Acylated insulin

Information

  • Patent Grant
  • 6011007
  • Patent Number
    6,011,007
  • Date Filed
    Thursday, November 20, 1997
    28 years ago
  • Date Issued
    Tuesday, January 4, 2000
    26 years ago
Abstract
The present invention relates to protracted human insulin derivatives in which the A21 and the B3 amino acid residues are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the B30 amino acid residue is (a) a non-codable, lipophilic amino acid having from 10 to 24 carbon atoms, in which case an acyl group of a carboxylic acid with up to 5 carbon atoms is bound to the .epsilon.-amino group of Lys.sup.B29 ; or (b) the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys, in any of which cases the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent; and any Zn.sup.2+ complexes thereof with the proviso that when B30 is Thr or Ala and A21 and B3 are both Asn, and Phe.sup.B1 is present, then the insulin derivative is always present as a Zn.sup.2+ complex.
Description

FIELD OF THE INVENTION
The present invention relates to novel human insulin derivatives which are soluble and have a protracted profile of action, to a method of providing such derivatives, to pharmaceutical compositions containing them, and to the use of such insulin derivatives in the treatment of diabetes.
BACKGROUND OF THE INVENTION
Many diabetic patients are treated with multiple daily insulin injections in a regimen comprising one or two daily injections of a protracted insulin to cover the basal requirement supplemented by bolus injections of a rapid acting insulin to cover the requirement related to meals.
Protracted insulin compositions are well known in the art. Thus, one main type of protracted insulin compositions comprises injectable aqueous suspensions of insulin crystals or amorphous insulin. In these compositions, the insulin compounds utilized typically are protamine insulin, zinc insulin or protamine zinc insulin.
Certain drawbacks are associated with the use of insulin suspensions. Thus, in order to secure an accurate dosing, the insulin particles must be suspended homogeneously by gentle shaking before a defined volume of the suspension is withdrawn from a vial or expelled from a cartridge. Also, for the storage of insulin suspensions, the temperature must be kept within more narrow limits than for insulin solutions in order to avoid lump formation or coagulation.
While it was earlier believed that protamines were non-immunogenic, it has now turned out that protamines can be immunogenic in man and that their use for medical purposes may lead to formation of antibodies (Samuel et al., Studies on the immunogenecity of protamines in humans and experimental animals by means of a micro-complement fixation test, Clin. Exp. Immunol. 33, pp. 252-260 (1978)).
Also, evidence has been found that the protamine-insulin complex is itself immunogenic (Kurtz et al., Circulating IgG antibody to protamine in patients treated with protamine-insulins. Diabetologica 25, pp. 322-324 (1983)). Therefore, with some patients the use of protracted insulin compositions containing protamines must be avoided.
Another type of protracted insulin compositions are solutions having a pH value below physiological pH from which the insulin will precipitate because of the rise in the pH value when the solution is injected. A drawback with these solutions is that the particle size distribution of the precipitate formed in the tissue on injection, and thus the timing of the medication, depends on the blood flow at the injection site and other parameters in a somewhat unpredictable manner. A further drawback is that the solid particles of the insulin may act as a local irritant causing inflammation of the tissue at the site of injection.
WO 91/12817 (Novo Nordisk A/S) discloses protracted, soluble insulin compositions comprising insulin complexes of cobalt(III). The protraction of these complexes is only intermediate and the bioavailability is reduced.
Human insulin has three primary amino groups: the N-terminal group of the A-chain and of the B-chain and the .epsilon.-amino group of Lys.sup.B29. Several insulin derivatives which are substituted in one or more of these groups are known in the prior art. Thus, U.S. Pat. No. 3,528,960 (Eli Lilly) relates to N-carboxyaroyl insulins in which one, two or three primary amino groups of the insulin molecule has a carboxyaroyl group. No specifically N.sup..epsilon.B29 -substituted insulins are disclosed.
According to GB Patent No. 1.492.997 (Nat. Res. Dev. Corp.), it has been found that insulin with a carbamyl substitution at N.sup..epsilon.B29 has an improved profile of hypoglycaemic effect.
JP laid-open patent application No. 1-254699 (Kodama Co., Ltd.) discloses insulin wherein a fatty acid is bound to the amino group of Phe.sup.B1 or to the .epsilon.-amino group of Lys.sup.B29 or to both of these. The stated purpose of the derivatisation is to obtain a pharmacologically acceptable, stable insulin preparation.
Insulins, which in the B30 position have an amino acid having at least five carbon atoms which cannot necessarily be coded for by a triplet of nucleotides, are described in JP laid-open patent application No. 57-067548 (Shionogi). The insulin analogues are claimed to be useful in the treatment of diabetes mellitus, particularly in patients who are insulin resistant due to generation of bovine or swine insulin antibodies.
By "insulin derivative" as used herein is meant a compound having a molecular structure similar to that of human insulin including the disulfide bridges between Cys.sup.A7 and Cys.sup.B7 and between Cys.sup.A20 and Cys.sup.B19 and an internal disulfide bridge between Cys.sup.A6 and Cys.sup.A11, and which have insulin activity.
However, there still is a need for protracted injectable insulin compositions which are solutions and contain insulins which stay in solution after injection and possess minimal inflammatory and immunogenic properties.
One object of the present invention is to provide human insulin derivatives, with a protracted profile of action, which are soluble at physiological pH values.
Another object of the present invention is to provide a pharmaceutical composition comprising the human insulin derivatives according to the invention.
It is a further object of the invention to provide a method of making the human insulin derivatives of the invention.
SUMMARY OF THE INVENTION
Surprisingly, it has turned out that certain human insulin derivatives, wherein the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent, have a protracted profile of action and are soluble at physiological pH values.
Accordingly, in its broadest aspect, the present invention relates to an insulin derivative having the following sequence: ##STR1## wherein Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;
Xaa at position B1 is Phe or is deleted;
Xaa at position B30 is (a) a non-codable, lipophilic amino acid having from 10 to 24 carbon atoms, in which case an acyl group of a carboxylic acid with up to 5 carbon atoms is bound to the .epsilon.-amino group of Lys.sup.B29, (b) any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys, in which case the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent or (c) deleted, in which case the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent; and any Zn.sup.2+ complexes thereof, provided that when Xaa at position B30 is Thr or Ala, Xaa at positions A21 and B3 are both Asn, and Xaa at position B1 is Phe, then the insulin derivative is a Zn.sup.2+ complex.
In one preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms; and 2-4 Zn.sup.2+ ions may be bound to each insulin hexamer with the proviso that when B30 is Thr or Ala and A21 and B3 are both Asn, and Phe.sup.B1 is not deleted, then 2-4 Zn.sup.2+ ions are bound to each hexamer of the insulin derivative.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys, with the proviso that if the B30 amino acid residue is Ala or Thr, then at least one of the residues A21 and B3 is different from Asn; Phe.sup.B1 may be deleted; and the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms; and 2-4 Zn.sup.2+ ions are bound to each insulin hexamer.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Asp.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Glu.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Thr.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a lipophilic amino acid having at least 10 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a lipophilic .alpha.-amino acid having from 10 to 24 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a straight chain, saturated, aliphatic .alpha.-amino acid having from 10 to 24 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is D- or L-N.sup..epsilon. -dodecanoyllysine.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino decanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino undecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino dodecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino tridecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino tetradecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino pentadecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino hexadecanoic acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is an .alpha.-amino acid.
In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Ala.
In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Gln.
In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Gly.
In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Ser.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Asp.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Gln.
In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Thr.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a carboxylic acid having at least 6 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group, branched or unbranched, which corresponds to a carboxylic acid having a chain of carbon atoms 8 to 24 atoms long.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a fatty acid having at least 6 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 6 to 24 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 8 to 12 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 10 to 16 carbon atoms.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an oligo oxyethylene group comprising up to 10, preferably up to 5, oxyethylene units.
In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an oligo oxypropylene group comprising up to 10, preferably up to 5, oxypropylene units.
In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 2 Zn.sup.2+ ions.
In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 3 Zn.sup.2+ ions.
In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 4 Zn.sup.2+ ions.
In another preferred embodiment, the invention relates to the use of a human insulin derivative according to the invention for the preparation of a medicament for treating diabetes.
In another preferred embodiment, the invention relates to a pharmaceutical composition for the treatment of diabetes in a patient in need of such a treatment comprising a therapeutically effective amount of a human insulin derivative according to the invention together with a pharmaceutically acceptable carrier.
In another preferred embodiment, the invention relates to a pharmaceutical composition for the treatment of diabetes in a patient in need of such a treatment comprising a therapeutically effective amount of a human insulin derivative according to the invention, in mixture with an insulin or an insulin analogue which has a rapid onset of action, together with a pharmaceutically acceptable carrier.
In another preferred embodiment, the invention relates to a pharmaceutical composition comprising a human insulin derivative according to the invention which is soluble at physiological pH values.
In another preferred embodiment, the invention relates to a pharmaceutical composition comprising a human insulin derivative according to the invention which is soluble at pH values in the interval from about 6.5 to about 8.5.
In another preferred embodiment, the invention relates to a protracted pharmaceutical composition comprising a human insulin derivative according to the invention.
In another preferred embodiment, the invention relates to a pharmaceutical composition which is a solution containing from about 120 nmol/ml to about 1200 nmol/ml, preferably about 600 nmol/ml of a human insulin derivative according to the invention.
In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention together with a pharmaceutically acceptable carrier.
In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention, in mixture with an insulin or an insulin analogue which has a rapid onset of action, together with a pharmaceutically acceptable carrier.
Examples of preferred human insulin derivatives according to the present invention in which no Zn.sup.2+ ions are bound are the following:
N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin,
N.sup..epsilon.B29 -tridecanoyl Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin,
N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin and
N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin.
Examples of preferred human insulin derivatives according to the present invention in which two Zn.sup.2+ ions are bound per insulin hexamer are the following:
(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 2Zn.sup.+,
(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+ and
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+.
Examples of preferred human insulin derivatives according to the present invention in which three Zn.sup.2+ ions are bound per insulin hexamer are the following:
(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+ and
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+.
Examples of preferred human insulin derivatives according to the present invention in which four Zn.sup.2+ ions are bound per insulin hexamer are the following:
(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 GlnB.sup.3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+ and
(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+.





BRIEF DESCRIPTION OF THE DRAWINGS
The present invention is further illustrated with reference to the appended drawings wherein
FIG. 1 shows the construction of the plasmid pEA5.3.2;
FIG. 2 shows the construction of the plasmid pEA108; and
FIG. 3 shows the construction of the plasmid pEA113.





DETAILED DESCRIPTION OF THE INVENTION
Terminology
The three letter codes and one letter codes for the amino acid residues used herein are those stated in J. Biol. Chem. 243, p. 3558 (1968).
In the DNA sequences, A is adenine, C is cytosine, G is guanine, and T is thymine.
The following acronyms are used: DMSO for dimethyl sulphoxide, DMF for dimethylformamide, Boc for tert-butoxycarbonyl, RP-HPLC for reversed phase high performance liquid chromatography, X-OSu is an N-hydroxysuccinimid ester, X is an acyl group, and TFA for trifluoroacetic acid.
Preparation of Lipophilic Insulin Derivatives
The insulin derivatives according to the present invention can be prepared i.a. as described in the following:
1. Insulin Derivatives Featuring in Position B30 an Amino Acid Residue Which can be Coded for by the Genetic Code e.g. Threonine (Human Insulin) or Alanine (Porcine Insulin)
1.1 Starting from Human Insulin
Human insulin is treated with a Boc-reagent (e.g. di-tert-butyl dicarbonate) to form (A1,B1)-diBoc human insulin, i.e., human insulin in which the N-terminal end of both chains are protected by a Boc-group. After an optional purification, e.g. by HPLC, an acyl group is introduced in the .epsilon.-amino group of Lys.sup.B29 by allowing the product to react with a N-hydroxysuccinimide ester of the formula X-OSu wherein X is the acyl group to be introduced. In the final step, TFA is used to remove the Boc-groups and the product, NE.sup.68 B29 -X human insulin, is isolated.
1.2 Starting from a Single Chain Insulin Precursor
A single chain insulin precursor, extended in position B1 with an extension (Ext) which is connected to B1 via an arginine residue and in which the bridge from B30 to A1 is an arginine residue, i.e. a compound of the general formula Ext-Arg-B(1-30)-Arg-A(1-21), can be used as starting material. Acylation of this starting material with a N-hydroxysuccinimide ester of the general formula X-OSu wherein X is an acyl group, introduces the acyl group X in the .epsilon.-amino group of Lys.sup.B29 and in the N-terminal amino group of the precursor. On treating this acylated precursor of the formula (N.sup..epsilon.B29 -X),X-Ext-Arg-B(1-30)-Arg-A(1-21) with trypsin in a mixture of water and a suitable water-miscible organic solvent, e.g. DMF, DMSO or a lower alcohol, an intermediate of the formula (N.sup..epsilon.B29 -X),Arg.sup.B31 insulin is obtained. Treating this intermediate with carboxypeptidase B yields the desired product, (N.sup..epsilon.B29 -X) insulin.
2. Insulin Derivatives with no Amino Acid Residue in Position B30, i.e. des(B30) Insulins
2.1 Starting from Human Insulin or Porcine Insulin
On treatment with carboxypeptidase A in ammonium buffer, human insulin and porcine insulin both yield des(B30) insulin. After an optional purification, the des(B30) insulin is treated with a Boc-reagent (e.g. di-tert-butyl dicarbonate) to form (A1,B1)-diBoc des(B30) insulin, i.e., des(B30) insulin in which the N-terminal end of both chains are protected by a Boc-group. After an optional purification, e.g. by HPLC, an acyl group is introduced in the .epsilon.-amino group of Lys.sup.B29 by allowing the product to react with a N-hydroxysuccinimide ester of the formula X-OSu wherein X is the acyl group to be introduced. In the final step, TFA is used to remove the Boc-groups and the product, (N.sup..epsilon.B29 -X) des(B30) insulin, is isolated.
2.2 Starting from a Single Chain Human Insulin Precursor
A single chain human insulin precursor, which is extended in position B1 with an extension (Ext) which is connected to B1 via an arginine residue and which has a bridge from B30 to A1 can be a useful starting material. Preferably, the bridge is a peptide of the formula Y.sub.n -Arg, where Y is a codable amino acid except lysine and arginine, and n is zero or an integer between 1 and 35. When n>1, the Y's may designate different amino acids. Preferred examples of the bridge from B30 to A1 are: AlaAlaArg, SerArg, SerAspAspAlaArg and Arg (European Patent No. 163529). Treatment of such a precursor of the general formula Ext-Arg-B(1-30)-Y.sub.n -Arg-A(1-21) with a lysyl endopeptidase, e.g. Achromobacter lyticus protease, yields Ext-Arg-B(1-29) Thr-Y.sub.n -Arg-A(1-21) des(B30) insulin. Acylation of this intermediate with a N-hydroxysuccinimide ester of the general formula X-OSu wherein X is an acyl group, introduces the acyl group X in the .epsilon.-amino group of Lys.sup.B29, and in the N-terminal amino group of the A-chain and the B-chain to give (N.sup..epsilon.B29 -X) X-Ext-Arg-B(1-29) X-Thr-Y.sub.n -Arg-A(1-21) des(B30) insulin. This intermediate on treatment with trypsin in mixture of water and a suitable organic solvent, e.g. DMF, DMSO or a lower alcohol, gives the desired derivative, (N.sup..epsilon.B29 -X) des(B30) human insulin.
Data on N.sup..epsilon.B29 Modified Insulins
Certain experimental data on N.sup..epsilon.B29 modified insulins are given in Table 1.
The lipophilicity of an insulin derivative relative to human insulin, k'.sub.rel, was measured on a LiChrosorb RP18 (5 .mu.m, 250.times.4 mm) HPLC column by isocratic elution at 40.degree. C. using mixtures of A) 0.1 M sodium phosphate buffer, pH 7.3, containing 10% acetonitrile, and B) 50% acetonitrile in water as eluents. The elution was monitored by following the UV absorption of the eluate at 214 nm. Void time, t.sub.0, was found by injecting 0.1 mM sodium nitrate. Retention time for human insulin, t.sub.human, was adjusted to at least 2t.sub.0 by varying the ratio between the A and B solutions. k'.sub.rel =(t.sub.derivative -t.sub.0)/(t.sub.human -t.sub.0).
The degree of prolongation of the blood glucose lowering effect was studied in rabbits. Each insulin derivative was tested by subcutaneous injection of 12 nmol thereof in each of six rabbits in the single day retardation test. Blood sampling for glucose analysis was performed before injection and at 1, 2, 4 and 6 hours after injection. The glucose values found are expressed as percent of initial values. The Index of Protraction, which was calculated from the blood glucose values, is the scaled Index of Protraction (prolongation), see p. 211 in Markussen et al., Protein Engineering 1 (1987) 205-213. The formula has been scaled to render a value of 100 with bovine ultralente insulin and a value of 0 with Actrapid.RTM. insulin (Novo Nordisk A/S, 2880 Bagsvaerd, Denmark).
The insulin derivatives listed in Table 1 were administered in solutions containing 3 Zn.sup.2+ per insulin hexamer, except those specifically indicated to be Zn-free.
For the very protracted analogues the rabbit model is inadequate because the decrease in blood glucose from initial is too small to estimate the index of protraction. The prolongation of such analogues is better characterized by the disappearance rate in pigs. T.sub.50% is the time when 50% of the A14 Tyr(.sup.125 I) analogue has disappeared from the site of injection as measured with an external .gamma.-counter (Ribel, U et al., The Pig as a Model for Subcutaneous Absorption in Man. In: M. serrano-Rios and P. J. Lefebre (Eds): Diabetes 1985; Proceedings of the 12th Congress of the International Diabetes Federation, Madrid, Spain, 1985 (Excerpta Medica, Amsterdam, (1986) 891-96).
In Table 2 are given the T.sub.50% values of a series of very protracted insulin analogues. The analogues were administered in solutions containing 3 Zn.sup.2+ per insulin hexamer.
TABLE 1__________________________________________________________________________ Relative Blood glucose, % of initial Index ofInsulin Derivative *) Lipophilicity 1 h 2 h 4 h 6 h protraction__________________________________________________________________________N.sup..epsilon.B29 -benzoyl insulin 1.14N.sup..epsilon.B29 -phenylacetyl insulin (Zn-free) 1.28 55.4 58.9 88.8 90.1 10N.sup..epsilon.B29 -cyclohexylacetyl insulin 1.90 53.1 49.6 66.9 81.1 28N.sup..epsilon.B29 -cyclohexylpropionyl insulin 3.29 55.5 47.6 61.5 73.0 39N.sup..epsilon.B29 -cyclohexylvaleroyl insulin 9.87 65.0 58.3 65.7 71.0 49N.sup..epsilon.B29 -octanoyl insulin 3.97 57.1 54.8 69.0 78.9 33N.sup..epsilon.B29 -decanoyl, des-(B30) insulin 11.0 74.3 65.0 60.9 64.1 65N.sup..epsilon.B29 -decanoyl insulin 12.3 73.3 59.4 64.9 68.0 60N.sup..epsilon.B29 -undecanoyl, des-(B30) insulin 19.7 88.1 80.0 72.1 72.1 80N.sup..epsilon.B29 -lauroyl, des-(B30) insulin 37.0 91.4 90.0 84.2 83.9 78N.sup..epsilon.B29 -myristoyl insulin 113 98.5 92.0 83.9 84.5 97N.sup..epsilon.B29 -choloyl insulin 7.64 58.2 53.2 69.0 88.5 20N.sup..epsilon.B29 -7-deoxycholoyl insulin (Zn-free) 24.4 76.5 65.2 77.4 87.4 35N.sup..epsilon.B29 -lithocholoyl insulin (Zn-free) 51.6 98.3 92.3 100.5 93.4 115N.sup..epsilon.B29 -4-benzoyl-phenylalanyl insulin 2.51 53.9 58.7 74.4 89.0 14N.sup..epsilon.B29 -3,5-diiodotyrosyl insulin 1.07 53.9 48.3 60.8 82.1 27N.sup..epsilon.B29 -L-thyroxyl insulin 8.00__________________________________________________________________________ *) 3 Zn.sup.2+ /insulin hexamer except where otherwise indicated.
TABLE 2______________________________________ SubcutaneousDerivative of Human Insulin Relative disappearance600 .mu.M, 3 Zn.sup.2+ /hexamer, hydrophobicity in pigsphenol 0.3%, glycerol 1.6%, pH 7.5 k'.sub.rel T.sub.50%, hours______________________________________N.sup..epsilon.B29 -decanoyl des(B30) insulin 11.0 5.6N.sup..epsilon.B29 -undecanoyl des(B30) insulin 19.7 6.9N.sup..epsilon.B29 -lauroyl des(B30) insulin 37 10.1N.sup..epsilon.B29 -tridecanoyl des(B30) insulin 65 12.9N.sup..epsilon.B29 -myristoyl des(B30) insulin 113 13.8N.sup..epsilon.B29 -palmitoyl des(B30) insulin 346 12.4N.sup..epsilon.B29 -2-succinyl-amido myristic acid 10.5 13.6insulinN.sup..epsilon.B29 -myristoyl insulin 113 11.9N.sup..epsilon.B29 -2-succinyl-amido palmitic acid 420 20.1insulinN.sup..epsilon.B29 -myristoyl-.alpha.-glutamyl des(B30) 23.7 8.8insulinN.sup..epsilon.B29 -myristoyl-.alpha.-glutamyl-glycyl 20.0 11.9des(B30) insulinN.sup..epsilon.B29 -lithocholoyl-.alpha.-glutamyl 12.5 14.3des(B30) insulinHuman NPH 10______________________________________
Solubility
The solubility of all the N.sup..epsilon.B29 modified insulins mentioned in Table 1, which contain 3 Zn.sup.2+ ions per insulin hexamer, exceeds 600 nmol/ml in a neutral (pH 7.5), aqueous, pharmaceutical formulation which further comprises 0.3% phenol as preservative, and 1.6% glycerol to achieve isotonicity. 600 nmol/ml is the concentration of human insulin found in the 100 IU/ml compositions usually employed in the clinic.
The .epsilon.-B29 amino group can be a component of an amide bond, a sulphonamide bond, a carbamide, a thiocarbamide, or a carbamate. The lipophilic substituent carried by the .epsilon.-B29 amino group can also be an alkyl group.
Pharmaceutical compositions containing a human insulin derivative according to the present invention may be administered parenterally to patients in need of such a treatment. Parenteral administration may be performed by subcutaneous, intramuscular or intravenous injection by means of a syringe, optionally a pen-like syringe. Alternatively, parenteral administration can be performed by means of an infusion pump. A further option is a composition which may be a powder or a liquid for the administration of the human insulin derivative in the form of a nasal spray.
The injectable human insulin compositions of the invention can be prepared using the conventional techniques of the pharmaceutical industry which involves dissolving and mixing the ingredients as appropriate to give the desired end product.
Thus, according to one procedure, the human insulin derivative is dissolved in an amount of water which is somewhat less than the final volume of the composition to be prepared. An isotonic agent, a preservative and a buffer is added as required and the pH value of the solution is adjusted--if necessary--using an acid, e.g. hydrochloric acid, or a base, e.g. aqueous sodium hydroxide as needed. Finally, the volume of the solution is adjusted with water to give the desired concentration of the ingredients.
Examples of isotonic agents are sodium chloride, mannitol and glycerol.
Examples of preservatives are phenol, m-cresol, methyl p-hydroxybenzoate and benzyl alcohol.
Examples of suitable buffers are sodium acetate and sodium phosphate.
A composition for nasal administration of an insulin derivative according to the present invention may, for example, be prepared as described in European Patent No. 272097 (to Novo Nordisk A/S).
The insulin compositions of this invention can be used in the treatment of diabetes. The optimal dose level for any patient will depend on a variety of factors including the efficacy of the specific human insulin derivative employed, the age, body weight, physical activity, and diet of the patient, on a possible combination with other drugs, and on the severity of the case of diabetes. It is recommended that the daily dosage of the human insulin derivative of this invention be determined for each individual patient by those skilled in the art in a similar way as for known insulin compositions.
Where expedient, the human insulin derivatives of this invention may be used in mixture with other types of insulin, e.g. human insulin or porcine insulin or insulin analogues with a more rapid onset of action. Examples of such insulin analogues are described e.g. in the European patent applications having the publication Nos. EP 214826 (Novo Nordisk A/S), EP 375437 (Novo Nordisk A/S) and EP 383472 (Eli Lilly & Co.).
The present invention is further illustrated by the following examples which, however, are not to be construed as limiting the scope of protection. The features disclosed in the foregoing description and in the following examples may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.
EXAMPLES
Plasmids and DNA Material
All expression plasmids are of the cPOT type. Such plasmids are described in EP patent application No. 171 142 and are characterized in containing the Schizosaccharomyces pombe triose phosphate isomerase gene (POT) for the purpose of plasmid selection and stabilization. A plasmid containing the POT-gene is available from a deposited E. coli strain (ATCC 39685). The plasmids furthermore contain the S. cerevisiae triose phosphate isomerase promoter and terminator (P.sub.TPI and T.sub.TPI). They are identical to pMT742 (Egel-Mitani, M. et al., Gene 73 (1988) 113-120) (see FIG. 1) except for the region defined by the ECoRI-XbaI restriction sites encompassing the coding region for signal/leader/product.
Synthetic DNA fragments were synthesized on an automatic DNA synthesizer (Applied Biosystems model 380A) using phosphoramidite chemistry and commercially available reagents (Beaucage, S. L. and Caruthers, M. H., Tetrahedron Letters 22 (1981) 1859-1869).
All other methods and materials used are common state of the art knowledge (see, e.g. Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989).
Analytical
Molecular masses of the insulins prepared were obtained by MS (mass spectroscopy), either by PDMS (plasma desorption mass spectrometry) using a Bio-Ion 20 instrument (Bio-Ion Nordic AB, Uppsala, Sweden) or by ESMS (electrospray mass spectrometry) using an API III Biomolecular Mass Analyzer (Perkin-Elmer Sciex Instruments, Thornhill, Canada).
Example 1
Synthesis of Ala.sup.A21 Asp.sup.B3 Human Insulin Precursor from Yeast Strain yEA002 Using the LaC212spx3 Signal/Leader
The following oligonucleotides were synthesized:
__________________________________________________________________________#98 5'-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTGGTTGAA (SEQ ID NO:3) GCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGA CGACGCT-3' (Asp.sup.83)#128 5'-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAAGAACAG (SEQ ID NO:4) ATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3' (Ala.sup.A21)#126 5'-GTCGCCATGGCTAAGAGATTCGTTG-3' (Asp.sup.B3) (SEQ ID NO:5)#16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID NO:6)__________________________________________________________________________
The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, Conn. 06859, U.S.A.) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co., St. Louis, Mo., U.S.A.).
2.5 .mu.l of oligonucleotide #98 (2.5 pmol)
2.5 .mu.l of oligonucleotide #128 (2.5 pmol)
10 .mu.l of 10.times. PCR buffer
16 .mu.l of dNTP mix
0.5 .mu.l of Taq enzyme
58.5 .mu.l of water
One cycle was performed: 94.degree. C. for 45 sec., 49.degree. C. for 1 min, 72.degree. C. for 2 min.
Subsequently, 5 .mu.l of oligonucleotides #16 and #126 was added and 15 cycles were performed: 94.degree. C. for 45 sec., 45.degree. C. for 1 min, 72.degree. C. for 1.5 min. The PCR mixture was loaded onto a 2.5% agarose gel and subjected to electrophoresis using standard techniques (Sambrook et al., Molecular cloning, Cold Spring Harbour Laboratory Press, 1989). The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean Kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif., 92038, U.S.A.) according to the manufacturer's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases NcoI and XbaI according to standard techniques, run on a 2.5% agarose gel and purified using the Gene Clean Kit as described.
The plasmid pAK188 consists of a DNA sequence of 412 bp composed of a EcoRI/NcoI fragment encoding the synthetic yeast signal/leader gene LaC212spx3 (described in Example 3 of WO 89/02463) followed by a synthetic NcoI/XbaI fragment encoding the insulin precursor M15, which has a SerAspAspAlaLys bridge connecting the B29 and the A1 amino acid residues (see SEQ ID NOS. 14, 15 and 16), inserted into the EcoRI/XbaI fragment of the vector (phagemid) pBLUESCRIPT IIsk(.+-.) (Stratagene, U.S.A.). The plasmid pAK188 is shown in FIG. 1.
The plasmid pAK188 was also cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 3139 bp isolated. The two DNA fragments were ligated together using T4 DNA ligase and standard conditions (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, 1989). The ligation mixture was transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using standard DNA miniprep technique (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, 1989), checked with appropriate restrictions endonucleases i.e. EcoRI, XbaI, NcoI and HpaI. The selected plasmid was shown by DNA sequencing analyses (Sequenase, U.S. Biochemical Corp.) to contain the correct sequence for the Ala.sup.A21, Asp.sup.B3 human insulin precursor and named pEA5.3.
The plasmid pKFN1627 is an E. coli--S. cerevisiae shuttle vector, identical to plasmid pKFN1003 described in EP patent No. 375718, except for a short DNA sequence upstream from the unique XbaI site. In pKFN1003, this sequence is a 178 bp fragment encoding a synthetic aprotinin gene fused in-frame to the yeast mating factor alpha 1 signal-leader sequence. In pKFN1627, the corresponding 184 bp sequence encodes the insulin precursor M15 (Glu.sup.B1, Glu.sup.B28) (i.e. B(1-29, Glu.sup.B1,Glu.sup.B28)-SerAspAspAlaLys-A(1-21) fused in-frame to the mating factor alpha 1 sequence (see SEQ ID NOS. 17, 18 and 19). The vector pKFN1627 is shown in FIG. 1.
pEA5.3 was cut with the restriction endonucleases EcoRI and XbaI and the resulting DNA fragment of 412 bp was isolated. The yeast expression vector pKFN1627 was cut with the restriction endonucleases NcoI and XbaI and with NcoI and EcoRI and the DNA fragment of 9273 bp was isolated from the first digestion and the DNA fragment of 1644 bp was isolated from the second. The 412 bp EcoRI/XbaI fragment was then ligated to the two other fragments, that is the 9273 bp NcoII/XbaI fragment and the 1644 bp NcoI/EcoRI fragment using standard techniques.
The ligation mixture was transformed into E. coli as described above. Plasmid from the resulting E. coli was isolated using standard techniques, and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, Hpa I. The selected plasmid was shown by DNA sequence analysis (using the Sequenase kit as described by the manufacturer, U.S. Biochemical) to contain the correct sequence for the Ala.sup.A21 Asp.sup.B3 human insulin precursor DNA and to be inserted after the DNA encoding the LaC212spx3 signal/leader DNA. The plasmid was named pEA5.3.2 and is shown in FIG. 1. The DNA sequence encoding the LaC212spx3 signal/leader/Ala.sup.A21 Asp.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 20, 21 and 22. The plasmid pEA5.3.2 was transformed into S. cerevisiae strain MT663 as described in European patent application having the publication No. 214826 and the resulting strain was named yEA002.
Example 2
Synthesis of Ala.sup.A21 Thr.sup.B3 Human Insulin Precursor from Yeast Strain yEA005 Using the LaC212spx3 Signal/Leader
The following oligonucleotides were synthesized:
__________________________________________________________________________#101 5'-TGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCACTT (SEQ ID NO:7) GGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACA CTCCAAAGTCTGACGACGCT-3' THR.sup.B3)#128 5'-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAA (SEQ ID NO:4) GAACAGATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3'(Ala.sup.A21)#15 5'-GTCGCCATGGCTAAGAGATTCGTTA-3' (Thr.sup.B3) (SEQ ID NO:8)#16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID NO:6)__________________________________________________________________________
The DNA encoding Ala.sup.A21 Thr.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Ala.sup.A21 Thr.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 23, 24 and 25. The plasmid pEA8.1.1 was shown to contain the desired sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA005.
Example 3
Synthesis of Gly.sup.A21 Asp.sup.B3 Human Insulin Precursor from Yeast Strain yEA007 Using the LaC212spx3 Signal/Leader
The following oligonucleotides were synthesized:
______________________________________#98 5'-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTG (SEQ ID NO:3) GTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCT ACACTCCAAAGTCTGACGACGCT-3' (Asp.sup.B3)#127 5'-CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAA (SEQ ID NO:9) AGAACAGATAGAAGTACAACATTGTTCAACGATACCCT TAGCGTCGTCAGACTTTGG-3' (Gly.sup.A21)#126 5'-GTCGCCATGGCTAAGAGATTCGTTG-3' (Asp.sup.B3) (SEQ ID NO:5)#16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID NO:6)______________________________________
The DNA encoding Gly.sup.A21 Asp.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Gly.sup.A21 Asp.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 26, 27 and 28. The plasmid pEA1.5.6 was shown to contain the desired sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA007.
Example 4
Synthesis of Gly.sup.A21 Thr.sup.B3 Human Insulin Precursor from Yeast Strain yEA006 Using the LaC212spx3 Signal/Leader
The following oligonucleotides were synthesized:
__________________________________________________________________________#101 5'-TGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCACTTGGTTGAAG (SEQ IDNO:7) CTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACG ACGCT-3' (Thr.sup.B3)#127 5'-CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAAAGAACAG (SEQ ID NO:9) ATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3' (Gly.sup.A21)#15 5'-GTCGCCATGGCTAAGAGATTCGTTA-3' (Thr.sup.B3) (SEQ ID NO:8)#16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID NO:6)__________________________________________________________________________
The DNA encoding Gly.sup.A21 Thr.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Gly.sup.A21 Thr.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 29, 30 and 31. The plasmid pEA4.4.11 was shown to contain the desired DNA sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA006.
Example 5
Synthesis of Arg.sup.B-1 Arg.sup.B31 Single Chain Human Insulin Precursor Having an N-Terminal Extension (GluGluAlaGluAlaGluAlaArg) from Yeast Strain yEA113 Using the Alpha Factor Leader
A) The following oligonucleotides were synthesized:
__________________________________________________________________________#220 5'-ACGTACGTTCTAGAGCCTGCGGGCTGC-3' (SEQ ID NO:10)#263 5'-CACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTC (SEQ ID NO:11) TTCTACACTCCAAAGACTAGAGGTATCGTTGAA-3'#307 5'-GCTAACGTCGCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGCT (SEQ ID NO:12)AGATTCGTTAACCAACAC-3'__________________________________________________________________________
The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, Conn. 06859, U.S.A.) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co, St. Louis, Mo., U.S.A.). The plasmid pAK220 (which is identical to pAK188) consists of a DNA sequence of 412 bp encoding the synthetic yeast signal/leader LaC212spx3 (described in Example 3 of WO 89/02463) followed by the insulin precursor M15 (see SEQ ID NOS. 14, 15 and 16) inserted into the vector (phagemid) pBLUESCRIPT IIsk(.+-.) (Stratagene, U.S.A.).
5 .mu.l of oligonucleotide #220 (100 pmol)
5 .mu.l of oligonucleotide #263 (100 pmol)
10 .mu.l of 10.times. PCR buffer
16 .mu.l of dNTP mix
0.5 .mu.l of Taq enzyme
0.5 .mu.l of pAK220 plasmid (identical to pAK188) as template (0.2 .mu.g of DNA)
63 .mu.l of water
A total of 16 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes at 72.degree. C. The PCR mixture was then loaded onto a 2% agarose gel and subjected to electrophoresis using standard techniques. The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif., 92038, U.S.A.) according to the manufacture's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases HindIII and XbaI according to standard techniques. The HindIII/XbaI DNA fragment was purified using The Gene Clean Kit as described.
The plasmid pAK406 consists of a DNA sequence of 520 bp comprising an EcoRI/HindIII fragment derived from pMT636 (described in WO 90/10075) encoding the yeast alpha factor leader and part of the insulin precursor ligated to the HindIII/XbaI fragment from pAK188 encoding the rest of the insulin precursor MI5 (see SEQ ID NOS. 32, 33 and 34) inserted into the vector cPOT. The vector pAK406 is shown in FIG. 2.
The plasmid pAK233 consists of a DNA sequence of 412 bp encoding the synthetic yeast signal/leader LaC212spx3 (described in Example 3 of WO 89/02463) followed by the gene for the insulin precursor B(1-29)-GluLysArg-A(1-21)(A21-Gly) (see SEQ ID NOS. 35, 36 and 37) inserted into the vector cPOT. The plasmid pAK233 is shown in FIG. 2.
The plasmid pAK233 was cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 9273 bp isolated. The plasmid pAK406 was cut with the restriction endonucleases NcoI and HindIII and the vector fragment of 2012 bp isolated. These two DNA fragments were ligated together with the HindIII/XbaI PCR fragment using T4 DNA ligase and standard conditions. The ligation mixture was then transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, HindIII. The selected plasmid was shown by DNA sequencing analyses to contain the correct sequence for the Arg.sup.B31 single chain human insulin precursor DNA and to be inserted after the DNA encoding the S. cerevisiae alpha factor DNA. The plasmid was named pEA108 and is shown in FIG. 2. The DNA sequence encoding the alpha factor leader/Arg.sup.B31 single chain human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 38, 39 and 40. The plasmid pEA108 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA108.
B) The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, Conn. 06859, U.S.A.) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co., St. Louis, Mo., U.S.A.)
5 .mu.l of oligonucleotide #220 (100 pmol)
5 .mu.l of oligonucleotide #307 (100 pmol)
10 .mu.l of 10.times. PCR buffer
16 .mu.l of dNTP mix
0.5 .mu.l of Taq enzyme
0.2 .mu.l of pEA108 plasmid as template (0.1 ug DNA)
63 .mu.l of water
A total of 16 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes at 72.degree. C. The PCR mixture was then loaded onto an 2% agarose gel and subjected to electrophoresis using standard techniques. The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif., 92038, U.S.A.) according to the manufacture's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases NcoI and XbaI according to standard techniques. The NcoI/XbaI DNA fragment was purified using The Gene Clean Kit as described.
The plasmid pAK401 consists of a DNA sequence of 523 bp composed of an EcoRI/NcoI fragment derived from pMT636 (described in WO 90/10075) (constructed by by introducing a NcoI site in the 3'-end of the alpha leader by site directed mutagenesis) encoding the alpha factor leader followed by a NcoI/XbaI fragment from pAK188 encoding the insulin precursor M15 (see SEQ ID NOS. 41, 42 and 43) inserted into the vector (phagemid) pBLUESCRIPT IIsk(.+-.) (Stratagene, U.S.A.). The plasmid pAK401 is shown in FIG. 3.
The plasmid pAK401 was cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 3254 bp isolated and ligated together with the NcoI/XbaI PCR fragment. The ligation mixture was then transformed into a competent E. coli strain and plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI. The selected plasmid, named p113A (shown in FIG. 3), was cut with EcoRI and XbaI and the fragment of 535 bp isolated.
The plasmid pAK233 was cut with the restriction endonucleases NcoI and XbaI, and with EcoRI/NcoI and the fragments of 9273 and 1644 bp isolated. These two DNA fragments were ligated together with the EcoRI/XbaI fragment from p113A using T4 DNA ligase and standard conditions. The ligation mixture was then transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, HindIII. The selected plasmid was shown by DNA sequencing analyses to contain the correct sequence for the Arg.sup.B31 single chain human insulin precursor DNA with the N-terminal extension GluGluAlaGluAlaGluAlaArg and to be inserted after the DNA encoding the S. cerevisiae alpha factor DNA. The plasmid was named pEA113 and is shown in FIG. 3. The DNA sequence encoding the alpha factor leader/Arg.sup.B-1 ArgB31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaArg) and the amino acid sequence thereof are SEQ ID NOS. 44, 45 and 46. The plasmid pEA113 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA113.
Example 6
Synthesis of Arg.sup.B-1 Arg.sup.B31 Single Chain Human Insulin Precursor Having an N-Terminal Extension (GluGluAlaGluAlaGluAlaGluArg) from Yeast Strain yEA136 Using the Alpha Factor Leader
The following oligonucleotide was synthesized:
#389 5'-GCTAACGTCGCCATGGCTAAGAGAGAAGAAGCTGAAGCGAAGCTGAAAGATTCGTTAACCAACAC-3' (SEQ ID NO:13)
The following PCR was performed using the Gene Amp PCR reagent kit
5 .mu.l of oligonucleotide #220 (100 pmol)
5 .mu.l of oligonucleotide #389 (100 pmol)
10 .mu.l of 10.times. PCR buffer
16 .mu.l of dNTP mix
0.5 .mu.l of Taq enzyme
0.2 .mu.l of pEA113 plasmid as template (0.5 ug DNA)
63 .mu.l of water
A total of 12 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 37.degree. C.; and 2 minutes at 72.degree. C.
The DNA encoding alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaGluArg) was constructed in the same manner as described for the DNA encoding alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaArg) in Example 5. The plasmid was named pEA136. The DNA sequence encoding the alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaGluArg) and the amino acid sequence thereof are SEQ ID NOS. 47, 48 and 49. The plasmid pEA136 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA136.
Example 7
Synthesis of (A1,B1)-diBoc Human Insulin
5 g of zinc-free human insulin was dissolved in 41.3 ml of DMSO. To the solution was added 3.090 ml of acetic acid. The reaction was conducted at room temperature and initiated by addition of 565 mg of di-tert-butyl pyrocarbonate dissolved in 5.650 ml of DMSO. The reaction was allowed to proceed for 51/2 hour and then stopped by addition of 250 .mu.l of ethanolamine. The product was precipitated by addition of 1500 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. A yield of 6.85 g material was obtained.
(A1,B1)-diBoc insulin was purified by reversed phase HPLC as follows: The crude product was dissolved in 100 ml of 25% ethanol in water, adjusted to pH 3.0 with HCl and applied to a column (5 cm diameter, 30 cm high) packed with octadecyldimethylsilyl-substituted silica particles (mean particle size 15 .mu.m, pore size 100 .ANG.) and equilibrated with elution buffer. The elution was performed using mixtures of ethanol and 1 mM aqueous HCl, 0.3 M KCl at a flow of 2 l/h. The insulin was eluted by increasing the ethanol content from 30% to 45%. The appropriate fraction was diluted to 20% ethanol and precipitated at pH 4.8. The precipitated material was isolated by centrifugation and dried in vacuum. Thus 1.701 g of (A1,B1)-diBoc human insulin was obtained at a purity of 94.5%.
Example 8
Synthesis of (N.sup..epsilon.B29 -benzoyl Human Insulin).sub.6, 3Zn.sup.2+
400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 14.6 mg of benzoic acid N-hydroxysuccinimide ester dissolved in 132 .mu.l DMF. The reaction was stopped after 2 hours by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 343 mg of material was collected.
The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum.
N.sup..epsilon.B29 -benzoyl human insulin was purified by reversed phase HPLC as described in Example 7. A yield of 230 mg was obtained. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 190 mg.
Molecular mass, found by MS: 5911, theory: 5911.
Example 9
Synthesis of (N.sup..epsilon.B29 -lithocholoyl Human Insulin).sub.6, 3Zn.sup.2+
400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 31.94 mg of lithocholic acid N-hydroxysuccinimide ester dissolved in 300 .mu.l of DMF. The reaction was stopped after 2 hours by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 331 mg of material was obtained.
The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. The yield was 376 mg.
B29-lithocholoyl insulin was purified by reversed phase HPLC as described in Example 7. A final yield of 67 mg was obtained at a purity of 94%. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 49 mg.
Molecular mass, found by MS: 6160, theory: 6166.
Example 10
Synthesis of (N.sup..epsilon.B29 -decanoyl Human Insulin).sub.6, 3Zn.sup.2+
400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 18.0 mg of decanoic acid N-hydroxysuccinimide ester dissolved in 132 .mu.l of DMF. The reaction was stopped after 60 minutes and the product precipitated by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 420 mg of intermediate product was collected.
The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and the product was then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. The yield of crude product was 420 mg.
The crude product was purified by reversed phase HPLC as described in Example 7. A final yield of 254 mg of the title product was obtained. The purity was 96.1%. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 217 mg.
Molecular mass, found by MS: 5962, theory: 5962.
Example 11
Synthesis of des(B30) Human Insulin
Synthesis of des(B30) human insulin was carried out as described by Markussen (Methods in diabetes research, Vol. I, Laboratory methods, part B, 404-410. Ed: J. Larner and S. Phol, John Wiley & Sons, 1984). 5 g of human insulin was dissolved in 500 ml of water while the pH value of the solution was kept at 2.6 by addition of 0.5 M sulphuric acid. Subsequently, the insulin was salted out by addition of 100 g of ammonium sulphate and the precipitate was isolated by centrifugation. The pellet was dissolved in 800 ml of 0.1 M ammonium hydrogen carbonate and the pH value of the solution was adjusted to 8.4 with 1 M ammonia.
50 mg of bovine carboxypeptidase A was suspended in 25 ml of water and isolated by centrifugation. The crystals were suspended in 25 ml of water and 1 M ammonia was added until a clear solution was obtained at a final pH of 10. The carboxypeptidase solution was added to the insulin solution and the reaction was allowed to proceed for 24 hours. A few drops of toluene were added to act as preservative during the reaction.
After 24 hours the des(B30) human insulin was crystallized by successive addition of 80 g of sodium chloride while the solution was stirred. The pH value was then adjusted to 8.3 and the crystallization was allowed to proceed for 20 hours with gentle stirring. The crystals were isolated on a 1.2 .mu.l filter, washed with 250 ml of ice cold 2-propanol and finally dried in vacuum.
Example 12
Synthesis of (A1,B1)-diBoc des(B30) Human Insulin
The title compound was synthesized by a method similar to that described in Example 7, using des(B30) porcine insulin as the starting material. The crude product was precipitated by acetone and dried in vacuum. The (A1,B1)-diBoc des(B30) human insulin was purified by reversed phase HPLC as described in Example 7.
Example 13
Synthesis of N.sup..epsilon.B29 -decanoyl des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was used as starting material for the synthesis of N.sup..epsilon.B29 -decanoyl des(B30) human insulin, following the procedure described in Example 10. The crude product was precipitated by acetone, dried in vacuum and deprotected using TFA. The resulting product was precipitated by acetone and dried in vacuum. N.sup..epsilon.B29 -decanoyl des(B30) human insulin was then purified by reversed phase HPLC as described in Example 10.
Molecular mass, found by MS: 5856, theory: 5861.
Example 14
Synthesis of N.sup..epsilon.B29 -dodecanoyl des(B30) Human Insulin
a. Immobilization of A. lyticus Protease
13 mg of A. lyticus protease, dissolved in 5 ml of aqueous 0.2 M NaHCO.sub.3 buffer, pH 9.4, was mixed with 4 ml of settled MiniLeak.RTM. Medium gel, which had been washed with the same buffer (MiniLeak is a divinylsulfone activated Sepharose CL 6B, obtained from KemEnTec, Copenhagen). The gel was kept in suspension by gentle stirring for 24 hours at room temperature. Then, the gel was isolated by filtration, washed with water, and suspended in 20 ml of 1 M ethanolamine buffer, pH 9.4, and kept in suspension for 24 hours at room temperature. Finally, the gel was washed with water followed by 0.1 M acetic acid and stored at 4.degree. C. The enzyme activity in the filtrate was 13% of that in the initial solution, indicating a yield in the immobilization reaction of about 87%.
b. Immobilization of Porcine Trypsin
Porcine trypsin was immobilized to MiniLeak.RTM. Low to a degree of substitution of 1 mg per ml of gel, using the conditions described above for immobilization of A. lyticus.
c. Synthesis of Glu(GluAla).sub.3 Arg-B(1-29), ThrArg-A(1-21) Insulin Using Immobilized A. lyticus Protease
To 200 mg of Glu(GluAla).sub.3 Arg-B(1-29)-ThrArg-A(1-21) single-chain human insulin precursor, dissolved in 20 ml of 0.1 M NaHCO.sub.3 buffer, pH 9.0, was added 4 ml of the gel carrying the immobilized A. lyticus protease. After the gel had been kept in suspension in the reaction mixture for 6 hours at room temperature the hydrolysis was complete, rendering Glu(GluAla).sub.3 -Arg-B(1-29), ThrArg-A(1-21) human insulin (the reaction was followed by reversed phase HPLC). After the hydrolysis, the gel was removed by filtration. To the filtrate was added 5 ml of ethanol and 15 .mu.l of 1 M ZnCl.sub.2 and the pH was adjusted to 5.0 using HCl. The precipitation of the product was completed on standing overnight at 4.degree. C. with gentle stirring. The product was isolated by centrifugation. After one washing with 1 ml of ice cold 20% ethanol and drying in vacuo the yield was 190 mg.
d. Synthesis of N.sup..alpha.A1,N.sup..alpha.B1,N.sup..epsilon.B29 -tridodecanoyl Glu(GluAla).sub.3 Arg-B(1-29), Thr-Arg-A(1-21) Human Insulin Using Dodecanoic Acid N-hydroxysuccinimide Ester
190 mg (30 .mu.mol) of Glu(GluAla).sub.3 Arg-B(1-29),ThrArg-A(1-21) insulin was dissolved in 1 ml of DMSO and 1.05 ml of a 0.572 M solution of N,N-diisopropylethylamine in DMF. The solution was cooled to 15.degree. C. and 36 mg (120 .mu.mol) of dodecanoic acid N-hydroxysuccinimide ester dissolved in 0.6 ml of DMSO was added. The reaction was completed within 24 hours. The lipophilic title compound was not isolated.
e. Synthesis of N.sup..epsilon.B29 -dodecanoyl des(B30) Insulin
The product from the previous step, d., contained in approximately 2.65 ml of DMSO/DMF/N,N-diisopropylethylamine was diluted with 10.6 ml of a 50 mM glycine buffer comprising 20% ethanol and the pH adjusted to 10 with NaOH. After standing for 1 hour at room temperature 1 ml of MiniLeak gel, carrying 1 mg of immobilized trypsin per ml of gel, was added. The reaction mixture was stirred gently for 48 hours at room temperature. In order to isolate the desired product, the reaction mixture was applied to a reversed phase HPLC column (5 cm in diameter, 30 cm high), packed with octadecyldimethylsilyl-substituted silica particles (mean particle size 15 .mu.m, pore size 100 .ANG.). For the elution was used 20 mM Tris/HCl buffers, adjusted to pH 7.7 and comprising an increasing concentration of ethanol, from 40% to 44% (v/v), at a rate of 2000 ml/h. The major peak eluting at about 43-44% of ethanol contained the title compound. The fractions containing the major peak were pooled, water was added to reduce the ethanol concentration to 20% (v/v), and the pH was adjusted to 5.5. The solution was left overnight at -20.degree. C., whereby the product precipitated. The precipitate was isolated by centrifugation at -8.degree. C. and dried in vacuo. The yield of the title compound was 90 mg.
Molecular mass, found by MS: 5892, theory: 5890.
Example 15
Synthesis of N.sup..epsilon.B29 -(N-myristoyl-.alpha.-glutamyl) Human Insulin
500 mg of (A1,B1)-diBoc human insulin was dissolved in 2.5 ml of DMSO and 428 .mu.l of ethyl diisopropylamine, diluted with 2.5 ml of DMSO/DMF 1/1 (v/v), was added. The temperature was adjusted to 15.degree. C. and 85 mg of N-myristoyl-Glu(OBut) N-hydroxysuccinimide ester, dissolved in 2.5 ml of DMSO/DMF 1/1 (v/v), was added. After 30 min the reaction mixture was poured into 60 ml of water, the pH adjusted to 5 and the precipitate isolated by centrifugation. The precipitate was dried in vacuo. The dried reaction mixture was dissolved in 25 ml of TFA, and the solution was left for 30 min at room temperature. The TFA was removed by evaporation in vacuo. The gelatinous residue was dissolved in 60 ml of water and the pH was adjusted to 11.2 using concentrated ammonia. The title compound was crystallized from this solution by adjustment of the pH to 8.51 using 6 N HCl. The product was isolated by centrifugation, washed once by 10 ml of water, and dried in vacuo. Yield 356 mg. Purity by HPLC 94%.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.12 CONHCH(CH.sub.2 CH.sub.2 COOH)CO--.
Molecular mass, found by MS: 6146, theory: 6148.
Example 16
Synthesis of N.sup..epsilon.B29 -undecanoyl des(B30) Human Insulin
The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using undecanoic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 5876, theory: 5876.
Example 17
Synthesis of N.sup..epsilon.B29 -tridecanoyl des(B30) Human Insulin
The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using tridecanoic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 5899, theory: 5904.
Example 18
Synthesis of N.sup..epsilon.B29 -myristoyl des(B30) Human Insulin
The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using myristic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 5923, theory: 5918.
Example 19
Synthesis of N.sup..epsilon.B29 -palmitoyl des(B30) Human Insulin
The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using palmitic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 5944, theory: 5946.
Example 20
Synthesis of N.sup..epsilon.B29 -suberoyl-D-thyroxine Human Insulin
a. Preparation of N-(succinimidylsuberoyl)-D-thyroxine
Disuccinimidyl suberate (1.0 g, Pierce) was dissolved in DMF (50 ml), and D-thyroxine (2.0 g, Aldrich) was added with stirring at 20.degree. C. The thyroxine slowly dissolved, and after 20 hours the solvent was removed by evaporation in vacuo. The oily residue was crystallized from 2-propanol to yield 0.6 g of N-(succinimidylsuberoyl)-D-thyroxine, m.p. 128-133.degree. C.
b. Reaction of (A1,B1)-diBoc Human Insulin with N-(succinimidylsuberoyl)-D-thyroxine
(A1,B1)-diBoc human insulin (200 mg) was dissolved in dry DMF (10 ml) by addition of triethylamine (20 .mu.l) at room temperature. Then, N-(succinimidylsuberoyl)-D-thyroxine (80 mg) was added. The reaction was monitored by reversed phase HPLC and when the reaction was about 90% complete, the solvent was removed in vacuo. To the evaporation residue, anhydrous trifluoroacetic acid (5 ml) was added, and the solution was kept for 1 hour at room temperature. After removal of the trifluoroacetic acid in vacuo, the residue was dissolved in a mixture of 1M acetic acid (5 ml) and acetonitrile (1.5 ml), purified by preparative reversed phase HPLC and desalted on a PD-10 column. The yield of N.sup..epsilon.B29 -suberoyl-D-thyroxine human insulin was 50 mg.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: Thyrox-CO(CH.sub.2).sub.6 CO--, wherein Thyrox is thyroxine which is bound to the octanedioic acid moiety via an amide bond to its .alpha.-amino group.
Molecular mass of the product found by MS: 6724, theory: 6723.
Example 21
Synthesis of N.sup..epsilon.B29 -(2-succinylamido)myristic acid Human Insulin
a. Preparation of .alpha.-aminomyristic acid methyl ester,HCl
To methanol (5 ml, Merck) at -10.degree. C., thionyl chloride (0.2 ml, Aldrich) was added dropwise while stirring vigorously. Then, .alpha.-aminomyristic acid (0.7 g, prepared from the .alpha.-bromo acid by reaction with ammonia) was added. The reaction mixture was stirred at room temperature overnight, and then evaporated to dryness. The crude product (0.7 g) was used directly in step b.
b. Preparation of N-succinoyl-.alpha.-aminomyristic acid methyl ester
.alpha.-Aminomyristic acid methyl ester,HCl (0.7 g) was dissolved in chloroform (25 ml, Merck). Triethylamine (0.35 ml, Fluka) was added, followed by succinic anhydride (0.3 g, Fluka). The reaction mixture was stirred at room temperature for 2 hours, concentrated to dryness, and the residue recrystallized from ethyl acetate/petroleum ether (1/1). Yield: 0.8 g.
c. Preparation of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester
N-succinoyl-.alpha.-aminomyristic acid methyl ester (0.8 g) was dissolved in dry DMF (10 ml, Merck, dried over 4 .ANG. molecular sieve). Dry pyridine (80 .mu.l, Merck), and di(N-succinimidyl)carbonate (1.8 g, Fluka) were added, and the reaction mixture was stirred overnight at room temperature. The evaporation residue was purified by flash chromatography on silica gel 60 (Merck), and recrystallized from 2-propanol/petroleum ether (1/1). Yield of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester: 0.13 g, m.p. 64-66.degree. C.
d. Reaction of (A1,B1)-diBoc human insulin with N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester
The reaction was carried out as in Example 20 b., but using N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester (16 mg) instead of N-(succinimidylsuberoyl)-D-thyroxine. After removal of the trifluoroacetic acid in vacuo, the evaporation residue was treated with 0.1M sodium hydroxide at 0.degree. C. to saponify the methyl ester. When the saponification was judged to be complete by reversed phase HPLC, the pH value in the solution was adjusted to 3, and the solution was lyophilized. After purification by preparative reversed phase HPLC and desalting on a PD-10 column, the yield of N.sup..epsilon.B29 -(2-succinylamido)myristic acid human insulin was 39 mg.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.11 CH(COOH)NHCOCH.sub.2 C:H.sub.2 CO--.
Molecular mass of the product found by MS: 6130, theory: 6133.
Example 22
Synthesis of N.sup..epsilon.B29 -octyloxycarbonyl Human Insulin
The synthesis was carried out as in Example 20 b., but using n-octyloxycarbonyl N-hydroxysuccinimide (9 mg, prepared from n-octyl chloroformate (Aldrich) and N-hydroxysuccinimide), instead of N-(succinimidylsuberoyl)-D-thyroxine. The yield of N.sup..epsilon.B29 -octyloxycarbonyl human insulin was 86 mg.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.7 OCO--.
Molecular mass of the product found by MS: 5960, theory: 5964.
Example 23
Synthesis of NE.sup..epsilon.B29 -(2-succinylamido)palmitic acid Human Insulin
a. Preparation of N-(succinimidylsuccinoyl)-.alpha.-amino palmitic acid methyl ester
This compound was prepared as described in Example 21 a.-c., using .alpha.-amino palmitic acid instead of .alpha.-amino myristic acid.
b. Reaction of (A1,B1)-diBoc Human Insulin with N-(succinimidylsuccinoyl)-.alpha.-aminopalmitictic acid methyl ester
The reaction was carried out as in Example 21 d., but using N-(succinimidylsuccinoyl)-.alpha.-aminopalmitic acid methyl ester instead of N-(succinimidylsuccinoyl)-.alpha.-aminopalmitic acid methyl ester to give N.sup..epsilon.B29 -(2-succinylamido)palmitic acid human insulin.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.13 CH(COOH)NHCOCH.sub.2 CH.sub.2 CO--.
Example 24
Synthesis of N.sup..epsilon.B29 -(2-succinylamidoethyloxy)palmitic acid Human Insulin
a. Preparation of N-(succinimidylsuccinoyl)-2-aminoethyloxy palmitic acid methyl ester
This compound was prepared as described in Example 21 a.-c. but using 2-aminoethyloxy palmitic acid (synthesized by the general procedure described by R. TenBrink, J. Org. Chem. 52 (1987) 418-422 instead of .alpha.-amino myristic acid.
b. Reaction of (A1,B1)-diBoc human insulin with N-(succinimidylsuccinoyl)-2-aminoethyloxypalmitictic acid methyl ester
The reaction was carried out as in Example 21 d., but using N-(succinimidylsuccinoyl)-2-aminoethyloxypalmitic acid methyl ester instead of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester to give N.sup..epsilon.B29 -(2-succinylamidoethyloxy)palmitic acid human insulin.
The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.13 CH(COOH)NHCH.sub.2 CH.sub.2 OCOCH.sub.2 CH.sub.2 CO--.
Example 25
Synthesis of N.sup..epsilon.B29 -lithocholoyl-.alpha.-glutamyl des(B30) Human Insulin
The synthesis was carried out as in Example 13 using N-lithocholoyl-L-glutamic acid .alpha.-N-hydroxysuccinimide ester, .gamma.-tert-butyl ester instead of decanoic acid N-hydroxysuccinimide ester.
The product of this example is thus des(B30) human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: lithocholoyl-NHCH(CH.sub.2 CH.sub.2 COOH)CO--.
Molecular mass of the product found by MS: 6194, theory: 6193.
Example 26
Synthesis of N.sup..epsilon.B29 -3,3',5,5'-tetraiodothyroacetyl Human Insulin
The synthesis was carried out as in Example 10 using 3,3',5,5'-tetraiodothyroacetic acid N-hydroxysuccinimide ester, instead of decanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 6536, theory: 6538.
Example 27
Synthesis of N.sup..epsilon.B29 -L-thyroxyl Human Insulin
The synthesis was carried out as in Example 10 using Boc-L-thyroxine N-hydroxysuccinimide ester, instead of decanoic acid N-hydroxysuccinimide ester.
Molecular mass of the product found by MS: 6572, theory: 6567.
Example 28
A Pharmaceutical Composition Comprising 600 nmol/ml of N.sup..epsilon.B29 -decanoyl des(B30) Human Insulin, 1/3Zn.sup.2+ in Solution
N.sup..epsilon.B29 -decanoyl des(B30) human insulin (1.2 .mu.mol) was dissolved in water (0.8 ml) and the pH value was adjusted to 7.5 by addition of 0.2 M sodium hydroxide. 0.01 M zinc acetate (60 .mu.l) and a solution containing 0.75% of phenol and 4% of glycerol (0.8 ml) was added. The pH value of the solution was adjusted to 7.5 using 0.2 M sodium hydroxide and the volume of the solution was adjusted to 2 ml with water.
The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.
Example 29
A Pharmaceutical Composition Comprising 600 nmol/ml of N.sup..epsilon.B29 -decanoyl Human Insulin, 1/2Zn.sup.2+ in Solution
1.2 .mu.mol of the title compound was dissolved in water (0.8 ml) and the pH value was adjusted to 7.5 by addition of 0.2 M sodium hydroxide. A solution containing 0.75% of phenol and 1.75% of sodium chloride (0.8 ml) was added. The pH value of the solution was adjusted to 7.5 using 0.2 M sodium hydroxide and the volume of the solution was adjusted to 2 ml with water.
The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.
Example 30
A Pharmaceutical Composition Comprising 600 nmol/ml of N.sup..epsilon.B29 -lithocholoyl Human Insulin in Solution
1.2 .mu.mol of the title compound was suspended in water (0.8 ml) and dissolved by adjusting the pH value of the solution to 8.5 using 0.2 M sodium hydroxide. To the solution was then added 0.8 ml of a stock solution containing 0.75% cresol and 4% glycerol in water. Finally, the pH value was again adjusted to 8.5 and the volume of the solution was adjusted to 2 ml with water.
The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.
Example 31
A Pharmaceutical Composition Comprising a Solution of 600 nmol/ml of N.sup..epsilon.B29 -hexadecanoyl Human Insulin 1/3 Zinc Ion per Insulin Monomer, 16 mM m-cresol, 16 mM phenol, 1.6% glycerol, 10 mM sodium chloride and 7 mM sodium phosphate
1.2 .mu.mol of N.sup..epsilon.B29 -hexadecanoyl human insulin was dissolved in water (0.5 ml) by addition of 0.2 M sodium hydroxide to pH 8.0 and 40 .mu.l of 0.01 M zinc acetate was added. To the solution was further added 100 .mu.l of 0.32 M phenol, 200 .mu.l of 0.16 M m-cresol, 800 .mu.l of 4% glycerol, 33.3 .mu.l of 0.6 M sodium chloride, and 140 .mu.l of 0.1 M sodium phosphate (pH 7.5). The pH value of the solution was adjusted to 7.5 with 0.1 M hydrochloric acid and the volume adjusted to 2 ml with water.
Example 32
Solubility of Various Compositions Comprising N.sup..epsilon.B29 -tetradecanoyl des(B30) Human Insulin and N.sup..epsilon.B29 -hexadecanoyl Human Insulin
The solubility of N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin and N.sup..epsilon.B29 -hexadecanoyl human insulin in different compositions was tested. The compositions were prepared as described in Example 31 with the necessary adjustment of the amount of the components. Zinc acetate was either left out or an amount corresponding to 1/3 Zn.sup.2+ per insulin monomer was used. Sodium chloride was used in amounts which resulted in a final concentration of 5, 25, 50, 75, 100 or 150 mM of sodium chloride. Zinc-free insulin was added to give a final amount in the composition of 1000 nmol/ml. In some cases a precipitate formed. The resulting solutions and suspensions were kept at 4.degree. C. for a week and the concentration of insulin in solution in each composition was then measured by high performance size exclusion chromatography relative to a standard of human insulin (column: Waters ProteinPak 250.times.8 mm; eluent: 2.5 M acetic acid, 4 mM arginine: 20% acetonitrile; flow rate: 1 ml/min; injection volume: 40 .mu.l; detection: UV absorbance at 276 nm). The results, in nmol/ml, are given in the table below:
______________________________________Solubility of insulins(nmol/ml) in 16 mM phenol,16 mM m-cresol,1.6% glycerol, 7 mM sodiumphosphate, and pH 7.5,varying zinc acetate and Sodium chloridesodium chloride (mM) 5 25 50 75 100 150concentrations at 4.degree. C. mM mM mM mM mM mM______________________________________N.sup..epsilon.B29 -tetradecanoyl des(B30) 82 115 54 77 74 84human insulin, zinc-free.N.sup..epsilon.B29 -tetradecanoyl des(B30) >950 >950 >950 >950 >950 485human insulin, 1/3 Zn.sup.2+ perinsulin monomer.N.sup..epsilon.B29 -hexadecanoyl human >890 >950 283 106 45 29insulin, zinc-free.N.sup..epsilon.B29 -hexadecanoyl human >950 >950 >950 >950 920 620insulin, 1/3 Zn.sup.2+ per insulinmonomer.______________________________________
In conclusion it appears that the solubility of the acylated insulins is increased by the addition of zinc. This is contrary to published data on human, porcine and bovine insulin (J Brange: Galenics of Insulin, page 19, Springer Verlag (1987); J Markussen et al. Protein Engineering 1 (1987) 205-213).
Example 33
Preparative Crystallization of Zinc-Free N.sup..epsilon.B29 -tetradecanoyl des(B30) Human Insulin
10 g of N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin was dissolved in 120 ml of 0.02 M NH.sub.4 Cl buffer adjusted to pH 9.0 with NH.sub.3 in ethanol/water (1:4, v/v). Gentle stirring was maintained throughout the crystallization. Crystallization was initiated at 23.degree. C. by addition of 20 ml of 2.5 M NaCl dissolved in ethanol/water (1:4, v/v). A slight turbidity appeared in the solution. Further, 20 ml of 2.5 M sodium chloride dissolved in ethanol/water (1:4, v/v) was added at a constant rate of 5 ml/h, which caused the crystallization to proceed slowly. In order to decrease the solubility of the insulin, the pH value was then adjusted to 7.5 using 1 N hydrochloric acid. Finally, the temperature was lowered to 4.degree. C. and the stirring continued overnight. The crystals were collected by filtration, washed twice with 25 ml of 0.2 M NaCl in ethanol/water (1:4, v/v), sucked dry and lyophilized.
The weight of the wet filter cake was 19.33 g.
The weight of lyophilized filter cake was 9.71 g.
Example 34
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -tetradecanoyl-Glu-Gly-1) des(B30) Human Insulin
500 mg of (A1,B1)-diBoc human insulin was dissolved in a mixture of 186 .mu.l of 4-methylmorpholine and 3814 .mu.l of DMSO. The reaction was initiated by addition of 144 mg of tetradecanoyl-Glu(.gamma.-OtBu)-Gly-OSu dissolved in 1000 .mu.l of DMF. The reaction conducted at 15.degree. C. and it was stopped after 4.5 hours by addition of 100 ml of acetone. The reaction product precipitated by addition of a few drops of concentrated HCl was subsequently isolated by centrifugation. The precipitate was then suspended in 100 ml of acetone, isolated by centrifugation and dried in vacuum. 637 mg of material was obtained.
The Boc protecting groups were eliminated by addition of 5 ml of TFA. The dissolved material was incubated for 30 minutes and then precipitated by addition of 100 ml of acetone and a few drops of concentrated HCl. The precipitate was then suspended in 100 ml acetone and isolated by centrifugation. The precipitated material was dissolved in 200 ml of 25% ethanol at pH 8 by addition of NH.sub.4 OH and purified by reversed phase HPLC. The dissolved material was applied to a column (5 cm diameter, 30 cm high) packed with octadecyldimethylsilyl-substituted silica particles (mean particle size 15 .mu.m, pore size 100 .ANG.) and equilibrated with 0.02 M Bis-Tris, 30% ethanol adjusted to pH 7.3 with hydrochloric acid at a temperature of 40.degree. C. The elution was performed using mixtures of 70% ethanol in water and Bis-Tris buffer. The flow was 2 l/h. The insulin was eluted by increasing the ethanol content from 30% to 50% and the effluent was monitored by its UV absorbance at 280 nm. The appropriate fraction was diluted to 20% ethanol adjusted to pH 4.5 and frozen at -20.degree. C. The precipitated material was isolated after equilibration of the sample at 1.degree. C. and subsequent centrifugation at the same temperature. The precipitate was dried in vacuum. Thus 292 mg of the title compound was obtained at a purity of 95.5%.
Molecular mass, found by MS: 6102.+-.6, theory: 6103.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =20. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 11.9 hours. The determination was carried out as described on page 24 of the description using a composition similar to those described in Table 2 on page 26 of the description.
Example 35
Synthesis of Lys.sup.B29 (N.sup..epsilon. -tetradecanoyl-Glu-) des(B30) Human Insulin
500 mg of (A1,B1)-diBoc human insulin was dissolved in a mixture of 186 .mu.l of 4-methylmorpholine and 3814 .mu.l of DMSO. The reaction was initiated by addition of 85 mg of N.sup..alpha. -tetradecanoyl-Glu(OtBu)-OSu dissolved in 1000 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. The intermediate product was isolated and the protection groups were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 356 mg of the title compound was obtained at a purity of 94.1%. Molecular mass, found by MS: 6053.+-.6, theory: 6046.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =24. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 8.8 hours. The determination was carried out as described on page 24 of the description using a composition similar to those described in Table 2 on page 26 of the description.
Example 36
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -tetradecanoyl-Glu(-)--OH]) Human Insulin
400 mg of (A1,B1)-diBoc human insulin was dissolved in a mixture of 232 .mu.l of ethyldiisopropylamine, 1880 .mu.l of DMSO and 2088 .mu.l of 1-methyl-2-pyrrolidone. The reaction was initiated by addition of 138 mg of N.sup..alpha. -tetradecanoyl-Glu(OSu)-OtBu dissolved in 800 .mu.l of 1-methyl-2-pyrrolidone. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. The protection groups were removed from the intermediate product by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 222 mg of the title compound was obtained at a purity of 95.5%. Molecular mass, found by MS: 6150.+-.6, theory: 6147.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =21. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 8.0 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 37
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -hexadecanoyl-Glu(-)--OH]) Human Insulin
400 mg of (A1,B1)-diBoc human insulin was dissolved in a mixture of 232 .mu.l of ethyldiisopropylamine, 880 .mu.l of DMSO and 2088 .mu.l of 1-methyl-2-pyrrolidone. The reaction was initiated by addition of 73 mg of N.sup..alpha. -hexadecanoyl-Glu(OSu)-OtBu dissolved in 800 .mu.l of DMF. The reaction was conducted at 150.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. 476 mg of intermediate product was obtained. The protection groups were removed from the intermediate product by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 222 mg of the title compound was obtained at a purity of 81.2%. Molecular mass, found by MS: 6179.+-.6, theory: 6175.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =67. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 13.0 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 38
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -octadecanoyl-Glu(-)--OH]) des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 232 .mu.l of ethyldiisopropylamine, 3000 .mu.l of DMSO and 268 .mu.l of dimetylformamide. The reaction was initiated by addition of 114 mg N.sup..alpha. -octadecanoyl-Glu(OSu)-OtBu dissolved in 500 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. 420 mg of intermediate product was obtained. The protection groups were removed from the intermediate product by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 169 mg of the title compound was obtained at a purity of 98.3%. Molecular mass, found by MS: 6103.+-.5, theory: 6102.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =185. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 9.7 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 39
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -tetradecanoyl-Glu(-)--OH]) des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 232 .mu.l of ethyldiisopropylamine and 3000 .mu.l of DMSO. The reaction was initiated by addition of 138 mg of N.sup..alpha. -tetradecanoyl-Glu(OSu)-OtBu dissolved in 768 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. 505 mg of intermediate product was obtained. The protection groups of the intermediate product were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 237 mg of the title compound was obtained at a purity of 96.7%. Molecular mass, found by MS: 6053.+-.6, theory: 6046.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =21. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 12.8 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 40
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -hexadecanoyl-Glu(-)--OH]) des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 232 .mu.l of ethyldiisopropylamine, 3000 .mu.l of DMSO and 400 .mu.l of dimetylformamide. The reaction was initiated by addition of 73 mg of N.sup..alpha. -hexadecanoyl-Glu(OSu)-OtBu dissolved in 400 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. The protection groups of the intermediate product were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 153 mg of the title compound was obtained at a purity of 95.2%. Molecular Mass, found by MS: 6073.+-.6, theory: 6074.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =67. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 18.0 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 41
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -lithocholyl-Glu(-)--OH]) des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 148 .mu.l 4-methylmorpholine and 3452 .mu.l of DMSO. The reaction was initiated by addition of 132 mg of N.sup..alpha. -lithocholoyl-Glu(OSu)-OtBu dissolved in 400 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. 493 mg of intermediate product was obtained. The protection groups of the intermediate product were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 209 mg of the title compound was obtained at a purity of 97.4%. Molecular Mass, found by MS: 6185.+-.10, theory: 6194.
Example 42
Lys.sup.B29 (N.sup..epsilon. -N.sup..alpha. -tetradecanoyl Aad(-)--OH]) des(B30) Human Insulin
Aad is 5-aminohexadioic acid. 347 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 129 .mu.l of 4-methylmorpholine and 2645 .mu.l of DMSO. The reaction was initiated by addition of 58 mg of N.sup..alpha. -tetradecanoyl-Aad(OSu)-OtBu dissolved in 694 .mu.l of DMF. The activated ester was prepared in analogy with chemistry well-known from as aspartic acid derivatisation (L. Benoiton: Can.J.Chem.40,570-72,1962, R. Roeske: J.Org.Chem 28 1251-93 (1963)). The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. The protection groups of the intermediate product were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
Thus 149 mg of the title compound was obtained at a purity of 97.9%. Molecular Mass, found by MS: 6061.+-.2, theory: 6060.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =21. The determination was carried out as described on page 23 of the description.
The disappearance half-life, T.sub.50%, of the title compound after subcutaneous injection in pigs was found to be 16.1 hours. The determination was carried out as described on page 24 of the description using a composition similar to the one described in the present Example 31.
Example 43
Synthesis of Lys.sup.B29 (N.sup..epsilon. -[N.sup..alpha. -tetradecanoyl-.gamma.-carboxy-Glu-]) des(B30) Human Insulin
400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved in a mixture of 190 .mu.l of triethylamine and 3000 .mu.l of DMSO. The reaction was initiated by addition of 83 mg of .gamma.-carboxy Glu N-tetradecansyre .gamma.,.gamma.'-di(OtBu) .alpha.-(OSu) (i.e. (tBuOCO).sub.2 CHCH.sub.2 --CH(COOSu)-NH--CO(CH.sub.2).sub.12 CH.sub.3) dissolved in 800 .mu.l of DMF. The reaction was conducted at 15.degree. C. and it was stopped after 4.5 hours. The remaining process steps were performed as described in Example 34. The protection groups of the intermediate product were removed by TFA before purification by RP-HPLC and final isolation by precipitation and vacuum drying.
63 mg of the title compound were obtained. Molecular Mass, found by MS: 6090 .+-.3, theory: 6091.
The lipophilicity of the title compound, relative to human insulin, k'.sub.rel =10. The determination was carried out as described on page 23 of the description.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 49- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 21 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cy - #s Ser Leu Tyr Gln Leu# 15- Glu Asn Tyr Cys Xaa 20- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 30 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Xaa Val Xaa Gln His Leu Cys Gly Ser His Le - #u Val Glu Ala Leu Tyr# 15- Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Th - #r Pro Lys Xaa# 30- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 110 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- TGGCTAAGAG ATTCGTTGAC CAACACTTGT GCGGTTCTCA CTTGGTTGAA GC - #TTTGTACT 60# 110AGAGGT TTCTTCTACA CTCCAAAGTC TGACGACGCT- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 100 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- CTGCGGGCTG CGTCTAAGCA CAGTAGTTTT CCAATTGGTA CAAAGAACAG AT - #AGAAGTAC 60# 100 ACCC TTAGCGTCGT CAGACTTTGG- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:# 25 GATT CGTTG- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:# 27 GGGC TGCGTCT- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 110 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- TGGCTAAGAG ATTCGTTACT CAACACTTGT GCGGTTCTCA CTTGGTTGAA GC - #TTTGTACT 60# 110AGAGGT TTCTTCTACA CTCCAAAGTC TGACGACGCT- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 25 GATT CGTTA- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 100 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- CTGCGGGCTG CGTCTAACCA CAGTAGTTTT CCAATTGGTA CAAAGAACAG AT - #AGAAGTAC 60# 100 ACCC TTAGCGTCGT CAGACTTTGG- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 27 CTGC GGGCTGC- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 78 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- CACTTGGTTG AAGCTTTGTA CTTGGTTTGT GGTGAAAGAG GTTTCTTCTA CA - #CTCCAAAG 60# 78 AA- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 63 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- GCTAACGTCG CCATGGCTAA GAGAGAAGAA GCTGAAGCTG AAGCTAGATT CG - #TTAACCAA 60# 63- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 65 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- GCTAACGTCG CCATGGCTAA GAGAGAAGAA GCTGAAGCGA AGCTGAAAGA TT - #CGTTAACC 60# 65- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..391- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT AAC CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Asn Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCA AAG TCT GAC GAC GCT AAG GGT ATC GT - #T GAA CAA TGT TGT ACT 352Thr Pro Lys Ser Asp Asp Ala Lys Gly Ile Va - #l Glu Gln Cys Cys Thr# 90- TCT ATC TGT TCT TTG TAC CAA TTG GAA AAC TA - #C TGT AAC TAGACGCAGC 401Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ty - #r Cys Asn# 100# 415- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 104 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Asn Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Ser Asp# 80- Asp Ala Lys Gly Ile Val Glu Gln Cys Cys Th - #r Ser Ile Cys Ser Leu# 95- Tyr Gln Leu Glu Asn Tyr Cys Asn 100- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #TTGGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGT TTCAGACTGC TGCGATTCCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 360- AAGAAACATG GTTAACCTTT TGATGACATT GATCTGCGTC GGGCGTCCGA GA - #TCT 415- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..499- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ATTAAAAGA ATG AGA TTT CCT TCA ATT TTT - # ACT GCA GTT TTA 112# Met Arg Phe Pro Ser Ile Phe Thr Ala - # Val Leu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 160Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 208Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 256Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 304Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCT TTG GAT AAG AGA GA - #A GTT AAC CAA CAC TTG 352Lys Glu Glu Gly Val Ser Leu Asp Lys Arg Gl - #u Val Asn Gln His Leu# 90- TGC GGT TCT CAC TTG GTT GAA GCT TTG TAC TT - #G GTT TGT GGT GAA AGA 400Cys Gly Ser His Leu Val Glu Ala Leu Tyr Le - #u Val Cys Gly Glu Arg# 105- GGT TTC TTC TAC ACT GAA AAG TCT GAC GAC GC - #T AAG GGT ATC GTT GAA 448Gly Phe Phe Tyr Thr Glu Lys Ser Asp Asp Al - #a Lys Gly Ile Val Glu# 120- CAA TGT TGT ACT TCT ATC TGT TCT TTG TAC CA - #A TTG GAA AAC TAC TGT 496Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gl - #n Leu Glu Asn Tyr Cys# 135# 523 GCAGGCTC TAGAAsn140- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 140 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Leu Asp Lys Arg Glu Val Asn Gln His Le - #u Cys Gly Ser His Leu# 95- Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Ar - #g Gly Phe Phe Tyr Thr# 110- Glu Lys Ser Asp Asp Ala Lys Gly Ile Val Gl - #u Gln Cys Cys Thr Ser# 125- Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cy - #s Asn# 140- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TAATTTTCTT ACTCTAAAGG AAGTTAAAAA TGACGTCAAA AT - #AAGCGTCG 120- TAGGAGGCGT AATCGACGAG GTCAGTTGTG ATGTTGTCTT CTACTTTGCC GT - #GTTTAAGG 180- CCGACTTCGA CAGTAGCCAA TGAGTCTAAA TCTTCCCCTA AAGCTACAAC GA - #CAAAACGG 240- TAAAAGGTTG TCGTGTTTAT TGCCCAATAA CAAATATTTA TGATGATAAC GG - #TCGTAACG 300- ACGATTTCTT CTTCCCCATA GAAACCTATT CTCTCTTCAA TTGGTTGTGA AC - #ACGCCAAG 360- AGTGAACCAA CTTCGAAACA TGAACCAAAC ACCACTTTCT CCAAAGAAGA TG - #TGACTTTT 420- CAGACTGCTG CGATTCCCAT AGCAACTTGT TACAACATGA AGATAGACAA GA - #AACATGGT 480#523 TTGA TCTGCGTCGG GCGTCCGAGA TCT- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..391- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT GAC CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Asp Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCA AAG TCT GAC GAC GCT AAG GGT ATC GT - #T GAA CAA TGT TGT ACT 352Thr Pro Lys Ser Asp Asp Ala Lys Gly Ile Va - #l Glu Gln Cys Cys Thr# 90- TCT ATC TGT TCT TTG TAC CAA TTG GAA AAC TA - #C TGT GCT TAGACGCAGC 401Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ty - #r Cys Ala# 100# 415- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 104 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Asp Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Ser Asp# 80- Asp Ala Lys Gly Ile Val Glu Gln Cys Cys Th - #r Ser Ile Cys Ser Leu# 95- Tyr Gln Leu Glu Asn Tyr Cys Ala 100- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #CTGGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGT TTCAGACTGC TGCGATTCCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 360- AAGAAACATG GTTAACCTTT TGATGACACG AATCTGCGTC GGGCGTCCGA GA - #TCT 415- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..391- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT ACT CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Thr Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCA AAG TCT GAC GAC GCT AAG GGT ATC GT - #T GAA CAA TGT TGT ACT 352Thr Pro Lys Ser Asp Asp Ala Lys Gly Ile Va - #l Glu Gln Cys Cys Thr# 90- TCT ATC TGT TCT TTG TAC CAA TTG GAA AAC TA - #C TGT GCT TAGACGCAGC 401Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ty - #r Cys Ala# 100# 415- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 104 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Thr Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Ser Asp# 80- Asp Ala Lys Gly Ile Val Glu Gln Cys Cys Th - #r Ser Ile Cys Ser Leu# 95- Tyr Gln Leu Glu Asn Tyr Cys Ala 100- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #TGAGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGT TTCAGACTGC TGCGATTCCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 360- AAGAAACATG GTTAACCTTT TGATGACACG AATCTGCGTC GGGCGTCCGA GA - #TCT 415- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..391- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT GAC CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Asp Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCA AAG TCT GAC GAC GCT AAG GGT ATC GT - #T GAA CAA TGT TGT ACT 352Thr Pro Lys Ser Asp Asp Ala Lys Gly Ile Va - #l Glu Gln Cys Cys Thr# 90- TCT ATC TGT TCT TTG TAC CAA TTG GAA AAC TA - #C TGT GGT TAGACGCAGC 401Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ty - #r Cys Gly# 100# 415- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 104 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Asp Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Ser Asp# 80- Asp Ala Lys Gly Ile Val Glu Gln Cys Cys Th - #r Ser Ile Cys Ser Leu# 95- Tyr Gln Leu Glu Asn Tyr Cys Gly 100- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #CTGGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGT TTCAGACTGC TGCGATTCCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 360- AAGAAACATG GTTAACCTTT TGATGACACC AATCTGCGTC GGGCGTCCGA GA - #TCT 415- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..391- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT ACT CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Thr Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCA AAG TCT GAC GAC GCT AAG GGT ATC GT - #T GAA CAA TGT TGT ACT 352Thr Pro Lys Ser Asp Asp Ala Lys Gly Ile Va - #l Glu Gln Cys Cys Thr# 90- TCT ATC TGT TCT TTG TAC CAA TTG GAA AAC TA - #C TGT GGT TAGACGCAGC 401Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ty - #r Cys Gly# 100# 415- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 104 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Thr Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Ser Asp# 80- Asp Ala Lys Gly Ile Val Glu Gln Cys Cys Th - #r Ser Ile Cys Ser Leu# 95- Tyr Gln Leu Glu Asn Tyr Cys Gly 100- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #TGAGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGT TTCAGACTGC TGCGATTCCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 360- AAGAAACATG GTTAACCTTT TGATGACACC AATCTGCGTC GGGCGTCCGA GA - #TCT 415- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..499- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ATTAAAAGA ATG AGA TTT CCT TCA ATT TTT - # ACT GCA GTT TTA 112# Met Arg Phe Pro Ser Ile Phe Thr Ala - # Val Leu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 160Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 208Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 256Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 304Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCT TTG GAT AAG AGA TT - #C GTT AAC CAA CAC TTG 352Lys Glu Glu Gly Val Ser Leu Asp Lys Arg Ph - #e Val Asn Gln His Leu# 90- TGC GGT TCT CAC TTG GTT GAA GCT TTG TAC TT - #G GTT TGT GGT GAA AGA 400Cys Gly Ser His Leu Val Glu Ala Leu Tyr Le - #u Val Cys Gly Glu Arg# 105- GGT TTC TTC TAC ACT CCA AAG TCT GAC GAC GC - #T AAG GGT ATC GTT GAA 448Gly Phe Phe Tyr Thr Pro Lys Ser Asp Asp Al - #a Lys Gly Ile Val Glu# 120- CAA TGT TGT ACT TCT ATC TGT TCT TTG TAC CA - #A TTG GAA AAC TAC TGT 496Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gl - #n Leu Glu Asn Tyr Cys# 135# 523 GCAGGCTC TAGAAsn140- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 140 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Leu Asp Lys Arg Phe Val Asn Gln His Le - #u Cys Gly Ser His Leu# 95- Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Ar - #g Gly Phe Phe Tyr Thr# 110- Pro Lys Ser Asp Asp Ala Lys Gly Ile Val Gl - #u Gln Cys Cys Thr Ser# 125- Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cy - #s Asn# 140- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TAATTTTCTT ACTCTAAAGG AAGTTAAAAA TGACGTCAAA AT - #AAGCGTCG 120- TAGGAGGCGT AATCGACGAG GTCAGTTGTG ATGTTGTCTT CTACTTTGCC GT - #GTTTAAGG 180- CCGACTTCGA CAGTAGCCAA TGAGTCTAAA TCTTCCCCTA AAGCTACAAC GA - #CAAAACGG 240- TAAAAGGTTG TCGTGTTTAT TGCCCAATAA CAAATATTTA TGATGATAAC GG - #TCGTAACG 300- ACGATTTCTT CTTCCCCATA GAAACCTATT CTCTAAGCAA TTGGTTGTGA AC - #ACGCCAAG 360- AGTGAACCAA CTTCGAAACA TGAACCAAAC ACCACTTTCT CCAAAGAAGA TG - #TGAGGTTT 420- CAGACTGCTG CGATTCCCAT AGCAACTTGT TACAACATGA AGATAGACAA GA - #AACATGGT 480#523 TTGA TCTGCGTCGG GCGTCCGAGA TCT- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 409 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..385- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ACCAAAAGA ATG AAG GCT GTT TTC TTG GTT - # TTG TCC TTG ATC 112# Met Lys Ala Val Phe Leu Val Leu Ser - # Leu Ile# 10- GGA TTC TGC TGG GCC CAA CCA GTC ACT GGC GA - #T GAA TCA TCT GTT GAG 160Gly Phe Cys Trp Ala Gln Pro Val Thr Gly As - #p Glu Ser Ser Val Glu# 25- ATT CCG GAA GAG TCT CTG ATC ATC GCT GAA AA - #C ACC ACT TTG GCT AAC 208Ile Pro Glu Glu Ser Leu Ile Ile Ala Glu As - #n Thr Thr Leu Ala Asn# 40- GTC GCC ATG GCT AAG AGA TTC GTT AAC CAA CA - #C TTG TGC GGT TCT CAC 256Val Ala Met Ala Lys Arg Phe Val Asn Gln Hi - #s Leu Cys Gly Ser His# 55- TTG GTT GAA GCT TTG TAC TTG GTT TGT GGT GA - #A AGA GGT TTC TTC TAC 304Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Gl - #u Arg Gly Phe Phe Tyr# 75- ACT CCT AAG GAA AAG AGA GGT ATC GTT GAA CA - #A TGT TGT ACT TCT ATC 352Thr Pro Lys Glu Lys Arg Gly Ile Val Glu Gl - #n Cys Cys Thr Ser Ile# 90- TGT TCT TTG TAC CAA TTG GAA AAC TAC TGT GG - #T TAGACGCAGC CCGCAGGCTC 405Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Gl - #y# 100# 409- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 102 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- Met Lys Ala Val Phe Leu Val Leu Ser Leu Il - #e Gly Phe Cys Trp Ala# 15- Gln Pro Val Thr Gly Asp Glu Ser Ser Val Gl - #u Ile Pro Glu Glu Ser# 30- Leu Ile Ile Ala Glu Asn Thr Thr Leu Ala As - #n Val Ala Met Ala Lys# 45- Arg Phe Val Asn Gln His Leu Cys Gly Ser Hi - #s Leu Val Glu Ala Leu# 60- Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty - #r Thr Pro Lys Glu Lys# 80- Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Il - #e Cys Ser Leu Tyr Gln# 95- Leu Glu Asn Tyr Cys Gly 100- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 409 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TGGTTTTCTT ACTTCCGACA AAAGAACCAA AACAGGAACT AG - #CCTAAGAC 120- GACCCGGGTT GGTCAGTGAC CGCTACTTAG TAGACAACTC TAAGGCCTTC TC - #AGAGACTA 180- GTAGCGACTT TTGTGGTGAA ACCGATTGCA GCGGTACCGA TTCTCTAAGC AA - #TTGGTTGT 240- GAACACGCCA AGAGTGAACC AACTTCGAAA CATGAACCAA ACACCACTTT CT - #CCAAAGAA 300- GATGTGAGGA TTCCTTTTCT CTCCATAGCA ACTTGTTACA ACATGAAGAT AG - #ACAAGAAA 360# 409GATGA CACCAATCTG CGTCGGGCGT CCGAGATCT- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 511 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 77..487- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:- GAATTCCATT CAAGAATAGT TCAAACAAGA AGATTACAAA CTATCAATTT CA - #TACACAAT 60#ACT GCA GTT TTA 109 TTT CCT TCA ATT TTT#Met Arg Phe Pro Ser Ile Phe Thr Ala Val L - #eu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 157Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 205Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 253Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 301Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCC ATG GCT AAG AGA TT - #C GTT AAC CAA CAC TTG 349Lys Glu Glu Gly Val Ser Met Ala Lys Arg Ph - #e Val Asn Gln His Leu# 90- TGC GGT TCC CAC TTG GTT GAA GCT TTG TAC TT - #G GTT TGT GGT GAA AGA 397Cys Gly Ser His Leu Val Glu Ala Leu Tyr Le - #u Val Cys Gly Glu Arg# 105- GGT TTC TTC TAC ACT CCA AAG ACT AGA GGT AT - #C GTT GAA CAA TGT TGT 445Gly Phe Phe Tyr Thr Pro Lys Thr Arg Gly Il - #e Val Glu Gln Cys Cys# 120- ACT TCT ATC TGT TCT TTG TAC CAA TTG GAA AA - #C TAC TGC AAC# 487Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu As - #n Tyr Cys Asn# 135# 511GCTC TAGA- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 137 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Met Ala Lys Arg Phe Val Asn Gln His Le - #u Cys Gly Ser His Leu# 95- Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Ar - #g Gly Phe Phe Tyr Thr# 110- Pro Lys Thr Arg Gly Ile Val Glu Gln Cys Cy - #s Thr Ser Ile Cys Ser# 125- Leu Tyr Gln Leu Glu Asn Tyr Cys Asn# 135- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 511 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:- CTTAAGGTAA GTTCTTATCA AGTTTGTTCT TCTAATGTTT GATAGTTAAA GT - #ATGTGTTA 60- TATTTGCTAA TTTTCTTACT CTAAAGGAAG TTAAAAATGA CGTCAAAATA AG - #CGTCGTAG 120- GAGGCGTAAT CGACGAGGTC AGTTGTGATG TTGTCTTCTA CTTTGCCGTG TT - #TAAGGCCG 180- ACTTCGACAG TAGCCAATGA GTCTAAATCT TCCCCTAAAG CTACAACGAC AA - #AACGGTAA 240- AAGGTTGTCG TGTTTATTGC CCAATAACAA ATATTTATGA TGATAACGGT CG - #TAACGACG 300- ATTTCTTCTT CCCCATAGGT ACCGATTCTC TAAGCAATTG GTTGTGAACA CG - #CCAAGGGT 360- GAACCAACTT CGAAACATGA ACCAAACACC ACTTTCTCCA AAGAAGATGT GA - #GGTTTCTG 420- ATCTCCATAG CAACTTGTTA CAACATGAAG ATAGACAAGA AACATGGTTA AC - #CTTTTGAT 480# 511 GGGC GTCCGAGATC T- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 80..499- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- ATCGAATTCC ATTCAAGAAT AGTTCAAACA AGAAGATTAC AAACTATCAA TT - #TCATACAC 60- AATATAAACG ATTAAAAGA ATG AGA TTT CCT TCA ATT TTT - # ACT GCA GTT TTA 112# Met Arg Phe Pro Ser Ile Phe Thr Ala - # Val Leu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 160Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 208Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 256Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 304Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCC ATG GCT AAG AGA TT - #C GTT AAC CAA CAC TTG 352Lys Glu Glu Gly Val Ser Met Ala Lys Arg Ph - #e Val Asn Gln His Leu# 90- TGC GGT TCC CAC TTG GTT GAA GCT TTG TAC TT - #G GTT TGC GGT GAA AGA 400Cys Gly Ser His Leu Val Glu Ala Leu Tyr Le - #u Val Cys Gly Glu Arg# 105- GGT TTC TTC TAC ACT CCT AAG TCT GAC GAT GC - #T AAG GGT ATT GTC GAG 448Gly Phe Phe Tyr Thr Pro Lys Ser Asp Asp Al - #a Lys Gly Ile Val Glu# 120- CAA TGC TGT ACC TCC ATC TGC TCC TTG TAC CA - #A TTG GAA AAC TAC TGC 496Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gl - #n Leu Glu Asn Tyr Cys# 135# 523 GCAGGCTC TAGAAsn140- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 140 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Met Ala Lys Arg Phe Val Asn Gln His Le - #u Cys Gly Ser His Leu# 95- Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Ar - #g Gly Phe Phe Tyr Thr# 110- Pro Lys Ser Asp Asp Ala Lys Gly Ile Val Gl - #u Gln Cys Cys Thr Ser# 125- Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cy - #s Asn# 140- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 523 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:- TAGCTTAAGG TAAGTTCTTA TCAAGTTTGT TCTTCTAATG TTTGATAGTT AA - #AGTATGTG 60- TTATATTTGC TAATTTTCTT ACTCTAAAGG AAGTTAAAAA TGACGTCAAA AT - #AAGCGTCG 120- TAGGAGGCGT AATCGACGAG GTCAGTTGTG ATGTTGTCTT CTACTTTGCC GT - #GTTTAAGG 180- CCGACTTCGA CAGTAGCCAA TGAGTCTAAA TCTTCCCCTA AAGCTACAAC GA - #CAAAACGG 240- TAAAAGGTTG TCGTGTTTAT TGCCCAATAA CAAATATTTA TGATGATAAC GG - #TCGTAACG 300- ACGATTTCTT CTTCCCCATA GGTACCGATT CTCTAAGCAA TTGGTTGTGA AC - #ACGCCAAG 360- GGTGAACCAA CTTCGAAACA TGAACCAAAC GCCACTTTCT CCAAAGAAGA TG - #TGAGGATT 420- CAGACTGCTA CGATTCCCAT AACAGCTCGT TACGACATGG AGGTAGACGA GG - #AACATGGT 480#523 TTGA TCTGCGTCGG GCGTCCGAGA TCT- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 535 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 77..511- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:- GAATTCCATT CAAGAATAGT TCAAACAAGA AGATTACAAA CTATCAATTT CA - #TACACAAT 60#ACT GCA GTT TTA 109 TTT CCT TCA ATT TTT#Met Arg Phe Pro Ser Ile Phe Thr Ala Val L - #eu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 157Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 205Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 253Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 301Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCC ATG GCT AAG AGA GA - #A GAA GCT GAA GCT GAA 349Lys Glu Glu Gly Val Ser Met Ala Lys Arg Gl - #u Glu Ala Glu Ala Glu# 90- GCT AGA TTC GTT AAC CAA CAC TTG TGC GGT TC - #C CAC TTG GTT GAA GCT 397Ala Arg Phe Val Asn Gln His Leu Cys Gly Se - #r His Leu Val Glu Ala# 105- TTG TAC TTG GTT TGT GGT GAA AGA GGT TTC TT - #C TAC ACT CCA AAG ACT 445Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Ph - #e Tyr Thr Pro Lys Thr# 120- AGA GGT ATC GTT GAA CAA TGT TGT ACT TCT AT - #C TGT TCT TTG TAC CAA 493Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Il - #e Cys Ser Leu Tyr Gln# 135- TTG GAA AAC TAC TGC AAC TAGACGCAGC CCGCAGGCTC TA - #GA# 535Leu Glu Asn Tyr Cys Asn140 1 - #45- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 145 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Met Ala Lys Arg Glu Glu Ala Glu Ala Gl - #u Ala Arg Phe Val Asn# 95- Gln His Leu Cys Gly Ser His Leu Val Glu Al - #a Leu Tyr Leu Val Cys# 110- Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Th - #r Arg Gly Ile Val Glu# 125- Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gl - #n Leu Glu Asn Tyr Cys# 140- Asn145- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 535 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:- CTTAAGGTAA GTTCTTATCA AGTTTGTTCT TCTAATGTTT GATAGTTAAA GT - #ATGTGTTA 60- TATTTGCTAA TTTTCTTACT CTAAAGGAAG TTAAAAATGA CGTCAAAATA AG - #CGTCGTAG 120- GAGGCGTAAT CGACGAGGTC AGTTGTGATG TTGTCTTCTA CTTTGCCGTG TT - #TAAGGCCG 180- ACTTCGACAG TAGCCAATGA GTCTAAATCT TCCCCTAAAG CTACAACGAC AA - #AACGGTAA 240- AAGGTTGTCG TGTTTATTGC CCAATAACAA ATATTTATGA TGATAACGGT CG - #TAACGACG 300- ATTTCTTCTT CCCCATAGGT ACCGATTCTC TCTTCTTCGA CTTCGACTTC GA - #TCTAAGCA 360- ATTGGTTGTG AACACGCCAA GGGTGAACCA ACTTCGAAAC ATGAACCAAA CA - #CCACTTTC 420- TCCAAAGAAG ATGTGAGGTT TCTGATCTCC ATAGCAACTT GTTACAACAT GA - #AGATAGAC 480- AAGAAACATG GTTAACCTTT TGATGACGTT GATCTGCGTC GGGCGTCCGA GA - #TCT 535- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 538 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 77..514- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:- GAATTCCATT CAAGAATAGT TCAAACAAGA AGATTACAAA CTATCAATTT CA - #TACACAAT 60#ACT GCA GTT TTA 109 TTT CCT TCA ATT TTT#Met Arg Phe Pro Ser Ile Phe Thr Ala Val L - #eu# 10- TTC GCA GCA TCC TCC GCA TTA GCT GCT CCA GT - #C AAC ACT ACA ACA GAA 157Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Va - #l Asn Thr Thr Thr Glu# 25- GAT GAA ACG GCA CAA ATT CCG GCT GAA GCT GT - #C ATC GGT TAC TCA GAT 205Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Va - #l Ile Gly Tyr Ser Asp# 40- TTA GAA GGG GAT TTC GAT GTT GCT GTT TTG CC - #A TTT TCC AAC AGC ACA 253Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pr - #o Phe Ser Asn Ser Thr# 55- AAT AAC GGG TTA TTG TTT ATA AAT ACT ACT AT - #T GCC AGC ATT GCT GCT 301Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Il - #e Ala Ser Ile Ala Ala# 75- AAA GAA GAA GGG GTA TCC ATG GCT AAG AGA GA - #A GAA GCT GAA GCT GAA 349Lys Glu Glu Gly Val Ser Met Ala Lys Arg Gl - #u Glu Ala Glu Ala Glu# 90- GCT GAA AGA TTC GTT AAC CAA CAC TTG TGC GG - #T TCC CAC TTG GTT GAA 397Ala Glu Arg Phe Val Asn Gln His Leu Cys Gl - #y Ser His Leu Val Glu# 105- GCT TTG TAC TTG GTT TGT GGT GAA AGA GGT TT - #C TTC TAC ACT CCA AAG 445Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Ph - #e Phe Tyr Thr Pro Lys# 120- ACT AGA GGT ATC GTT GAA CAA TGT TGT ACT TC - #T ATC TGT TCT TTG TAC 493Thr Arg Gly Ile Val Glu Gln Cys Cys Thr Se - #r Ile Cys Ser Leu Tyr# 135- CAA TTG GAA AAC TAC TGC AAC TAGACGCAGC CCGCAGGCT - #C TAGA 53 - #8Gln Leu Glu Asn Tyr Cys Asn140 1 - #45- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 146 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:- Met Arg Phe Pro Ser Ile Phe Thr Ala Val Le - #u Phe Ala Ala Ser Ser# 15- Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Gl - #u Asp Glu Thr Ala Gln# 30- Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser As - #p Leu Glu Gly Asp Phe# 45- Asp Val Ala Val Leu Pro Phe Ser Asn Ser Th - #r Asn Asn Gly Leu Leu# 60- Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Al - #a Lys Glu Glu Gly Val# 80- Ser Met Ala Lys Arg Glu Glu Ala Glu Ala Gl - #u Ala Glu Arg Phe Val# 95- Asn Gln His Leu Cys Gly Ser His Leu Val Gl - #u Ala Leu Tyr Leu Val# 110- Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Ly - #s Thr Arg Gly Ile Val# 125- Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Ty - #r Gln Leu Glu Asn Tyr# 140- Cys Asn145- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 538 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:- CTTAAGGTAA GTTCTTATCA AGTTTGTTCT TCTAATGTTT GATAGTTAAA GT - #ATGTGTTA 60- TATTTGCTAA TTTTCTTACT CTAAAGGAAG TTAAAAATGA CGTCAAAATA AG - #CGTCGTAG 120- GAGGCGTAAT CGACGAGGTC AGTTGTGATG TTGTCTTCTA CTTTGCCGTG TT - #TAAGGCCG 180- ACTTCGACAG TAGCCAATGA GTCTAAATCT TCCCCTAAAG CTACAACGAC AA - #AACGGTAA 240- AAGGTTGTCG TGTTTATTGC CCAATAACAA ATATTTATGA TGATAACGGT CG - #TAACGACG 300- ATTTCTTCTT CCCCATAGGT ACCGATTCTC TCTTCTTCGA CTTCGACTTC GA - #CTTTCTAA 360- GCAATTGGTT GTGAACACGC CAAGGGTGAA CCAACTTCGA AACATGAACC AA - #ACACCACT 420- TTCTCCAAAG AAGATGTGAG GTTTCTGATC TCCATAGCAA CTTGTTACAA CA - #TGAAGATA 480- GACAAGAAAC ATGGTTAACC TTTTGATGAC GTTGATCTGC GTCGGGCGTC CG - #AGATCT 538__________________________________________________________________________
Claims
  • 1. An insulin derivative having the following sequence: ##STR2## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;
  • (b) Xaa at position B1 is Phe or is deleted;
  • (c) Xaa at position B30 is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; and
  • (d) the .epsilon.-amino group of Lys.sup.B29 is substituted with a lipophilic substituent having at least 10 carbon atoms;
  • wherein the insulin derivative is a Zn.sup.2+ complex and the Zn.sup.2+ complex of the insulin derivative is more water soluble than the insulin derivative without Zn.sup.2+.
  • 2. The insulin derivative according to claim 1, wherein Xaa at position A21 is Asn.
  • 3. The insulin derivative according to claim 2, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 4. The insulin derivative according to claim 1, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser.
  • 5. The insulin derivative according to claim 4, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 6. The insulin derivative according to claim 1, wherein Xaa at position B1 is deleted.
  • 7. The insulin derivative according to claim 6, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 8. The insulin derivative according to claim 1, wherein Xaa at position B1 is Phe.
  • 9. The insulin derivative according to claim 8, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 10. The insulin derivative according to claim 1, wherein Xaa at position B3 is Asn, Asp, Gln or Thr.
  • 11. The insulin derivative according to claim 10, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 12. The insulin derivative according to claim 1, wherein Xaa at position B30 is Ala or Thr.
  • 13. The insulin derivative according to claim 12, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 14. The insulin derivative according to claim 1, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser, Xaa at position B3 is Asn, Asp, Gln or Thr, and Xaa at position B30 is Ala or Thr.
  • 15. The insulin derivative according to claim 14, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 16. The insulin derivative according to claim 1, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, Xaa at position B1 is Phe and Xaa at position B30 is Thr.
  • 17. The insulin derivative according to claim 16, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 18. The insulin derivative according to claim 1, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 19. The insulin derivative according to claim 1 which is in the form of a hexamer.
  • 20. The insulin derivative according to claim 19, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 21. The insulin derivative according to claim 19, wherein Xaa at position A21 is Asn, Xaa at position B1 is Phe, Xaa at position B3 is Asn, and Xaa at position B30 is Thr.
  • 22. The insulin derivative according to claim 19, wherein two zinc ions bind to the hexamer.
  • 23. The insulin derivative according to claim 22, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 24. The insulin derivative according to claim 19, wherein three zinc ions bind to the hexamer.
  • 25. The insulin derivative according to claim 24, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 26. The insulin derivative according to claim 19, wherein four zinc ions bind to the hexamer.
  • 27. The insulin derivative according to claim 26, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 28. A pharmaceutical composition which is an aqueous solution, comprising (a) an insulin derivative according to claim 1, (b) an isotonic agent, (c) a preservative and (d) a buffer.
  • 29. The pharmaceutical composition according to claim 28, wherein the pH of the aqueous solution is in the range of 6.5-8.5.
  • 30. The pharmaceutical composition according to claim 28, wherein the solubility of the insulin derivative exceeds 600 nmol/ml of the aqueous solution.
  • 31. The pharmaceutical composition according to claim 28, further comprising an insulin or an insulin analogue which has a rapid onset of action.
  • 32. The pharmaceutical composition according to claim 28, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, Xaa at position B1 is Phe and Xaa at position B30 is Thr.
  • 33. The pharmaceutical composition according to claim 28, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 34. The pharmaceutical composition according to claim 28, wherein the insulin derivative is in the form of a hexamer.
  • 35. A method of treating diabetes in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition according to claim 28.
  • 36. The insulin derivative of claim 1, wherein the lipophilic substituent is cyclohexylvaleroyl.
  • 37. The insulin derivative of claim 1, wherein the lipophilic substituent is acyl-glutamyl wherein the acyl is a linear, saturated acyl having 6 to 24 carbon atoms.
  • 38. The insulin derivative of claim 1, wherein the lipophilic substituent is lauroyl.
  • 39. The insulin derivative of claim 1, wherein the lipophilic substituent is myristoyl.
  • 40. The insulin derivative of claim 1, wherein the lipophilic substituent is palmitoyl.
  • 41. The insulin derivative of claim 1, wherein the lipophilic substituent is 2-succinylamido myristic acid.
  • 42. The insulin derivative of claim 1, wherein the lipophilic substituent is 2-succinylamido palmitic acid.
  • 43. The insulin derivative of claim 1, wherein the lipophilic substituent is 2-succinylamidoethyloxy palmitic acid.
  • 44. The insulin derivative of claim 1, wherein the lipophilic substituent is myristoyl-.alpha.-glutamyl.
  • 45. The insulin derivative of claim 1, wherein the lipophilic substituent is myristoyl-.alpha.-glutamyl-glycyl.
  • 46. The insulin derivative of claim 1, wherein the lipophilic substituent is choloyl.
  • 47. The insulin derivative of claim 1, wherein the lipophilic substituent is 7-deoxycholoyl.
  • 48. The insulin derivative of claim 1, wherein the lipophilic substituent is lithocholoyl.
  • 49. The insulin derivative of claim 1, wherein the lipophilic substituent is lithocholoyl-glutamyl.
  • 50. The insulin derivative of claim 1, wherein the lipophilic substituent is 4-benzoyl-phenylalanine.
  • 51. The insulin derivative of claim 1, wherein the lipophilic substituent is L-thyroxyl.
  • 52. The insulin derivative of claim 1, wherein the lipophilic substituent is suberoyl-D-thyroxine.
  • 53. The insulin derivative of claim 1, wherein the lipophilic substituent is 3,3',5,5'-tetraiodothyroacetyl.
  • 54. An insulin derivative having the following sequence: ##STR3## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;
  • (b) Xaa at position B1 is Phe or is deleted;
  • (c) Xaa at position B30 is deleted; and
  • (d) the .epsilon.-amino group of Lys.sup.B29 is substituted with a lipophilic substituent having at least 10 carbon atoms;
  • wherein the insulin derivative is a Zn.sup.2+ complex and the Zn.sup.2+ complex of the insulin derivative is more water soluble than the insulin derivative without Zn.sup.2+.
  • 55. The insulin derivative according to claim 54, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser.
  • 56. The insulin derivative according to claim 55, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 57. The insulin derivative according to claim 54, wherein Xaa at position B1 is deleted.
  • 58. The insulin derivative according to claim 57, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 59. The insulin derivative according to claim 54, wherein Xaa at position B1 is Phe.
  • 60. The insulin derivative according to claim 59, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 61. The insulin derivative according to claim 54, wherein Xaa at position B3 is Asn, Asp, Gln or Thr.
  • 62. The insulin derivative according to claim 61, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 63. The insulin derivative according to claim 54 wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser, and Xaa at position B3 is Asn, Asp, Gln or Thr.
  • 64. The insulin derivative according to claim 63, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 65. The insulin derivative according to claim 54, wherein Xaa at position A21 is Asn, Xaa at position B1 is Phe, and Xaa at position B3 is Asn.
  • 66. The insulin derivative according to claim 65, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 67. The insulin derivative according to claim 54, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 68. The insulin derivative according to claim 54 which is in the form of a hexamer.
  • 69. The insulin derivative according to claim 68, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 70. The insulin derivative according to claim 68, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, and Xaa at position B1 is Phe.
  • 71. The insulin derivative according to claim 68, wherein two zinc ions bind to the hexamer.
  • 72. The insulin derivative according to claim 71, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 73. The insulin derivative according to claim 68, wherein three zinc ions bind to the hexamer.
  • 74. The insulin derivative according to claim 73, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 75. The insulin derivative according to claim 68, wherein four zinc ions bind to the hexamer.
  • 76. The insulin derivative according to claim 75, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 77. A pharmaceutical composition which is an aqueous solution, comprising (a) an insulin derivative according to claim 54, (b) an isotonic agent, (c) a preservative and (d) a buffer.
  • 78. The pharmaceutical composition according to claim 77, wherein the pH of the aqueous solution is in the range of 6.5-8.5.
  • 79. The pharmaceutical composition according to claim 77, wherein the solubility of the insulin derivative exceeds 600 nmol/ml of the aqueous solution.
  • 80. The pharmaceutical composition according to claim 77, further comprising an insulin or an insulin analogue which has a rapid onset of action.
  • 81. The pharmaceutical composition according to claim 77, wherein the insulin derivative is a Zn.sup.2+ complex.
  • 82. The pharmaceutical composition according to claim 77, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, and Xaa at position B1 is Phe.
  • 83. The pharmaceutical composition according to claim 77, wherein the lipophilic substituent has from 12 to 24 carbon atoms.
  • 84. The pharmaceutical composition according to claim 77, wherein the insulin derivative is in the form of a hexamer.
  • 85. A method of treating diabetes in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition according to claim 77.
  • 86. The insulin derivative of claim 54, wherein the lipophilic substituent is cyclohexylvaleroyl.
  • 87. The insulin derivative of claim 54, wherein the lipophilic substituent is acyl-glutamyl wherein the acyl is a linear, saturated acyl having 6 to 24 carbon atoms.
  • 88. The insulin derivative of claim 54, wherein the lipophilic substituent is lauroyl.
  • 89. The insulin derivative of claim 54, wherein the lipophilic substituent is myristoyl.
  • 90. The insulin derivative of claim 54, wherein the lipophilic substituent is palmitoyl.
  • 91. The insulin derivative of claim 54, wherein the lipophilic substituent is 2-succinylamido myristic acid.
  • 92. The insulin derivative of claim 54, wherein the lipophilic substituent is 2-succinylamido palmitic acid.
  • 93. The insulin derivative of claim 54, wherein the lipophilic substituent is 2-succinylamidoethyloxy palmitic acid.
  • 94. The insulin derivative of claim 54, wherein the lipophilic substituent is myristoyl-.alpha.-glutamyl.
  • 95. The insulin derivative of claim 54, wherein the lipophilic substituent is myristoyl-.alpha.-glutamyl-glycyl.
  • 96. The insulin derivative of claim 54, wherein the lipophilic substituent is choloyl.
  • 97. The insulin derivative of claim 54, wherein the lipophilic substituent is 7-deoxycholoyl.
  • 98. The insulin derivative of claim 54, wherein the lipophilic substituent is lithocholoyl.
  • 99. The insulin derivative of claim 54, wherein the lipophilic substituent is lithocholoyl-glutamyl.
  • 100. The insulin derivative of claim 54, wherein the lipophilic substituent is 4-benzoyl-phenylalanine.
  • 101. The insulin derivative of claim 54, wherein the lipophilic substituent is L-thyroxyl.
  • 102. The insulin derivative of claim 54, wherein the lipophilic substituent is suberoyl-D-thyroxine.
  • 103. The insulin derivative of claim 54, wherein the lipophilic substituent is 3,3',5,5'-tetraiodothyroacetyl.
  • 104. An insulin derivative having the following sequence: ##STR4## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;
  • (b) Xaa at position B1 is Phe or is deleted;
  • (c) Xaa at position B30 is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; and
  • (d) the .epsilon.-amino group of Lys.sup.B29 is substituted with a lipophilic substituent having at least 10 carbon atoms;
  • wherein the lipophilic substituent is benzoyl, phenylacetyl, cyclohexylacetyl, 3,5-diiodotyrosyl or cyclohexylpropionyl and the insulin derivative is a Zn.sup.2+ complex and the Zn.sup.2+ complex of the insulin derivative is more water soluble than the insulin derivative without Zn.sup.2+.
  • 105. The insulin derivative of claim 104, wherein the lipophilic substituent is benzoyl.
  • 106. The insulin derivative of claim 104, wherein the lipophilic substituent is phenylacetyl.
  • 107. The insulin derivative of claim 104, wherein the lipophilic substituent is cyclohexylacetyl.
  • 108. The insulin derivative of claim 104, wherein the lipophilic substituent is 3,5-diiodotyrosyl.
  • 109. The insulin derivative of claim 104, wherein the lipophilic substituent is cyclohexylpropionyl.
  • 110. An insulin derivative having the following sequence: ##STR5## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;
  • (b) Xaa at position B1 is Phe or is deleted;
  • (c) Xaa at position B30 is deleted; and
  • (d) the .epsilon.-amino group of Lys.sup.B29 is substituted with a lipophilic substituent having at least 10 carbon atoms;
  • wherein the lipophilic substituent is benzoyl, phenylacetyl, cyclohexylacetyl, 3,5-diidotyrosyl or cyclohexylpropionyl and the insulin derivative is a Zn.sup.2+ complex and the Zn.sup.2+ complex of the insulin derivative is more water soluble than the insulin derivative without Zn.sup.2+.
  • 111. The insulin derivative of claim 110, wherein the lipophilic substituent is benzoyl.
  • 112. The insulin derivative of claim 110, wherein the lipophilic substituent is phenylacetyl.
  • 113. The insulin derivative of claim 110, wherein the lipophilic substituent is cyclohexylacetyl.
  • 114. The insulin derivative of claim 110, wherein the lipophilic substituent is 3,5-diidotyrosyl.
  • 115. The insulin derivative of claim 110, wherein the lipophilic substituent is cyclohexylpropionyl.
Priority Claims (1)
Number Date Country Kind
104493 Sep 1993 DKX
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part of application Ser. No. 08/400,256 filed Mar. 8, 1995 now U.S. Pat. No. 5,750,997, which is a continuation-in-part of Ser No. 08/190,829 filed Feb. 2, 1994, now abandoned, and Ser. No. PCT/DK94/00347 filed Sep. 16, 1994, now abandoned, the contents of which are fully incorporated herein by reference.

US Referenced Citations (7)
Number Name Date Kind
3528960 Haas et al. Sep 1970
3823125 Grant et al. Jul 1974
3868356 Smyth Feb 1975
3950517 Lindsay et al. Apr 1976
4645740 Breddam et al. Feb 1987
5008241 Markussen et al. Apr 1991
5208217 Panayotis May 1993
Foreign Referenced Citations (3)
Number Date Country
57-67548 Apr 1982 JPX
1 492 997 Nov 1977 GBX
WO 9112817 Sep 1991 WOX
Non-Patent Literature Citations (15)
Entry
Markussen et al. Prot. Eng. 1:205-213, 1987.
Markussen et al. Prot. Eng. 2:157-166, 1988.
Gammelhoft. Phys. Rev. 64:1321-1378, 1984.
Samuel et al., (1978) Clin. Exp. Immunol. 33:252-260.
Kurtz et al., (1983) Diabetologia 25:322-324.
Lindsay and Shall: The Acetylation of Insulin Biochem: (1991) 121, pp. 737-745.
Brange and Langkjaer: Chemical Stability of Insulin Acta Pharm. Nord.4(3) 149-158 (1992).
MIMS Annual 1991, Section 6d "Insulin Preparations" (IMS Publishing).
MIMS Annual 1993, Section 6d "Insulin Preparations" (IMS Publishing).
Prescription Products Guide 1992, pp. 942-944, 957-958 and 1307-1308.
J. Schlichtkrull, "Insulin Crystals" (Ejnar Munksgaard) 1958, pp. 21-33.
A Marble et al., Joslin's Diabetes Mellitus, 12th Edition, 1985, pp. 380-382.
Schade: Intensive Insulin Therapy, Exerpta Medica 1983, pp. 7 and 304.
W.O. Foye: Principles of Medicinal Chemistry 1974, pp. 563-565.
Doerge: Wilson and Gisvold's textbook of organic medicinal and pharmaceutical chemistry 1982, pp. 774-776.
Continuation in Parts (2)
Number Date Country
Parent 400256 Mar 1995
Parent 190829