Patent Application
20250137057
The Sequence Listing for this application is labeled “CUHK.221.xml” which was created on Aug. 29, 2023 and is 5,320 bytes. The entire contents of the sequence listing is incorporated herein by reference in its entirety.
Liver cancer is the fourth most common cancer worldwide with approximately 900,000 cases diagnosed annually [1]. It causes over 830,000 deaths annually, making liver cancer the third most common cause of cancer death worldwide [1]. Hepatocellular carcinoma (HCC) is the most common form of liver cancer and accounts for about 90% of the cases. HCC is challenging to manage. Most HCC patients are diagnosed in the advanced stage when patients are not eligible for surgical treatments. This leads to a generally poor prognosis. a 5-year survival rate of 36% in those diagnosed in early stages and less than 13% in late stages [2]. To date, three multikinase inhibitors, sorafenib, regorafenib and lenvatinib, have been approved by the FDA for advanced HCC. However, the benefit of multikinase inhibitors has been modest, with the median survival prolonged by a few months [3, 4].
Currently available biomarkers for HCC are either non-specific or lack treatment indication. Immune checkpoint inhibitors have shown promising effects in different types of cancers; however, their response rate in HCC is low and only effective in some patients [5]. Therefore, there is a pressing need for effective prognostic markers and treatment regimens.
The subject invention relates to methods of using effective prognostic markers to diagnose and treat patients with liver diseases. The present invention provides the use of ADRM1/Rpn13 spliced variant ΔEx9 (ADRM1-ΔEx9) as a biomarker for prediction of prognosis in hepatocellular carcinoma (HCC) patients. By assessing the expression of the ADRM1-ΔEx9 isoform in a patient biopsy or resected tumor, prognostic outcome are predicted. In certain embodiments, ADRM1-ΔEx9 can be a molecular marker to predict the response of HCC cells to PARP1 inhibitors, such as, for example, Olaparib, Rucaparib, Niraparib, Talazoparib, or any combination thereof.
In certain embodiments, Olaparib, Rucaparib, Niraparib, Talazoparib, or other PARP1 inhibitors inhibit the DNA repair enzyme poly ADP ribose polymerase (PARP). It is commonly used for cancer patients with a documented deleterious or suspected deleterious germline mutation in BRCA1 or BRCA2 or a positive laboratory test for genomic instability called homologous recombination DNA-repair deficiency (HRD). In certain embodiments, the therapeutic use of Olaparib, Rucaparib, Niraparib, Talazoparib, or any combination thereof can be used to treat other cancer types, including, for example, breast cancer, ovarian cancer, fallopian tube cancer, peritoneal cancer, pancreatic cancer, and prostate cancer. However, the sensitivity of cancer cells to Olaparib is independent of BRCA mutations or HRD status. In certain embodiments, ADRM1-ΔEx9 is a binding partner of BRCA1 Associated Protein 1 (BAP1). In certain embodiments, increased ADRM1-ΔEx9 expression correlates with enhanced anti-tumor efficacy of Olaparib, Rucaparib, Niraparib, Talazoparib, or other PARP1 inhibitors in patient-derived HCC organoids. In certain embodiments, Olaparib, Rucaparib, Niraparib, Talazoparib, or other PARP1 inhibitors can be used to treat HCC tumors with a high expression of ADRM1-ΔEx9. In certain embodiments, ADRM1-ΔEx9 was overexpressed in 63.9% of HCC patients.
In certain embodiments, an increased expression ADRM1-ΔEx9 caused a reduction in the level of tumor suppressor protein FBXW7. In certain embodiments, deubiquitinase BAP1 is a binding partner to ADRM1-ΔEx9.
The subject invention pertains to methods of diagnosing liver disease, aiding in the diagnosis of liver disease, treating the liver disease, and/or predicting the effectiveness of a treatment of liver disease. More specifically, the subject invention provides methods for using the ADRM1/Rpn13 spliced variant ΔEx9 (ADRM1-ΔEx9) in methods of diagnosing liver disease, aiding in the diagnosis of liver disease, treating the liver disease, and/or predicting the effectiveness of a treatment of liver disease by assessing the expression of the ADRM1-ΔEx9 isoform in a biopsy or resected tumor. In certain embodiments, a PARP1 inhibitor is administered to a subject to treat the liver disease.
As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising”. The transitional terms/phrases (and any grammatical variations thereof) “comprising”, “comprises”, “comprise”, “consisting essentially of”, “consists essentially of”, “consisting” and “consists” can be used interchangeably.
The phrases “consisting essentially of” or “consists essentially of” indicate that the claim encompasses embodiments containing the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claim.
The term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured, i.e., the limitations of the measurement system. In the context of compositions containing amounts of ingredients where the term “about” is used, these compositions contain the stated amount of the ingredient with a variation (error range) of 0-10% around the value (X±10%). In other contexts, the term “about” is used provides a variation (error range) of 0-10% around a given value (X±10%). As is apparent, this variation represents a range that is up to 10% above or below a given value, for example, X±1%, X±2%, X±3%, X±4%, X±5%, X±6%, X±7%, X±8%, X±9%, or X±10%.
In the present disclosure, ranges are stated in shorthand to avoid having to set out at length and describe each and every value within the range. Any appropriate value within the range can be selected, where appropriate, as the upper value, lower value, or the terminus of the range. For example, a range of 0.1-1.0 represents the terminal values of 0.1 and 1.0, as well as the intermediate values of 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and all intermediate ranges encompassed within 0.1-1.0, such as 0.2-0.5, 0.2-0.8, 0.7-1.0, etc. Values having at least two significant digits within a range are envisioned, for example, a range of 5-10 indicates all the values between 5.0 and 10.0 as well as between 5.00 and 10.00 including the terminal values. When ranges are used herein, combinations and subcombinations of ranges (e.g., subranges within the disclosed range) and specific embodiments therein are explicitly included.
“Subject” refers to an animal, such as a mammal, for example a human. The methods described herein can be useful in both humans and non-human animals. In some embodiments, the subject is a mammal (such as an animal model of disease), and in some embodiments, the subject is a human. The terms “subject” and “patient” can be used interchangeably. The animal may be for example, humans, pigs, horses, goats, cats, mice, rats, dogs, apes, fish, chimpanzees, orangutans, guinea pigs, hamsters, cows, sheep, birds, chickens, as well as any other vertebrate or invertebrate with a liver, such as, for example, a cephalopod.
By “reduces” is meant a negative alteration of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.
By “increases” is meant as a positive alteration of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.
The terms “antagonist” and “inhibitor” may be used interchangeably, and they refer to a compound having the ability to inhibit a biological function of a target protein, whether by inhibiting the activity or expression of the target protein. Accordingly, the terms “antagonist” and “inhibitor” are defined in the context of the biological role of the target protein.
In some embodiments of the invention, the method comprises administration of multiple doses of the compositions of the subject invention. The method may comprise administration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, or more therapeutically effective doses of a composition of the subject invention as described herein. In some embodiments, doses are administered over the course of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, 21 days, 30 days, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more than 1 year. Moreover, treatment of a subject with a therapeutically effective amount of the compositions of the invention can include a single treatment or can include a series of treatments. It will also be appreciated that the effective dosage of a composition used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays or imaging techniques for detecting tumor sizes known in the art. In some embodiments of the invention, the method comprises administration of the composition several time per day, including but not limiting to 2 times per day, 3 times per day, and 4 times per day.
“Treatment”, “treating”, “palliating” and “ameliorating” (and grammatical variants of these terms), as used herein, are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit. A therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying cancer such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the cancer.
As used herein, the term “cancer” refers to the presence of cells possessing abnormal growth characteristics, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, perturbed oncogenic signaling, and certain characteristic morphological features.
The term “effective amount” or “therapeutically effective amount” refers to that amount of an inhibitor described herein that is sufficient to affect the intended application, including but not limited to disease treatment. The therapeutically effective amount may vary depending on the intended application (in vitro or in vivo) or the subject and disease condition being treated, e.g., the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will induce a particular response in target cells, e.g., reduction of proliferation or downregulation of activity of a target protein. The specific dose will vary depending on the particular compounds chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which it is carried.
The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
The subject invention provides an effective and accurate method for predicting prognostic outcome of HCC patients. The method of the subject invention comprises first obtaining a biological sample from the subject. Then, measuring the expression level of ADRM1-ΔEx9 in a biological sample taken from the subject, comparing the expression level with a reference amount of ADRM1-ΔEx9 mRNA in HCC tumor, and treating the subject. In preferred embodiments, the biological sample is tissue from the primary HCC tumor.
In certain embodiments, the mRNA sequence of ADRM1-ΔEx9 is:
In some embodiments, the biological sample is liver tissue, preferably tissue from a tumor in the liver, such as, for example, a tissue sample from a liver biopsy or resected liver. In certain embodiments, mRNA can be isolated from the tissue sample. In certain embodiments, the mRNA can be isolated using an RNA extraction kit and associated methods, such as, for example RNeasy® (Qiagen, Hilden, Germany) or Direct-zol (Zymo Research).
In certain embodiments, measuring the expression level of ADRM1-ΔEx9 in a sample taken from the subject can be determined using conventional methods, such as, for example, northern blotting, nuclease protection assays, in situ hybridization, or a one-step or two-step quantitative reverse transcriptase polymerase chain reaction (RT-qPCR). In preferred embodiments, the isolated mRNA can be reverse transcribed, according to methods known in art and the resulting cDNA can be amplified using primers specific to ADRM1-ΔEx9 and at least one probe (e.g., fluorescent probe) specific to ADRM1-ΔEx9. In certain embodiments, the forward primer is CGCGGATGAGATCCAGAATAC (SEQ ID NO: 1), the reverse primer is TCCTCCTCTTCGTCCTTCTT (SEQ ID NO: 2), and the probe is CAGTTCCAGCAGATGTGGAAGCGTTT (SEQ ID NO: 3).
In certain embodiments, the expression levels of ADRM1-ΔEx9 in a sample can be compared to reference levels. In certain embodiments, ADRM1-ΔEx9 expression can be measured in non-tumor liver tissues to establish a reference level, particularly in a non-tumor liver tissue that is adjacent to liver tumor tissue in a subject. In certain embodiments, the expression of ADRM1-ΔEx9 can normalized with 18S rRNA. In certain embodiments, the fold change of ADRM1-ΔEx9 in tumor tissue compared to non-tumor tissue can be calculated. In certain embodiments, if a subject has a fold change greater than about 3, about 3.5, about 3.8842, about 4, about 4.4523, about 5, about 10, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70 about 75, about 80, about 90, about 95, about 100, about 105, about 110, about 113, about 115, about 120, about 125, about 150 in the tumor tissue relative to the reference level, it indicates the onset of HCC or an increased risk of HCC. In certain embodiments, when the subject has a fold change greater than about 3.8842 in the tumor tissue relative to the reference level, the subject is treated with a PARP1 inhibitor.
In certain embodiments, the method of the subject invention comprises treating a subject with HCC if the expression level of ADRM1-ΔEx9 in the biological sample is significantly higher or significantly lower than the reference level of ADRM1-ΔEx9. In preferred embodiments, the method of the subject invention comprises treating a subject with HCC if the expression level of ADRM1-ΔEx9 in the biological sample is significantly higher than the reference level of ADRM1-ΔEx9. In certain embodiments, the increase in the expression level of ADRM1-ΔEx9 indicates that the subject has poorer prognosis if the HCC is untreated, and the administration of a PARP1 inhibitor will treat the HCC. In some embodiments, an increase in the expression level of ADRM1-ΔEx9 when compared with the average amount indicates the more robust response of the subject to Olaparib.
In certain embodiments, the methods can further include communicating the subject's risk of worsening or progressing HCC.
The subject invention provides methods of treating HCC with a PARP1 inhibitor, such as, for example, Olaparib, Rucaparib, Niraparib, Talazoparib, or any combination thereof. In certain embodiments, about 1 mg to about 1000 mg, about 10 mg to about 750 mg, about 30 mg to about 500 mg, or about 300 mg of the PARP1 inhibitor can be administered to the subject. In certain embodiments, the subject can be treated daily, twice per week, weekly, biweekly, monthly, bimonthly, quarterly, twice per year, yearly, or biyearly. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 doses of the PARP1 can be administered at each treatment interval (e.g., daily, twice per week, weekly, etc.). In certain embodiments, the PARP1 inhibitor can be administered while monitoring the toxicity of the PARP1 inhibitor, and the treatment can be stopped if the dose is toxic to the subject. In certain embodiments, the size and location of a tumor and the expression level of ADRM1-ΔEx9 can be measured during the treatment.
In certain embodiments, the administration of the PARP1 inhibitor can be combined with other known treatments of HCC. Known treatments of HCC include, for example, curative resection, liver transplantation, radiofrequency ablation, trans-arterial chemoembolization, radioembolization, and systemic targeted agents, such as, for example, a multi-kinase inhibitor and immune checkpoint inhibitor. In certain embodiments, the multi-kinase inhibitor is, for example, Sorafenib, Lenvatinib, Cabozantinib, Regorafenib, or any combination thereof. In certain embodiments, the immune checkpoint inhibitor is, for example, Atezolizumab, Bevacizumab, Nivolumab, or any combination thereof.
In certain embodiments, ADRM1-ΔEx9 caused a reduction in the level of tumor suppressor protein FBXW7 by creating a de novo consensus protein binding motif to FBXW7. In certain embodiments, administration of a PARP1 inhibitor increases the level of FBXW7.
Total RNA from liver tissues were extracted using Qiagen RNeasy Plus Mini Kit (Catalog Number:74034). Tissues were minced on dry ice with scalpels precooled in −80° C. freezer. Six hundred microliters of Buffer RLT Plus was added to the minced tissues. After vertexing and centrifugation, the supernatant was transferred to gDNA eliminator spin columns to eliminate genomic DNA. Six hundred microliters of 70% ethanol was added to the flow-through and mixed by pipetting up and down. The mixture was then transferred to RNeasy spin columns and centrifuged at 8,000 g for 15 seconds at room temperature. The columns were washed once with 700 μL Buffer RW1, and then twice with 700 μL Buffer RPE. The columns were spun for 2 minutes at 15,000 g in order to thoroughly dry the resin. At last, RNA was eluted from the columns with 30 μL Nuclease-free water. The purified RNA samples were placed at −80° C. for long term storage. The concentration and purity of the extracted RNA were determined by measuring optical density (OD) at 260 nm and ration of OD 260/280, respectively, using the ND-2000 UV-VIS Spectrometer.
SuperScript™ III First-Strand Synthesis System kit (Invitrogen, Catalog Number: 18080051) was used to conduct reverse transcription. Five hundred nanograms of RNA sample was mixed with 1 μL dNTP mix (10 mM) and 1 μL Random hexamers (50 ng/μL). The mixture was incubated at 65° C. for 5 min, and then placed on ice for at least 1 min. After mixed with 2 μL 10×RT buffer, 4 μL 25 mM MgCl2, 2 μL 0.1 M DTT, 1 μL RNaseOUT (40 U/μL) and 1 μL SuperScript® III RT (200 U/μL), the mixture was incubated for 10 minutes at 25° C., followed by 50 minutes at 50° C. The reaction was terminated at 85° C. for 5 minutes and then chilled on ice. At last, 1 μL RNase H was added into each tube and incubated for 20 minutes to eliminate residual RNA. After diluted 10 times with Nuclease-free water, cDNA samples were placed at −20° C. for long term storage.
TaqMan-Based Quantitative Real-Time PCR (qPCR)
TaqMan™ Universal PCR Master Mix (Applied Biosystems, Catalog Number: 4304437) was used. Forward and reverse primers of ADRM1-ΔEx9 were dissolved in nuclease-free waster at concentration of 10 μM. TaqMan™ probe of ADRM1-ΔEx9 was dissolved in nuclease-free waster at a concentration of 25 μM. Expression for ADRM1-ΔEx9 and endogenous control 18S were determined in separate wells. To determine expression of ADRM1-ΔEx9, each reaction consisted of 2 μL diluted cDNA, 5 μL TaqMan™ Universal PCR Master Mix, 1 μL forward primer, 1 μL reverse primer, 0.25 μL TaqMan™ probe and 0.75 μL Nuclease-free waster. To determine expression of endogenous control 18S, each reaction was consisted of 2 μL diluted cDNA, 5 μL TaqMan™ Universal PCR Master Mix, 0.5 μL 20× TaqMan Gene Expression assay and 2.5 μL Nuclease-free waster. All assays were conducted in triplicate wells of 384-well PCR plates (Thermo Scientific, Catalog Number: AB1384). QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) was used to perform qPCR.
Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
To determine the level of ADRM1-FL and ADRM1-ΔEx9 in HCC, we used juncture flanking TaqMan probes to precisely interrogate their expression in an independent cohort containing 86 pairs of HCC tumors and paired adjacent non-tumor tissue. Although both ADRM1-FL and ADRM1-ΔEx9 were significantly overexpressed in HCC tumors, pairwise comparison demonstrated that ADRM1-ΔEx9, but not ADRM1-FL, was uniformly upregulated in HCC tumors (
Tumor-promoting properties of ADRM1 have been presented in multiple cancer types [10, 11]. However, the roles of each splicing variant, especially the functional characteristics of the unannotated ADRM1 isoform, remain elusive in HCC. We overexpressed ADRM-FL and -ΔEx9 in human hepatocytes cell line L02 (
To further elucidate the biological functions of ADRM1-ΔEx9, we designed shRNAs to target the unique juncture region of exon 8 to 10 of the variant. Results from qPCR demonstrated that two shRNA sequences specially knocked down ADRM1-ΔEx9 without affecting the expression of ADRM1-FL in two HCC cell lines, Hep3B and in-house established HKCI-10 (
To further delineate the mechanism underlying ADRM1-ΔEx9 biology, we turned to the functional domains of ADRM1 protein. ADRM1 has two functional motifs. The N-terminal PRU domain is responsible for recognizing polyubiquitin chains [7], while the C-terminal domain directly binds to and activates deubiquitinase Uch37 [8, 13]. Alphafold2 prediction suggested that exon 9 skipping in ADRM1-ΔEx9 results in a conformational change to the C-terminus domain (
We next conducted an experiment to understand the role of ADRM1-ΔEx9 in FBXW7 regulation. FBXW7 is an E3 ligase that binds to a broad range of oncogenic substrates through a consensus binding motif -TPXXS- for polyubiquitination and subsequent degradation [19]. Recent studies show that a few binding partners of FBXW7, instead of being degraded, disrupt FBXW7 dimerization and promote FBXW7 self-ubiquitination and degradation [19, 20]. Intriguingly, in silico analysis revealed that exon 9 skipping in ADRM1-ΔEx9 creates a de novo FBXW7 consensus binding motif (-TPSPS-) within the codons 350-354 of the c-terminus (
Having defined the substrate of ADRM1-ΔEx9, we further studied the mechanism by which ADRM1-ΔEx9 redirects proteasome specificity. It is known that ADRM1 mediates specific proteasomal degradation mainly by two mechanisms: (1) activating deubiquitinating enzyme Uch37 to modulate the outcome of ubiquitination [8, 13] and (2) recognizing proteins with K48-linked polyubiquitin chains through the N-terminal PRU domain [7]. As ADRM1-ΔEx9 preserves the intact PRU domain, we postulated that the rewired UPS specificity was resulted from the altered C-terminus. Indeed, immunoprecipitation assay showed that classical binding of ADRM1-ΔEx9 to deubiquitinase Uch37 is not detected (
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.
Embodiment 1. A method for treating hepatocellular carcinoma (HCC) in a subject, the method comprising:
