8), wherein the nucleotide is ATP, CTP, GTP, TTP, UTP, dATP, dCTP, dGTP, dTTP, dUTP, ddATP, ddCTP, ddGTP, ddTTP, ddUTP, or a derivative thereof.
(13) A fluorescence analysis process characterized by using the fluorochrome for labeling of the above item (2) as a fluorescent label.
(14) A fluorescence analysis process according to the above item (13), which uses a semiconductor laser emitting a wavelength of 670 to 840 nmas a light source.
(15) A fluorescence analysis process according to the above item (13) or (14), which uses the labeled substance derived from an organism of the above item (5).

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is an IR spectrum (neat) of 3,4-bis(dibromomethyl)bromobenzene.
FIG. 2 is an NMR spectrum in CDCl.sub.3 of 6-bromo-2,3-dicyanonaphthalene.
FIG. 3 is an IR spectrum (KBr) of 6-bromo-2,3-dicyanonaphthalene.
FIG. 4 is an IR spectrum (KBr) of 6-bromo-1,3-diiminobenz[f]isoindoline.
FIG. 5 is an IR spectrum (KBr) of dichlorosilicon-tetrabromonaphthalocyanine.
FIG. 6 is an electronic spectrum (tetrahydrofuran solution) of dichlorosilicon-tetrabromonaphthalocyanine.
FIG. 7 is an IR spectrum (KBr) of dihydroxysilicon-tetrabromonaphthalocyanine.
FIG. 8 is an electronic spectrum (tetrahydrofuran solution) of dihydroxysilicon-tetrabromonaphthalocyanine.
FIG. 9 is an electronic spectrum (methanol solution) of bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetrabromonaphthalocyanine.
FIG. 10 is an electronic spectrum (methanol solution) of bis(methoxy-polyethylene glycol (Mw about 2,000))--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine.
FIG. 11 is an electronic spectrum (methanol solution) of bis(methoxy-polyethylene glycol (Mw about 2,000))--NH--CO.NH--(CH.sub.2).sub.3 Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine.
FIG. 12 is an IR spectrum (neat) of methyl 3,4-dimethylbenzoate.
FIG. 13 is an IR spectrum (KBr) of methyl 3,4-bis(dibromomethyl)benzoate.
FIG. 14 is an IR spectrum (KBr) of 6-methoxycarbonyl-2,3-dicyanonaphthalene.
FIG. 15 is an IR spectrum (KBr) of 6-chloro-2,3-dicyanoquinoxaline.
FIG. 16 is an IR spectrum (KBr) of 6-carbamoyl-1,3-diiminobenz[f]isoindoline.
FIG. 17 is an electronic spectrum (quinoline solution) of dihydroxysilicon-tetracarbamoylnaphthalocyanine.
FIG. 18 is an electronic spectrum (methanol solution) of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-naphthalocyaninetetracarboxylate (illustrative compound No. 17).
FIG. 19 is an electronic spectrum (methanol solution) of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 19).
FIG. 20 is an electronic spectrum (methanol solution) of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinoxalocyanineoctacarboxylate (illustrative compound No. 169).
FIG. 21 is an electronic spectrum (methanol solution) of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinolocyanineoctacarboxylate (illustrative compound No. 49).

DESCRIPTION OF THE PREFERRED EMBODIMENTS
The water-soluble tetraazaporphin derivative of the present invention is represented by the formula: ##STR3## and since it is highly soluble not only in water but also in polar organic solvents such as methanol, ethanol, etc., it can easily be purified to be improved in purity, by chromatography, recrystallization, reprecipitation, etc.
In the compound of the formula (I) of this invention, the linear, branched or cyclic alkyl group, aryl group, heterocyclic group or aralkyl group represented by R.sup.1 include methyl group, ethyl group, propyl group, isopropyl group, butyl group, isobutyl group, sec-butyl group, tert-butyl group, pentyl group, sec-pentyl group, tert-pentyl group, neopentyl group, 2-ethylhexyl group, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, phenyl group, o-tolyl group, m-tolyl group, p-tolyl group, 2,3-xylyl group, 2,4-xylyl group, o-cumenyl group, m-cumenyl group, p-cumenyl group, mesityl group, thienyl group, furyl group, tetrahydrofurfuryl, benzyl group, phenethyl group, trityl group, naphthyl group, norbornyl group, etc.
The group represented by the formula --(C.sub.X H.sub.2X O)y-- includes, for example, polyethylene glycol residues and polypropylene glycol residues, which have an average molecular weight of 200 to 10,000.
As to XQ or Q, i.e., the substituent which A may have in the general formula (I), specific examples of the saturated or unsaturated, linear, branched or cyclic hydrocarbon group represented by Q are methyl group, ethyl group, propyl group, isopropyl group, butyl group, isobutyl group, sec-butyl group, tert-butyl group, pentyl group, isopentyl group, neopentyl group, hexyl group, heptyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, vinyl group, 1-propenyl group, allyl group, isopropenyl group, 1-butenyl group, 2-butenyl group, 2-pentenyl group, ethynyl group, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cyclohexenyl group, phenyl group, tolyl group, xylyl group, mesityl group, cumenyl group, benzyl group, phenethyl group, naphthyl group, etc. Specific examples of the heterocyclic group are furyl group, thienyl group, pyrrolyl group, etc.
The anion represented by Z includes Cl.sup.--, Br.sup.--, I.sup.--, ClO.sub.4.sup.--, SO.sub.4.sup.--, PO.sub.3.sup.--, etc. The cation represented by Z includes H.sup.+, Li.sup.+, Na.sup.+, K.sup.+, Mg.sup.2+, Ca.sup.2+, ammonium ion, etc. The cationic group represented by E includes, for example, --N.sup.+ R.sup.2.sub.3 and ##STR4## wherein R.sup.2 and R.sup.3 are independently an alkyl group, an aryl group, a heterocyclic group or an aralkyl group which are the same as those exemplified above for R.sup.1 and may have one or more hydrophilic substituents. The anionic group represented by E includes --COO.sup.13 , --OSO.sub.3.sup.--, --OPO.sub.3.sup.--, --SO.sub.3.sup.--, etc. The fused polycyclic aromatic ring formed from two or more aromatic rings which is represented by A, includes naphthalene ring, anthracene ring, phenanthrene ring, quinoline ring, quinoxaline ring, chrysene ring, etc. The bonding position of the fused polycyclic aromatic ring has not any limitation.
The kind and form of the above substituents have a great influence not only on the solubility of the novel tetraazaporphin of the above general formula (I) in water or polar organic solvents but also on the absorption spectrum and the wavelength of absorption maximum, or the wavelength of fluorescence emission maximum and the fluorescence emission intensity, in a solution.
The symbol "p" represents zero or an integer of 1 or 2 indicating the number of groups of the formula --OL.sub.K --(C.sub.X H.sub.2X O).sub.y --R.sup.1 bonded to M. When M is Al, Sc or Ga, p is 1. When M is Si, P or Ge, p is 2.
In the compound of the general formula (I), the water-soluble group represented by EZ is bonded to the fused polycyclic aromatic ring represented by A and/or the hydrocarbon group or heterocyclic group for Q bonded to the aromatic ring. The position(s) to which EZ is bonded is determined by the synthetic pathway of the compound of the general formula (I). For example, when as shown in Example 2 described hereinafter, XQ having one or more substituents (ester groups) convertible into EZ by hydrolysis is introduced into the fused polycyclic aromatic ring represented by A and then hydrolyzed, the product has a water-soluble group(s) EZ as substituent(s) only in Q.
Specific examples of the water-soluble tetraazaporphin of this invention are shown in Table 1.
TABLE 1 - No. M A L k (C.sub.x H.sub.2x O).sub.y R.sup.1 p XQ or Q m EZ 4n 1 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR5## CH.sub.3 2 -- 0 COONa 4 2 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR6## CH.sub.3 2 -- 0 COONa 4 3 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR7## CH.sub.3 2 ##STR8## 1 COONa 8 4 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR9## CH.sub.3 2 ##STR10## 1 COONa 8 5 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR11## CH.sub.3 2 -- 0 COONa 4 6 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR12## CH.sub.3 2 -- 0 COONa 4 7 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR13## CH.sub.3 2 ##STR14## 1 COONa 8 8 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR15## CH.sub.3 2 ##STR16## 1 COONa 8 9 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR17## CH.sub.3 2 -- 0 COONa 4 10 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR18## CH.sub.3 2 -- 0 COONa 4 11 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR19## CH.sub.3 2 ##STR20## 1 COONa 8 12 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR21## CH.sub.3 2 ##STR22## 1 COONa 8 13 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR23## CH.sub.3 2 -- 0 COONa 4 14 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR24## CH.sub.3 2 -- 0 COONa 4 15 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR25## CH.sub.3 2 ##STR26## 1 COONa 8 16 Si 2,3-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR27## CH.sub.3 2 ##STR28## 1 COONa 8 17 Si 2,3-Naphthalene ring -- 0 ##STR29## CH.sub.3 2 -- 0 COONa 4 18 Si 2,3-Naphthalene ring -- 0 ##STR30## CH.sub.3 2 -- 0 COONa 4 19 Si 2,3-Naphthalene ring -- 0 ##STR31## CH.sub.3 2 ##STR32## 1 COONa 8 20 Si 2,3-Naphthalene ring -- 0 ##STR33## CH.sub.3 2 ##STR34## 1 COONa 8 21 Si 2,3-Naphthalene ring -- 0 ##STR35## ##STR36## 2 -- 0 COONa 4 22 Si 2,3-Naphthalene ring -- 0 ##STR37## CH.sub.3 2 -- 0 COONa 4 23 Ge 2,3-Naphthalene ring -- 0 ##STR38## CH.sub.3 2 -- 0 COONa 4 24 Al 2,3-Naphthalene ring -- 0 ##STR39## CH.sub.3 1 -- 0 COONa 4 25 Ga 2,3-Naphthalene ring -- 0 ##STR40## CH.sub.3 1 -- 0 COONa 4 26 Si 2,3-Naphthalene ring -- 0 ##STR41## CH.sub.3 2 ##STR42## 1 SO.sub.3 Na 8 27 Si 2,3-Naphthalene ring -- 0 ##STR43## CH.sub.3 2 ##STR44## 1 OPO.sub.3 Na 8 28 Si 2,3-Naphthalene ring -- 0 ##STR45## CH.sub.3 2 ##STR46## 1 ##STR47## 6 29 Si 2,3-Naphthalene ring -- 0 ##STR48## CH.sub.3 2 SC.sub.2 H.sub.4 1 COONa 4 30 Si 2,3-Naphthalene ring -- 0 ##STR49## CH.sub.3 2 ##STR50## 1 ##STR51## 8 31 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR52## CH.sub.3 2 -- 0 COONa 4 32 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR53## CH.sub.3 2 -- 0 COONa 4 33 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR54## CH.sub.3 2 ##STR55## 1 COONa 8 34 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR56## CH.sub.3 2 ##STR57## 1 COONa 8 35 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR58## CH.sub.3 2 -- 0 COONa 4 36 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR59## CH.sub.3 2 -- 0 COONa 4 37 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR60## CH.sub.3 2 ##STR61## 1 COONa 8 38 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR62## CH.sub.3 2 ##STR63## 1 COONa 8 39 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.O 1 ##STR64## CH.sub.3 2 -- 0 COONa 4 40 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.O 1 ##STR65## CH.sub.3 2 -- 0 COONa 4 41 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.O 1 ##STR66## CH.sub.3 2 ##STR67## 1 COONa 8 42 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.O 1 ##STR68## CH.sub.3 2 ##STR69## 1 COONa 8 43 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.NH 1 ##STR70## CH.sub.3 2 -- 0 COONa 4 44 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.NH 1 ##STR71## CH.sub.3 2 -- 0 COONa 4 45 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.NH 1 ##STR72## CH.sub.3 2 ##STR73## 1 COONa 8 46 Si 2,3-Quinoline ring Si(CH.sub.3).sub.2.NH 1 ##STR74## CH.sub.3 2 ##STR75## 1 COONa 8 47 Si 2,3-Quinoline ring -- 0 ##STR76## CH.sub.3 2 -- 0 COONa 4 48 Si 2,3-Quinoline ring -- 0 ##STR77## CH.sub.3 2 -- 0 COONa 4 49 Si 2,3-Quinoline ring -- 0 ##STR78## CH.sub.3 2 ##STR79## 1 COONa 8 50 Si 2,3-Quinoline ring -- 0 ##STR80## CH.sub.3 2 ##STR81## 1 COONa 8 51 Si 2,3-Quinoline ring -- 0 ##STR82## ##STR83## 2 -- 0 COONa 4 52 Si 2,3-Quinoline ring -- 0 ##STR84## CH.sub.3 2 -- 0 COONa 4 53 Ge 2,3-Quinoline ring -- 0 ##STR85## CH.sub.3 2 -- 0 COONa 4 54 Al 2,3-Quinoline ring -- 0 ##STR86## CH.sub.3 1 -- 0 COONa 4 55 Ga 2,3-Quinoline ring -- 0 ##STR87## CH.sub.3 1 -- 0 COONa 4 56 Si 2,3-Quinoline ring -- 0 ##STR88## CH.sub.3 2 ##STR89## 1 SO.sub.3 Na 8 57 Si 2,3-Quinoline ring -- 0 ##STR90## CH.sub.3 2 ##STR91## 1 OPO.sub.3 Na 8 58 Si 2,3-Quinoline ring -- 0 ##STR92## CH.sub.3 2 ##STR93## 1 ##STR94## 6 59 Si 2,3-Quinoline ring -- 0 ##STR95## CH.sub.3 2 SC.sub.2 H.sub.4 1 COONa 4 60 Si 2,3-Quinoline ring -- 0 ##STR96## CH.sub.3 2 ##STR97## 1 ##STR98## 8 61 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR99## CH.sub.3 2 -- 0 COONa 4 62 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR100## CH.sub.3 2 -- 0 COONa 4 63 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR101## CH.sub.3 2 ##STR102## 1 COONa 8 64 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR103## CH.sub.3 2 ##STR104## 2 COONa 16 65 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub .3 NH.COO 1 ##STR105## CH.sub.3 2 -- 0 COONa 4 66 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR106## CH.sub.3 2 -- 0 COONa 4 67 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR107## CH.sub.3 2 ##STR108## 2 COONa 8 68 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR109## CH.sub.3 2 ##STR110## 2 COONa 16 69 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.O 1 ##STR111## CH.sub.3 2 -- 0 COONa 4 70 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.O 1 ##STR112## CH.sub.3 2 -- 0 COONa 4 71 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.O 1 ##STR113## CH.sub.3 2 ##STR114## 1 COONa 8 72 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.O 1 ##STR115## CH.sub.3 2 ##STR116## 2 COONa 16 73 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.NH 1 ##STR117## CH.sub.3 2 -- 0 COONa 4 74 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.NH 1 ##STR118## CH.sub.3 2 -- 0 COONa 4 75 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.NH 1 ##STR119## CH.sub.3 2 ##STR120## 1 COONa 8 76 Si 9,10-Phenanthrene ring Si(CH.sub.3).sub.2.NH 1 ##STR121## CH.sub.3 2 ##STR122## 2 COONa 16 77 Si 9,10-Phenanthrene ring -- 0 ##STR123## CH.sub.3 2 -- 0 COONa 4 78 Si 9,10-Phenanthrene ring -- 0 ##STR124## CH.sub.3 2 -- 0 COONa 4 79 Si 9,10-Phenanthrene ring -- 0 ##STR125## CH.sub.3 2 ##STR126## 2 COONa 16 80 Si 9,10-Phenanthrene ring -- 0 ##STR127## CH.sub.3 2 ##STR128## 2 COONa 16 81 Si 9,10-Phenanthrene ring -- 0 ##STR129## ##STR130## 2 -- 0 COONa 4 82 Si 9,10-Phenanthrene ring -- 0 ##STR131## CH.sub.3 2 -- 0 COONa 4 83 Ge 9,10-Phenanthrene ring -- 0 ##STR132## CH.sub.3 2 -- 0 COONa 4 84 Al 9,10-Phenanthrene ring -- 0 ##STR133## CH.sub.3 1 -- 0 COONa 4 85 Ga 9,10-Phenanthrene ring -- 0 ##STR134## CH.sub.3 1 -- 0 COONa 4 86 Si 9,10-Phenanthrene ring -- 0 ##STR135## CH.sub.3 2 ##STR136## 1 SO.sub.3 Na 8 87 Si 9,10-Phenanthrene ring -- 0 ##STR137## CH.sub.3 2 ##STR138## 1 OPO.sub.3 Na 8 88 Si 9,10-Phenanthrene ring -- 0 ##STR139## CH.sub.3 2 ##STR140## 1 ##STR141## 6 89 Si 9,10-Phenanthrene ring -- 0 ##STR142## CH.sub.3 2 SC.sub.2 H.sub.4 1 COONa 4 90 Si 9,10-Phenanthrene ring -- 0 ##STR143## CH.sub.3 2 ##STR144## 1 ##STR145## 8 91 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR146## CH.sub.3 2 -- 0 COONa 4 92 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR147## CH.sub.3 2 -- 0 COONa 4 93 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR148## CH.sub.3 2 ##STR149## 1 COONa 8 94 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR150## CH.sub.3 2 ##STR151## 2 COONa 16 95 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR152## CH.sub.3 2 -- 0 COONa 4 96 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR153## CH.sub.3 2 -- 0 COONa 4 97 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR154## CH.sub.3 2 ##STR155## 2 COONa 8 98 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR156## CH.sub.3 2 ##STR157## 2 COONa 16 99 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.O 1 ##STR158## CH.sub.3 2 -- 0 COONa 4 100 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.O 1 ##STR159## CH.sub.3 2 -- 0 COONa 4 101 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.O 1 ##STR160## CH.sub.3 2 ##STR161## 1 COONa 8 102 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.O 1 ##STR162## CH.sub.3 2 ##STR163## 2 COONa 16 103 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.NH 1 ##STR164## CH.sub.3 2 -- 0 COONa 4 104 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.NH 1 ##STR165## CH.sub.3 2 -- 0 COONa 4 105 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.NH 1 ##STR166## CH.sub.3 2 ##STR167## 1 COONa 8 106 Si 2,3-Anthracene ring Si(CH.sub.3).sub.2.NH 1 ##STR168## CH.sub.3 2 ##STR169## 2 COONa 16 107 Si 2,3-Anthracene ring -- 0 ##STR170## CH.sub.3 2 -- 0 COONa 4 108 Si 2,3-Anthracene ring -- 0 ##STR171## CH.sub.3 2 -- 0 COONa 4 109 Si 2,3-Anthracene ring -- 0 ##STR172## CH.sub.3 2 ##STR173## 2 COONa 16 110 Si 2,3-Anthracene ring -- 0 ##STR174## CH.sub.3 2 ##STR175## 2 COONa 16 111 Si 2,3-Anthracene ring -- 0 ##STR176## ##STR177## 2 -- 0 COONa 4 112 Si 2,3-Anthracene ring -- 0 ##STR178## CH.sub.3 2 -- 0 COONa 4 113 Ge 2,3-Anthracene ring -- 0 ##STR179## CH.sub.3 2 -- 0 COONa 4 114 Al 2,3-Anthracene ring -- 0 ##STR180## CH.sub.3 1 -- 0 COONa 4 115 Ga 2,3-Anthracene ring -- 0 ##STR181## CH.sub.3 1 -- 0 COONa 4 116 Si 2,3-Anthracene ring -- 0 ##STR182## CH.sub.3 2 ##STR183## 1 SO.sub.3 Na 8 117 Si 2,3-Anthracene ring -- 0 ##STR184## CH.sub.3 2 ##STR185## 1 OPO.sub.3 Na 8 118 Si 2,3-Anthracene ring -- 0 ##STR186## CH.sub.3 2 ##STR187## 1 ##STR188## 6 119 Si 2,3-Anthracene ring -- 0 ##STR189## CH.sub.3 2 SC.sub.2 H.sub.4 2 COONa 8 120 Si 2,3-Anthracene ring -- 0 ##STR190## CH.sub.3 2 ##STR191## 1 ##STR192## 8 121 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR193## CH.sub.3 2 -- 0 COONa 4 122 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR194## CH.sub.3 2 -- 0 COONa 4 123 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR195## CH.sub.3 2 ##STR196## 1 COONa 8 124 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR197## CH.sub.3 2 ##STR198## 1 COONa 8 125 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR199## CH.sub.3 2 -- 0 COONa 4 126 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR200## CH.sub.3 2 -- 0 COONa 4 127 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR201## CH.sub.3 2 ##STR202## 1 COONa 8 128 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR203## CH.sub.3 2 ##STR204## 1 COONa 8 129 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR205## CH.sub.3 2 -- 0 COONa 4 130 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR206## CH.sub.3 2 -- 0 COONa 4 131 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR207## CH.sub.3 2 ##STR208## 1 COONa 8 132 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.O 1 ##STR209## CH.sub.3 2 ##STR210## 1 COONa 8 133 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR211## CH.sub.3 2 -- 0 COONa 4 134 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR212## CH.sub.3 2 -- 0 COONa 4 135 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR213## CH.sub.3 2 ##STR214## 1 COONa 8 136 Si 1,2-Naphthalene ring Si(CH.sub.3).sub.2.NH 1 ##STR215## CH.sub.3 2 ##STR216## 1 COONa 8 137 Si 1,2-Naphthalene ring -- 0 ##STR217## CH.sub.3 2 -- 0 COONa 4 138 Si 1,2-Naphthalene ring -- 0 ##STR218## CH.sub.3 2 -- 0 COONa 4 139 Si 1,2-Naphthalene ring -- 0 ##STR219## CH.sub.3 2 ##STR220## 1 COONa 8 140 Si 1,2-Naphthalene ring -- 0 ##STR221## CH.sub.3 2 ##STR222## 1 COONa 8 141 Si 1,2-Naphthalene ring -- 0 ##STR223## ##STR224## 2 -- 0 COONa 4 142 Si 1,2-Naphthalene ring -- 0 ##STR225## CH.sub.3 2 -- 0 COONa 4 143 Ge 1,2-Naphthalene ring -- 0 ##STR226## CH.sub.3 2 -- 0 COONa 4 144 Al 1,2-Naphthalene ring -- 0 ##STR227## CH.sub.3 1 -- 0 COONa 4 145 Ga 1,2-Naphthalene ring -- 0 ##STR228## CH.sub.3 1 -- 0 COONa 4 146 Si 1,2-Naphthalene ring -- 0 ##STR229## CH.sub.3 2 ##STR230## 1 SO.sub.3 Na 8 147 Si 1,2-Naphthalene ring -- 0 ##STR231## CH.sub.3 2 ##STR232## 1 OPO.sub.3 Na 8 148 Si 1,2-Naphthalene ring -- 0 ##STR233## CH.sub.3 2 ##STR234## 1 ##STR235## 6 149 Si 1,2-Naphthalene ring -- 0 ##STR236## CH.sub.3 2 SC.sub.2 H.sub.4 1 COONa 4 150 Si 1,2-Naphthalene ring -- 0 ##STR237## CH.sub.3 2 ##STR238## 1 ##STR239## 8 151 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR240## CH.sub.3 2 -- 0 COONa 4 152 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR241## CH.sub.3 2 -- 0 COONa 4 153 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR242## CH.sub.3 2 ##STR243## 1 COONa 8 154 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH 1 ##STR244## CH.sub.3 2 ##STR245## 1 COONa 8 155 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR246## CH.sub.3 2 -- 0 COONa 4 156 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR247## CH.sub.3 2 -- 0 COONa 4 157 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR248## CH.sub.3 2 ##STR249## 1 COONa 8 158 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.(CH.sub.2).sub.3 NH.COO 1 ##STR250## CH.sub.3 2 ##STR251## 1 COONa 8 159 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.O 1 ##STR252## CH.sub.3 2 -- 0 COONa 4 160 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.O 1 ##STR253## CH.sub.3 2 -- 0 COONa 4 161 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.O 1 ##STR254## CH.sub.3 2 ##STR255## 1 COONa 8 162 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.O 1 ##STR256## CH.sub.3 2 ##STR257## 1 COONa 8 163 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.NH 1 ##STR258## CH.sub.3 2 -- 0 COONa 4 164 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.NH 1 ##STR259## CH.sub.3 2 -- 0 COONa 4 165 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.NH 1 ##STR260## CH.sub.3 2 ##STR261## 1 COONa 8 166 Si 2,3-Quinoxaline ring Si(CH.sub.3).sub.2.NH 1 ##STR262## CH.sub.3 2 ##STR263## 1 COONa 8 167 Si 2,3-Quinoxaline ring -- 0 ##STR264## CH.sub.3 2 -- 0 COONa 4 168 Si 2,3-Quinoxaline ring -- 0 ##STR265## CH.sub.3 2 -- 0 COONa 4 169 Si 2,3-Quinoxaline ring -- 0 ##STR266## CH.sub.3 2 ##STR267## 1 COONa 8 170 Si 2,3-Quinoxaline ring -- 0 ##STR268## CH.sub.3 2 ##STR269## 1 COONa 8 171 Si 2,3-Quinoxaline ring -- 0 ##STR270## ##STR271## 2 -- 0 COONa 4 172 Si 2,3-Quinoxaline ring -- 0 ##STR272## CH.sub.3 2 -- 0 COONa 4 173 Ge 2,3-Quinoxaline ring -- 0 ##STR273## CH.sub.3 2 -- 0 COONa 4 174 Al 2,3-Quinoxaline ring -- 0 ##STR274## CH.sub.3 1 -- 0 COONa 4 175 Ga 2,3-Quinoxaline ring -- 0 ##STR275## CH.sub.3 1 -- 0 COONa 4 176 Si 2,3-Quinoxaline ring -- 0 ##STR276## CH.sub.3 2 ##STR277## 1 SO.sub.3 Na 8 177 Si 2,3-Quinoxaline ring -- 0 ##STR278## CH.sub.3 2 ##STR279## 1 OPO.sub.3 Na 8 178 Si 2,3-Quinoxaline ring -- 0 ##STR280## CH.sub.3 2 ##STR281## 1 ##STR282## 6 179 Si 2,3-Quinoxaline ring -- 0 ##STR283## CH.sub.3 2 SC.sub.2 H.sub.4 1 COONa 4 180 Si 2,3-Quinoxaline ring -- 0 ##STR284## CH.sub.3 2 ##STR285## 1 ##STR286## 8
The water-soluble tetraazaporphin of the general formula (I) can be obtained by various synthetic methods. For example, it can be synthesized by the following routes: ##STR287##
In the above formulae, NcA means the portion except for {OL.sub.K --C.sub.x H.sub.2x O).sub.y --R.sup.1 }.sub.p, --(EZ).sub.n and XQ (including Q; hereinafter the same applied); Y.sub.R --NcA--(XQ)--EZ is a compound of the general formula (I) wherein Y.sub.R is {OL.sub.K--C.sub.x H.sub.2x O).sub.y --R.sup.1 }.sub.p, bonded to M; Y.sub.H --NcA--(XQ)--EZ is a compound of the general formula (I) wherein the substituent on M is not Y.sub.R but --OH; Y.sub.X --NcA--(XQ)--EZ is a compound of the general formula (I) wherein the substituent on M is not Y.sub.R but a halogen atom; Y.sub.R --NcA--(XQ) is a compound of the general formula (I) wherein {OL.sub.K --C.sub.x H.sub.2x O).sub.y --R.sup.1 }.sub.p and XQ are present, said compound being able to have a substituent which can be introduced into EZ by hydrolysis on a fused polycyclic aromatic ring of NcA or XQ; Y.sub.H --NcA--(XQ) is a compound of the general formula (I) wherein the substituent on M is --OH and XQ is present, said compound being able to have a substituent which can be introduced into EZ by hydrolysis on a fused polycyclic aromatic ring of NcA or XQ; Y.sub.X --NcA--(XQ) is a compound of the general formula (I) wherein the substituent on M is a halogen atom and XQ is present, said compound being able to have a substituent which can be introduced into EZ by hydrolysis on a fused polycyclic aromatic ring of NcA or XQ; Y.sub.R --NcA is a compound of the general formula (I) wherein {OL.sub.K --C.sub.x H.sub.2x O).sub.y --R.sup.1 }.sub.p is present, said compound being able to have a leaving group which can be substituted with XQ; Y.sub.H --NcA is a compound of the general formula (I) wherein the substituent on M is --OH, said compound being able to have a leaving group which can be substituted with xQ; and Y.sub.X --NcA is a compound of the general formula (I) wherein the substituent on M is a halogen atom, said compound being able to have a leaving group which can be substituted with XQ.
The reactions of individual compounds in the above-mentioned routes are well known, but dependent on structures to be introduced. Further, preferable routes are dependent on the desired final products.
The reaction from the lowest compounds to upper compounds in the above-mentioned reaction routes, that is, the substitution from Y.sub.X to Y.sub.H, can be carried out by hydrolysis. Further, the substitution from Y.sub.H to Y.sub.R, can be carried out by reacting with a corresponding polyethylene glycol derivative, silanol, chlorosilane, or the like.
Further, in the above-mentioned reaction routes, the change of compounds from a right-hand side to a left-hand side, that is, the introduction of XQ and EZ, can be carried out by reacting with a compound having the desired XQ and/or EZ or having a moiety which can be changed to XQ or EZ by one step or a plurality of steps.
The compounds represented by Y.sub.X --NcA--(XQ)--EZ, Y.sub.X --NcA--(XQ) and Y.sub.X --NcA mentioned above can be synthesized from a corresponding dicyano aromatic compounds or isoindoline derivatives according to the methods described in references [Zh. Obshch. Khim., 39, 2554-2558 (1969), J. Am. Chem. Soc. 106, 7404-7410 (1984), Zh. Obshch. Khim., 39, 2536-2541 (1969), Chem. Ber., 121, 1479-1486 (1988), Synthetic Metals, 9, 329-340 (1984), etc.].
A most important characteristic required of a compound used as the fluorochrome for labeling is that the compound shows a high fluorescence quantum yield (>0.1). For showing such a high fluorescence quantum yield, a tetraazaporphin derivative should satisfy the following conditions: the central metal should not be a heavy metal or a transition metal, and the tetraazaporphin derivative should be in a monomolecular state in a solution.
For satisfying these conditions, Al, Si, P, Ga, Ge or Sc is used as the central metal M. In particular, it is most preferable to make it possible to maintain the molecular state in a solution by suppressing the formation of face-to-face E-aggregates between molecules which is characteristic of tetraazaporphin, by using a compound containing a tetravalent metal (Si or Ge) as the central metal and having two substituents --OL.sub.K --(C.sub.X H.sub.2X O).sub.y --R.sup.1 on M above and below a tetraazaporphin ring. For realizing the monomolecular state in an aqueous solution, it is preferable to place a surfactant together with the fluorochrome for labeling. The concentration of the surfactant is preferably 0.01 to 5% by weight, more preferably 0.04 to 2% by weight.
The surfactant includes ionic surfactants and nonionic surfactants. Of these, nonionic surfactants such as Triton X-100, Tween series surfactants, Brij series surfactants, etc. are particularly preferable.
A tetraazaporphin which assumes a monomolecular state in the aqueous solution thus obtained is highly soluble particularly in water and polar organic solvents, is easy to separate and purify in its synthesis, and shows a high fluorescence quantum yield (>0.3) sufficient to permit application of the tetraazaporphin to fluorochrome for labeling. For these reasons, it is particularly preferable to use the water-soluble tetraazaporphin of this invention.
The above-mentioned fluorochrome for labeling can be made into a reagent for various fluorescence analyses. As described above, the reagent preferably contains a nonionic surfactant, depending on the kind of the fluorochrome.
In practice, said fluorochrome for labeling is made into a reagent by attaching the same to any of various substances, depending on the purpose of analysis. When the fluorochrome is used for immunoassay, the substances are various antigens (including haptens and drugs) and antibodies. When the fluorochrome is used for analyzing the nucleotide sequence of DNA or when it is used for analysis in the form of a DNA probe, the substance is the DNA, i.e., nucleotide.
The fluorochrome is often used particularly as a fluorescent label for substances derived from organisms, for example, in the above analyses.
The substance derived from an organism which can be labeled with the aforesaid fluorochrome for labeling and is used in this invention, includes proteins (peptides), nucleotides, sugars, lipids, hormones, vitamins, alkaloids, antibiotics, complexes thereof, etc. which are obtained from organisms such as animals, plants, microorganisms (including viruses), etc. These substances may be any of those extracted from natural sources, artificial and completely synthetic ones, and artificial and semisynthetic ones.
Specific examples of the proteins (peptides) are serum albumin, immunoglobulins (e.g. IgG, IgA, IgM, IgD and IgE), monoclonal antibodies against various proteins or membrane antigens of leucocyte, and enzymes (e.g. peroxidases, glucose oxidase and alkaline oxidases). Specific examples of the nucleotides are DNA, RNA, synthetic oligonucleotides, synthetic polynucleotides, ATP, CTP, GTP, TTP, UTP, dATP, dCTP, dGTP, dTTP, dUTP, ddATP, ddCTP, ddGTP, ddTTP, ddUTP, and derivatives thereof. Specific examples of the sugars are polysaccharides (e.g. glycogen, starch, and mannan), oligosaccharides, and monosaccharides (e.g. glucose and mannose). The lipids include phosphatidylcholine, phosphatidylethanolamine, fats, fatty acids, etc. The hormones include peptide hormones (e.g. insulin, growth hormone, oxytocin, vasopressin, secretin, epidermal growth factor, gastrin, glucagon and calcitonin), steroid hormones (e.g. androgen, estrogen and hydrocortisone), catecholamines (e.g. adrenaline and noradrenaline), etc. The vitamins include various vitamins such as vitamin A, vitamin B1, B2, B6 and B12, biotin, folic acid, vitamin C, vitamin D, vitamin E, etc. The alkaloids include opium alkaloids (e.g. morphine), tropane alkaloids (e.g. atropine and scopolamine), indole alkaloids (e.g. vinblastine and vincristine), isoquinoline alkaloids (e.g. coptis root), etc. The antibiotics include penicillin, cephalosporin, kanamycin, erythromycin, chloramphenicol, etc.
The substance derived from an organism and the fluorochrome for labeling can be combined by linking a functional group (e.g. a phosphoric acid group, carboxylic acid group, amino group, hydroxyl group or thiol group) in the substance derived from an organism and a functional group (e.g. a carboxyl group or a sulfonic acid group) in the fluorochrome for labeling, directly to each other through an ionic bond or a covalent bond. Alternatively, the substance derived from an organism and the fluorochrome for labeling can be combined through a combination assistant group called a linker, for facilitating bond-forming reaction. The substance derived from an organism which has been labeled with the fluorochrome for labeling can be purified by conventional purifying means such as chromatography, recrystallization, etc.
The aforesaid linker should be a group having at least two functional groups because one or more bonds should be formed for each of the substance derived from an organism and the fluorochrome for labeling. For this purpose, there can be used diols, diamines, amino alcohols, dicarboxylic acids, dithiols, aminocarboxylic acids, hydroxycarboxylic acids, etc.
The fluorochrome for labeling and the reagent comprising the same of this invention can be used in various fluorescence analysis method.
In particular, the compound of the general formula (I) absorbs semiconductor laser beams (670 to 840 nm) efficiently to emit fluorescence, and hence are very useful for assay of various antigens, drugs, DNAs, etc. and analysis of the nucleotide sequence of DNA (DNA sequencer) in which measurement is carried out using an inexpensive and compact semiconductor laser.
This invention is explained below with reference to Examples, which are not by way of limitation but by way of illustration.
SYNTHETIC EXAMPLE 1
Synthesis of 3,4-bis(dibromomethyl)bromobenzene
To a solution of 37 g (0.2 mol) of 4-bromo-o-xylene (75%) (mfd. by Aldrich Chemical Co.) and 142.4 g (0.8 mol) of N-bromosuccinimide in 500 ml of carbon tetrachloride was added 1 g of benzoyl peroxide, and the rusulting mixture was irradiated by a 100-W high pressure mercury arc lamp for 8 to 12 hours under reflux in an inner irradiating tube (mfd. by Ushio Inc.). After the mixture was allowed to cool, the white crystals precipitated were removed by filtration and the carbon tetrachloride solution, i.e., the mother liquor was concentrated under reduced pressure. The solid thus obtained was recrystallized from hexane/methylene chloride to obtain 64 g of 3,4-bis(dibromomethyl)bromobenzene as colorless crystals. Physical properties of 3,4-bis(dibromomethyl)bromobenzene were as follows:
(1) Melting point: 108.5.degree.-110.5.degree. C.
(2) Elementary analysis values:
TABLE 2______________________________________ C H Br______________________________________Calculated (%) 19.19 1.01 79.80Found (%) 19.12 0.88 79.84______________________________________
(3) NMR spectrum values: CDCl.sub.3
.delta. values: 7.81 (1H, br-s), 7.57 (1H, d, J=8.54 Hz), 7.50 (1H, dd, J=8.54, 1.83 Hz), 7.06 (1H, s), 7.02 (1H, s)
(4) IR spectrum (KBr) is shown in FIG. 1.
SYNTHETIC EXAMPLE 2
Synthesis of 6-bromo-2,3-dicyanonaphthalene
To a solution of 100.2 g (0.2 mol) of 3,4-bis(dibromomethyl)bromobenzene and 27 g (0.346 mol) of fumaronitrile in 800 ml of anhydrous N,N-dimethylformamide was added 200 g (0.67 mol) of sodium iodide with sufficient stirring, and the resulting mixture was stirred under nitrogen at about 75.degree. C. for about 7 hours. After completion of the reaction, the reaction mixture was poured onto about 4 kg of ice. Sodium hydrogen-sulfite was slowly added until the reddish-brown aqueous solution thus obtained turned light-yellow. Sodium hydrogensulfite was added in a slight excess and stirred for a while. The resulting mixture was allowed to stand overnight at room temperature. The light-yellow solid precipitated was filtered by suction and sufficiently washed with water and then methanol. The light-yellow solid was recrystallized from acetone/ethanol to obtain 33 g of colorless needles. The crystals were confirmed to be 6-bromo-2,3-dicyanonaphthalene from the following analyses:
(1) Melting point: 254.5.degree.-255.5.degree. C.
(2) Elementary analysis values:
TABLE 3______________________________________ C H N Br______________________________________Calculated (%) 56.06 1.96 10.90 31.08Found (%) 55.99 1.67 10.87 30.74______________________________________
(3) NMR spectrum values: CDCl.sub.3 (the NMR spectrum is shown in FIG. 2)
.delta. values: 8.34 (1H, s), 8.27 (1H, s), 8.17 (1H, br-s), 7.88 (2H, m)
(4) IR spectrum (KBr) is shown in FIG. 3.
SYNTHETIC EXAMPLE 3
Synthesis of 6-bromo-1,3-diiminobenz[f]isoindoline
Under nitrogen, 44.1 g (0.17 mol) of 6-bromo-2,3-dicyanonaphthalene was added to a solution of sodium methoxide in methanol prepared by adding 1.92 g (84 mmols) of metallic sodium to 270 ml of absolute methanol in 5 times, and anhydrous ammonia gas was slowly bubbled into the resulting mixture with sufficient stirring at room temperature for about 1 hour. The mixture was refluxed for about 3 hours while bubbling therethrough anhydrous ammonia gas. After cooling, the yellow solid precipitated was filtered and the residue was sufficiently washed with methanol and dried under reduced pressure to obtain 45 g of 6-bromo-1,3-diiminobenz[f]isoindoline as a yellow solid. IR spectrum of this 6-bromo-1,3-diiminobenz[f]isoindoline is shown in FIG. 4. The 6-bromo-1,3-diiminobenz[f]isoindoline was used in the subsequent reaction without further purification.
SYNTHETIC EXAMPLE 4
Synthesis of dichlorosilicon-tetrabromonaphthalocyanine
Under nitrogen, 54 ml of anhydrous tri-n-butylamine was added to a suspension of 22.5 g (81.8 mmols) of 6-bromo-1,3-diiminobenz[f]isoindoline in 110 ml of anhydrous tetralin, followed by adding thereto 14.4 ml (0.126 mol) of silicon tetrachloride, and the resulting mixture was refluxed for about 3 hours. After cooling, 700 ml of methanol was added and the resulting mixture was allowed to stand overnight. The reddish-brown reaction mixture was filtered and the residue was sufficiently washed with methanol and then dried under reduced pressure to obtain about 20 g of dichlorosilicon-tetrabromonaphthalocyanine as a dark-green solid.
This dichlorosilicon-tetrabromonaphthalocyanine was used in the subsequent reaction without further purification. IR spectrum of dichlorosilicon-tetrabromonaphthalocyanine is shown in FIG. 5. Its electronic spectrum is shown in FIG. 6.
SYNTHETIC EXAMPLE 5
Synthesis of dihydroxysilicon-tetrabromonaphthalocyanine
To 250 ml of concentrated sulfuric acid was 5 added 9.7 g (8.6 mmols) of dichlorosilicon-tetrabromonaphthalocyanine, and stirred for about 2 hours. The reaction mixture was poured onto about 800 g of ice and the rusulting mixture was allowed to stand overnight. The precipitate formed was filtered, and after sufficient washing with water and then methanol, the precipitate was refluxed in 180 ml of concentrated aqueous ammonia for about 1 hour. After cooling followed by suction filtration, the residue was sufficiently washed successively with water, methanol and acetone, and dried under reduced pressure to obtain 8.7 g of dihydroxysilicon-tetrabromonaphthalocyanine as a dark-green solid. This dihydroxysilicon-tetrabromonaphthalocyanine was used in the subsequent reaction without further purification. IR spectrum of dihydroxysilicon-tetrabromonaphthalocyanine is shown in FIG. 7. Its electronic spectrum is shown in FIG. 8.
SYNTHETIC EXAMPLE 6
Synthesis of bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetrabromonaphthalocyanine
A mixture of 22 mg (0.02 mmol) of dihydroxysilicon-tetrabromonaphthalocyanine, 40 mg (0.02 mmol) of a poly(ethylene glycol) monomethyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid was slowly heated to 220.degree. C. with stirring and maintained at 220.degree. C. for 2 hours. After cooling, the reaction product was separated and purified by a molecular sieve column chromatography to obtain 69 mg (68%) of bis(methoxypolyethylene glycol (Mw about 2,000))-modified silicon-tetrabromonaphthalocyanine as a dark-green solid. Electronic spectrum (methanol solution) of this compound is shown in FIG. 9.
SYNTHETIC EXAMPLE 7
Synthesis of bis(methoxy-polyethylene glycol (Mw about 2,000)--NH--CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine
To a solution of 174 mg (0.16 mmol) of dihydroxysilicon-tetrabromonaphthalocyanine and 48 mg (0.7 mmol) of imidazole in 1 ml of anhydrous N,N-dimethylformamide was added dropwise 120 mg (0.7 mmol) of (3-chloropropyl)dimethylchlorosilane with stirring at 20.degree. C. The resulting mixture was stirred at 20.degree. C. for 20 hours, after which the solvent was removed under reduced pressure. By separation and purification from the residue by a silica gel column chromatography, 84 mg (41%) of bis(3-chloropropyldimethylsiloxy)silicon-tetrabromonaphthalocyanine was obtained.
After a solution of 13 mg (0.01 mmol) of the obtained bis(3-chloropropyldimethylsiloxy)silicon-tetrabromonaphthalocyanine, 400 mg (0.2 mmol) of a terminally aminated poly(ethylene glycol monomethyl ether) (Mw about 2,000) and 1.5 mg (0.01 mmol) of sodium iodide in 1 ml of N,N-dimethylformamide was stirred at 90.degree. C. for 15 hours. Then, the solvent was distilled off under reduced pressure and the reaction product was separated and purified by chromatography in the same manner as described in Synthetic Example 6 to obtain 38 mg (73%) of bis(methoxy-polyethylene glycol (Mw about 2,000)--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine. Electronic spectrum (methanol solution) of this compound is shown in FIG. 10.
SYNTHETIC EXAMPLE 8
Synthesis of bis(methoxy-polyethylene glycol (Mw about 2,000)--NH--CO--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine
To a solution of 174 mg (0.16 mmol) of dihydroxysilicon-tetrabromonaphthalocyanine and 150 mg (2.2 mmol) of imidazole in 2 ml of N,N-dimethylformamide was added dropwise 124 mg (0.7 mmol) of 3-isocyanatopropyldimethylchlorosilane with stirring over a period of 1 minute. The stirring was continued at room temperature for 30 hours, after which the solvent was distilled off under reduced pressure to obtain a solid residue.
A solution of 10 mg of the solid obtained and 50 mg (0.025 mmol) of a terminally aminated poly(ethylene glycol) monomethyl ether (Mw about 2,000) in 3 ml of methanol was refluxed for 1 hour. After the solvent was distilled off, the reaction product was separated and purified by reverse phase chromatography (eluent: methanol) to obtain 26 mg of bis(methoxypolyethylene glycol (Mw about 2,000)--NH--CO--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine. Electronic spectrum of this compound is shown in FIG. 11.
SYNTHETIC EXAMPLE 9
Synthesis of methyl 3,4-dimethylbenzoate
To 200 ml of methanol was added 47.6 g (0.317 mol) of 3,4-dimethylbenzoic acid, and the resulting mixture was refluxed for about 4 hours in the presence of about 6 ml of concentrated sulfuric acid with continuous extraction of water by use of Molecular Sieves 3A (a drying agent mfd. by Wako Pure Chemical Industries, Ltd.). After cooling, 600 ml of water was added and the resulting mixture was extracted three times with about 200 ml of benzene. The benzene solution thus obtained was washed three times with a saturated aqueous sodium hydrogencarbonate solution and then three times with water, and dried with anhydrous sodium sulfate. The benzene solution thus treated was concentrated and then distilled under reduced pressure to obtain 49.4 g of a colorless liquid at a boiling point of 133.degree.-134.degree. C./30 mmHg. This liquid was confirmed to be methyl 3,4-dimethylbenzoate from the following analysis results:
(1) Elementary analysis values:
TABLE 4______________________________________ C H______________________________________Calculated (%) 73.15 7.37Found (%) 73.13 7.46______________________________________
(2) NMR spectrum values: CDCl.sub.3
.delta. values: 7.81 (1H, br-s), 7.76 (1H, dd, J=7.93, 1.53 Hz), 7.18 (1H, d, J=7.93 Hz), 3.89 (3H, s), 2.30 (6H, s)
(3) IR spectrum (neat) is shown in FIG. 12.
The spectrum shows an absorption due to ester
C.dbd.O stretching vibration near 1710 cm.sup.-1.
SYNTHETIC EXAMPLE 10
Synthesis of 6-methoxycarbonyl-2,3-dicyanonaphthalene
To a solution of 33.8 g (0.2 mol) of methyl 3,4-dimethylbenzoate and 142.2 g (0.8 mol) of N-bromosuccinimide in 500 ml of carbon tetrachloride was added 1 g of benzoyl peroxide, and the resulting mixture was irradiated by a 100-W high pressure mercury arc lamp for 8 to 12 hours under reflux in an irradiating tube. After cooling, the white crystals precipitated were removed by suction filtration and the carbon tetrachloride solution, i.e., the mother liquor was concentrated under reduced pressure. The solid thus obtained was recrystallized from hexane/methylene chloride to obtain 79 g of methyl 3,4-bis(dibromomethyl)benzoate as colorless crystals. Physical properties of methyl 3,4-bis(dibromomethyl)benzoate were as follows:
(1) Melting point: 99.5.degree.-100.5.degree. C.
(2) Elementary analysis values:
TABLE 5______________________________________ C H Br______________________________________Calculated (%) 25.03 1.68 66.62Found (%) 25.07 1.54 65.72______________________________________
(3) NMR spectrum values: CDCl.sub.3
.delta. values: 8.29 (1H, br-s), 8.03 (1H, dd, J=8.24, 1.53 Hz), 7.81 (1H, d, J=8.24 Hz), 7.18 (1H, br-s), 7.09 (1H, br-s), 3.96 (3H, s)
(4) IR spectrum (KBr) is shown in FIG. 13.
The spectrum shows an absorption due to ester C.dbd.O stretching vibration near 1705 cm.sup.-1.
Next, 100 g (0.67 mol) of sodium iodide was added to a solution of 48 g (0.1 mol) of the methyl 3,4-bis(dibromomethyl)benzoate obtained and 13.5 g (0.173 mol) of fumaronitrile in 400 ml of anhydrous N,N-dimethylformamide with sufficient stirring, and the resulting mixture was stirred under nitrogen at about 75.degree. C. for about 7 hours. After completion of the reaction, the reaction mixture was poured onto about 2 kg of ice. Sodium hydrogensulfite was slowly added until the reddish-brown aqueous solution thus obtained turned light-yellow. Sodium hydrogensulfite was added in a slight excess and after stirring for a while, the resulting mixture was allowed to stand overnight at room temperature. The light-yellow solid precipitated was filtered by suction and sufficiently washed with water and then methanol. The light-yellow solid was recrystallized from acetone/methanol to obtain 13.9 g of colorless needles. The crystals were confirmed to be 6-methoxycarbonyl-2,3-dicyanonaphthalene from the following analysis results:
(1) Melting point: 264.degree.-265.degree. C.
(2) Elementary analysis values:
TABLE 6______________________________________ C H N______________________________________Calculated (%) 71.18 3.41 11.86Found (%) 71.21 3.37 11.87______________________________________
(3) NMR spectrum values: CDCl.sub.3
.delta. values: 8.72 (1H, br-s), 8.47 (1H, s), 8.41 (1H, s), 8.38 (1H, dd, J=8.55, 1.53 Hz), 8.06 (1H, d, J=8.55 Hz), 4.04 (3H, s)
(4) IR spectrum (KBr) is shown in FIG. 14.
The spectrum shows an absorption due to ester C.dbd.O stretching vibration near 1700 cm.sup.-1.
SYNTHETIC EXAMPLE 11
Synthesis of 6-chloro-2,3-dicyanoquinoxaline
To 300 ml of ethyl acetate were added 5 g (46.3 mmols) of diaminomaleonitrile, 5 g (41.5 mmols) of anhydrous magnesium sulfate and 15 g (170.3 mmols) of activated manganese dioxide, followed by ultrasonication at about 45.degree. C. for about 30 hours. The reaction mixture was filtered and the filtrate was sufficiently washed with ethyl acetate. The light-yellow mother liquor was concentrated, followed by separation and purification by a silica gel column chromatography (eluent: hexane/ethyl acetate=75/25), whereby 2.90 g (59%) of diiminosuccinonitrile was obtained as colorless crystals.
A mixture of 0.5 g (4.7 mmols) of the diiminosuccinonitrile and 0.67 g (4.7 mmols) of 4-chloro-1,2-phenylenediamine was slowly added to 10 ml of trifluoroacetic acid at about 20.degree. C. over a period of 30 minutes, and the resulting mixture was stirred at room temperature for 8 hours and then allowed to stand overnight. To the reaction mixture was added 50 ml water, and the solid precipitated was filtered and sufficiently washed with water. The solid thus obtained was dried under reduced pressure, followed by a silica gel column chromatography (eluent: hexane/ethyl acetate=75/25) and then recrystallization from chloroform/ethanol, whereby 0.6 g (59%) of 6-chloro-2,3-dicyanoquinoxaline was obtained as colorless crystals.
(1) NMR spectrum values: CDCl.sub.3
.delta. values: 8.28 (1H, d, J=2.13 Hz), 8.23 (1H, d, J=9.16 Hz), 8.04 (1H, dd, J=9.16, 2.13 Hz)
(2) Melting point: 188.degree.-189.degree. C.
(3) IR spectrum (KBr) is shown in FIG. 15.
SYNTHETIC EXAMPLE 12
Synthesis of dihydroxysilicon-tetrachloroquinoxalocyanine
Under nitrogen, 5.97 g (27.8 mmols) of 6-chloro-2,3-dicyanoquinoxaline was added to a solution of sodium methoxide in methanol prepared by adding 0.12 g (5.4 mmols) of metallic sodium to 75 ml of absolute methanol, and anhydrous ammonia gas was bubbled into the resulting mixture with sufficient stirring at room temperature for about 1 hour. The mixture was refluxed for about 3 hours, while bubbling therethrough anhydrous ammonia gas. After cooling, the reaction mixture was filtered and the residue was sufficiently washed with methanol and dried under reduced pressure to obtain 5.23 g of isoindoline derivative of 6-chloro-2,3-dicyanoquinoxaline as a light-gray solid. The isoindoline derivative was used in the subsequent reaction without further purification.
Under nitrogen, 10 ml (90 mmols) of silicon tetrachloride was added to a suspension of 5.1 g (22.0 mmols) of the above isoindoline derivative in 108 ml of anhydrous quinoline, and the resulting mixture was refluxed for 3 hours. After cooling, the reaction mixture was poured into 300 ml of methanol, and the resulting mixture was allowed to stand overnight at room temperature. The solid precipitated was filtered, sufficiently washed with methanol, and then dried under reduced pressure to obtain a black solid quantitatively. To 100 ml of ethanol were added 6 g of the black solid and then 100 ml of aqueous ammonia, and the resulting mixture was refluxed for about 5 hours.
After cooling, the reaction mixture was filtered and the residue was sufficiently washed with methanol and then dried under reduced pressure to obtain 4.5 g of a black solid. The black solid was considered dihydroxysilicon-tetrachloroquinoxalocyanine and used in the subsequent reaction without further purification.
EXAMPLE 1
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-naphthalocyaninetetracarboxylate (illustrative compound No. 17)
To a solution of sodium methoxide in methanol prepared by adding 0.1 g (4.35 mmols) of metallic sodium to 20 ml of absolute methanol was added 2 g (8.47 mmols) of 6-methoxycarbonyl-2,3-dicyanonaphthalene, and anhydrous ammonia gas was bubbled into the resulting mixture with sufficient stirring at room temperature for about 1 hour. The mixture was refluxed for about 3 hours, while bubbling therethrough anhydrous ammonia gas. After cooling, the yellow solid precipitated was filtered, and the solid was sufficiently washed with methanol and dried under reduced pressure to obtain 1.785 g (88%) of 6-carbamoyl-1,3-diiminobenz[f]isoindoline as a yellow solid. IR spectrum of this 6-carbamoyl-1,3-diiminobenz[f]isoindoline is shown in FIG. 16. The 6-carbamoyl-1,3-diiminobenz[f]isoindoline was used in the subsequent reaction without further purification.
To a suspension of 500 mg (2.10 mmols) of the 6-carbamoyl-1,3-diiminobenz[f]isoindoline in 10 ml of anhydrous quinoline was added 1.8 ml of silicon tetrachloride, and the resulting mixture was stirred at 220.degree. C. for 3 hours. Then, an excess amount of the silicon tetrachloride was distilled off. After cooling, 40 ml of ethanol and 20 ml of concentrated aqueous ammonia were added to the residue, and the resulting mixture was refluxed for 5 hours. After cooling, a dark-green solid thus obtained was filtered and the residue was sufficiently washed with methanol and dried under reduced pressure to obtain 934 mg of a dark-green solid. The dark-green solid was considered to be containing dihydroxysilicon-tetracarbamoylnaphthalocyanine from the electronic spectrum shown in FIG. 17. The dihydroxysilicon-tetracarbamoylnaphthalocyanine was used in the subsequent reaction without further purification.
A mixture of 19 mg (0.02 mmol) of the dihydroxysilicon-tetracarbamoylnaphthalocyanine, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid was stirred at 200.degree. C. for 3 hours. After completion of the reaction, 5 ml of 1% aqueous NaOH solution and 10 ml of ethanol were added to the reaction mixture, and the resulting mixture was refluxed for 5 hours. The reaction mixture was filtered while hot and the filtrate was sufficiently washed with methanol and acetone. The mother liquor collected was concentrated, followed by separation and purification by reverse phase chromatography (eluent: methanol), whereby 46 mg of the desired compound sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-naphthalocyaninetetracarboxylate (illustrative compound No. 17) was obtained as a green solid. Electronic spectrum of this compound is shown in FIG. 18.
EXAMPLE 2
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 19)
A suspension of 10 mg (0.002 mmol) of bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetrabromonaphthalocyanine and 3 mg (0.009 mmol) of copper(I) 3,5-dimethoxycarbonylphenylthiolate in 1 ml of quinoline was stirred at 140.degree. C. for 15 hours. After completion of the reaction, the reaction mixture was evaporated to dryness under reduced pressure, and 2 ml of a 2% aqueous NaOH solution and 5 ml of ethanol were added to the residue and stirred at 90.degree. C. for 2 hours. After cooling, the reaction mixture was concentrated under reduced pressure and the reaction product was separated and purified by reverse phase chromatography to obtain 8 mg of sodium bis(methoxypolyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthionaphthalocyanine-octacarboxylate (illustrative compound No. 19) as dark-green crystals. Electronic spectrum (methanol solution) of this compound is shown in FIG. 19.
EXAMPLE 3
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinoxalocyanineoctacarboxylate (illustrative compound No. 169)
A mixture of 18 mg (0.02 mmol) of dihydroxysilicon-tetrachloroquinoxalocyanine, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid was treated in the same manner as described in Synthetic Example 6 to obtain 58 mg of a dark-green solid. Then, 10 mg (0.002 mmol) of this solid was treated in the same manner as described in Synthetic Example 2 to obtain 4 mg of sodium bis(methoxypolyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinoxalocyanineoctacarboxylate (illustrative compound No. 169) as dark-green crystals. Electronics pectrum (methanol solution) of this compound is shown in FIG. 20.
EXAMPLE 4
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-octaphenylthiophenanthracyaninehexadecacarboxylate (illustrative compound No. 79)
A mixture of 32 mg (0.02 mmol) of dihydroxysilicon-octabromophenanthracyanine synthesized by use of 4-bromophenylacetonitrile as starting material according to the method described in a reference (Synthetic Metals, vol. 9, pp. 329-340 (1984)) and Synthetic Examples 3, 4 and 5, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid, was treated in the same manner as described in Synthetic Example 6 to obtain 72 mg of a dark-green solid. Then, 11 mg (0.002 mmol) of this solid was treated in the same manner as described in Synthetic Example 2 to obtain 5 mg of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-octaphenylthiophenanthra-cyaninehexadecacarboxylate (illustrative compound No. 79) as dark-green crystals.
EXAMPLE 5
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-octaphenylthioanthracyaninehexadecacarboxylate (illustrative compound No. 109)
A mixture of 32 mg (0.02 mmol) of dihydroxysilicon-octabromoanthracyanine synthesized according to the methods described in references (Monatshefte Fur Chemie vol. 117, pp. 745-489 (1986) and J. pract. Chem. vol. 329, pp. S365-373 (1972)) and then Synthetic Examples 3, 4 and 5, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid, was treated in the same manner as described in Synthetic Example 6 to obtain 65 mg of a dark-green solid. Then, 11 mg (0.002 mmol) of this solid was treated in the same manner as described in Synthetic Example 2 to obtain 4 mg of sodium bis(methoxypolyethylene glycol (Mw about 2,000))-modified silicon-octaphenylthioanthracyaninehexadecacarboxylate (illustrative compound No. 109) as dark-green crystals.
EXAMPLE 6
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthio(1,2-naphthalocyanine)octacarboxylate (illustrative compound No. 139)
A mixture of 22 mg (0.02 mmol) of dihydroxysilicon-tetrabromo(1,2-naphtharocyanine) synthesized according to the method described in a references (Chem. Ber., 121, 1479-1486 (1988)) and then Synthetic Examples 3, 4 and 5, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid, was treated in the same manner as described in Synthetic Example 6 to obtain 51 mg of a dark-green solid. Then, 10 mg (0.002 mmol) of this solid was treated in the same manner as described in Synthetic Example 2 to obtain 6 mg of sodium bis(methoxypolyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthio(1,2-naphthalocyanine)octacarboxylate (illustrative compound No. 139) as dark-green crystals.
EXAMPLE 7
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinolocyanineoctacarboxylate (illustrative compound No. 49)
A mixture of 22 mg (0.02 mmol) of dihydroxysilicon-tetrabromoquinolocyanine synthesized according to the methods described in references (U.S. Pat. No. 4,459,409 (1984) and Khim. Geterotsikl, Soedin, pp. 274-278 (1972)) and then Synthetic Examples 3, 4 and 5, 40 mg (0.02 mmol) of a poly(ethylene glycol) methyl ether (Mw about 2,000) and 4 mg (0.02 mmol) of lauric acid, was treated in the same manner as described in Synthetic Example 6 to obtain 32 mg of a dark-green solid. Then, 10 mg (0.002 mmol) of this solid was treated in the same manner as described in Synthetic Example 2 to obtain 5 mg of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))-modified silicon-tetraphenylthioquinolocyanineoctacarboxylate (illustrative compound No. 49) as dark-green crystals. Electronic spectrum (methanol solution) of this compound is shown in FIG. 21.
EXAMPLE 8
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 3)
In the same manner as described in Example 2, 11 mg (0.002 mmol) of bis(methoxy-polyethylene glycol (Mw about 2,000))--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine was treated together with 3 mg (0.009 mmol) of copper(I) 3,5-dimethoxycarbonylphenylthiolate to obtain 5 mg of sodium bis(methoxy-polyethyleneglycol (Mw about 2,000))--NH--(CH.sub.2).sub.3 --Si(CH.sub.3).sub.2 --O)-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 3) as dark-green crystals.
EXAMPLE 9
Synthesis of sodium bis(methoxy-polyethylene glycol (Mw about 2,000))--NH--CO.NH(CH.sub.2).sub.3 Si(CH.sub.3).sub.2 --O)-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 7)
In the same manner as described in Example 2, 11 mg (0.002 mmol) of bis(methoxy-polyethylene glycol (Mw about 2,000)--NH--CO.NH(CH.sub.2).sub.3 Si(CH.sub.3).sub.2 --O)-modified silicon-tetrabromonaphthalocyanine was treated together with 3 mg (0.009 mmol) of copper(I) 3,5-dimethoxycarbonylphenylthiolate to obtain 6 mg of sodium bis(methoxy-polyethylene glycol (Mw about 2,000)--NH--CO.NH(CH.sub.2).sub.3 Si(CH.sub.3).sub.2 --O)-modified silicon-tetraphenylthionaphthalocyanineoctacarboxylate (illustrative compound No. 7) as dark-green crystals.
TEST EXAMPLE 1
Measurement of Fluorescence Quantum Yield
For the tetraazaporphins of this invention obtained in Examples 1 to 9, fluorescence quantum yield was measured according to the method for measuring relative quantum yield described in a reference [J. Photochem. Photobiol, A. Chemistry, vol. 45, pp. 117-121 (1988)] using 1,1',3,3,3',3'-hexamethylindotricarbocyanine perchlorate or oxazine-720 as a standard substance in the near infrared region. The results obtained are shown in Table 7. As is clear from Table 7, all of the fluorochromes for labeling of this invention show a sufficient fluorescence quantum yield.
TABLE 7______________________________________CompoundExample Excitation FluorescenceNo. Solvent wavelength (nm) quantum yield______________________________________1 Methanol 700 0.382 " " 0.393 " 650 0.554 " " 0.355 " 780 0.326 " 610 0.367 " 650 0.528 " 700 0.379 " " 0.40______________________________________
EXAMPLE 10 TO 18
Conversion of the Compounds Obtained in Examples 1 to 9 Into Monohydroxypropyl Esters
A solution of 4.7.times.10.sup.-6 mol of each of the compounds obtained in Examples 1 to 9 in 10 ml of methanol was acidified with dilute hydrochloric acid and quickly concentrated to dryness under reduced pressure. Only a material soluble in anhydrous dimethylformamide (DMF) was extracted from the resulting residue with 30 ml of anhydrous DMF, and 0.1 mg (8.14.times.10.sup.-7 mol) of N,N-dimethylaminopyridine and 0.35 mg (4.60.times.10.sup.-6 mol) of 1,3-propanediol were added to the extract solution, followed by adding thereto 1 mg (4.85.times.10.sup.-6 mol) of 1,3-dicyclohexylcarbodiimide (DCC) with sufficient stirring. The stirring was continued at room temperature for 5 hours. To the reaction mixture was added 1 ml of 0.2M Na.sub.2 CO.sub.3 buffer (pH 9.3), after which the resulting mixture was concentrated under reduced pressure. Separation and purification from the resulting residue by reverse phase chromatography gave monohydroxypropyl ester of the compound. Thus, there were obtained 4 to 6 mg each of monohydroxypropyl esters of the compounds obtained in Examples 1 to 9.
EXAMPLE 19
Synthesis of a Phosphorylated Oligonucleotide Primer
A primer (5'-GTTTCCCAGTCACGAC-3') SEQ ID NO: 1, was synthesized by means of an automatic DNA synthesizer using the solid phase CED-phosphoramide method. The primer synthesized was phosphorylated by incubating the same in 100 .mu.l of a reaction solution containing 50 mM Tris-hydrochloric acid (pH 7.6), 10 mM magnesium chloride, 10 mM dithiothreitol, 3 mMATP and T.sub.4 -nucleotide kinase, at 37.degree. C. for 1 hour. The primer phosphorylated was separated by a high pressure liquid chromatography (HPLC) using a column for gel filtration. A fraction corresponding to a peak due to the primer phosphorylated was collected, and the solvent was removed by freeze-drying.
EXAMPLES 20 TO 28
To 100 .mu.l of 0.05 mM solution of each of the monohydroxypropyl esters synthesized in Examples 10 to 18 in DMF were added 100 .mu.l of a 0.05 mM solution of the phosphorylated oligonucleotide primer obtained in Example 19 in DMF, and then 100 .mu.l of a 0.05 mM solution of DCC in DMF. The resulting mixture was stirred overnight at room temperature. To the reaction mixture was added 100 .mu.l of a 0.2M Na.sub.2 CO.sub.3 buffer (pH 9.3), after which the resulting mixture was concentrated under reduced pressure. The reaction product was separated from the resulting residue by HPLC. Thus, products formed by labeling of the oligonucleotide primer with each of the compounds synthesized in Examples 1 to 9 were obtained.
EXAMPLE 29
Analysis of the Base Sequence of DNA
A DNA having a known base sequence was used as a sample. Sanger reaction was carried out for the 4 kinds of bases using each of the primers having a tetraazaporphin attached thereto through a linker synthesized in Examples 20 to 28. The DNA fragments thus obtained were separated by electrophoresis in different lanes for the 4 reaction systems, respectively, and analyzed by means of a DNA sequencer equipped with a semiconductor laser. The results obtained are summarized in Table 8. The reaction systems contained a nonionic surfactant as an additive if necessary.
TABLE 8______________________________________ OutputTetra- wave-azaporphin- length oflabeled primer semi- Number(tetra- conductor ofazaporphin Nonionic laser bases Preci-Example No.) surfactant (nm) of DNA sion______________________________________1 Triton X-100 730 380 99.7%2 " 780 350 99.4%3 " 680 340 99.7%4 " " 300 100%5 " 780 350 99.7%6 " 680 280 100%7 " 730 320 99.4%8 " 780 380 100%9 " " 370 98.8%______________________________________
EXAMPLE 30
Synthesis of tetraazaporphin-labeled primers (labeling compound-ACACAACTGTGTTCACTAGC) SEQ ID NO: 2
Various labeled primers having a 5'-end labeled with a tetraazaporphin (each of the compounds obtained in Examples 1 to 9) (labeling compound-ACACAACTGTGTTCACTAGC SEQ ID NO: 2,) were synthesized in the same manner as described in Example 19 and Examples 20 to 28.
Detection of .beta.-globin gene in human DNA
Human .beta.-globin gene was detected by a gene detection method using the PCR (Polymerase Chain Reaction) method.
SAMPLE 1
Twenty cycles of gene amplification was carried out (the total volume of solution: 100 .mu.l) according to the protocol of Perkin-Elmer-Cetus Corporation by using human placental DNA (1 .mu.g), each of the labeled primers, i.e., labeling compound-ACACAACTGTGTTCACTAGC, SEQ ED NO: 2 synthesized in the manner described above (300 ng), HO-CAACTTCATCCACGTTCACC (300 ng), SEQ ID NO: 3 a nonionic surfactant, and TaqDNA polymerase (Perkin-Elmer-Cetus Corporation).
SAMPLE 2
Human placental DNA (1 .mu.g), the same labeling compound-ACACAACTGTGTTCACTAGC SEQ ID NO: 2, as in sample 1 (300 ng), HO-CAACTTCATCCACGTTCACC SEQ ID NO: 3, (300 ng) and a nonionic surfactant were added to a reaction solution containing no TaqDNA polymerase which had been prepared according to the protocol of Perkin-Elmer-Cetus Corporation (the total volume of the solution: 100 .mu.l).
To each of the samples (50 .mu.l) was added 450 .mu.l of buffer solution A (containing a nonionic surfactant, 50 mM NaCl, 10 mM Tris-HCl and 0.1 mM EDTA, pH 8.0), and the resulting mixture was added to octadecyl silane resin (Micro Bonda Pack C-18, Waters Co.) previously washed with buffer solution A. The octadecylsilane resin used was in the form of a layer formed by layering a suspension of the resin in ethanol over siliconized glass wool packed into the end of a pipet chip (for 1 ml).
After washing with buffer solution A (500 .mu.l) and buffer solution A containing 5% ethanol (500 .mu.l), elution was carried out using buffer solution A containing 10% ethanol (500 .mu.l). The pH of the eluate was adjusted to about 8, and fluorescence intensity was measured by means of a photodiode array by using a semiconductor laser as an exciting light source. Consequently, the relative intensities shown in Table 26 were attained.
Unreacted labeling compound-ACACAACTGTGTTCACTAGC SEQ ID NO: 2 was usually not eluted at all with buffer solution A containing 10% ethanol, and was eluted only with buffer solution A containing 15% ethanol.
From these results, it was found that .beta.-globingene in human DNA can be detected using an oligodeoxy-nucleotide labeled with the tetraazaporphin of this invention at the 5'-end.
TABLE 9______________________________________ Relative Output wavelength intensityExample Nonionic of semiconductor Sample SampleNo. surfactant laser (nm) 1 2______________________________________1 Tween 20 730 4 1832 " 780 6 1663 " 680 2 1354 " " 7 1475 " 780 6 1536 " 680 5 1447 " 730 4 1718 " 780 8 1589 " " 3 159______________________________________
COMPARATIVE EXAMPLE 1
Each of the phthalocyanines disclosed in International Publication Number WO89/03807 was attached to the oligonucleotide primer obtained in Example 19, according to the method of grafted patents and the methods described in Examples 20 to 28 of this invention. Using each of the phthalocyanine-attached oligonucleotides thus obtained, the base sequence of DNA was analyzed in the same manner as in Example 29.
The phthalocyanines used in this experiment are described below.
Comparative-example compound A: aluminum hydroxy-2,9,16,23-tetraphenoxyphthalocyaninesulfonate
Comparative-example compound B: aluminum hydroxy-2,9,16,23-tetrathiophenylphthalocyaninesulfonate
Comparative-example compound C: magnesium 20-phenyltetrabenztriazaporphinsulfonate
Comparative-example compound D: sodium bis(tributylsiloxy)silicon-phthalocyaninetetracarboxylate
The results obtained are shown in Table 10.
As shown in Table 10, the phthalocyanines could not be excited by means of a semiconductor laser emitting a wavelength of 730 nm or more, so that no fluorescence was observed at all. Therefore, measurement became impossible. Moreover, when a semiconductor laser emitting a wavelength of 680 nm was used, the precision of measurement was significantly lowered by interference of scattered light.
TABLE 10______________________________________Compara- Outputtive wavelength of Numberexample Nonionic semiconductor of bases Preci-compound surfactant laser (nm) of DNA sion______________________________________A Triton X-100 830 Not measurable" " 780 "" " 730 "" " 680 130 50%B " 830 Not measurable" " 780 "" " 730 "" " 680 120 48%C " 830 Not measurable" " 780 "" " 730 "" " 680 140 54%D " 830 Not measureable" " 780 "" " 730 "" " 680 "______________________________________
COMPARATIVE EXAMPLE 2
The phthalocyanines of comparative-example compounds A to D were utilized for detecting .beta.-globin gene in human DNA, in the same manner as described in Example 30.
The results obtained are shown in Table 11.
As shown in Table 11, the phthalocyanines could not be excited by means of a semiconductor laser emitting a wavelength of 730 nm or more, so that no fluorescence was observed at all. Therefore, measurement became impossible. Moreover, when a semiconductor laser emitting a wavelength of 680 nm was used, it became difficult to distinguish relative fluorescence intensities between of sample 1 and of sample 2 because of interference of excitation light source.
TABLE 11______________________________________ OutputCompara- wavelengthtive of semi-example Nonionic conductor Relative intensitycompound surfactant laser (nm) Sample 1 Sample 2______________________________________A Triton X-100 830 Not Not measurable measurable" " 780 Not Not measurable measurable" " 730 Not Not measurable measurable" " 680 125 146B " 830 Not Not measurable measurable" " 780 Not Not measurable measurable" " 730 Not Not measurable measurable" " 680 118 151C " 830 Not Not measurable measurable" " 780 Not Not measurable measurable " 730 Not Not measurable measurable" " 680 131 144D " 830 Not Not measurable measurable" " 780 Not Not measurable measurable" " 730 Not Not measurable measurable" " 680 Not Not measurable measurable______________________________________
EXAMPLE 31 TO 39
In methanol, 0.13 mmol of each of the tetraazaporphins synthesized in Examples 1 to 9 was acidified with concentrated hydrochloric acid, followed by quick concentration under reduced pressure. Only a material soluble in DMF was extracted from the resulting residue with 20 ml of DMF to obtain a dark-green DMF solution. To this solution was added 18 mg (0.13 mmol) of p-aminobenzoic acid (PABA). With cooling at about 0.degree. C., to the resulting solution were added a solution of 0.02 ml of diethylphosphoryl cyanide (DEPC) in 3 ml of DMF, and then 0.04 ml (0.28 mmol) of triethylamine, and the resulting mixture was stirred at 0.degree. C. for 30 minutes. Then, the stirring was continued at room temperature for 3 hours. After completion of the reaction, 1 ml of water was added to the reaction mixture and the resulting mixture was concentrated under reduced pressure. Separation and purification from the resulting residue by reverse phase chromatography gave a compound formed by the binding of the tetraazaporphin to a molecule of PABA. Thus, there were obtained compounds formed by the binding of each of the tetraazaporphins synthesized in Examples 1 to 9 to a molecule of PABA.
EXAMPLES 40 TO 48
A solution of each of the compounds obtained in Examples 31 to 39, i.e., tetraazaporphin (synthesized in Examples 1 to 9)-PABA and 3-(4-aminobutyl)morphine in DMF was treated with DEPC in the presence of triethyl amine in the same manner as described in Examples 31 to 39. Thus, tetraazaporphin-PABA-morphine combined products were obtained.
EXAMPLE 49
Measurement of Relative Immuno-affinity for Anti-morphine Monoclonal Antibody
For morphine, aminomorphine and the above-mentioned fluorochrome-labeled morphines, relative immuno-affinity for anti-morphine monoclonal antibody was measured using a competitive reaction in which they competed with tritium-labeled morphine. The results obtained are summarized in Table 12.
From the results shown in Table 12, it can be seen that the relative affinity is hardly different for different molecular species, and that the labeling with the fluorochrome hardly changes the reactivity of morphine with the monoclonal antibody.
TABLE 12______________________________________ RelativeMolecular species affinity______________________________________Morphine 1Aminomorphine 1Tetraazaporphin (Example 1)-PABA-morphine 0.95Tetraazaporphin (Example 2)-PABA-morphine 0.96Tetraazaporphin (Example 3)-PABA-morphine 0.94Tetraazaporphin (Example 4)-PABA-morphine 0.98Tetraazaporphin (Example 5)-PABA-morphine 0.97Tetraazaporphin (Example 6)-PABA-morphine 0.97Tetraazaporphin (Example 7)-PABA-morphine 0.94Tetraazaporphin (Example 8)-PABA-morphine 0.98Tetraazaporphin (Example 9)-PABA-morphine 0.96______________________________________
Using the compound of this invention as a fluorochrome for labeling, there can be provided a reagent for fluorescence analysis or a reagent for clinical examination, which is not affected by substances in a living body, such as hemes present in blood, and is useful for qualitative or quantitative analysis of various antigens, drugs, DNAs, etc. and analysis of the base sequence of DNA which use an inexpensive and compact semiconductor laser (670 to 840 nm).
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 3(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 16 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GTTTCCCAGTCACGAC16(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ACACAACTGTGTTCACTAGC20(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:CAACTTCATCCACGTTCACC20__________________________________________________________________________

Number	Date	Country	Kind
4-299773	Nov 1992	JPX
5-210059	Aug 1993	JPX

Water-soluble tetraazaporphins and fluorochrome for labeling

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (2)

Parent Case Info

Foreign Referenced Citations (1)

Divisions (1)