Patent Grant
7348400
This invention relates to novel peptides of the alpha conotoxin (α-conotoxin) class and their use in the treatment or prevention of pain, in recovery from nerve injury and in the treatment of painful neurological conditions such as stroke. The invention also relates to pharmaceutical compositions comprising these peptides. The peptides of the invention are also useful as research reagents for investigation of nicotinic acetylcholine receptor physiology and pharmacology.
All references, including any patents or patent applications, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country.
Predatory marine snails of the genus Conus (cone snails) are a highly diverse family of marine molluscs which capture their prey by envenomation (Screenivasan, 2002). The venom of a typical cone snail is a complex mixture comprising about one hundred different peptides, which target different ion channels and receptors and interfere with their function, resulting in immobilisation of the prey (Olivera et al, 1990; Olivera and Cruz, 2001).
The mixture of peptides present depends on the species of cone snail and the prey on which it feeds, and may vary with time even in individual molluscs (Lewis et al 1994; Jones et al 1996; Bingham et al 1996). Classes of peptides found in Conus venoms include the α-, αA- and ψ-conotoxins (antagonists at nicotinic acetylcholine receptors), μ-, μO-conotoxins (antagonists at voltage-gated sodium ion channels), δ-conotoxins (agonists, which inhibit inactivation at voltage-sensitive sodium channels), ω-conotoxins (antagonists at voltage-sensitive calcium channels), κ- and κA-conotoxins (antagonists at potassium channels), σ-conotoxins (inhibitors of 5HT receptors), χ-conotoxins (inhibitors of noradrenaline uptake), conantokins and conodynes (antagonists at NMDA receptors), ρ-conotoxins (inhibitors of the α1-adrenoceptors), conorfamides (Maillo et al., 2001), and contulakins (inhibitors of neurotensin receptors). For review see Jones and Bulaj, 2000; McIntosh and Jones, 2001).
The α-conotoxins are typically found in cone snails which prey on fish or on marine snails or marine worms. They are typically 12-19 amino acids in length, and have four cysteine residues which form two disulfide bonds, forming a two-loop structure (McIntosh et al, 1999). They are characterised by an ability to inhibit the nicotinic acetylcholine receptor (nAChR). nAChRs are ligand-gated ion channels which consist of five subunits arranged around a cation-conducting pore (Sargent 1993; Lukas et al 1999; Karlin, 2002).
There are two main classes of nAChRs:
1) the neuronal type; and
2) the muscle type.
Neuronal type nAChRs are present both pre- and post-synaptically in the central and peripheral nervous systems, while the muscle type nAChRs are found post-synaptically at skeletal neuromuscular junctions (Wonnacott 1997). The main difference between these receptors is their subunit composition. The neuronal type receptors are formed from the combination of α and β subunits or α subunits alone, while the muscle type receptors are composed of α, β, γ and ε (or δ) subunits. The functional receptors have different combinations of subunits (see Karlin, 2002), and have a range of pharmacological properties (see Albuquerque et al., 1997; Lukas et al 1999 for review). Specific α-conotoxins display different affinity and selectivity for muscle and neuronal nAChRs and their subtypes.
Compounds of the α-conotoxin class may be useful in the treatment of disorders which involve the neuronal nAChR. The neuronal nAChR has been implicated in the pathophysiology of Alzheimer's disease (Guan et al, 2000), Parkinson's disease (Aubert et al, 1992), schizophrenia (Mukherjee et al, 1994), small cell lung carcinoma (Codignola et al, 1996) nicotine addiction (U.S. Pat. No. 5,780,433, U.S. Pat. No. 5,866,682), pain (Marubio et al 1999), and as neuromuscular blocking agents, such as muscle relaxants (U.S. Pat. No. 6,268,473 and U.S. Pat. No. 6,277,825) and in certain forms of epilepsy (Steinlein et al 1995).
Conotoxins of another class, the ω-conotoxin class, have provided lead compounds for stroke and for pain. ω-conotoxin MVIIA (Neurex SNX-111, Warner-Lambert CI-1009, or Elan's Ziconotide) and ω-conotoxin CVID (AMRAD AM336) are presently undergoing clinical trials for the treatment of manifestations of stroke (Zhao et al 1994; Heading, 1999; Shen et al 2000; Jones and Bulaj, 2000) and for chronic pain (Bowersox et al 1996; 1997; Jain, 2000; Jones and Bulaj, 2000). These compounds target N-type calcium channels in nerves. However, the members of the ω-conotoxin class still have undesirable side effects in some patients (Penn and Paice, 2000), and the US Food and Drug Administration has requested a repeat of the Stage III clinical trials for Ziconotide (re-named Prialt™ by Elan) for treatment of cancer pain.
Yet another class of conopeptide, the conantokins, having 10-30 amino acids, including preferably two or more γ-carboxyglutamic acid residues, have been developed for the treatment of neurological and psychiatric disorders, including pain, e.g., as an analgesic agent (U.S. Pat. No. 6,277,825). In addition, a novel class of conopeptide, whose target receptor is yet to be defined (McIntosh et al 2000), has been shown to have analgesic activity in the mouse.
We have recently found that a specific amino acid at position 10 (Leu10) of α-conotoxin PnIB is responsible for conferring potency for the neuronal-type nicotinic response (Broxton et al 2000). We have also found that splice variants of the α-conotoxins PnIA and PnIB from Conus pennaceus show improved selectivity for α7 subunits of nAChRs (U.S. patent application Ser. No. 09/639,565; see also Hogg et al, 1999; Broxton et al, 2000).
We have now found that a previously unexamined Conus species, Conus victoriae, which is found along the north-western coast of Australia, has novel α-conotoxins with unexpectedly powerful analgesic activity. Surprisingly, the ability of one particular α-conotoxin (Vc1.1) to inhibit sensory nerve function, and consequently its analgesic activity, is even higher than that of ω-conotoxin MVIIA (ziconotide, Prialt™) from Conus magus. In addition, we have found that a post-translational modification of this peptide lacks analgesic activity but retains the ability of the parent compound to accelerate recovery from nerve injury. We have also identified two other new α-conotoxins, conotoxin An1.1 from Conus anemone and conotoxin Vg1.1 from Conus virgo, which have similar sequences to Vc1.1, and have similar pharmacological actions.
In a first aspect, the present invention provides an isolated α-conotoxin peptide comprising the following sequence of amino acids:
Xaa1-Cys-Cys-Ser-Xaa2-Xaa3-Xaa4-Cys-Xaa5-Xaa6-Xaa7-Xaa8-Xaa9-Xaa10-Xaa11-Cys (SEQ ID NO:10) in which Xaa1 is Gly or Asp Xaa3 is Pro or hydroxyproline or Gln; each of Xaa2, Xaa4 to Xaa8 and Xaa11 is independently any amino acid; Xaa9 is Pro, hydroxyproline or Gln; Xaa10 is Asp, Glu or γ-carboxyglutamate; Xaa11 is optionally absent; and the C-terminus is optionally amidated, with the proviso that the peptide is not α-conotoxin EpI or α-conotoxin ImI.
Preferably Xaa2 is Asp, His or Asn; Xaa4 is Ala, Pro or Arg; Xaa5 is Asn, Ala or Tyr; Xaa6 is Ala, Tyr, His, Met or Val; Xaa7 is Asn or Asp; Xaa8 is His or Asn; and Xaa11 is Ile or Tyr.
More preferably the isolated α-conotoxin peptide comprises the following sequence of amino acids:
Most preferably the peptide comprises the following sequence of amino acids:
The peptide of the invention preferably has one or more of the following abilities:
(a) to inhibit a neuronal nicotinic acetylcholine receptor (nAChR), or
(b) to act as an analgesic in mammals, or
(c) to accelerate recovery from nerve injury. Preferably also the peptide does not affect muscle-type nicotinic responses in rats.
In particularly preferred embodiments, the peptide comprises the sequence set out in any one of
in each of which the C-terminal cysteine is amidated.
It will be clearly understood that the peptide may be isolated from a mollusc of the genus Conus, or may be synthetic or recombinant. One or more L-amino acids present in the naturally-occurring sequence may be replaced by its corresponding D-amino acid.
Preferably the peptide is synthetic, and may be prepared by methods known in the art, for example by conventional solid-phase peptide synthesis using BOC or fMOC methods. Where the peptide is isolated from a mollusc of the genus Conus, the Conus is preferably Conus victoriae, Conus anemone or Conus virgo.
It will also be clearly understood that all isomers of the peptide, including all disulfide connectivity forms (see Price-Carter et al 2002) are within the scope of the invention.
The four cysteine residues in the peptide are oxidized to provide two intramolecular disulfide bonds. Since this reaction proceeds spontaneously, the reduced form is a source of the active form. This linking of cysteine residues via disulfide bonds may occur in three alternative ways: first to second, first to third or first to fourth cysteine, followed by linking of the two remaining cysteines in each case (see Gehrmann et al 1998). Other possible sulphydryl linkings are those known to produce active peptide at the neuronal nicotinic receptor, such as the 4:6 link in α-conotoxin AuIB from Conus aulicus (Luo et al 1998), or the 4:3 loop found in α-conotoxin Im1 from Conus imperialis (McIntosh et al, 1994).
Preferably the peptide has four cysteine residues in a CC—(X)4—C—(X)7—(C) [SEQ ID NO:13], or so-called 4:7 loop framework in which the linking of the cysteine residues via disulfide bonds occurs with the first to third and second to fourth cysteine. Amino acid deletions give rise to smaller loops, which may also provide active peptides, for example, the 4:6 loop α-conotoxin AuIB from Conus aulicus.
The peptide bonds of the primary sequence would normally be of a trans geometry, but one or more peptide bonds may assume a cis geometry. Furthermore, the disulfide bonds themselves are chiral, and the particular geometry assumed by each disulfide bond allows up to four forms as a result of this source of isomerism (Lin et al., 1999). All of these forms are within the scope of the invention.
Some interconversion between the various isomers is feasible under physiological conditions, so that any isomer may be a source of the active form; the invention includes within its scope all fully reduced forms, all partially oxidized forms and all oxidized forms encompassed by the types of isomerism described above.
The invention also encompasses amino acid sequence variants of the specific sequences disclosed herein, including sequences which have undergone one or more amino acid substitutions, additions, deletions or side chain modifications, provided that the peptide retains the ability to inhibit the activity of a nAChR, which is preferably a neuronal nAChR, to prevent pain, and/or to accelerate recovery from nerve injury.
Such substitutions may have a different effect on activity. For example, we have found that γ-carboxylation of glutamate results in significant reduction in analgesic activity, but does not affect the ability of the peptide to accelerate recovery from nerve injury.
Other derivatives contemplated by the invention include glycosylation variants, ranging from a completely unglycosylated molecule to a modified glycosylated molecule. Altered glycosylation patterns may result from expression of recombinant molecules in different host cells. In one preferred embodiment, the C-terminal glycine of the precursor peptide (see
in which the C-terminus cysteine is amidated.
Still other PTMs which are known in conopeptides include 5-bromotryptophan for tryptophan, O-sulfated tyrosine for tyrosine, pyroglutamate for glutamate at the N-terminus (as in κA-conotoxin SIVA and μ-conotoxin PIIIA), threonine-O-gal(Nac)-Gal for threonine and D-tryptophan for tryptophan, and those described in International patent application No. WO00/44769.
In a preferred embodiment, the α-conotoxin peptide has the following sequence:
This preferred peptide is designated Vc1.1.
The peptides of the invention may be naturally-occurring conopeptides, or may be derivatives of such naturally-occurring peptides. The derivatives of the naturally-occurring conopeptides may differ from their naturally occurring counterparts by one or more amino acid substitutions, deletions or additions, as described below.
Substitutions encompass amino acid alterations in which an amino acid is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as “conservative”, in which case an amino acid residue contained in a peptide is replaced with another naturally-occurring amino acid of similar character, for example Gly to Ala, Asp to Glu, Asn to Gln or Trp to Tyr. Possible alternative amino acids include serine or threonine, aspartate or glutamate or carboxyglutamate, proline or hydroxyproline, arginine or lysine, asparagine or histidine, histidine or asparagine, tyrosine or phenylalanine or tryptophan, aspartate or glutamate, isoleucine or leucine or valine.
It is to be understood that some non-conventional amino acids may also be suitable replacements for the naturally occurring amino acids. Substitutions encompassed by the present invention may also be “non-conservative”, in which an amino acid residue which is present in a polypeptide is substituted with an amino acid having different properties, such as naturally-occurring amino acid from a different group (eg. substituting a charged or hydrophilic or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid. Additions encompass the addition of one or more naturally occurring or non-conventional amino acid residues. Deletions encompass the deletion of one or more amino acid residues.
Without wishing to limit the scope of the invention, it is presently believed that the cysteine residues and 3 to 4 consensus amino acids are likely to be essential to the biological activity of the molecule, and therefore the scope of substitution at these points may be limited, as discussed further below.
It is to be clearly understood that the invention also encompasses peptide analogues, which include but are not limited to the following:
1. Compounds in which one or more amino acids is replaced by its corresponding D-amino acid. The skilled person will be aware that retro-inverso amino acid sequences can be synthesised by standard methods; see for example Chorev and Goodman, 1993;
2. Peptidomimetic compounds, in which the peptide bond is replaced by a structure more resistant to metabolic degradation. See for example Olson et al, 1993; and
3. Compounds in which individual amino acids are replaced by analogous structures for example, gem-diaminoalkyl groups or alkylmalonyl groups, with or without modified termini or alkyl, acyl or amine substitutions to modify their charge.
The use of such alternative structures can provide significantly longer half-life in the body, since they are more resistant to breakdown under physiological conditions.
Methods for combinatorial synthesis of peptide analogues and for screening of peptides and peptide analogues are well known in the art (see for example Gallop et al, 1994; Hogan, 1997).
The peptides or peptidomimetics of the invention may be synthesised using standard solid phase techniques, such as Fmoc or BOC chemistry, followed by oxidative disulfide bond formation. Methods for the synthesis of conotoxins are known in the art; see for example Loughnan et al (1998), Groebe et al (1997), Favreau et al (1999), Miranda and Alewood, 1999. Following deprotection and cleavage from the solid support the reduced peptides may be purified using methods known in the art, such as preparative chromatography.
The peptide of the invention may also be prepared using recombinant DNA technology. A nucleotide sequence encoding the peptide sequence may be inserted into a suitable vector and protein expressed in an appropriate expression system. In some instances, further chemical modification of the expressed peptide may be appropriate, for example C-terminal amidation. Under some circumstances it may be desirable to undertake oxidative bond formation of the expressed peptide as a chemical step following peptide expression. This may be preceded by a reductive step to provide the unfolded peptide. Those skilled in the art will readily be able to determine appropriate conditions for the reduction and oxidation of the peptide.
Thus in a second aspect, the invention further provides an isolated or synthetic nucleic acid molecule comprising:
ATGGGCATGCGGATGATGTTCACCGTGTTTCTGTTGGTTGTCTTGGCAAC
(b) a nucleotide sequence complementary to that defined in (a); or
(c) a nucleotide sequence able to hybridize to the sequence defined in either (a) or (b) under at least moderately stringent conditions.
(d) a nucleic acid molecule which has at least 75% sequence identity to (a).
More preferably in (c) the nucleic acid molecule is able to hybridise under stringent conditions to the molecule of (a). More preferably in (d) the nucleic acid molecule has at least about 75%, preferably at least 80%, even more preferably at least 90% sequence identity to the molecule of (a).
“Stringent conditions” for hybridization or annealing of nucleic acid molecules are those that (1) employ low ionic strength and high temperature for washing, for example 0.015 M NaCl/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50□C, or (2) employ during hybridization a denaturing agent such as formamide, for example 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42° C. Another example is use of 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg/mL), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC and 0.1% SDS.
Preferably the nucleic acid encodes peptide Vc1.1.
The nucleic acid molecules of the invention may be DNA or RNA. When the nucleic acid molecule is a DNA, it may be genomic DNA or cDNA. When the nucleic acid molecule is RNA, it is generally an mRNA. The nucleic acid molecules of the present invention may be integrated into or ligated to, or otherwise fused or associated with, other genetic molecules such as vectors, in particular expression vectors. Vectors and expression vectors are generally capable of replication and, if applicable, expression in one or both of a prokaryotic cell or a eukaryotic cell. Preferred prokaryotic cells include E. coli, Bacillus sp and Pseudomonas sp. Preferred eukaryotic cells include yeast, fungal, plant, mammalian and insect cells. Preferred bacterial expression systems (reviewed by Baneyx, 1999), which provide the special needs of the peptides referred to above, would include
(1) strains of Escherichia coli coexpressing DnaK-DnaL or GroEL-GroES chaperones (Nichihara et al 1998; Castanie et al 1997; Thomas and Baneyx, 1996) to aid folding;
(2) strains that express disuphide isomerases and disulphide oxidoreductases to aid disulphide-bond formation (Qiu et al 1998); and
(3) strains that express peptidyl prolyl cis/trans isomerases (Hottenrott et al 1997, Stoller et al 1995) to catalyse trans to cis isomerisation of prolyl residues.
In a third aspect the invention provides a probe for detection of nucleic acid encoding Vc1.1, comprising at least 15, preferably at least 20, more preferably at least 30 consecutive nucleotides from the sequence set out in SEQ ID NO:3. Preferably the probe has the sequence set out in SEQ ID NO: 5 or SEQ ID NO: 6.
In a fourth aspect, the invention provides a genetic construct comprising a vector portion and a nucleic acid encoding a peptide according to the invention. Preferably the nucleic acid is operably linked to a promoter on the vector, so that the promoter is capable of directing expression of the nucleic acid in an appropriate cell.
In a fifth aspect, the invention provides a composition comprising a peptide according to the invention, together with a physiologically acceptable carrier. In one preferred embodiment, the carrier is a pharmaceutically acceptable carrier, and the composition is suitable for administration to a mammalian subject. In a second preferred embodiment, the carrier is suitable for use in tissue cultures or in experimental tests of nicotinic acetylcholine receptor function.
It is contemplated that the peptide of the invention is suitable both for pharmaceutical use and as a research reagent in assessment of nicotinic acetylcholine receptor function and other physiological parameters. In particular, the peptide is useful in modulating a particular subset of sensory neurones (small unmyelinated C fibres) which represents the first order neurone in the pain-conducting pathway for investigating the role of these receptors.
In a sixth aspect, the invention provides a method of treatment of a condition mediated by a nAChR, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment.
Preferably the condition is mediated by a neuronal nAChR. More preferably the condition is selected from the group consisting of stroke, pain, epilepsy, nicotine addiction, schizophrenia, Parkinson's disease, small cell lung carcinoma and Alzheimer's disease. An extended list of such conditions is given in U.S. Pat. No. 6,265,541.
Most preferably the condition is pain, which may result from any condition associated with neurogenic or neuropathic pain, including but not limited to cancer pain, post-surgical pain, oral or dental pain, referred trigeminal neuralgia, post-herpetic neuralgia, phantom limb pain, fibromyalgia, reflex sympathetic dystrophy and neurogenic pain conditions, including pain associated with inflammatory conditions such as rheumatoid arthritis and other inflammatory arthritides; or degenerative arthritis, e.g. osteoarthritis.
In a preferred embodiment, the invention further provides a method of treating or preventing pain, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment.
In a seventh aspect the invention provides a method of accelerating functional recovery from nerve injury, comprising the step of administering an effective amount of a peptide of the invention to a mammal in need of such treatment.
The term “functional recovery” is to be understood to mean a return of function to normal. We have found that Vc1.1 and Vc1.1 ptm enhance (or “accelerate”) the rate at which this process occurs, ie functional recovery returns sooner than would otherwise have been the case; a faster return than with saline control or with MVIIA is observed.
The mammal may be a human, or may be a domestic or companion animal. While it is particularly contemplated that the compounds of the invention are suitable for use in medical treatment of humans, they are also applicable to veterinary treatment, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as felids, canids, bovids, and ungulates.
The compounds and compositions of the invention may be administered by any suitable route, and the person skilled in the art will readily be able to determine the most suitable route and dose for the condition to be treated. Dosage will be at the discretion of the attendant physician or veterinarian, and will depend on the nature and state of the condition to be treated, the age and general state of health of the subject to be treated, the route of administration, and any previous treatment which may have been administered.
The carrier or diluent, and other excipients, will depend on the route of administration, and again the person skilled in the art will readily be able to determine the most suitable formulation for each particular case.
Methods and pharmaceutical carriers for preparation of pharmaceutical compositions are well known in the art, as set out in textbooks such as Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing Company, Easton, Pa., USA.
The peptide may be delivered using any suitable delivery means, including oral administration; injection, either subcutaneously, intravenously, intra-arterially, intrathecally, intracerebrally, intramuscularly; or via microencapsulation (see for example U.S. Pat. Nos. 4,352,883; 4,353,888; 5,084,350); macroencapsulation (see for example U.S. Pat. Nos. 5,284,761; 5,158,881, 4,976,859); topical lotions or delivery via a vector or an osmotic pump, or via iontophoretic or electrophoretic means.
We have demonstrated that peptide Vc1.1 inhibits the neuronal nAChR, and has analgesic activity. It is not yet known whether the activity of the peptide of the invention is mediated by actual binding of the peptide to the target receptor, or whether it otherwise interferes with receptor activity. However, we have shown that the in vitro actions of the peptide are consistent with a competitive mode of action with nicotinic agonists, and are not mediated via voltage-activated ion channels. Further, the peptide does not inhibit the muscle-type nicotinic acetylcholine responses. For example, Vc1.1 did not inbibit the release of noradrenaline or adrenaline from bovine chromaffin cells in culture when stimulated by 56 mM K+ (see
For the purposes of this specification it will be clearly understood that the word “comprising” means “including but not limited to”, and that the word “comprises” has a corresponding meaning.
a and b show concentration-response curves for the action of Vc 1.1 on nicotine-stimulated catecholamine release from bovine chromaffin cells. Chromaffin cell cultures, 4-5 days old, were preincubated with Vc1.1 at 0.01 μM, 0.1 μM, 1 μM, 5 μM and 10 μM for five minutes before stimulation with nicotine.
a illustrates the short-term effect of intramuscular injection of saline, 0.53 μg/200 μL ω-conotoxin MVIIA or 0.36 μg/200 μL α-conotoxin Vc1.1 on mechanical pain threshold in rats with chronic constriction injury. Mechanical pain threshold is expressed as percentage of base-line data. Each data point represents the mean±SEM of 6 rats in each group. The asterisks indicate that the threshold for the group which received α-conotoxin Vc1.1 was significantly different from that for the saline control group at 1 hour and 24 hours post injection (p<0.05).
b illustrates the short-term effect of subcutaneous injection into the footpad receptive field of injured neurons, of saline, 0.53 μg/2.5 μL ω-conotoxin MVIIA or 0.36 μg/2.5 μL α-conotoxin Vc1.1 on mechanical pain threshold in rats with chronic constriction injury. Mechanical pain threshold is expressed as percentage of base-line data. Each data point represents the mean±SEM of 6 rats in each group. The asterisks indicate that the threshold for the group which received α-conotoxin Vc1.1 was significantly different from that for the saline control group at 1 hour and 24 hours post injection (p<0.05).
a illustrates the effect of daily intramuscular injection of saline or 0.53 μg/200 μL ω-conotoxin MVIIA and 0.36 μg/200 μL α-conotoxin Vc1.1 on mechanical pain threshold in rats with chronic constriction injury. Mechanical pain threshold is expressed as percentage of base-line data. Each data point represents the mean±SEM of 6 rats in each group. The asterisks indicate that the threshold for the treatment group which received α-conotoxin Vc1.1 was significantly different from that for the saline control group on day 11, day 12, day 13 and day 14 (p<0.05).
b illustrates the long-term effect of intramuscular injection of saline or 0.53 μg/200 μL ω-conotoxin MVIIA or 0.36 μg/200 μL α-conotoxin Vc1.1 on mechanical pain threshold in rats with chronic constriction injury. Intramuscular injections ceased after two weeks. Mechanical pain threshold is expressed as the percentage of base-line data. Each data point represents the mean±SEM of 6 rats in each group. The asterisks indicate that the threshold for the treatment group which received α-conotoxin Vc1.1 was significantly different from that for the control group (p<0.05).
a illustrates the dose-response effect of Vc1.1 on sensory nerve activity. The experiments were conducted as in
b compares the effectiveness of Vc1.1 and MVIIA in inhibition of sensory nerve activity (both at a concentration of 0.1 μM peptide). Vc1.1 is more potent than MVIIA at this lower concentration, whereas at 1 μM peptide (
a compares the long-term effectiveness of Vc1.1 and Vc1.1ptm in inhibiting neuropathic pain when administered intramuscularly at 0.36 μg/200 μl and 0.37 μg/200 μl for Vc1.1 and Vc1.1ptm, respectively. The bars represent mean+SEM (n=6−8). The asterisks denote significant difference compared to the saline control group (p<0.05) The results indicate that Vc1.1 but not Vc1.1ptm was effective in inhibiting neuropathic pain for up to 5 weeks after injection.
b compares the effectiveness of Vc1.1 and Vc1.1ptm given intramuscularly (im) in accelerating functional recovery of injured nerves, as assessed by their ability to mount an inflammatory vascular response.
b shows that Vc1.1ptm is less effective than Vc1.1 at inhibiting sensory nerve activity up to 24 hours after the 30 minutes superfusion with the peptide or saline. The concentration was 0.36 μg/200 μl for Vc1.1 and 0.37 μg/200 μl for Vc1.1ptm.
a illustrates the inhibition of the neuronal nicotinic response in cultured BCCs by An1.1, which was not nearly as inhibitory as Vc1.1 (compare with
b shows that An1.1 is also a competitive inhibitor of the functional nicotinic receptor response in BCCs, and protects against nicotinic receptor desensitisation caused by high concentrations of nicotine.
a) illustrates the effect of the peptide α-conotoxin Vg1.1 on nicotine (1 μM)-evoked release of catecholamines (noradrenaline and adrenaline) from BCCs.
b) is a comparison of the effects of Vg1.1 and Vc1.1 (both at 1.0 μM) on stimulation-induced vascular response in the rat (also compare with
For the purposes of this specification, the term “peptide and peptide analogue” includes compounds made up of units which have an amino and carboxy terminus separated in a 1,2, 1,3, 1,4 or larger substitution pattern. This includes the 20 naturally-occurring or “common” α-amino acids, in either the L or D configuration, the biosynthetically-available or “uncommon” amino acids not usually found in proteins, such as 4-hydroxyproline, 5-hydroxylysine, citrulline and ornithine; synthetically-derived α-amino acids, such as α-methylalanine, norleucine, norvaline, Cα- and N-alkylated amino acids, homocysteine, and homoserine; and many others as known in the art.
This term also includes compounds that have an amine and carboxyl functional group separated in a 1,3 or larger substitution pattern, such as β-alanine, γ-amino butyric acid, Freidinger lactam (Freidinger et al, 1982), the bicyclic dipeptide (BTD) (Freidinger et al, 1982; Nagai and Sato, 1985), amino-methyl benzoic acid (Smythe and von Itzstein, 1994), and others well known in the art. Statine-like isosteres, hydroxyethylene isosteres, reduced amide bond isosteres, thioamide isosteres, urea isosteres, carbamate isosteres, thioether isosteres, vinyl isosteres and other amide bond isosteres known to the art are also useful for the purposes of the invention.
A “common” amino acid is an L-amino acid selected from the group consisting of glycine, leucine, isoleucine, valine, alanine, phenylalanine, tyrosine, tryptophan, aspartate, asparagine, glutamate, glutamine, cysteine, methionine, arginine, lysine, proline, serine, threonine and histidine. These are referred to herein by their conventional three-letter or one-letter abbreviations.
An “uncommon” amino acid includes, but is not restricted to, one selected from the group consisting of D-amino acids, homo-amino acids, N-alkyl amino acids, dehydroamino acids, aromatic amino acids (other than phenylalanine, tyrosine and tryptophan), ortho-, meta- or para-aminobenzoic acid, ornithine, citrulline, norleucine, γ-glutamic acid, aminobutyric acid (Abu), and α, α-disubstituted amino acids.
As stated above, the present invention includes peptides in which one or more of the amino acids has undergone side-chain modifications. Examples of side-chain modifications contemplated by the invention include modifications of amino groups such as reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; modification of amino groups with 2,4,6-trinitrobenzene sulphonic acid (TNBS); and acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride. The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivatisation, for example to a corresponding amide. Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulfide with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH. Any modification of a cysteine residue must not affect the ability of the peptide to form the necessary disulfide bonds. However, it is possible to replace the sulphydryl group of cysteine with the selenium equivalent, a selenohydryl group, so that the peptide forms a diselenium bond in place of one or more of the disulfide bonds.
Tryptophan residues may be modified, for example, by oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulfenyl halides. Tyrosine residues may be in a sulfated or phosphorylated form. A non-exhaustive list of amino acids having modified side chains and other modified or non-naturally occurring amino acids is set out in Table 1.
These types of modifications may be useful to stabilise the peptide following administration to a subject. Other modifications may be made to the peptide in order to stabilise it or to enhance its other properties, for example membrane penetration or solubility. Such modifications include modifying the side chain of one or more amino acids to attach other types of group, for example one or more lipophilic groups. Such attachment may be made through a linking group designed to space the other group or groups away from the peptide so as not to interfere with the activity of the peptide. All such modified forms of the peptide are within the scope of the invention, provided that the modified peptide retains the ability to inhibit the activity of a nAChR, to prevent pain, and/or accelerate the rate of recovery from nerve injury. Those skilled in the art will readily be able to determine how to modify the peptides of the invention, and to identify those modified peptides which have the necessary activity.
For oral administration the active ingredients may require protection before administration. For example, the peptide may be formulated with an assimilable edible carrier, or the peptide may be enclosed in hard or soft shell gelatin capsule, or compressed into tablets, or incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations preferably contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. The tablets, troches, pills, capsules and the like may also contain the components as listed hereafter: A binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin maybe added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. In addition, the active compound(s) may be incorporated into sustained-release preparations and formulations.
The pharmaceutical forms suitable for injectable use include sterile injectable solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions. The solvent or dispersion medium for the injectable solution or dispersion may contain any of the conventional solvent or carrier systems for peptide actives, and may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about where necessary by the inclusion of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include agents to adjust osmolality, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be achieved by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Pharmaceutical forms suitable for injectable use may be delivered by any appropriate route including intravenous, intramuscular, intraperitoneal, subcutaneous, intracerebral, intrathecal, epidural injection or infusion.
The present invention also extends to any other forms suitable for administration, for example topical application such as creams, lotions and gels, or compositions suitable for inhalation or intranasal delivery, for example solutions or dry powders.
Parenteral dosage forms are preferred, including those suitable for intravenous, intrathecal, intracerebral, intramuscular, intraperitoneal, subcutaneous or epidural delivery. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. A unit dosage form can, for example, contain the principal active compound in amounts ranging from 0.25 μg to about 2000 mg. Expressed in proportions, the active compound is generally present from about 0.25 μg/ml to about 200 mg/ml of carrier. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
Peptide Vc1.1 was identified through the application of the following molecular biology techniques to Conus victoriae. A cDNA library was created from mRNA isolated from venom duct tissue. Oligonucleotide primers were used to amplify α-conotoxin precursors using the polymerase chain reaction. The PCR product was cloned into a suitable plasmid vector and individual clones sequenced. The amino acid sequence encoded by the cDNA was then elucidated. This is described in further detail in Example 1.
Peptide Vc1.1 inhibits the neuronal nAChR. This was determined using a bovine chromaffin cell neuronal nAChR assay system. Bovine chromaffin cells are known to express neuronal nAChRs (Campos-Caro et al, 1997). When stimulated with nicotine the catecholamines noradrenaline and adrenaline are released. Chromaffin cells were isolated from the bovine adrenal medulla (Livett et al 1987a) and stimulated with nicotine in the presence of the peptide Vc1.1. Catecholamines released by chromaffin cells were separated using reverse phase high performance liquid chromatography and quantitated using electrochemical detection (Livett et al 1987b). It was found that the peptide Vc1.1 inhibited catecholamine release evoked by nicotine. This is described in Example 2.
Peptide Vc1.1 also has analgesic activity. The chronic constriction injury model (CCI) of Bennett and Xie (1987) was used to test the ability of Vc1.1 to inhibit mechanically induced hyperalgesia in rats. Rats were anesthetized and the right sciatic nerve exposed and tied with four chromic gut ligatures. This procedure produces hyperalgesia in the rat's paw. Rats were then injected intramuscularly in the mid thigh region with either saline or saline containing Vc1.1 A Basile Analgesy-Meter (Ugo Basile, Comerio, Italy), which exerts a force that increases at a constant rate, was used to apply pressure to the rat's paw. The force applied before the rat withdrew its paw was measured. It was found that following intramuscular administration of Vc1.1, nerve induced mechanical hyperalgesia was significantly attenuated both in the short (1-24 hrs) and long term (day 1-21). The ability of Vc1.1 to reduce mechanically induced hyperalgesia was compared with ω-MVIIA, a conotoxin that has been reported to be 1000 times more potent than morphine (Bowersox et al, 1996). Vc1.1 was found to be approximately 3 times more effective than ω-MVIIA at relieving mechanically induced hyperalgesia. This is described in Example 3.
Peptide Vc1.1 is also effective in inhibiting sensory nerve function as determined by measuring the vascular response to nerve stimulation. Microvascular blood flow was measured in the skin using laser Doppler flowmetry from the base of blisters raised on the hind footpad of anaesthetized rats using a suction pressure of −40 kPa. Sensory nerve modulation of vascular function was assessed using antidromic electrical nerve stimulation performed on a sciatic nerve preparation and by perfusing sensory neuropeptides over the blister base. This is described in Example 4.
Peptide Vc 1.1 and its post-translationally modified form (SEQ ID NO. 7) were also effective in accelerating the rate of recovery from nerve injury. This is discussed in Example 5.
The invention will now be described in detail by way of reference only to the following non-limiting examples and drawings.
(a) mRNA Extraction and cDNA Synthesis
Specimens of the cone snail Conus victoriae were collected from Broome, Western Australia. The snails were part of the legal by-catch of a commercial fisherman, and approximately 20 snails were used. The venom ducts and bulbs of the cone snails were removed by dissection, before being snap-frozen in liquid nitrogen. Poly-A mRNA was extracted using a Dynabeads mRNA Direct Kit in accordance with the manufacturer's specifications. Double-stranded cDNA was prepared from the isolated mRNA utilising a Marathon™ cDNA amplification kit. First strand DNA was constructed utilising the Marathon cDNA synthesis primer and Moloney murine leukaemia virus reverse transcriptase. Second strand DNA synthesis was achieved using E. coli DNA polymerase, E. coli DNA ligase and E. coli RNase H. Blunt ended double stranded cDNA was prepared using T4 DNA polymerase.
(b) PCR Amplification of DNA Encoding Vc1.1
DNA encoding the Vc1.1 was amplified using oligonucleotide primers designed to anneal to the 5′ pre region
and the 3′ untranslated region
The PCR contained 5 U of Taq polymerase (Hoffmann-La Roche); 5 μl of 10× reaction buffer (100 mM Tris-HCl, 15 mM MgCl2, 500 mM KCl, pH 8.3); 400 μg of primers; 2 μl of 10 mM dNTPs; and an appropriate amount of cDNA in a total volume of 50 μl of milliQ water. The conditions for the PCR reaction were: 94° C. for 2 min; followed by 30 cycles of 94° C. for 30 sec, an annealing step of 55° C. for 30 sec, 72° C. for 45 sec; concluding with a final step of 72° C. for 5 mins.
(c) Cloning of Vc1.1 DNA
50 ng PCR product was ligated into the pCR2.1 vector (Original TA Cloning® Kit) at a molar ratio of 2:1. The reaction mixture was incubated overnight at 14° C. in a final volume of 10 μl of 6 mM Tris-HCl, pH7.5, 6 mM MgCl2, 5 mM NaCl, 0.1 mg.ml−1 BSA, 7 mM β-mercaptoethanol, 0.1 mM ATP, 2 mM dithiothreitol, 1 mM spermidine with 4 U of T4 DNA ligase. The pCR2.1 plasmid was transformed into competent INVαF′E. coli cells in accordance with the manufacturer's specifications (Original TA Cloning® Kit). Cells were then spread onto LB plates containing ampicillin and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). Recombinant colonies were selected, incubated overnight at 37° C. in LB broth, and screened using a UltraClean™ Mini Plasmid Prep Kit in accordance with the manufacturer's protocols.
(d) Sequencing of DNA Fragments Encoding Vc1.1
Clones containing inserts of interest were identified by agarose gel electrophoresis and sequenced by the dideoxy chain termination method using an ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit. A GeneAmp PCR System 2400 (Perkin Elmer) was used for thermal cycling. Each sequencing reaction underwent 25 cycles of: 96° C. for 10 sec, 50° C. for 5 sec, 60° C. for 4 min. Sequences were analysed on a Perkin Elmer 377 sequencer.
The nucleotide sequence of the clone encoding Vc1.1 (SEQ ID NO: 3) and deduced amino acid sequence for the Vc1.1 precursor protein (up to the stop codon) (SEQ ID NO: 4) are shown in
(a) The coding sequence is the first 201 base pairs up to and including a stop codon of SEQ ID NO:3.
(b) The coding sequence translates to 66 amino acid residues:
H P E I C G;
the mature toxin region is underlined.
(c) the synthesised 16 amino acid residue peptide Vc1.1 (SEQ ID NO: 2) derives from the 17 amino acid residues preceding the STOP codon, with the C-terminal glycine residue usually being removed and replaced by amidation of the resulting C-terminal cysteine, consistent with the C-terminus of known α-conotoxins which are active as neuronal nAChR antagonists.
(d) The synthesized peptide has four cysteine residues in a CC—(X)4—C—(X)7—C framework.
Adrenal chromaffin cells were isolated from adult bovine adrenal glands as described by Livett et al., (1987a). Isolated cells were plated out on collagen coated 24-well plates at a density of 2.8×105 cells/cm2.
Three- to four-day old cultured chromaffin cells were allowed to equilibrate to room temperature for 5 mins. The incubation media was removed by two consecutive washes in Locke's buffer (154 mM NaCl, 2.6 mM KCl, 2.15 mM K2HPO4, 0.85 mM KH2PO4, 10 mM D-glucose, 1.18 mM MgSO4.7H2O, 2.2 mM CaCl2.2H2O, 0.5% bovine serum albumin, pH 7.4) for five mins. Cells were then incubated with various concentrations (0.01 μM, 0.1 μM, 1 μM, 10 μM) of the peptide Vc1.1 for five mins, before stimulation with either 4 μM nicotine or 56 mM KCl for a further five mins. The incubation mixture was separated from the cells and acidified with 2M perchloric acid (PCA) to give a final concentration of 0.4M PCA. The catecholamines remaining in the chromaffin cells were released by lysing the cells with 0.01M PCA, and then acidified by addition of an equal volume of 0.8M PCA. Precipitated proteins were removed by centrifugation at 10,000 rpm for 10 mins. To measure the basal release of catecholamines, a control containing neither nicotine, KCl or Vc1.1 was used. To determine the maximal release of catecholamines, a second control was stimulated with 4 μM nicotine or 56 mM KCl in the absence of Vc1.1.
Catecholamines present in each sample were separated by reverse phase high performance liquid chromatography (RP-HPLC) utilizing a C18 column (Bio-Rad; 150 mm×4.6 mm, 5 μm particle size) and isocratic elution with 10% methanol in the mobile phase (70 mM KH2PO4, 0.1 mM NaEDTA, 0.2% heptane sulphonic acid). Catecholamines eluting from the column were identified by their retention time, and quantified by electrochemical detection (650 mV BAS model LC-3A). Known adrenaline and noradrenaline standards were used to calculate the amount of catecholamines in each sample, and these were expressed as a percentage of the total cell content. The results are shown in
Consistent with its membership in an A-lineage superfamily, this novel α-conotoxin was a potent inhibitor of the nicotinic response in an in vitro cell-based functional assay for the neuronal-type nicotinic receptor, but did not inhibit the response due to 56 mM K+, indicating that voltage-activated ion channels such as the N-type voltage-gated Ca++ ion channels which are the target for the ω-conotoxins such as ziconotide are unlikely to be involved.
Thus it was found that Vc1.1 inhibited catecholamine release evoked by nicotine. At a concentration of 10 μM Vc1.1 inhibited noradrenaline release by 86% and adrenaline release by 97%. The IC50 of Vc1.1 was calculated to be 1-3 μM. Vc1.1 did not have an inhibitory action when catecholamine release was evoked with KCl, as shown in
Bovine adrenal glands obtained from the local abattoir were dissected and the medulla removed and placed into ice-cold 10% w/v 0.32M sucrose buffer, supplemented with 1 mM EDTA, 0.1 mM PMSF and 0.01% sodium azide. The medulla was homogenised using a Polytron homogeniser, and the homogenate centrifuged at 100 g for 10 minutes at 4° C. The resultant supernatant was decanted (S1) and the pellet resuspended in ice-cold sucrose buffer (5 ml/g of original medulla weight). This resuspended pellet was centrifuged at 100 g for 10 minutes at 4° C. and the supernatants S1 and S2 were combined and centrifuged at 12000 g for 30 minutes at 4° C. The resultant pellet was resuspended in 50 μM phosphate buffer (40 mM K2HPO4, 10 mM KH2PO4) containing 0.01% sodium azide, 0.1 mM PMSF and 1 mM bovine serum albumin and centrifuged at 12000 g for 30 minutes at 4° C. This step was repeated and the washed pellet resuspended in 50 mM phosphate buffer and stored at −70° C. A Bradford assay was performed to determine protein concentration, using bovine serum albumin as standard.
This study used 3H-epibatidine (3H-epi) and other ligands in binding studies for pharmacological characterisation of the nAChRs expressed on bovine adrenal medullary membranes. Epibatidine has a high affinity for neuronal nAChRs, particularly those containing α3, but a low affinity for α7 nAChRs (Gerzanich et al 1995). The stored adrenal medulla membranes were thawed and incubated (300-500 μg protein/tube) at 37° C., for 2 hours in the presence of 1 nM 3H-epibatidine and the test ligand (concentration range 1 nM-1 mM). 3H-epibatidine was the radioligand, of choice as it has broad nAChR subtype affinity. After the incubation period each assay tube was filtered and washed with phosphate buffered saline (150 mM NaCl, 8 mM K2HPO4, 2 mM KH2PO4) in a Brandell filtration system. Glass fibre filters used in the filtration step had previously been soaked overnight in phosphate-buffered saline containing 5% polyethylene imine (PEI). The bound radioactivity remaining on the membranes was quantitated by liquid scintillation. Non-specific binding was that remaining on the membranes after displacement with 2 mM nicotine. Total binding was obtained by substituting the displacing test ligand with milliQ water. Specific binding was determined by subtracting the non-specific from the total binding. Saturation binding experiments (n=3) determined a Kd value using non-linear regression analysis (Prism, GraphPad, San Diego, Calif.). From the displacement experiments Hill coefficients and Ki values were determined using non-linear regression analysis. Ki values were determined using the Cheng-Prusoff rule whereby: Ki=IC50/(1+[3H-epibatidine])/Kd of 3H-epibatidine.
Our results show that 3H-epibatidine binding to bovine adrenal medullary membranes fits a single affinity model with a Hill coefficient of 1.08. Vc1.1 and Vc1.1ptm were examined for their ability to displace 3H-epibatidine. The plasma membranes are known to contain neuronal α-nAChRs.
As shown in
In other studies we have found that cytosine, 1,1-dimethyl-4-phenylpiperazinium iodide (DMPP), carbachol, and nicotine, but not the α7 selective ligands, α-conotoxin ImI (purchased commercially from SIGMA or AUSpep) and α-bungarotoxin, displaced 3H-epibatidine binding. Taken together, these studies indicate that Vc01 probably binds to receptors of the α3α4 or α3α5α4 subtypes, whereas the receptor population not labelled by 3H-epi most probably contains the α7 subtype, perhaps in combination with other subunits.
(a) Chronic Constriction Injury Model
A unilateral peripheral neuropathy was produced by the Chronic Constriction Injury (CCI) method of Bennett and Xie (1987). Rats (n=4-8 per group) were anaesthetized with sodium pentobarbital (60 mg/kg). The right sciatic nerve was exposed at the level of the middle of the thigh by blunt dissection through the biceps femoris muscle. Proximal to the sciatic trifurcation, about 7 mm of nerve was freed of adhering tissue and 4 ligatures (4.0 chromic gut) were tied loosely around it with about 1 mm spacing. The skin incision was closed using surgical clips. Groups of control rats received sham procedures, in which the right sciatic nerves were isolated but not ligated.
(b) Measurement of Mechanical Pain Threshold
A synthetic form of ω-conotoxin MVIIA (SNX-111; Bowersox et al., 1996) was purchased from Auspep Pty Ltd, Animals were allowed to recover for one week before being injected intramuscularly at the mid thigh region with saline, or with either Vc1.1 or the synthetic ω-conotoxin MVIIA dissolved in 0.2 ml saline. Mechanical pain thresholds were determined with a slightly modified version of the Randall-Selitto method (Randall and Selitto, 1957), using the Basile Analgesy-Meter (Ugo Basile, Comerio, Italy). This instrument exerts a force on the rat's paw, which increases at a constant rate (a certain number of grams per second). The animal was restrained gently between cupped hands, and calibrated pressure increased until the rat withdrew its hind paw. Mechanical pain thresholds were measured before drug injection, 1,3 and 24 hours post-injection, and then daily over 7 days. After 7 days of drug treatment, intramuscular injections ceased, and the pain threshold was measured twice a week.
(c) Effect of Vc1.1 on Mechanically-induced Hyperalgesia
Vc1.1 attenuated mechanically-induced hyperalgesia by 89%, 64%, and 116% after 1 hour, 3 hours and 24 hours, respectively, compared to saline-treated controls. These results are summarized in
This study compared the effects of three synthetic conotoxins, ω-conotoxin MVIIA, ω-conotoxin GVIA and α-conotoxin Vc1.1, on the vascular response mediated via activation of unmyelinated primary afferent sensory nerves (antidromic stimulation) using low frequency electrical stimulation (LFES) at 20V, 2 ms for 1 min at 5 Hz. The conotoxin peptides were perfused over the base of a blister raised on the footpad of an anaesthetized rat using a suction pressure of −40 kPa. The footpad is innervated by peripheral terminals of the sciatic nerve, and these are accessible to the perfused compounds. Changes in the microvascular blood flow were measured in the skin using laser Doppler flowmetry from the base of the blister (Merhi, Dusting and Khalil, 1998). The three conopeptides were perfused for 30 min prior to electrical stimulation of the sciatic nerve, throughout the 1 min electrical stimulation period and for 20 min following the stimulation. The results illustrated in
We propose, based on the above results, that the most likely mechanism of action of Vc1.1 is one which involves blocking the neuronal type nicotinic acetylcholine receptors on sensory nerves. This is not to exclude other mechanisms (for example possible blocking of N-type Ca++ channels), and indeed appears likely since a functional association of specific presynaptic nAChRs and voltage-gated calcium channels has been demonstrated (Kulak et al, 2001).
Previous studies in our laboratory (Khalil et al 1999) showed that recovery from chronic constriction nerve injury can be determined by a reduction in hyperalgesia and a return to normal of the peripheral vascular response in an area innervated by the injured nerve. The vascular response can be examined by the perfusion of a vasodilator (substance P, which acts via a preterminal mechanism) over a base of a blister raised over an area innervated by the injured nerve.
Peptide Vg1.1 was isolated from the venom ducts of Conus Virgo (collected at Lizard Island, North Queensland) by the same molecular approach as described for the isolation of Vc1.1 from Conus victoriae (see Example 1 above). Clones were selected, and the nucleotide sequence of the clone encoding Vg1.1 was amplified using RTPCR/RACE technology. The amino acid sequence for Vg1.1 was deduced and synthesized commercially (AusPep, Melbourne) by solid-phase peptide synthesis, and the disulfide bonds allowed to form by air oxidation. The deduced peptide Vg1.1 has the structure:
in which the C-terminus cysteine is amidated.
The synthesized peptide was tested as described for Vc1.1 for its ability to
Peptide An1.1 was isolated as described above for Vg1.1, except that the source of the peptide was the venom ducts of Conus anemone collected from Edithburgh, St Vincent's Gulf, South Australia). The deduced structure of peptide An1.1 is:
In which the C-terminus cysteine is amidated.
The deduced sequence was chemically synthesised commercially (AusPep, Melbourne) and air oxidized. The synthetic peptide was tested in vitro and in vivo as described for Vc1.1. The results are shown in
The sequences of Vc1.1, Vc1.1ptm, An1.1 and Vg1.1 can be aligned as follows, to illustrate the high degree of homology:
In a preliminary experiment to determine whether the novel α-conotoxins had any adverse systemic side-effects, the effect of Vc1.1 (1 μM in 200 μl im) on resting systolic blood pressure in the rat was measured.
The association of nicotinic receptor function with pain is relatively new. Earlier work had established that strong nicotinic agonists were analgesics, but the case is not so obvious or well established for nicotinic antagonists. Mice lacking a particular nicotinic receptor subunit in the brain, have reduced pain responses (Marubio et al 1999).
There is now good evidence that nAChRs are also expressed on the somata of cultured sensory dorsal root ganglion (DRG) neurons (Genzen et al 2001), and it is possible that nAChRs are also expressed on the terminals of DRG afferents. The spinal cord contains a subpopulation of inhibitory cholinergic interneurons which make presynaptic contact on to the terminals of primary afferents in the dorsal horn (reviewed by Genzen et al 2001). Acetylcholine in the spinal cord might therefore activate nAChRs expressed on the central terminals of DRG afferents. The sources of acetylcholine which could activate nAChRs on peripheral nerve terminals have not been identified, although there is evidence that many non-neuronal cells either contain or can manufacture acetylcholine (Wessler et al 1999). In addition, Changeux and colleagues have recently shown that up to 40% of neuronal nAChRs are constitutively active, and do not require ACh for activation (Changeux and Edelstein 2001).
Nicotinic antagonists are effective in dampening down the constitutive level of activity. This population of constitutively active receptors may be differentially expressed in higher numbers in a neuroma following peripheral nerve damage. In addition, nicotinic receptor desensitization, which is responsible for the analgesic effects of strong nicotinic agonists such as epibatidine and ABT-594, occurs at much lower agonist concentrations than those needed for nicotinic receptor activation (see Genzen et al 2001), and may play an important role in modulating sensory activity. Others have reported irrative and autonomic responses or hyperalgesia when such agonists are administered at subanalgesic doses (Masner, 1972; Khan et al 1994).
While peripheral applications of nicotinic agonists can cause the excitatory effects described above, behavioural experiments have demonstrated that nicotinic agonists can also have analgesic properties. Interestingly, epibatidine bears a resemblance to nicotine. Taking note of the similar structure of epibatidine, but aware that it was too toxic for human use, Daly and his colleagues in association with Abbott Laboratories began to create nicotine-like chemicals hoping that one may be effective as a painkiller (for review see Plotkin, 2000). Of the hundreds of molecules devised and tested, one stood out: ABT-594. Not only did it lack the toxicity of epibatidine, but proved effective against several types of pain, including pain caused by nerve damage against which even opiates are relatively ineffective. Unlike opiates, ABT-594 appears to be non-addictive, enhances alertness rather than causing sedation and has relatively little effect upon the respiratory system. It lacks the major side effects of morphine, such as constipation and addiction, but has yet to receive regulatory approval.
ABT-594, like epibatidine, is an nicotinic agonist with analgesic potency greater than morphine, and can produce analgesia when administered systemically, intradermally or centrally in the nucleus raphe magnus, a site involved in descending modulatory system of analgesia.
Whereas the excitatory effects of nicotinic agonists are primarily due to nAChR activation with subsequent neuronal depolarization leading to Na+ or Ca2+ channel activation, we propose that the inhibitory effects of strong nicotinic agonists like epibatidine and derivatives such as ABT-594, may be due to receptor desensitization and Na+ or Ca2+ channel closure. This has not been suggested previously, and indicated that nicotinic antagonists, such as the α-conotoxins are useful as analgesics for clinical use against pain.
It will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.
References cited herein are listed on the following pages, and are incorporated herein by this reference.
| Number | Date | Country | Kind |
|---|---|---|---|
| PR4094 | Mar 2001 | AU | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/AU02/00411 | 3/28/2002 | WO | 00 | 8/26/2004 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO02/079236 | 10/10/2002 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5514774 | Olivera et al. | May 1996 | A |
| 5589340 | Olivera et al. | Dec 1996 | A |
| 5633347 | Olivera et al. | May 1997 | A |
| 6797808 | Watkins et al. | Sep 2004 | B1 |
| 20030109670 | Olivera et al. | Jun 2003 | A1 |
| Number | Date | Country |
|---|---|---|
| WO 9501436 | Jan 1995 | WO |
| WO 9851322 | Nov 1998 | WO |
| WO 9933482 | Jul 1999 | WO |
| WO 0043409 | Jul 2000 | WO |
| WO 0043409 | Jul 2000 | WO |
| WO 0044776 | Aug 2000 | WO |
| WO 0207750 | Jan 2002 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 20050215480 A1 | Sep 2005 | US |
