Patent Application
20180028643
Zika virus (ZIKV; Flaviviridae, Flavivirus) is an emerging arbovirus, transmitted by Aedes mosquitoes (loos et al., 2014). ZIKV has a positive-sense, single-stranded RNA genome, approximately 11 kilobases in length that encodes three structural proteins: the capsid (C), premembrane/membrane (prM), and envelope (E), and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, 2K, NS4B, and NS5). Based on a genetic study using nucleotide sequences derived from the NS5 gene, there are three ZIKV lineages: East African, West African, and Asian (Musso, 2015; Faye et al., 2014). ZIKV emerged out of Africa and previously caused outbreaks of febrile disease in the Yap islands of the Federated states of Micronesia (Duffy et al., 2009), French Polynesia (Cao-Lormeau et al., 2014), and Oceania. Currently, several Latin American countries are experiencing the first-ever reported local transmission of ZIKV in the Americas (Hennessey et al., 2016). The current outbreak in the Americas is cause for great concern, because of the fast and uncontrolled autochthonous spread. Clinically, infection with ZIKV resembles dengue fever and several other arboviral diseases (Dyer, 2015), but it has been linked to neurological syndromes and congenital malformation (Pinto Junior et al., 2015). Alarmingly, the rate of microcephaly (small head, reduced brain size, impaired neurocognitive development) in infants born to pregnant women has increased significantly (20-fold in 2015) in areas with high ZIKV incidence in Brazil (Oliveira Melo et al., 2016) (Butler, 2016). In February 2016, the World Health Organization declared the Zika virus an international public health emergency, prompted by its link to microcephaly. As many as four million people could be infected by the end of the year (Galland, 2016).
To date, there are no vaccines or antiviral therapy for ZIKV, although successful vaccines have been developed for other flavivirus infections (dengue, Japanese encephalitis and yellow fever).
Mosquito-borne Zika virus (ZIKV) typically causes a mild and self-limiting illness known as Zika fever, which often is accompanied by maculopapular rash, headache, and myalgia. However, more serious consequences have been reported for ZIKV infection during pregnancy, microcephaly of the fetus. As described herein, Zika virus-like particles (VLPs) were developed and their immunogenicity and protective efficacy were evaluated in a small animal model for wild-type ZIKV. The prM and E genes of ZIKV strain 33 H/PF/2013 with a nascent signal sequence in the 3′ coding region of the capsid protein were cloned into a pCMV expression vector under the control of a cytomegalovirus (CMV) promoter and CMV polyadenylation signal. Following transfection of HEK293 cells, ZIKV-VLPs expression was confirmed by Western blot and transmission electron microscopy. ZIKV-VLPs (about 0.45 μg) were formulated with 0.2% Imject alum and used to inject groups of six-week-old AG129 mice by the intramuscular (IM) route, followed by a boost administration two weeks later. Control groups received PBS mixed with alum. At five weeks post-initial vaccination all animals were challenged with 200 PFU (>400 LD50s) of ZIKV strain H/PF/2013 by injection into the right hind footpad. All control animals (n=6) died 9 days post challenge, while vaccinated mice survived with no morbidity or weight loss and had significantly lower viremia. This was in contrast to Dengue VLPs produced from prM and E, which did not produce a protective immune response (Pijlman, 2015). Significant levels of neutralizing antibodies were observed in all ZIKV-VLP vaccinated mice compared to control groups. The role of neutralizing antibodies in protecting mice was demonstrated by antibody passive transfer studies; naive AG129 mice that received pooled serum from VLP vaccinated animals were fully protected. Thus, the present findings demonstrate the protective efficacy of the ZIKV-VLP vaccine and highlight the role that neutralizing antibodies play in protection against ZIKV infection.
One advantage of VLPs is that VLPs structurally mimic the conformation of native viruses but do not contain any viral genetic material (no viral replication) and are therefore non-infectious. This is in contrast to a live attenuated vaccine (which has genetic material) or in the case of insufficient inactivation of killed vaccines (resulting in viral replication). A VLP vaccine approach eliminates concerns associated with such replication for pregnant women and other populations at high risk for suffering the effects of ZIKV infections.
In one embodiment, a recombinant nucleic acid vector is provided comprising a heterologous promoter operably linked to a sequence encoding flavivirus, e.g., ZIKV, prM/E. In one embodiment, the vector lacks nucleic acid sequences encoding one or more of flavivirus NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally lacks nucleic acid sequences encoding functional flavivirus capsid, e.g., a protein that aggregates so as to form a viral capsid having a diameter of about 50 to 60 nm or about 45 nm to 70 nm. In one embodiment, the heterologous promoter is expressed in mammalian cells. In one embodiment, the heterologous promoter is a heterologous viral promoter. In one embodiment, the heterologous promoter comprises a CMV promoter, a SV40 promoter, an EF-1α promoter or a PGK1 promoter. In one embodiment, the flavivirus is a Zika virus. In one embodiment, the vector sequences are from a Zika virus from the East African or West African lineage. In one embodiment, only a portion of flavivirus capsid sequences is included, e.g., a C-terminal portion of a flavivirus capsid that is linked to prM/E sequences as in the poly-protein that is expressed by wild-type flavivirus. In one embodiment, the portion of the capsid sequence includes amino acids 98 to 112 of the capsid protein encoded by SEQ ID NO:1 or a protein having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more amino acid sequence identity thereto. In one embodiment, the prM/E sequences have at least 80% %, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 98%, 99% or more amino acid sequence identity to the prM/E sequences encoded by any one of SEQ ID Nos. 1-3, 5 or 11-13. In one embodiment, the portion of the capsid sequence lacks a NS2B-3 cleavage site, e.g., KEKKRR (SEQ ID NO:10). In one embodiment, the prM/E sequences are operably linked to a heterologous secretion signal. In one embodiment, the vector further comprises an intron and/or enhancer sequence, e.g., 5′ to a prM/E coding sequence. In one embodiment, the vector further comprises comprises an intron, internal ribosome entry sequence, or an enhancer sequence, or any combinantion thereof.
A recombinant host cell comprising the vector is also provided. In one embodiment, the cell is a mammalian, e.g., Vero cell, HeLa cell or CHO cell, insect or yeast cell. In one embodiment, the cell is a human or simian cell. In one embodiment, the genome of the cell is augmented, e.g., stably augmented, with nucleic acid sequences encoding flavivirus NS2B, e.g., the source of NS2B may be heterologous or homologous to the source for prM/E. In one embodiment, the genome of the cell is augmented, e.g., stably augmented, with nucleic acid sequences encoding flavivirus capsid, e.g., the capsid may be heterologous or homologous to prM/E, which sequences are optionally integrated into the genome of the cell. In one embodiment, the genome of the cell is augmented with nucleic acid sequences encding flavivuirus NS2B, which sequences are optionally integrated into the genome of the cell. In one embodiment, the vector is integrated into the genome of the host cell.
Also provided is a method to prepare flavivirus VLPs. The method includes contacting a culture of isolated host cells that do not express one or more of flavivirus NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally do not express functional flavivirus capsid, with the recombinant vector and collecting VLPs from supernatant of the culture. Thus, in one embodiment, the isolated host cells do not have flavivirus sequences prior to contact with the vector. In one embodiment, the collected particles have a diameter of about 10 to 100 nm, e.g., 20 to 60 nm, 40 to 70 nm or 40 to 60 nm. In one embodiment, the host cell expresses flavivirus NS2B. In one embodiment, the host cell expresses flavivirus capsid protein and optionally NS2B.
Further provided is a preparation comprising a flavivirus VLPs. The VLP comprises a lipid bilayer comprising flavivinis prM/E but lacks one or more of a flavivirus NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally lacks functional flavivirus capsid. Such a preparation may be used in a vaccine or immunogenic composition. The vaccine or immunogenic composition may have about 10 μg to 1000 μg, e.g., 200 μg to 400 lμg or 400 lμg to 800 μg, about 0.5 μg to 100 μg, about 1 μg to 50 μg, about 5 μg to 75 μg, about 1 to 500 mg, e.g., about 20 to 50 mg, about 100 to 300 or about 300 to 400 mg, of VLP. The vaccine or immunogenic composition may further comprise one or more adjuvants. In one embodiment, the adjuvant comprises alum, monophosphoryl lipid A (MPLA), squalene, a TLR4 agonist, dimethyldioctadecylammonium, tripalmitoyl-S-glyceryl cysteine, trehalose dibehenate; saponin, MF59, AS03, virosomes, ASO4, CpG, imidazoquinoline, poly I:C, flagellin, or any combination thereof In one embodiment, an adjuvant is included at about 0.001 mg to about 10 mg, about 0.01 to about 10 mg, about 1 to about 20 mg, or about 10 mg to about 100 mg.
Further provided is a method to prevent, inhibit or treat flavivirus infection in a mammal. The method includes administering an effective amount of the recombinant vector, a host cell having the vector or the vaccine or immunogenic composition having the VLPs. In one embodiment, the mammal is a female mammal. In one embodiment, the vector, host cell, vaccine or immunogenic composition is administered subcutaneously, intradermally, intramuscularly or intravenously to the mammal.
In one embodiment, a method to passively prevent, inhibit or treat flavivirus infection in a mammal is provided. The method includes obtaining serum or plasma having anti-flavivirus antibodies from a mammal exposed to flavivinis and optionally isolating antibodies from the serum or plasma; and administering an effective amount of the serum or plasma, or isolated antibodies, to a different mammal at risk of or having a flavivirus infection. In one embodiment, the mammal is immunocompromised. In one embodiment, the anti-flavivirus antibodies are isolated from the serum before administration. In one embodiment, the mammal is a human.
As used herein, the terms “isolated” refers to in vitro preparation, isolation of a nucleic acid molecule such as a vector or plasmid of the invention or a virus-like particle of the invention, so that it is not associated with in vivo substances, or is substantially purified from in vitro substances. An isolated virus-like particle preparation is generally obtained by in vitro culture and propagation and is substantially free from infectious agents. As used herein, “substantially free” means below the level of detection for a particular infectious agent using standard detection methods for that agent. As used herein, the term “recombinant nucleic acid” or “recombinant DNA sequence or segment” refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from a source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in the native genome. An example of DNA “derived” from a source, would be a DNA sequence that is identified as a useful fragment, and which is then chemically synthesized in essentially pure form. An example of such DNA “isolated” from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.
A signal peptide (sometimes referred to as signal sequence, secretory signal, e.g., an Oikosin 15 secretory signal, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a short (about 5 to 30 amino acids long) peptide present at the N-terminus of proteins that are destined towards the secretory pathway. These proteins include those that reside either inside certain organelles (the endoplasmic reticulum, golgi or endosomes), secreted from the cell, or inserted into most cellular membranes. Although most type I membrane-bound proteins have signal peptides, the majority of type II and multi-spanning membrane-bound proteins are targeted to the secretory pathway by their first transmembrane domain, which biochemically resembles a signal sequence except that it is not cleaved. Signal sequences generally have a tripartite structure, consisting of a hydrophobic care region (h-region) flanked by an n- and c-region. The latter contains the signal peptidase (SPase) consensus cleavage site. Usually, signal sequences are cleaved off co-translationally, the resulting cleaved signal sequences are termed signal peptides.
Zika virus infection transmitted by Aedes mosquitoes is now receiving considerable attention due to its associated with microcephaly and Guillain-Barre syndrome. According to the CDC, there have been over 500 cases of travel-related Zika infections in America to date, with no locally-acquired vector-borne cases reported; in contrast, over 700 cases have been reported in US territories, of which nearly all were locally-transmitted.
Computational analysis has identified ZIKV envelope glycoproteins as a good candidate for vaccine development, as these are the most immunogenic (Shawan, 2015). Several approaches are currently being explored to develop a ZIKV vaccine, including inactivated, recombinant live-attenuated viruses, protein subunit vaccines, or DNA vaccines. A VLP vaccine approach against ZIKV may eliminate concerns of live attenuated vaccines and insufficient inactivation of killed vaccines for pregnant women and other populations at high risk of suffering the devastating effects of ZIKV infections.
VLPs are structurally mimic the conformation of native virions but do not generate progeny viruses (VLPs are “non-infectious”) and do not contain any viral genetic material. VLPs are known to be highly immunogenic and elicit higher titer neutralizing antibody responses than subunit vaccines based on individual proteins (Wang et al., 2013). Such VLPs present viral spikes and other surface components that display linear or conformational epitopes in a repetitive array that effectively results in recognition by B-cells (Metz and Pijlman, 2016). This recognition leads to B cell signaling and MHC class II up-regulation that facilitates the generation of high titer specific antibodies. VLPs from viruses, including hepatitis B virus, West Nile virus and Chikungunya virus, elicit high titer neutralizing antibody responses that contribute to protective immunity in preclinical animal models and in humans (Akahata et al., 2010; Spohn et al., 2010; Wang et al., 2012).
As mentioned above, a VLP vaccine approach against ZIKV eliminates concerns of live attenuated vaccines and insufficient inactivation of killed vaccines for pregnant women and other populations at high risk of suffering the devastating effects of ZIKV infections. The generation of ZIKV-VLPs containing the prM and E genes as well as the immunogenicity and efficacy testing in the AG129 mouse model is described herein. A position in the secretory signal was identified that likely allows for higher than normal levels of VLP secretion, due to the absence of an auto (NS2b-3) cleavage signal. Using bioinformatic signal sequence prediction tools, the putative signal sequences of ZIKV starting from positions aa 98-aa 112 were examined, and a site was selected that putatively resulted in the highest secretion score. The prM and E genes from ZIKV (Colombian isolate; GenBank accession no. KU646827) were combined with a secretory signal (positions aa 98-aa 112), were cloned into a mammalian expression vector (pCMV-prM/E). HEK-293 cells were transfected and supernatants were harvested from the cells at approximately 10 days post transfection. Transfected HEK-293 cells secreted VLPs with relatively high yields, likely due to the inclusion of a secretory signal that allows for higher than normal levels of VLP secretion. The cell supernatants contained a fraction of extracellular particles that were purified by ultracentrifugation though a sucrose cushion. These particles reacted with known ZIKV antibodies by Western Blot. Western blot analysis also revealed relatively high yields of VLPs after purification, indicating the potential for scalable production. To test the efficacy of this VLP vaccine, AG129 mice susceptible to ZIKV were vacinated with 2 μg of total protein (about 400-500 ng of VLPs) formulated with 1 mg of adjuvant, and the mice boosted with the same vaccine two weeks later. At two weeks post boost, serum from vaccinated animals was collected and tested for anti-ZIKV neutralizing antibodies. Three weeks post boost mice were challenged with 200 PFU of ZIKV (about 400 LD50s). All control animals (n=6) died by 9 days post challenge, while vaccinated mice survived with no morbidity/illness (as of 11 days post-challenge). Passive transfer of antibodies from vaccinated mice was efficacious in protecting susceptible mice from Zika infections. Thus, the present findings show the protective efficacy of a ZIKV-VLP vaccine and highlight the important role that neutralizing antibodies play in protection against ZIKV infection. Further, passive transfer may be employed as a treatment for immune-compromised patients that cannot receive a vaccine.
In one embodiment, a recombinant nucleic acid vector is provided comprising a heterologous promoter operably linked to a sequence encoding ZIKV, prM/E. In one embodiment, the vector lacks nucleic acid sequences encoding ZIKV NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally lacks nucleic acid sequences encoding functional ZIKV capsid, e.g., a protein that aggregates so as to form a viral capsid having a diameter of about 50 to 60 nm. In one embodiment, the heterologous promoter is expressed in mammalian cells. In one embodiment, the heterologous promoter is a heterologous viral promoter. In one embodiment, only a portion of ZIKV capsid sequences is included, e.g., a C-terminal portion of a ZIKV capsid that is linked to prM/E sequences as in the polyprotein that is expressed by wild-type flavivirus. In one embodiment, the portion of the capsid sequence includes amino acids 98 to 112 of the capsid protein encoded by SEQ ID NO:1 or a protein having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more amino acid sequence identity thereto. In one embodiment, the prM/E sequences have at least 80% %, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more amino acid sequence identity to the prM/E sequences encoded by any one of SEQ ID Nos. 1-3 or 5. In one embodiment, the portion of the capsid sequence lacks a NS2B-3 cleavage site. In one embodiment, the prM/E sequences are operably linked to a heterologous secretion signal. In one embodiment, the vector further comprises an intron and/or enhancer sequence, e.g., 5′ to a prM/E coding sequence.
A recombinant host cell comprising the vector is also provided. In one embodiment, the cell is a mammalian cell. In one embodiment, the cell is a human or simian cell. In one embodiment, the genome of the cell is augmented, e.g., stably augmented, with nucleic acid sequences encoding ZIKV NS2B, e.g., the source of NS2B may be heterologous or homologous to the source for prM/E. In one embodiment, the genome of the cell is augmented, e.g., stably augmented, with nucleic acid sequences encoding ZIKV capsid, e.g., the capsid may be heterologous or homologous to prM/E. In one embodiment, the vector is integrated into the genome of the host cell.
Also provided is a method to prepare ZIKV VLPs. The method includes contacting a culture of isolated host cells that do not express ZIKV NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally do not express functional ZIKV capsid, with the recombinant vector and collecting VLPs from supernatant of the culture. Thus, in one embodiment, the isolated host cells do not have ZIKV sequences prior to contact with the vector. In one embodiment, the collected particles have a diameter of about 10 to 100 nm, e.g., 20 to 60 nm, 40 to 70 nm or 40 to 60 nm. In one embodiment, the host cell expresses ZIKV NS2B. In one embodiment, the host cell expresses ZIKV capsid protein and optionally NS2B.
Further provided is a preparation comprising a ZIKV VLPs. The VLP comprises a lipid bilayer comprising ZIKV prM/E but lacks ZIKV NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5 and optionally lacks functional ZIKV capsid. Such a preparation may be used in a vaccine or immunogenic composition. The vaccine or immunogenic composition may have about 10 to 1000 μg, e.g., 200 to 400 μg or 400 to 800 μg, or about 1 to about 500 mg, e.g., about 20 to 50 mg, about 100 to 300 or about 300 to 400 mg, of VLP. The vaccine or immunogenic composition may further comprise one or more adjuvants. In one embodiment, an adjuvant is included at about 0.01 to about 10 mg, about 1 to about 20 mg, or about 10 mg to about 100 mg.
Further provided is a method to prevent, inhibit or treat ZIKV infection in a mammal. The method includes administering an effective amount of the recombinant vector, a host cell having the vector or the vaccine or immunogenic composition having the VLPs. In one embodiment, the mammal is a female mammal. In one embodiment, the vector, host cell, vaccine or immunogenic composition is administered intradermally, intramuscularly or intravenously to the mammal.
In one embodiment, a method to passively prevent, inhibit or treat ZIKV infection in a mammal is provided. The method includes obtaining serum or plasma having anti-ZIKV antibodies from a mammal exposed to ZIKV and optionally isolating antibodies from the serum or plasma; and administering an effective amount of the serum or plasma, or isolated antibodies, to a different mammal at risk of or having a ZIKV infection. In one embodiment, the mammal is immunocompromised. In one embodiment, the anti-flavivirus antibodies are isolated from the serum before administration. In one embodiment, the mammal is a human.
Adjuvants are compounds that enhance the specific immune response against co-inoculated antigens. Adjuvants can be used for various purposes: to enhance the immunogenicity of highly purified or recombinant antigens; to reduce the amount of antigen or the number of immunizations needed for protective immunity; to prime the efficacy of vaccines in newborns, the elderly or immuno-compromised persons; or as antigen delivery systems for the uptake of antigens by the mucosa. Ideally, adjuvants should not induce immune responses against themselves and promote an appropriate immune response (i.e., cellular or antibody immunity depending on requirements for protection). Adjuvants can be classified into three groups: active immunostimulants, being substances that increase the immune response to the antigen; carriers being immunogenic proteins that provide T-cell help; and vehicle adjuvants, being oil emulsions or liposomes that serve as a matrix for antigens as well as stimulating the immune response.
Adjuvant groups include but are not limited to mineral salt adjuvants, e.g., alum-based adjuvants and salts of calcium, iron and zirconium; tensoactive adjuvants, e.g, Quil A which is a saponin derived from an aqueous extract from the bark of Quillaja saponaria: Saponins induce a strong adjuvant effect to T-dependent as well as T-independent antigens. Other adjuvant groups are bacteria-derived substances including cell wall peptidoglycan or lipopolysaccharide of Gram-negative bacteria, that enhance immune response against co-administered antigens and which is mediated through activation of Toll-like receptors; lipopolysaccharides (LPS) which are potent B-cell mitogens, but also activate T cells; and trehalose dimycolate (TCM), which simulates both humoral and cellular responses.
Other adjuvants are emulsions, e.g., oil in water or water in oil emulsions such as FIA (Freund's incomplete adjuvant), Montanide, Adjuvant 65, and Lipovant; liposomes, which may enhance both humoral and cellular immunity; polymeric adjuvants such as biocompatible and biodegradable microspheres; cytokines; carbohydrates; inulin-derived adjuvants, e.g., gamma inulin, a carbohydrate derived from plant roots of the Compositae family, is a potent humoral and cellular immune adjuvant and algammulin, which is a combination of γ-inulin and aluminium hydroxide. Other carbohydrate adjuvants include polysaccharides based on glucose and mannose including but not limited to glucans, dextrans, lentinans, glucomannans, galactomannans, levans and xylans.
Some well known parenteral adjuvants, like MDP, monophosphoryl lipid A (MPL) and LPS, also act as mucosal adjuvants. Other mucosal adjuvants poly(DL-lactide-coglycolide) (DL-PLG), cellulose acetate, iminocarbonates, proteinoid microspheres, polyanhydrides, dextrans, as well as particles produced from natural materials like alginates, geletine and plant seeds.
Adjuvants for DNA immunizations include different cytokines, polylactic microspheres, polycarbonates and polystyrene particles.
In one embodiment, adjuvants useful in the vaccines, compositions and methods described herein include, but are not limited to, mineral salts such as aluminum salts, calcium salts, iron salts, and circonium slats, saponin, e.g., Quid A including QS21, squalene (e.g., AS03), TLR ligands, bacterial MDP (N-acetyl muramyl-L-alanyl-D-isoglutamine), lipopolysaccharide (LPS), Lipid A, montanide, Adjuvant 65, Lipovant, Incomplete Freund's adjuvant (IFA), liposmes, microparticles formed of, for example, poly(D,L-lactide (coglycolide)), cytokines, e.g., IFN-gamma or GMCSF, or carbohydrates such as gamma inulin, glucans, dextrans, lentinans, glucomannans and/or glactomannans.
Pharmaceutical compositions of the present invention, suitable for inoculation or for parenteral or oral administration, comprise flavivirus VLPs, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The compositions can further comprise auxiliary agents or excipients, as known in the art. See, e.g., Berkow et al., 1987; Avery's Drug Treatment, 1987. The composition of the invention is generally presented in the form of individual doses (unit doses).
Vaccines may contain about 0.1 to 500 ng, 0.1 to 500 μg, or 1 to 100 μg, of VLPs. In one embodiment, the vaccine may contain about 100 μg to about 500 μg of VLPs. In one embodiment, the vaccine may contain about at least 100 ng of VLPs. In one embodiment, the vaccine may contain about at least 500 ng of VLPs. In one embodiment, the vaccine may contain about at least 1000 ng of VLPs. In one embodiment, the vaccine may contain about at least 50 μg of VLPs. In one embodiment, the vaccine may contain less than about 750 μg of VLPs. In one embodiment, the vaccine may contain less than about 250 μg of VLPs. In one embodiment, the vaccine may contain less than about 100 μg of VLPs. In one embodiment, the vaccine may contain less than about 40 μg of VLPs. The vaccine forming the main constituent of the vaccine composition of the invention may comprise a combination of different flavirus VLPs, for example, at least two of the three types, Chinese, West African or East African.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which may contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Avery's, 1987.
When a composition of the present invention is used for administration to an individual, it can further comprise salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. For vaccines, adjuvants, substances which can augment a specific immune response, can be used. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the organism being immunized. Examples of materials suitable for use in vaccine compositions are provided.
A pharmaceutical composition according to the present invention may further or additionally comprise at least one chemotherapeutic compound, for example, immunosuppressants, anti-inflammatory agents or immune enhancers, chemotherapeutics including, but not limited to, gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon-α, interferon-β, interferon-γ, tumor necrosis factor-alpha, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir.
The composition can also contain variable but small quantities of endotoxin-free formaldehyde, and preservatives, which have been found safe and not contributing to undesirable effects in the organism to which the composition is administered.
The administration of the composition (or the antisera that it elicits) may be for either a “prophylactic” or “therapeutic” purpose. When provided prophylactically, the compositions of the invention which are vaccines, are provided before any symptom of a pathogen infection becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate any subsequent infection or one or more symptoms associated with the disease.
When provided therapeutically, a VLP vaccine is provided upon the detection of a symptom of actual infection. The therapeutic administration of the vaccine serves to attenuate any actual infection. See, e.g., Avery, 1987.
Thus, a VLP vaccine composition of the present invention may thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
A composition is said to be “pharmacologically acceptable” if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a “therapeutically effective amount” if the amount administered is physiologically significant. A composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient, e.g., enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious flavivirus.
The “protection” provided need not be absolute, i.e., the flavivirus infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection may be limited to mitigating the severity or rapidity of onset of symptoms of the flavivirus infection.
A composition of the present invention may confer resistance to one or more pathogens, e.g., one or more flavivirus strains, by either passive immunization or active immunization. In active immunization, an inactivated or attenuated live vaccine composition is administered prophylactically to a host (e.g., a mammal), and the host's immune response to the administration protects against infection and/or disease. For passive immunization, the elicited antisera can be recovered and administered to a recipient suspected of having an infection caused by at least one flavivirus strain.
In one embodiment, the vaccine or immune serum is provided to a mammalian female (at or prior to pregnancy or parturition), under conditions of time and amount sufficient to cause the production of an immune response which serves to protect both the female and the fetus or newborn (via passive incorporation of the antibodies across the placenta or in the mother's milk).
The present invention thus includes methods for preventing or attenuating a disorder or disease, e.g., an infection. As used herein, a vaccine is said to prevent or attenuate an infection if its administration results either in the total or partial attenuation (i.e., suppression) of a symptom or condition of the infection, or in the total or partial immunity of the individual to the disease.
At least one VLP or composition thereof, of the present invention may be administered by any means that achieve the intended purposes, using a pharmaceutical composition as previously described.
For example, administration of such a composition may be by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral or transdermal routes. Parenteral administration can be by bolus injection or by gradual perfusion over time. One mode of using a pharmaceutical composition of the present invention is by intramuscular or subcutaneous application. See, e.g., Avery, 1987.
A typical regimen for preventing, suppressing, or treating a flavivirus related pathology, comprises administration of an effective amount of a vaccine composition as described herein, administered as a single treatment, or repeated as enhancing or booster dosages, over a period up to and including between one week and about 24 months, or any range or value therein.
According to the present invention, an “effective amount” of a composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect wanted. The ranges of effective doses provided below are not intended to limit the invention and represent suggested dose ranges. However, the dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art. See, e.g., Avery's, 1987; and Ebadi, 1985.
The invention will be further described by the following non-limiting examples.
African Green Monkey kidney cells (Vero) and Human embryonic kidney 293 (HEK293) were obtained from ATCC (ATCC; Manassas, Va., USA) and grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 100 U/mL of penicillin, 100 μg/mL of streptomycin, and incubated at 37° C. in 5% CO2. ZIKV strain H/PF/2013 (GenBank:KJ776791), was obtained from Xavier de Lamballerie (European Virus Archive, Marseille France). Virus stocks were prepared by inoculation onto a confluent monolayer of Vero cells.
Mice of the 129/Sv background deficient in alpha/beta interferon (IFN-α/β) and IFN-Υ receptors (AG129 mice) were obtained from B&K Universal Limited (Hull, England) and were bred in the pathogen-free animal facilities of the University of Wisconsin-Madison School of Veterinary Medicine. Groups of mixed sex mice were used for all experiments.
Production and purification of ZIKV VLPs
The prM and E genes of ZIKV strain H/PF/2013 with nascent signal sequence were cloned into a pCM/V expression vector under the control of a cytomegalovirus (CMV) promoter and CMV polyadenylation signal (pCMV-prM/E). Endotoxin free, transfection grade DNA was prepared using Maxiprep kit (Zymo Research, Irvine, Calif.). VLPs were expressed by transfecting 90% confluent monolayers of HEK293 cells in a T-75 flasks with 15 μg of pCMV-prM/E using Fugene HD (Promega, Madison, Wis.) transfection reagent according to manufacturer protocol. The 10 ml supernatant was harvested 72 hours after transfection, and clarified by centrifugation at 15,000 RCF for 30 minutes at 4° C. Clarified supernatants were layered onto a 20% sucrose cushion and ultra-centrifuged in a SW-28 rotor at 112,000 RCF for 3.5 hours at 4° C. Pellet (PT) and supernatant (SUP) fractions at each step were saved for analysis by SDS-PAGE and Western blot. Post sucrose cushion PT were resuspended in Phosphate Buffered Saline (PBS) pH 7.2. Total protein in VLP preparations was quantified by Bradford assay. VLP specific protein was determined by comparing Zika specific bands on SDS-PAGE gels to known concentrations of BSA using ImageJ software.
VLP fractions were boiled in Laemmli sample buffer (BioRad, Hercules, Calif., USA) and resolved on a 4-20% SDS-PAGE gel (Biorad) by electrophoresis using a Mini-PROTEAN 3 system (BIO-RAD, CA). Gels were electroblotted onto nitrocellulose membranes using a Turboblot® system. Membranes were blocked in 5% (W/V) skim milk and probed with mouse hyper immune ascites fluid primary antibody (1:5000) and goat anti-mouse HRP conjugated secondary antibody (1:5000). Membranes were developed using a solid phase 3,3′,5,5′-tetramethylbenzidine (TMB) substrate system.
Samples were negatively stained for electron microscopy using the drop method. A drop of sample was placed on a Pioloform™ (Ted Pella, Inc.) carbon-coated 300 Mesh Cu grid, allowed to adsorb for 30 seconds, and the excess removed with filter paper. Next, a drop of methylamine tungstate or uranyl acetate (Nano-W, Nanoprobes Inc.) was placed on the still wet grid, and the excess removed. The negatively stained sample was allowed to dry, and was documented in a Philips CM120 (Eindhoven, The Netherlands) transmission electron microscope at 80 kV. Images were obtained using a SIS MegaView III digital camera (Soft Imaging Systems, Lakewood, Color.).
For VLP formulations, 0.45 μg of sucrose cushion purified VLPs was mixed with 0.2% Imject Alum (Thermo Scientific) according to manufacturer's protocol. Groups of AG129 mice were injected intramuscularly (IM) with VLPs mixed with alum (n=5) or PBS mixed with alum (n=6) at 6 weeks of age, and again at 8 weeks of age. Sub-mandibular blood draws were performed pre boost and pre challenge to collect serum for analysis by neutralization assays and for passive transfer studies.
Vaccinated mice were challenged with 200 PFU of ZIKV strain H/PF/2013 in 25 μl volumes by intradermal (ID) injection into the right hind footpad. Following infection, mice were monitored daily for the duration of the study. Mice that were moribund or that lost greater than 20% of starting weight were humanely euthanized. Sub-mandibular blood draws were performed on day two post challenge (PC) and serum collected to measure viremia.
For passive transfer studies, 5 naive mice were injected intraperitoneally (IP) with 500 μl of pooled serum from VLP vaccinated, diluted serum (1:5 n=4, 1:10, n=4), or serum from PBS/alum (n=5) treated mice. At 12 hours post transfer, mice were challenged with 20 PFU in 25 μl as above.
Viremia was determined by TCID50 assay. Briefly, serum was serially diluted ten-fold in microtiter plates 263 and added to duplicate wells of Vero cells in 96-well plates, incubated at 37° C. for 5 days, then fixed and 264 stained with 10% (W/V) crystal violet in 10% (V/V) formalin. Plates were observed under a light microscope to determine the 50% tissue culture infective doses (TCID50s). Serum samples were also tested for viral RNA copies by qRT-PCR. RNA was extracted from 0.02 ml of serum using the ZR Viral 267 RNA Kit (Zymo Research, Irvine, Calif.). Viral RNA was quantified by qRT-PCR using the primers and probe designed by Lanciotti et al. (Lanciotti et al., 2008). The qRT-PCR was performed using the iTaq Universal Probes One-Step Kit (BioRad, Hercules, Calif.) on an iCycler instrument (BioRad, Hercules, Calif.). Primers and probe were used at final concentrations of 500 nM and 250 nM respectively. Cycling conditions were as follows: 50° C. for 10 minutes and 95° C. for 2 minutes, followed by 40 cycles of 95° C. for 15 seconds and 60° C. for 30 seconds. Virus concentration was determined by interpolation onto an internal standard curve made up of a 5-point dilution series of in vitro transcribed RNA.
Serum antibody titers were deteiliiined by microneutralization assay. Briefly, serum was incubated at 56° C. for 30 minutes to inactivate complement and then serially diluted two-fold in microtiter plates. 200 PFUs of virus were added to each well and incubated at 37° C. for 1 hour. The virus-serum mixture was added to duplicate wells of Vero cells in 96-well plates, incubated at 37° C. for 5 days, then fixed and stained with 10% (W/V) crystal violet in 10% (V/V) formalin, then observed under a light microscope. The titer was determined as the serum dilution resulting in the complete neutralization of the virus.
Serum samples were serially diluted, mixed with 200 PFU of the ZIKV H/PF/2013 strain and incubated for 1 hour at 37° C. This serum/virus mixture was added to confluent layers of Vero cells in 96 well plates and incubated for 1 hour at 37° C., after which the serum/virus mixture was removed and overlay solution (3% CMC, 1×DMEM, 2% FBS and 1×Anti/Anti) was added. After 48 hours of infection, the monolayers were fixed with 4% PFA, washed twice with PBS, and then incubated with ZIKV hyperimmune mouse ascitic fluid (1:2000, UTMB) diluted in blocking solution (1×PBS, 0.01% Tween-20 and 5% Milk) and incubated overnight at 4° C. Plates were washed three times with PBS-T and then peroxidase-labeled goat anti-mouse secondary antibody (1:2000) was incubated on monolayers for 2 hours at 37° C. Following incubation, cells were washed a final three times with PBS-T and developed using 3-amino-9-ethylcarbazole (AEC)-peroxidase substrate. The amount of formed foci were counted using an 292 ELISPOT plate reader (ImmunoSPOT-Cellular Technology); quality control was performed to each scanned well to ensure accurate counting. Neutralization percentages (Nx) were calculated per sample/replicate/dilution as follows:
Where A corresponds to the amount of foci counted in the sample and Control is the geometric mean of foci counted from wells treated with cells and virus only. Data of corresponding transformed dilutions (Log(1/Dilution)) against neutralization percentages per sample was plotted and fitted to a sigmoidal dose-299 response curve to interpolate PRNT50 and PRNT90 values (GraphPad Prism software).
To generate Zika VLPs (ZIKVLPs), the prM/E genes with a native signal sequence were cloned into a pCMV expression vector (pCMV-prM/E) (
To determine if the immune reactive extracellular particles were virus like in nature, transmission electron microscopy (TEM) was performed on pCMV-prM/E SC pt. material. TEM revealed flavi virus 103 like particles with a size that ranged from 30-60 nm (data not show), and a typical size of about 50 nm (
Mice that received ZIKVLPs developed low levels (GMT=1:9.2) of neutralizing antibodies (nAbs) at 109 two weeks post administration, that increased two weeks after boost (GMT=1:32). Five weeks after primary vaccination, all mice were challenged with 200 PFU of ZIKV by the ID route. Mice administered ZIKVLP maintained weight, while mice that received PBS/alum experienced significant weight loss associated morbidity throughout the challenge period.
All control mice (n=6) died 9 days after ZIKV challenge. Mice administered ZIKVLP survived with no apparent morbidity. Finally, ZIKVLP vaccinated mice had significantly lower levels of viremia on day 2 post challenge than control mice detected by qRT-PCR (p=0.0356) and 116 TCID50 assay (p=0.0493).
The plaque reduction neutralization test (PRNT) assay is widely considered to be the “gold standard” for characterizing and quantifying circulating levels of anti-dengue and other flaviviral neutralizing antibodies (nAb) (Thomas et al., 2009). A PRNT assay was developed for rapidly measuring ZIKV specific neutralizing antibodies. Pooled serum samples collected from mice pre-challenge, as well as individual serum samples collected from mice post-challenge were tested by this PRNT assay. Pre-challenge, pooled serum from mice administered ZIKVLP had a calculated 90% plaque reduction (PRNT90) titer of 1:34. The PRNT90 titer increased 2 weeks post challenge (GMT=126 662).
To test the role of anti-ZIKV antibodies in protection against challenge, groups of mice received ZIKVLP 128 antiserum, undiluted (n=5), diluted 1:5 (n=4), or 1:10 (n=4). As a negative control mice (n=5) were transferred serum from mice previously vaccinated with PBS alum.
Negative control mice rapidly lost weight starting after day 7 and all died day 9 post challenge. Mice that received undiluted serum maintained weight throughout the 12 day period post challenge, and showed no signs of infection. Mice that received diluted anti-ZIKV antibodies were not protected from challenge, although survival and weigh loss were slightly extended relative to negative control mice 134.
Most experts and public health workers agree that a Zika vaccine is urgently needed. In February 2016, the World Health Organization declared that the recent clusters of microcephaly and other neurological disorders in Brazil constitute a public health emergency of international concern. Their recommendations included enhanced surveillance and research, as well as aggressive measures to reduce infection with Zika virus, particularly amongst pregnant women and women of childbearing age. ZIKV is now receiving considerable attention due to its rapid spread in the Americas, and its association with microcephaly (Mlakar et al., 2016) and Guillain-Barre syndrome (Pinto Junior et al., 2015). In our studies, we designed a ZIKV-virus-like particle (VLP) vaccine, demonstrated expression in vitro by western blot and transmission electron microscopy, and tested the protective efficacy and role of antibodies in protection in the AG129 mouse model.
Although the transfection and purification procedures for this ZIKV-VLP have yet to be optimized, we had an overall calculated yield of 2.2 mg/ml. Similar expression levels have been reported for other flavivirus VLP expression strategies (Pijlman, 2015). Future work will optimize VLP production and purification parameters, which should significantly increase both yield and purity. Stably transfected HEK cells that continuously express VLPs allow for scalable production to meet global demand for a ZIKV vaccine.
ZIKV-VLPs, formulated with alum, induced detectable neutralizing antibodies and protected animals against lethal challenge (>400 LD50s) with no morbidity or weight loss. Pre-challenge GMT neutralizing titers were 1:32, and pooled pre-challenge serum PRNT90 and PRNT50 titers were 1:34 and 1:157 respectively. At a relatively low dose of 450 ng, the present results indicate that the ZIKV VLPs are highly immunogenic. Additionally, the antibody titers we obtained are consistent with those reported for other highly immunogenic flavivirus VLP vaccines (Ohtaki et al., 2010; Pijlman, 2015).
Vaccinated mice challenged with >400 LD50s had low levels of viremia (mean=127, geometric mean=25.4 TCID50/ml) detected after challenge. Copies of RNA ZIKV genomes in serum of mice were significantly higher than levels of viremia. However, the disparity between viral genome copies and viremia has been observed for other flaviviruses including dengue (Bae et al., 2003). Since AG129 mice are highly susceptible to viral challenge, it is possible that the challenge dose given for the active vaccination study was artificially high. Additionally, methods for challenging mice from infected mosquito bite should be developed to most accurately mimic natural infection. Animal studies can determine if the ZIK VLP vaccine can protect female mice from contracting ZIKV during pregnancy using established models for such studies (Miner et al., 2016). ZIK-VLP vaccines may be tested in a non-human primate translational model which most accurately mimics human infection.
A VLP vaccine approach against ZIKV has significant advantages over other technologies as it will eliminate concerns of live attenuated vaccines and insufficient inactivation of killed vaccines for pregnant women and other populations at high risk of suffering the devastating effects of ZIKV infections. In recent years, recombinant virus-like particle (VLP)-based vaccine strategies have been frequently used for novel vaccine design. VLPs are known to be highly immunogenic and elicit higher titer neutralizing antibody responses than subunit vaccines based on individual proteins (Ariano et al., 2010).
The role of neutralizing antibodies in protecting against ZIKV was demonstrated by antibody passive transfer studies as naive AG129 mice receiving pooled serum from VLP vaccinated animals were fully protected. These results are consistent with previous findings that indicate the important role of antibodies in protecting against many mosquito-borne viruses, such as Japanese encephalitis, yellow fever and chikungunya. In this study, full protection was observed when animals received undiluted serum, with no weight loss or other clinical signs observed. While these studies highlight the importance of serum antibodies in ZIKV protection, upcoming studies will determine the minimum antibody titer needed for protection, whether the ZIKV-VLP can elicit CD8+ responses, and the overall role of cellular immunity in protection. It is also important to determine whether anti-ZIKV antibodies elicited by the VLPs play any role in dengue protection or disease enhancement.
In this study, the AG129 IFN receptor-deficient mouse model was used for evaluation of the ZIKV-VLP. Recently, the suitability of mice deficient in IFN-α/β and -γ receptors as an animal model for ZIKV was demonstrated, as they are highly susceptible to ZIKV infection and disease, developing rapid viremic dissemination in visceral organs and brain and dying 7-8 days post-infection (Aliota et al., 2016). The AG129 mouse model exhibits an intact adaptive immune system, despite the lack of an IFN response, and it has been used extensively to evaluate vaccines and antivirals for DENV (Brewoo et al., 2012; Fuchs et al., 2014; Johnson and Roehrig, 1999; Sarathy et al., 2015).
In the present study, aluminum hydroxide (commonly known as alum) was used as the adjuvant for the ZIKV-VLP preparations. Since its first use in 1932, vaccines containing aluminum-based adjuvants have been successfully administered in humans demonstrating excellent safety. A variety of adjuvant formulations may, however, be employed with ZIKV VLPs to enhance immunogenic potential including adjuvants that facilitate antigen dose sparing, enhanced immunogenicity, and/or broadened pathogen protection.
Thus, a VLP based Zika vaccine is described herein that elicits protective antibodies in mice, and is safe, suitable for scalable production, and highly immunogenic. Fast-tracking development of this ZIKV vaccine is a public health priority and is crucial for restoring confidence and security to people who wish to have children or reside in, or visit areas in which ZIKV is endemic.
Accession No. KU646827 (Which is Incorporated by Reference Herein)
prM/E proteins include those having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more amino acid sequence identity to the prM/E proteins encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:13.
Capsid proteins include those having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more amino acid sequence identity to the proteins encoded by one or more of SEQ ID NO:1 SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:13.
An exemplary intron/enhancer sequences useful in a vector include: atcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccgcggccgggaa cggtgcattggaacgcggattccccgtgccaagagtgactcaccgtccggatctcagcaagcaggtatgtactctccag ggtgggcctggcttccccagtcaagactccagggatttgagggacgctgtgggctcttctatacatgtaccttttgcttgc ctcaaccctgactatcttccaggtcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaaca gtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaac (SEQ ID NO:4), or a nucleotide sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 97%, 99% or more nucleotide sequence identity to SEQ ID NO:4.
An exemplary vector sequence useful to produce VLPs is shown in
An exemplary African lineage Zika isolate has the following nucleotide sequence (SEQ ID NO:11 which encodes the protein provided at Accession No. HQ234500 which is incorporated by reference herein):
An exemplary Asian lineage Zika isolate has the following sequence (SEQ ID NO:12 which encodes the protein provided at Accession No. HQ234499 which is incorporated by reference herein):
An exemplary Spodweni virus lineage has the following nucleotide sequence (SEQ ID NO:13 which encodes the protein provided at Accession No. DQ859064, which is incorporated by reference herein:
Exemplary vectors expressing GFP were transfected into HEK293 cells and expression was assessed (
ZIKV VLPS (ZIKVLPs) formulated with alum were injected into 6-8-week-old interferon deficient A129 and AG129 mice. Control mice received PBS/alum. Animals were challenged with 200 PFU (>400 LD50s) of ZIKV strain H/PF/2013. All vaccinated mice survived with no morbidity or weight loss while control animals either died at 9 days post challenge (AG129) or had increased viremia (A129). Neutralizing antibodies were observed in all ZIKVLP vaccinated mice.
African Green Monkey kidney cells (Vero) and Human embryonic kidney 293 (HEK293) were obtained from ATCC (ATCC; Manassas, Va., USA) and grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), 2 mM L-glutamine, 1.5 g/l sodium bicarbonate, 100 U/ml of penicillin, 100 μg/ml of streptomycin, and incubated at 37° C. in 5% CO2. ZIKV strain H/PF/2013 (GenBank:KJ776791), was obtained from Xavier de Lamballerie (European Virus Archive, Marseille France). Virus stocks were prepared by inoculation onto a confluent monolayer of Vero cells.
Mice of the 129/Sv background deficient in alpha/beta interferon alpha/beta/gamma (IFN-α/β/IFN-Υ) receptors (AG129 mice) were obtained from B&K Universal Limited (Hull, England) and were bred in the pathogen-free animal facilities of the University of Wisconsin-Madison School of Veterinary Medicine. 5-week-old BALB/c mice (The Jackson Laboratory, Maine, USA) were used for wild-type vaccination studies. Groups of mixed sex mice were used for all experiments.
The prM and E genes of ZIKV strain H/PF/2013 with nascent signal sequence were cloned into a pCMV expression vector under the control of a cytomegalovirus (CMV) promoter and CMV polyadenylation signal (pCMV-prM/E,
VLP fractions were boiled in Laemmli sample buffer (BioRad, Hercules, Calif., USA) and resolved on a 4-20% SDS-PAGE gel (Biorad) by electrophoresis using a Mini-PROTEAN 3 system (BIO-RAD, CA). Gels were electroblotted onto nitrocellulose membranes using a Turboblot® system. Membranes were blocked in 5% (W/V) skim milk and probed with mouse hyper immune ascites fluid primary antibody (1:5000) and goat anti-mouse HRP conjugated secondary antibody (1:5000). Membranes were developed using a solid phase 3,3′,5,5′-tetramethylbenzidine (TMB) substrate system.
Samples were negatively stained for electron microscopy using the drop method. A drop of sample was placed on a Pioloform™ (Ted Pella, Inc.) carbon-coated 300 Mesh Cu grid, allowed to adsorb for 30 seconds, and the excess removed with filter paper. Next, a drop of methylamine tungstate or uranyl acetate (Nano-W, Nanoprobes Inc.) was placed on the still wet grid, and the excess removed. The negatively stained sample was allowed to dry, and was documented in a Philips CM120 (Eindhoven, The Netherlands) transmission electron microscope at 80 kV. Images were obtained using a SIS MegaView III digital camera (Soft Imaging Systems, Lakewood. Colo.).
Each of the following animal studies was performed as one biological replicate. For VLP formulations, the indicated dose of sucrose cushion purified VLPs was mixed with 0.2% Imject Alum (Thermo Scientific) according to manufacturer's protocol. Groups of AG129 mice were injected intramuscularly (TM) with VLPs mixed with alum (n=5) or PBS mixed with alum (n=6) at 6 weeks of age, and again at 8 weeks of age. Sub-mandibular blood draws were performed pre boost and pre challenge to collect serum for analysis by neutralization assays and for passive transfer studies.
AG129 mice were challenged with 200 PFU of ZIKV strain H/PF/2013 in 25 μL volumes by intraderml (ID) injection into the right hind footpad at 11 weeks of age. Balb/c mice were vaccinated once at 5 weeks of age as above, and challenged at 13 weeks of age with 200 PFU of H/PF/2013 in 50 μl by retro orbital injection (IV route).
Following infection, mice were monitored daily for the duration of the study. Mice that were moribund or that lost greater than 20% of starting weight were humanely euthanized. Sub-mandibular blood draws were performed on day two post challenge (PC) and serum collected to measure viremia.
Eight week old AG129 mice were used for passive transfer studies Five naive mice were injected intraperitoneally (IP) with 500 μL of pooled serum from VLP vaccinated, diluted serum (1:5 n=4, 1:10, n=4), or serum from PBS/alum (n=5) treated mice. At 12 h post transfer, mice were challenged with 20 PFU in 25 μl as above.
Viremia was determined by TCID50 assay. Briefly, serum was serially diluted ten-fold in microtiter plates and added to duplicate wells of Vero cells in 96-well plates, incubated at 37° C. for 5 days, then fixed and stained with 10% (W/V) crystal violet in 10% (V/V) formalin. Plates were observed under a light microscope to determine the 50% tissue culture infective doses (TCID50s). Serum samples were also tested for viral RNA copies by qRT-PCR. RNA was extracted from 0.02ml of serum using the ZR Viral RNA Kit (Zymo Research, Irvine, Calif.). Viral RNA was quantified by qRT-PCR using the primers and probe designed by Lanciotti et al (Lanciotti et al., 2008). The qRT-PCR was performed using the iTaq Universal Probes One-Step Kit (BioRad, Hercules, Calif.) on an iCycler instrument (BioRad, Hercules, Calif.). Primers and probe were used at final concentrations of 500 nM and 250 nM respectively. Cycling conditions were as follows: 50° C. for 10 min and 95° C. for 2 min, followed by 40 cycles of 95° C. for 15 sec and 60° C. for 30 sec. Virus concentration was deteif lined by interpolation onto an internal standard curve made up of a 5-point dilution series of in vitro transcribed RNA, with the lowest copies per reaction being 100.
Serum antibody titers were determined by microneutralization assay. Briefly, serum was incubated at 56° C. for 30 min to inactivate complement and then serially diluted two-fold in microtiter plates. 200 PFUs of vines were added to each well and incubated at 37° C. for 1 h. The virus-serum mixture was added to duplicate wells of Vero cells in 96-well plates, incubated at 37° C. for 5 days, then fixed and stained with 10% (W/V) crystal violet in 10% (V/V) formalin, then observed under a light microscope. The titer was determined as the serum dilution resulting in the complete neutralization of the virus.
Serum samples were serially diluted, mixed with 200 PFU of the ZIKV H/PF/2013 strain and incubated for 1 hr at 37° C. This serum/virus mixture was added to confluent layers of Vero cells in 96 well plates and incubated for 1 hr at 37° C., after which the serum/virus mixture was removed and overlay solution (3% CMC, 1×DMEM, 2% FBS and 1×Anti/Anti) was added. After 48 hrs of infection, the monolayers were fixed with 4% PFA, washed twice with PBS, and then incubated with ZIKV hyperimmune mouse ascitic fluid (1:2000, UTMB) diluted in blocking solution (1×PBS, 0.01% Tween-20 and 5% Milk) and incubated overnight at 4° C. Plates were washed three times with PBS-T and then peroxidase-labeled goat anti-mouse secondary antibody (1:2000) was incubated on monolayers for 2 hours at 37° C. Following incubation, cells were washed a final three times with PBS-T and developed using 3-amino-9-ethylcarbazole (AEC)-peroxidase substrate. The amount of formed foci were counted using an ELISPOT plate reader (ImmunoSPOT-Cellular Technology); quality control was performed to each scanned well to ensure accurate counting. Neutralization percentages (Nx) were calculated per sample/replicate/dilution as follows:
Where A corresponds to the amount of foci counted in the sample and Control is the geometric mean of foci counted from wells treated with cells and virus only. Data of corresponding transformed dilutions (Log(1/Dilution)) against neutralization percentages per sample was plotted and fitted to a sigmoidal dose-response curve to interpolate PRNT50 and PRNT90 values (GraphPad Prism software).
Expression and Purification of Soluble, Zika VLPs To generate Zika VLPs (ZIKVLPs), we cloned the prM/E genes with native signal sequence into a pCMV expression vector (pCMV-prM/E) (
First, the LD50 of the H/PF/2013 strain in 12 week-old mixed sex AG129 mice was determined. Groups of mice (n=5) were infected with 5-fold serial dilutions from 2 PFU to 0.02PFU of ZIKV and monitored for 4 weeks following the last mortality. All mice infected with 2 or 0.4 PFU died within the first week of challenge (
To determine if ZIKVLPs are immunogenic and protective in highly susceptible AG129 mice, groups of mice received a prime and boost of 450ng ZIKVLPs. AG129 mice that received ZIKVLPs developed low levels (GMT=1:9.2) of neutralizing antibodies (nAbs) at two weeks post administration (
The plaque reduction neutralization test (PRNT) assay is widely considered to be the “gold standard” for characterizing and quantifying circulating levels of anti-dengue and other flaviviral neutralizing antibodies (nAb) (Thomas et al., 2009). A PRNT assay was developed for rapidly measuring ZIKV specific neutralizing antibodies. Pooled serum samples collected from mice pre-challenge, as well as individual serum samples collected from mice post-challenge were tested by this PRNT assay. Pre challenge, pooled serum from mice administered ZIKVLPs had a calculated 50% plaque reduction (PRNT50) titer of 1:157. The PRNT50 titer increased 2 weeks post challenge (GMT=5122) (
To test the role of anti-ZIKV antibodies in protection against challenge, groups of mice received ZIKVLP antiserum (pooled pre challenge serum, titer in
To determine if a single dose could protect AG129 mice, groups of 6-week old AG129 mice were vaccinated with 3 μg ZIKVLPs adjuvanted with alum. An additional group of mice (n=5) was vaccinated with a prime and boost of 0.45 μg adjuvanted with alum for comparison. Negative control mice (n=5) received a prime and boost of PBS/alum. Vaccinated mice developed neutralizing antibodies measured by PRNT assay prior to challenge (
To determine if ZIKVLPs can protect wildtype BALB/c mice against non-lethal ZIKV challenge, a group (n=6) was vaccinated with a single dose of 3 ZIKVLPS adjuvanted with alum. Negative control mice (n=5) were administered PBS/alum. Eight weeks after vaccination mice were challenged with 200 PFU ZIKV by the IV route. A single dose of ZIKVLPs elicited high titers of neutralizing antibodies (PRNT50=381, PRNT90=75) detected immediately prior to challenge (
Most experts and public health workers agree that a Zika vaccine is urgently needed. In February 2016, the World Health Organization declared that the recent clusters of microcephaly and other neurological disorders in Brazil constitute a public health emergency of international concern. Their recommendations included enhanced surveillance and research, as well as aggressive measures to reduce infection with Zika virus, particularly amongst pregnant women and women of childbearing age. ZIKV is now receiving considerable attention due to its rapid spread in the Americas, and its association with microcephaly (Mlakar et al., 2016) and Guillain-Barre syndrome (Pinto Junior et al., 2015). In these studies, a ZIKV-virus-like particle (VLP) vaccine was designed and it was expressed in vitro as shown by western blot and transmission electron microscopy, and its protective efficacy and role of antibodies in protection in the AG129 mouse model tested. An overall yield of 2.2 mg/L was calculated for the VLP tested. Similar expression levels have been reported for other flavivirus VLP expression strategies (Pijlman, 2015). Future work will optimize VLP production and purification parameters, which should significantly increase both yield and purity. Stably transfected HEK cells that continuously express VLPs allow for scalable production to help meet global demand for a ZIKV vaccine, which is estimated to be 100 million doses a year.
ZIKV-VLPs, formulated with alum, induced detectable neutralizing antibodies and protected animals against lethal challenge (>400 LD50s) with no morbidity or mortality. Pre-challenge GMT neutralizing titers were 1:32, and pooled pre-challenge serum PRNT90 and PRNT50 titers were 1:34 and 1:157 respectively. At a relatively low dose of 450 ng, our results indicate that our ZIKVLPs are highly immunogenic. The antibody titers obtained are consistent with those reported for other highly immunogenic flavivirus VLP vaccines (Ohtaki et al., 2010; Pijlman, 2015). Previous work has shown a direct correlation between dose of VLPs and neutralizing antibody titers. For ZIKV, questions remain about the quantitative relationship between dose of VLPs and their effect on neutralizing antibody titers and protection from ZIKV challenge in vivo.
In the above-described studies, mice were vaccinated with ZIKVLPS and challenged with a homologous strain of ZIKV (H/PF/2013), which raises the question of ZIKVLP specific antibody cross reactivity to heterologous viruses currently circulating in the Americas. Although the H/PF/2013 virus was isolated well before the current outbreak from a patient infected in French Polynesia, there is a high degree of amino acid similarity (about 99%) to endemic South American strains of ZIKV (Faria et al., 2016; Zanluca et al., 2015). Some experts agree that the high serological cross-reactivity among ZIKV strains would allow for a monovalent vaccine (Lazear and Diamond, 2016). Nevertheless, care must be taken to empirically determine if antibody responses elicited by ZIKV LPs cross-react and protect against South American strains. Finally, any future ZIKV vaccination programs should incorporate careful surveillance of circulating strains to help suppress immunological escape, and ensure efficacy of vaccines in human populations.
Vaccinated AG129 mice challenged with >1000 LD50s had low levels of viremia (1.3×102 TCID50s,
A VLP vaccine approach against ZIKV has significant advantages over other technologies as it will eliminate concerns of live attenuated vaccines and insufficient inactivation of killed vaccines for pregnant women and other populations at high risk of suffering the devastating effects of ZIKV infections. Production of inactivated vaccines requires high titer growth of infectious virus which may pose a safety concern for workers. Additionally, the production of both attenuated and inactivated ZIKV vaccines is limited to “batch” production, whereas flavirus VLPs can continuously expressed from stable cell lines. In recent years, recombinant virus-like particle (VLP)-based vaccine strategies have been frequently used for vaccine design. VLPs are known to be highly immunogenic and elicit higher titer neutralizing antibody responses than subunit vaccines based on individual proteins (Ariano et al., 2010).
The role of neutralizing antibodies in protecting against ZIKV was demonstrated by antibody passive transfer studies as naive AG129 mice receiving pooled serum from VLP vaccinated animals were fully protected. These results are consistent with previous findings that indicate the important role of antibodies in protecting against many insect-borne flaviviruses, such as Japanese encephalitis, west Nile virus, and tick borne encephalitis (Chiba et al., 1999; Kimura-Kuroda and Yasui, 1988; Tesh et al., 2002), even at low levels of circulating antibodies. In this study, full protection was observed when animals received undiluted serum (PRNT50 1:157), with no weight loss or other clinical signs observed. While these studies highlight the importance of serum antibodies in ZIKV protection, there are still many important questions related to ZIKV immunology. What is the minimum antibody titer needed for protection, do ZIKVLPs elicit CD8+ responses and are these responses involved in protection, and what is the overall role of cellular immunity in protection? It is also important to determine if anti-ZIKV antibodies, particularly those elicited by ZIKVLPs, play any role in dengue protection or disease enhancement.
In this study AG129 IFN receptor-deficient mice were used. This mouse models are commonly used for the evaluation of arboviral vaccines, including dengue, chikungunya and yellow fever virus (Meier et al., 2009; Partidos et al., 2011; Prestwood et al., 2012). We recently documented the suitability of mice deficient in IFN-α/β and -γ receptors as an animal model for ZIKV, as they are highly susceptible to ZIKV infection and disease, developing rapid viremic dissemination in visceral organs and brain and dying 7-8 days post-infection (Aliota et al., 2016), and evaluated doses as low as 1 PFU. In our current studies we observed consistent lethality at doses below 1 PFU, indicating that there are viral subpopulations refractory for the formation of CPE in cell culture, but still capable of establishing a lethal infection in highly susceptible mice. It is of great interest is that at a very low dose (0.2PFU) two of five mice became ill more than 1 month after infection, as infection with ZIKV typically produces rapid lethality in AG129 mice.
The current studies challenged mice with 200 PFU at 11 weeks of age. All control mice lost 20% weight, were moribund, and succumbed to by challenge by day 9. ZIKV challenge therefore appears to be completely lethal in both juvenile and adult AG129 mice. The AG129 mouse model exhibits an intact adaptive immune system, despite the lack of an IFN response, and it has been used extensively to evaluate vaccines and antivirals for DENV (Brewoo et al., 2012; Fuchs et al., 2014; Johnson and Roehrig, 1999; Sarathy et al., 2015). In our studies WT BALB/c mice did not succumb to infection with ZIKV consistent with previous studies where BALB/c mice were experimentally inoculated with 200 PFU of ZIKV (Larocca et al., 2016). Mice also developed high levels of viremia following IV inoculation. A single dose of VLPs prevented detection of viral RNA copies in serum of vaccinated mice at 2 days post infection—when viremia levels typically peak in the BALB/c model. It is possible that viral replication was completely inhibited, as there was no “boost” response in neutralizing antibodies observed following challenge. Finally, in repeat AG129, and Balb/c mice mouse studies, animals were protected from ZIKV challenge 8 weeks after vaccination. ZIKVLP therefore appear to elicit a potent “memory” response.
In the present study, aluminum hydroxide (commonly known as alum) was used as the adjuvant for ZIKV-VLP preparations. Since its first use in 1932, vaccines containing aluminum-based adjuvants have been successfully administered in humans demonstrating excellent safety. Adjuvant formulations of ZIKV-VLP may facilitate antigen dose sparing, enhanced immunogenicity, and broadened pathogen protection.
In summary, a vaccine against ZIKV is currently unavailable, nor is there any specific prophylactic treatment. A VLP based Zika vaccine that elicits protective antibodies in mice, and is safe, suitable for scalable production, and highly immunogenic, is disclosed herein. Fast-tracking development of this ZIKV vaccine is a public health priority and is crucial for restoring confidence and security to people who wish to have children or reside in, or visit areas in which ZIKV is endemic.
This application claims the benefit of the filing date of U.S. application Ser. No. 62/352,904, filed on Jun. 21, 2016, and U.S. application Ser. No. 62/384,967, filed on Sep. 8, 2016, the disclosure of which are incorpraoted by reference herein.
| Number | Date | Country | |
|---|---|---|---|
| 62352904 | Jun 2016 | US | |
| 62384967 | Sep 2016 | US |
