The present invention relates to a method for diagnosis and prognosis of cancer and for monitoring the progression of cancer and/or the therapeutic efficacy of an anti-cancer treatment in a subject by detecting altered cadherin proteins in tumor cells. Therapeutic methods for preventing, inhibiting or treating cancer are also presented herein.
The transformation of a normal cell into a malignant cell results, among other things, in the uncontrolled proliferation of the progeny cells, which exhibit immature, undifferentiated morphology, exaggerated survival and proangiogenic properties and expression, and overexpression or constitutive activation of oncogenes not normally expressed in this form by normal, mature cells. Once a tumor has formed, cancer cells can leave the original tumor site and migrate to other parts of the body via the bloodstream or the lymphatic system or both by a process called metastasis. In this way the disease may spread from one organ or part to another non-contiguous organ or part.
The increased number of cancer cases reported around the world is a major concern. Currently there are only a handful of treatments available for specific types of cancer, and these provide no guarantee of success. In order to be most effective, these treatments require not only an early detection of the malignancy, but a reliable assessment of the severity of the malignancy, the ability of the malignancy to spread, and the response of a subject to anti-cancer treatment. There is a need for diagnostic and prognostic tools to identify and characterize tumors, and which can be used to assign treatments to a patient, and to monitor therapeutic efficacy. There is also a need for anti-cancer treatments which can be administered to subjects having cancer to prevent, inhibit or treat the disease and the spread thereof.
During the process of tumor progression, a subset of primary tumor cells undergoes molecular changes leading to an increased ability to survive, proliferate, invade, and in many tumors, form secondary metastases. The mechanisms governing invasion and metastasis are complex and poorly understood. However, it is recognized that at the cell surface, alterations in classes of adhesion molecules are critical for detachment of tumor cells, mobility through host tissue, and the successful formation of secondary sites (Christofori (2006) Nature 441: 444-450). These alterations involve not only reduction in surface adhesion molecules, but also changes in the profile of adhesion molecule expression at the cell surface.
Classical cadherins are cell adhesion molecules (CAMs) that mediate Ca2+-dependent, and generally, homophilic intercellular interactions. They have been identified as key CAMs in epithelia, since they are critical for establishing and maintaining intercellular connections and for the spatial segregation of cell types. The precursor form of classical cadherins contains a signal sequence that is cleaved in the rough endoplasmic reticulum to reveal a prodomain of 130 amino acids (Koch et al. (2004) Structure 12: 793-805). Proteolytic processing of the prodomain is necessary to generate adhesively competent cadherins at the cell surface (Ozawa and Kemler (1990) J Cell Biol 111: 1645-1650). The recently solved N-cadherin prodomain structure (Koch et al. (2004) Structure 12: 793-805) reveals that the prodomain lacks the essential structural features for cadherin adhesion, thus explaining why it cannot itself mediate adhesive interactions, and why its presence prior to cleavage proximal to the mature cadherin sequence protects from dimerization of cadherins intracellularly ((Ozawa and Kemler (1990) J Cell Biol 111: 1645-1650); Wahl et al (2003) J Biol Chem 278: 17269-17276).
Classical cadherins play important roles in the pathogenesis of cancer, and it has been shown that the metastatic potential of tumor cells inversely correlates with expression of cadherins. In the skin, E-cadherin normally mediates attachment of melanocytes to keratinocytes, and is critical for intercellular signaling between these two cell types (Hsu et al. (2000) Am J Pathol 156: 1515-1525). In melanoma, malignant vertical growth phase (VGP) cells lose E-cadherin expression, whereas N-cadherin levels significantly increase and persist throughout malignant transformation. It has been concluded that E-cadherin downregulation in VGP melanoma cells, along with the upregulation of adhesively competent N-cadherin, enables invasion into the dermis and the subsequent formation of secondary metastases by a subset of these cells.
An E- to N-cadherin switch also takes place in other types of carcinomas. Loss of E-cadherin has been shown to be associated with high tumor grades and poor prognosis, and the upregulation of N-cadherin correlates with induced cellular motility. In addition to the upregulation of N-cadherin following loss of E-cadherin, the emergence of cadherin-11 in malignant carcinomas such as breast and prostate, correlates with invasiveness and poor prognosis. N-cadherin and cadherin-11 have been referred to as “mesenchymal cadherins” to denote the invasive morphology of cells bearing these cadherins on their surfaces, compared to polarized epithelial cells (Thiery (2002) Nat Rev Cancer 2: 442-454).
It is believed therefore that loss of E-cadherin and the upregulation of mesenchymal cadherins promote tumor cell invasion and metastasis. It has been hypothesized that loss of E-cadherin may be a prerequisite for tumor cell invasion, since E-cadherin functions in “anchoring” normal cells in place (Birchmeier and Behrens (1994) Biochem Biophys Acta 1198: 11-26). Re -establishing adherens junctions by forced E-cadherin expression, results in a reversion from an invasive, mesenchymal, to a benign, epithelial phenotype. Thus, loss of E-cadherin results in the disruption of adhesion junctions between adjacent cells allowing malignant cells to detach from the “E-cadherin” epithelial cell layer and invade the host tissue.
The gain of expression of mesenchymal cadherins such as N-cadherin, is thought to mediate adhesion of malignant cells to N-cadherin expressing stromal or endothelial cells, rather than epithelial cells, facilitating invasion of tumor cells and the formation of secondary metastases (Qi et al. (2005) Molec Biol Cell 16: 4386-4397). It has also been proposed that the association of tumor cells with fibroblasts and endothelial cells induces these host cells to produce growth factors and/or proteases promoting growth and invasion of the tumor cells (Li et al. (2002) Crit. Rev Oral Biol Med 13: 62-70). In breast cancer cells, it has been shown that the N-cadherin invasive activity is partially due to an interaction with the FGF receptor at the cell surface, resulting in sustained activation of the MAPK-ERK pathway as well as other pathways, and increased expression of MMP-9 (Suyama et al. (2002) Cancer Cell 2: 301-314).
Other tumors do not undergo an E- to N-cadherin shift, but exhibit persistence of N-cadherin in their component cells normally, as well as in the highly malignant state. A particularly interesting model is primary brain tumors, which arise from cells derived from the primitive neuroepithelium, and are among the most devastating malignancies. Glioblastoma multiforme (GBM) is the most aggressive type of malignant glioma, and long-term survival is seldom observed due to the extensive infiltration of vital brain regions by subpopulations of highly invasive cells. These tumors invade throughout the brain tissue as single cells, with a predilection for migration along existing anatomical structures, such as white matter tracts, the subpial glial space, and the periphery of neurons and blood vessels, and almost never metastasize outside the brain. Dissemination of glioma cells within the brain appears to depend on complex interactions, and possibly cooperation with resident brain cells, and likely correlates with CAM profiles. An upregulation of N-cadherin in malignant glioma cells compared to normal brain tissue has been demonstrated (Asano et al. (2004) J Neuro-Oncol 70: 3-15).
It is known that destabilized cell contacts, cellular reorganization, and metastatic dissemination are all associated with changes in cell adhesion, and that cadherins such as N-cadherin are major cellular adhesion molecules (CAMs) in normal physiology and during tumorigenesis, and have been shown to possess a range of adhesive strengths. However, this hierarchy of adhesion has been believed to be regulated solely by monomer: dimer ratios (Tanaka et al. (2000) Neuron 25: 93-107), “overlapping” domains (Sivasankar et al. (1999) Proc Natl Acad Sci 96: 11820-11824), clustering (He et al. (2003) Science 302:109-113), and by mass amounts of cadherin on cell surfaces. Persistence of the prosequence has never been observed, and it has been believed that the N-terminal prosequence in classical cadherins is completely removed by an endoprotease within the late Golgi following association of the catenins, resulting in a mature, adhesively competent molecule at the cell surface.
However, the idea that upregulation of adhesively competent N-cadherin mediates invasion is not easily reconciled with data showing that increased N-cadherin levels are associated with stronger intercellular adhesion and decreased cell motility (Gumbiner (1996) Cell 84: 345-357). There is a need therefore to understand better the role of N-cadherin in the invasion and migration of tumor cells, and in the stages of malignancy which occur during tumor progression.
It would also be highly desirable to be provided with a diagnostic method and/or a prognostic tool that permits evaluation of the invasiveness of a tumor and of the stage of malignancy of the tumor.
The present invention relates to a method for diagnosis and prognosis of cancer and for monitoring the progression of cancer and/or the therapeutic efficacy of an anti-cancer treatment in a subject by detecting altered cadherin proteins in tumor cells, as well as therapeutic methods for preventing, inhibiting or treating cancer.
In accordance with the present invention, there is provided a method for diagnosing or determining prognosis of a cancer in a subject, comprising determining the molecular form of cadherin at the cell surface of cancer cells in the subject, wherein the presence of a non-adhesive form of cadherin indicates that the cancer is invasive or metastatic.
Also in accordance with the present invention, there is provided a method for diagnosing or determining prognosis of a cancer in a subject, comprising determining the molecular form of cadherin at the cell surface of cancer cells in the subject, wherein a high ratio of non-adhesive to adhesive forms of cadherin indicates that the cancer is invasive or metastatic.
Further in accordance with the present invention, there is provided a method for diagnosing or determining prognosis of a cancer in a subject, comprising determining the expression level of furin and/or PC5 in cancer cells in the subject, wherein low expression of furin and/or high expression of PC5 indicates that the cancer is invasive or metastatic. There is also provided a method for monitoring the progression of a cancer in a subject, the method comprising determining the molecular form of cadherin at the cell surface of cancer cells in the subject, wherein the presence of a non-adhesive form of cadherin or a high ratio of non-adhesive to adhesive forms of cadherin indicates that the cancer has progressed to a metastatic phase.
In another aspect, there is provided herein a method for monitoring the efficacy of an anti-cancer treatment in a subject, comprising determining the molecular form of cadherin at the cell surface of cancer cells in the subject at a first timepoint, determining the molecular form of cadherin at the cell surface of cancer cells in the subject at a second timepoint, and comparing the amounts of non-adhesive and adhesive cadherin at the first and second timepoints, wherein a decrease or no change in the amount of non-adhesive cadherin or an increase in the amount of adhesive cadherin in the second sample compared to the first sample indicates efficacy of the anti-cancer treatment.
In yet another aspect, there is provided a method for monitoring the efficacy of an anti-cancer treatment in a subject, comprising determining the expression level of furin and/or PC5 cancer cells in the subject at a first timepoint, determining the expression level of furin and/or PC5 cancer cells in the subject at a second timepoint, and comparing the expression levels of furin and/or PC5 at the first and second timepoints, wherein an increase in the expression levels of furin and/or a decrease in the expression levels of PC5 in the second sample compared to the first sample indicates efficacy of the anti-cancer treatment.
In an embodiment, the encompassed cancer is selected from the group consisting of melanoma, breast cancer, prostate cancer, bladder cancer, squamous cell cancer, and malignant glioma.
In another embodiment, the encompassed cadherin is a type I or type II classical cadherin. The cadherin may be selected from the group consisting of E-cadherin, N-cadherin, R-cadherin, C-cadherin, VE-cadherin, P-cadherin, K-cadherin, T1-cadherin, T2-cadherin, OB-cadherin, Br-cadherin, M-cadherin, cadherin-12, cadherin-14, cadherin-7, F-cadherin, cadherin-8, cadherin-19, EP-cadherin (X1), BS-cadherin (Bs) and PB-cadherin (Rn). In a particular aspect, the cadherin is N-cadherin.
In another aspect, the molecular form of cadherin at the cell surface of cancer cells in the subject is determined in the methods of the invention using immunocytochemistry or immunoblotting in a sample from a subject. In a further aspect, the molecular form of cadherin at the cell surface of cancer cells in the subject is determined using radionuclide imaging, SPECT imaging, magnetic resonance imaging, fluorescence imaging, positron emission tomography, CT imaging, or a combination thereof.
In accordance with the present invention, there is also provided a kit for diagnosing or determining prognosis of a cancer in a subject, comprising reagents for determining the molecular form of cadherin at the cell surface of cancer cells in the subject, and instructions for use thereof. The kit may contain reagents comprising an antibody specific for a non-adhesive cleavage form, e.g., an antibody specific for the pro-domain of a cadherin, e.g. the anti-proN antibody. In another embodiment, the kit may contain reagents for determining expression levels of furin or PC5 in cancer cells in the subject, and instructions for use thereof. For example, the kit may contain reagents comprising PCR reagents, primers, antibodies specific for furin or PC5, and/or reagents for assaying furin or PC5 enzymatic activity.
In accordance with the present invention, there is also provided a method for preventing, inhibiting, or treating cancer or its metastasis comprising administering to a subject in need thereof an effective amount of an agent, wherein the agent increases the amount of adhesive cadherin or decreases the amount of non-adhesive cadherin at the cell surface of cancer cells in the subject. In one aspect, the agent may be an inhibitor of PC5 or an activator of furin. In another aspect, the agent is furin. In yet another aspect, the agent is an antisense against PC5 RNA, siRNA against PC5, or a small molecule inhibitor of PC5.
Also provided herein is the use of an agent which increases production of adhesive cadherin forms or decreases production of non-adhesive cadherin forms for preventing, inhibiting or treating cancer or metastasis thereof. The invention also relates to the use of an agent which increases production of adhesive cadherin forms or decreases production of non-adhesive cadherin forms in the manufacture of a medicament for preventing, inhibiting or treating cancer or metastasis thereof. In another aspect, a pharmaceutical composition comprising an agent which increases production of adhesive cadherin forms or decreases production of non-adhesive cadherin forms, and a pharmaceutically acceptable carrier is provided herein.
Having thus generally described the nature of the invention, reference will now be made to the accompanying drawings, showing by way of illustration, an embodiment or embodiments thereof, and in which:
FIG. 17 shows that cell surface expression of proNCAD promotes the formation of more aggressive tumors in vivo, wherein: in (A-C) U343 glioma cells were transfected with empty vector, wt NCAD-myc, or mutant proNCAD-myc, and injected into the striatum of SCID mice; mice were sacrificed 30 days post-injection, and immunohistochemistry using an anti-human nuclei antibody with a hemotoxylin counter stain was performed on fixed brain sections; typical three-dimensional reconstructions using the Neurolucida software are shown for each condition; compared to the other conditions, U343-proNCAD-myc cells formed multiple tumor foci and invaded the brain parenchyma in both the injected and non-injected hemispheres as single cells or small groups of cells; red closed contours or markers represent tumors or single cells, respectively, in the injected hemisphere, yellow markers represent cells migrating along the corpus callosum, and blue closed contours or markers represent tumors or single cells, respectively, in the non-injected hemisphere; in (D) immunohistochemistry using the proN antibody was carried out on sections from brains that were injected with U343-proNCAD-myc cells; cells expressing proNCAD were found migrating along ventricles (V), and the corpus callosum (CC) (top panel; Bar, 25 μm; and middle panel, higher magnification; Bar, 15 μm), and throughout the non-injected striatum (S) (bottom panel; Bar, 15 μm); quantification using the Neurolucida software reveals roughly 12 times more single cells invading the brain parenchyma (E), and double the mean invasion distance of single cells from the injection site (F), compared to the other conditions; values are relative to U343-myc, and are means ±SEM of three independent experiments.
FIG. 18 shows cleavage by Factor Xa does not compromise the integrity of mature NCAD, wherein Western blot analysis of total cell lysates of proNCAD-myc or mock transfected cells demonstrates that proNCAD-myc levels are decreased to background upon treatment with the specific protease, Factor Xa, and cleavage with Factor Xa does not compromise the integrity of the mature protein, wherein: in (A) ProNCAD is detected with the proN antibody; in (B) both proNCAD and the mature protein are detected with the NCAD cytoplasmic antibody; in (C) Western blot analysis of conditioned medium collected from proNCAD or mock transfected cells demonstrated specific cleavage of the mutant pro-fragment as an accumulation of the pro-fragment in the medium due to treatment with Factor Xa.
The invention described herein is based, at least in part, on the novel and unexpected observation that cadherin molecules undergo altered proteolytic processing during malignant transformation. This results in a mixture of cadherin molecular forms at the cell surface of cancer cells with altered adhesiveness and functionally enhances cellular migration and invasion.
We report herein our studies of the cellular localization, molecular form and functional state of cell surface cadherin, such as N-cadherin, in cancer cells, such as primary glial tumors and during melanoma transformation. These studies have led to the novel and unexpected finding that in cancer, e.g. during malignant melanoma transformation and in highly invasive glioma cells, in addition to mature N-cadherin (NA), significant amounts of non-adhesive forms (NP) of N-cadherin also appear on the cell surface. These non-adhesive forms comprise uncleaved precursor N-cadherin, as well as a form of N-cadherin where the molecule is cleaved at a second inactivating site, downstream of the Trp2 residue which is known to be required for cadherin mediated adhesion. We have also found that a high ratio of NP/NA can promote detachment, tumor cell migration and invasion.
We further report herein that classical cadherins, such as N-cadherin, possess a range of adhesive strengths, and play a critical role in tumor progression. Moreover, intercellular adhesion can be modulated by surface expression of a non-adhesive CAM.
During malignant transformation, the N-cadherin molecule undergoes altered proteolytic processing. This results in a mixture of N-cadherin molecular forms at the cell surface with varying degrees of adhesiveness. In particular, the precursor N-cadherin can escape proper cleavage and be expressed at the cell surface of, for example, aggressive brain tumor cells, as well as malignant melanoma cell lines and other human carcinoma cell lines. In addition, N-cadherin can be processed at a second inactivating cleavage site, for example in highly invasive brain tumor cells, and in VGP melanoma cells with metastatic potential as well. Precursor N-cadherin at the surface and cleavage at the second site appear to be due to dowregulation of the furin, and upregulation of the PC5A convertase enzymes, respectively. Cadherins which have undergone altered proteolytic processing show reduced adhesiveness compared to normally-processed cadherin and serve to enhance cellular migration and invasion.
In one aspect, the amount of non-adhesive cadherin at the cell surface, e.g. surface proN and functionally inactivated N-cadherin determine the degree of cell invasiveness and metastasis, in later stages of tumor progression. For example, in brain tumor cells, the switch from mature N-cadherin to non-adhesive N-cadherin molecules, mediates detachment from the main tumor mass, and invasion over extensive distances, as demonstrated herein using an in vitro assay. Thus, the switch from E-cadherin to N-cadherin, which has been observed in many tumors, is in many cases a switch to a mixture of N-cadherin molecules where only a certain proportion is functionally adhesive. Similarly, there is a NA to NP switch in brain tumors. In both cases, there is a transition from a functionally adhesive cadherin to one exhibiting compromised adhesion. By altering the cadherin composition at the cell surface, the adhesive strength of nascent cell-cell contacts may be regulated, allowing for fine-tuning of malignant intercellular connections.
Classical cadherins are synthesized as inactive propeptide precursors which become functional mature proteins upon post-translational processing. The proprotein convertases (PCs) are a family of Ca+2-dependent endoproteases responsible for the cleavage of precursor proteins by cleavage at a consensus recognition site. The common mammalian PCs described are furin, PC7, PACE4, PC5, PC⅓, PC2 and PC4. In particular, furin, PC7, PACE4 and PC5 have a wide tissue distribution and proteolytically process precursors in the constitutive secretory pathway. Furin is known to cleave pro-E-cadherin, and precursor N-cadherin, like other classical cadherins, has a consensus cleavage site for PCs at the C-terminal end of the prodomain.
PC5 is expressed as either the A or B isoform. These isoforms are generated by alternative splicing; the B isoform contains all of A except for a small part of its carboxyl-terminus that is positioned after the splice site. The B isoform also includes a transmembrane domain which is not present in the A isoform. PC5 is also known as PC5/6, PC5/6B, PC5A, PC5B, PC5A/B, PC6, PC6A, and PC6B, and these terms are used interchangeably herein. It is contemplated that all forms of the PC5 enzyme are encompassed by the methods and compositions of the present invention. For a review of proprotein convertases, see Thomas, G. (2002) Nat Rev Mol Cell Biol 3:753-766, the entire contents of which are hereby incorporated by reference in their entirety.
It is also provided herein that differential expression of PC enzymes may be a common mechanism in many types of tumors to regulate cellular motility and perhaps other malignant traits, by regulating the processing of cadherins. We report herein that furin is expressed at low levels in invasive tumor cells expressing precursor cadherin at the cell surface. In contrast, expression of PC5, which cleaves N-cadherin at position 28 in EC1, is high in invasive cells relative to non-invasive cells. Cleavage at position 28 in EC1 abolishes the adhesive function of N-cadherin since the Trp2 residue, which is required for adhesiveness, is lost. Therefore both low furin levels and high PC5 levels are correlated with a higher ratio of non-adhesive to adhesive forms of cadherin at the cell surface.
Cancer refers herein to a cluster of cancer or tumor cells showing over-proliferation by non-coordination of the growth and proliferation of cells due to the loss of the differentiation ability of cells. The terms “cancer cell” and “tumor cell” are used interchangeably herein.
The term “cancer” includes but is not limited to, breast cancer, large intestinal cancer, lung cancer, small cell lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, uterine sarcoma, ovarian cancer, rectal or colorectal cancer, anal cancer, colon cancer (generally considered the same entity as colorectal and large intestinal cancer), fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vulval cancer, squamous cell carcinoma, vaginal carcinoma, Hodgkin's disease, non-Hodgkin'lymphoma, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue tumor, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, glioma, astrocytoma, glioblastoma multiforme, primary CNS lymphoma, bone marrow tumor, brain stem nerve gliomas, pituitary adenoma, uveal melanoma (also known as intraocular melanoma), testicular cancer, oral cancer, pharyngeal cancer or a combination thereof. In an embodiment, the cancer is a brain tumor, e.g. glioma. The term “cancer” also includes pediatric cancers, including pediatric neoplasms, including leukemia, neuroblastoma, retinoblastoma, glioma, rhabdomyoblastoma, sarcoma and other malignancies.
In a particular embodiment, the invention relates to melanoma, breast cancer, prostate cancer, bladder cancer, squamous cell cancer, and/or brain cancer, such as malignant glioma, such as Glioblastoma multiforme (GBM). In another particular embodiment, the invention relates to epithelial carcinomas.
In another embodiment, the cancer expresses a cadherin protein on the cell surface. In a particular embodiment, the cancer expresses a cadherin protein on the cell surface with altered processing or reduced adhesiveness compared to the cadherin expressed on normal, i.e. non-cancerous cells.
Cadherin proteins which can be used in the methods and compositions of the invention include members of the classical type I and type II cadherin subfamilies. Cadherins are single-pass transmembrane proteins characterized by the presence of distinctive cadherin repeat sequences, consisting of about 110 amino acids, in their extracellular segments. Cadherins can be classified into several subfamilies based on shared properties and sequence similarity. Classical (type I) cadherins have a conserved tryptophan at position 2 of the mature protein, which is a central feature of the cell-cell adhesive interface. The pre- or pro-domain must be removed by furin family proteases for these molecules to mediate functional adhesion. Type II cadherins are different from type I cadherins in that they have a smaller pre- or pro-domain and two conserved tryptophan residues in their EC1 domain. Both type I and type II cadherins are linked to the actin cytoskeleton through specific adaptor proteins. For a review of cadherin proteins, see Nollet et al., J. Mol. Biol. (2000) 299: 551-572, and Patel et al., Curr. Opin. in Struct. Biol. (2003) 13: 690-698, the entire contents of which are hereby incorporated by reference.
Non-limiting examples of type I and type II cadherins which can be used in the methods and compositions of the invention include E-cadherin (also known as uvomorulin, L-CAM and cadherin-1), N-cadherin (also known as cadherin-2), C-cadherin, R-cadherin (also known as XmN-cadherin and cadherin-4), VE-cadherin (also known as cadherin-5), K-cadherin (also known as cadherin-6), T1-cadherin (also known as cadherin-9), T2-cadherin (also known as cadherin-10), OB-cadherin (also known as cadherin-11), Br-cadherin (also known as N-cadherin-2, cadherin-12, M-cadherin (also known as cadherin-15), P-cadherin, Cadherin-14 (also known as cadherin-18 or mouse EY-cadherin), cadherin-7, F-cadherin (also known as cadherin-20), cadherin-8, cadherin-19, EP-cadherin (XI), BS-cadherin (Bs) and PB-cadherin (Rn). It is contemplated that any cadherin which undergoes proteolytic processing, and for which the adhesiveness of the processed form differs from that of the unprocessed form, is encompassed by the invention described herein and can be used in the methods and compositions of the invention.
In accordance with the present invention, there is provided a method for diagnosing cancer and determining prognosis in a subject by characterizing the molecular form of cadherin expressed at the cell surface of cancer cells in the subject.
In one aspect of the invention, there is a provided a method of diagnosing and/or determining the prognosis of a cancer by determining the molecular forms of cadherin at the cell surface of the cancer cells. In one embodiment, anon-adhesive form of cadherin at the cell surface is diagnostic of a more aggressive, or more highly invasive, tumor. In another embodiment, the non-adhesive form of cadherin is the precursor or “pro-” form. In another embodiment, the non-adhesive form has been cleaved before the Trp2 residue. In yet another embodiment, the non-adhesive form has been cleaved by the PC5 convertase. Any form of cadherin which is non-adhesive or has reduced adhesiveness compared to normally-expressed cadherin is encompassed by the methods herein. Detection of non-adhesive cadherin, e.g. proN-cadherin, at the cell-surface in a cancer cell may therefore serve as a diagnostic and/or prognostic tool for staging and progression of the disease.
The terms “proNCAD”, “precursor N-cadherin”, “proN-cadherin” and “proN” are used interchangeably herein, and refer to the precursor or “pro-” form of N cadherin, i.e. the form of N-cadherin which has not been cleaved by furin and contains the pro domain. The terms “N-cadherin” and “NCAD” are used interchangeably herein and refer to N-cadherin (also known as cadherin-2). Similar terminology is used for the other cadherins, for example E-cadherin is also referred to as ECAD.
In another embodiment, a high ratio of non-adhesive to adhesive cadherin forms at the cell surface is diagnostic of a more aggressive, or highly invasive tumor. In another aspect, the invention provides methods of monitoring the progression of a cancer and/or monitoring the efficacy of an anti-cancer treatment or therapeutic regimen. It is contemplated that any anti-cancer treatment or therapeutic regimen known in the art could be used in the methods described herein. Non-limiting examples of treatments and therapeutic regimens encompassed herein include surgery, radiology, chemotherapy, and administration of targeted cancer therapies and treatments, which interfere with specific mechanisms involved in carcinogenesis and tumour growth.
Non-limiting examples of targeted cancer therapies include therapies that inhibit tyrosine kinase associated targets (such as Iressa®, Tarceva® and Gleevec®), inhibitors of extracellular receptor binding sites for hormones, cytokines, and growth factors (Herceptin®, Erbitux®), proteasome inhibitors (Velcade®) and stimulators of apoptosis (Genasense®). Such targeted therapies can be achieved via small molecules, monoclonal antibodies, antisense, siRNA, aptamers and gene therapy. A subject may also receive a combination of treatments or therapeutic regimens. Any other treatment or therapeutic regimen known in the art can be used in the methods described herein, alone or in combination with other treatments or therapeutic regimens.
In one aspect of the invention, therefore, the invention provides methods of monitoring the progression of a cancer and/or monitoring the efficacy of an anti-cancer treatment or therapeutic regimen by determining the molecular forms of cadherin at the cell surface of cancer cells. In one embodiment, a non-adhesive form of cadherin at the cell surface or a high ratio of non-adhesive to adhesive cadherin forms indicates that a cancer has progressed to an invasive, metastatic phase. In another embodiment, a subsequent decrease in the ratio of non-adhesive to adhesive cadherin in a cancer cell indicates further progression of the cancer to a less invasive stage.
In one embodiment, the non-adhesive form of cadherin is the precursor or “pro-” form. In another embodiment, the non-adhesive form has been cleaved before the Trp2 residue, e.g. by the PC5 convertase.
The molecular form of cadherin at the cell surface may be determined using standard methods known in the art. In one aspect, the molecular form of cadherin at the cell surface is determined in a sample from a subject, e.g. a tissue sample obtained via biopsy. Non-limiting examples of such methods include immunodiagnostic methods such as immunohistochemistry, immunocytochemistry, western blotting, radioimmune assay (RIA) and so on. In an embodiment, the molecular form is determined using an antibody specific for a particular molecular form, e.g. an antibody specific for the pro-domain, e.g. anti-proN, or an antibody specific for a particular cleavage form. In another aspect, the cadherin may be analyzed in a subject directly using imaging techniques known in the art such as radionuclide imaging, SPECT imaging, magnetic resonance imaging, fluorescence imaging, positron emission tomography, CT imaging, or a combination thereof. In one aspect, the cadherin may be analyzed in a subject directly using a detectably-labeled antibody, e.g. a detectably-labeled anti-proN antibody.
In another aspect of the invention, there is a provided a method of diagnosing and/or determining the prognosis of a cancer in a subject by determining the levels of expression of preprotein convertases in cancer cells. In one embodiment, the level of expression of furin is determined. In another embodiment, the level of expression of the PC5 convertase is determined. Low expression levels of furin correlate with expression of the precursor form of cadherin at the cell surface and are therefore diagnostic of a more aggressive, highly invasive tumor. High levels of PC5 convertase correlate with presence of a non-adhesive cleavage form of cadherin at the cell surface and are therefore diagnostic of a more aggressive, highly invasive tumor. In an aspect, expression levels of one or more than one convertase may be determined. For example, low furin expression levels and/or high PC5 expression levels is indicative of an invasive tumor, wherease high furin and/or low PC5 levels indicate a non-invasive tumor. Convertase levels may be determined alone or in combination. It is contemplated that expression levels of any proprotein convertase enzyme which cleaves a cadherin and thereby modulates its functional adhesiveness may be used in the methods of the invention.
Convertase expression levels may be determined using standard methods known in the art. Non-limiting examples of such methods include immunoblotting, methods to determine mRNA levels such as RT-PCR and northern analysis, real-time PCR, PCR, immunocytochemistry, immunohistochemistry, radioimmune assay (RIA), and so on.
In another aspect of the invention, the invention provides methods of monitoring the progression of a cancer and/or monitoring the efficacy of an anti-cancer treatment or therapeutic regimen by determining the levels of expression of proprotein convertase enzymes in cancer cells. In one embodiment, a low level of furin expression and/or a high level of PC5 expression indicates that a cancer has progressed to an invasive, metastatic phase. In another embodiment, a subsequent increase in furin expression and/or decrease in PC5 expression in a cancer cell indicates further progression of the cancer to a less invasive stage.
In yet another aspect, the invention provides a method of assigning an anti-cancer treatment or a therapeutic regimen to a subject. In one aspect, the method comprises determining the molecular forms of cadherin at the cell surface of the cancer cells in a subject, wherein a non-adhesive form of cadherin at the cell surface or a high ratio of non-adhesive to adhesive cadherin forms indicates that a cancer has progressed to an invasive, metastatic phase, and treatment appropriate for an invasive, metastatic cancer is assigned accordingly. In another embodiment, a subsequent decrease in the ratio of non-adhesive cadherin to adhesive cadherin in a cancer cell indicates further progression of the cancer to a less invasive stage and treatment may be modified accordingly. In another embodiment, the levels of expression of proprotein convertase enzymes in the cancer cells in a subject are determined, wherein a low level of furin expression and/or a high level of PC5 expression indicates that a cancer has progressed to an invasive, metastatic phase, and treatment is assigned accordingly. In another embodiment, a subsequent increase in furin expression and/or a decrease in PC5 expression in a cancer cell indicates further progression of the cancer to a less invasive stage and treatment is modified accordingly.
Kits for diagnosing or determining prognosis of a cancer in a subject, comprising reagents for determining the molecular form of cadherin at the cell surface of cancer cells in the subject, and instructions for use thereof, are also provided herein. The reagents may comprise one or more than one probe capable of detecting non-adhesive forms of cadherin at the cell surface, e.g. an antibody binding specifically to a non-adhesive form such as the pro-form or a cleavage form. In one aspect, the antibody may be specific for the pro-domain (also referred to as the pro-region) of a cadherin. In another aspect, the antibody may be specific for the pro-domain of N-cadherin. In another aspect, the antibody may be anti-proN (Koch et al. (2004) Structure 12: 793-805). The reagents may also comprise probes binding specifically to cadherin mRNA, e.g. N-cadherin mRNA, to allow detection of expression of e.g. N-cadherin. Kits for diagnosing or determining prognosis of a cancer in a subject, comprising reagents for determining expression levels of one or more than one proprotein convertase, e.g. furin or PC5, in cancer cells in the subject, and instructions for use thereof are also provided. The reagents may comprise, for example, PCR reagents, primers specifically hybridizing to proprotein convertase mRNA or a fragment thereof, antibodies specific for a proprotein convertase, e.g. furin and/or PC5, and/or reagents for assaying furin or PC5 enzymatic activity.
In a further aspect of the invention, there is provided a method for preventing, inhibiting, or treating cancer and/or the metastasis or spread thereof by decreasing the amount of non-adhesive cadherin forms at the cell surface of a cancer cell, by increasing the amount of adhesive cadherin forms at the cell surface of a cancer cell, or by decreasing the ratio of non-adhesive to adhesive cadherin forms at the cell surface of a cancer cell. In one aspect, the expression or activity of a proprotein convertase, e.g. furin, is increased. In another aspect, expression or activity of a proprotein convertase, such as PC5, is inhibited, e.g. by administration of an inhibitor.
In one aspect, an effective amount of a proprotein convertase inhibitor is administered to a subject to prevent, inhibit, or treat cancer and/or the metastasis or spread thereof by e.g. decreasing the amount of non-adhesive cadherin forms at the cell surface of a cancer cell, or increasing the amount of adhesive cadherin forms at the cell surface of a cancer cell, or decreasing the ratio of non-adhesive to adhesive cadherin forms at the cell surface of a cancer cell. In an aspect, the inhibitor may be e.g. decanoyl-RVKR-chloromethylketone or an alpha-1-antitrypsin variant, e.g. alpha-1-PDX (see, for example, Jean et al. (1998) Proc. Natl. Acad. Sci. USA 95:7293-7298; Tsuji et al. (2007) Protein Eng Des Sel 20: 163-170; the entire contents of which are hereby incorporated by reference). It is contemplated that PC5 inhibitors known in the art may be used in the methods and compositions of the invention. In one aspect, a PC5 inhibitor may be administered to a subject in need thereof. In another aspect, the amount of adhesive forms of cadherin at the cell surface may be increased by adding furin to the surface of a tumor. In another aspect, furin may be administered to a subject in need thereof. In another aspect, PC5 levels may be inhibited or decreased using antisense RNA or siRNA.
The present invention will be more readily understood by referring to the following examples, which are given to illustrate the invention rather than to limit its scope.
We studied the functional state of surface expressed N-cadherin in primary malignant glioma cell lines, and in melanoma cell lines representing different stages of transformation. N-cadherin expression was comparable in U343 and U251 cell lines (
Since N-cadherin is an abundant component of melanoma and glioma cell lines, we wanted to examine its adhesive activity in these cells. We observed greater aggregation in less invasive U343 glioma cells and in VGP cells (WM115), compared to highly invasive U251 cells and metastatic melanoma cells (WM266), respectively (
Cell surface Expression of Precursor N-cadherin Promotes Motility of Glioma and Melanoma Cells
Aggregation was notably faster in experiments where LN, cells were mixed with tumor cells, as compared with experiments with tumor cells alone (
To investigate this further, we generated a rabbit polyclonal antibody specifically against the N-cadherin prodomain (anti-proN). Using this antibody, we looked at immunolocalization of the N-cadherin precursor (proN) and found that it could be detected intracellularly in permeabilized glioma and melanoma cells (
Since N-cadherin expression has been shown to correlate with increased motility and proN lacks adhesive function, we hypothesized that loss of adhesion due to aberrant surface expression of proN may serve as a mechanism for enhanced motility in brain tumor cells, even in the presence of mature N-cadherin. In this way proN could influence for example glioma invasion and melanoma metastasis. We engineered an N-cadherin construct (called Ncad-1, which expresses a mutant precursor protein referred to as Ncad-1 or mutant proNCAD) where the endogenous consensus proprotein convertase cleavage site was replaced with a serum coagulation Factor Xa recognition site in the linker sequence (
To examine the role of proNCAD in cell motility, we performed a wound healing assay in which confluent monolayers are disrupted by scraping with a fine pipette tip. WM115 and WM266 mock transfected cells exhibited reduced migration into the wound compared to WM115 and WM266 cells transfected with mutant proNCAD (
The effect of surface proNCAD on invasion was assessed in three-dimensional collagen invasion assays and Boyden chamber assays. Spheroids of mutant proNCAD or mock transfected glioma cells were implanted into a collagen matrix with or without Factor Xa, and invasion was monitored over 5 days (
Classical cadherins are synthesized as inactive propeptide precursors, which become functional mature proteins upon post-translational processing. The subtilisin-like proprotein convertases (PCs) are a family of Ca2+-dependent endoproteases, responsible for the activation of precursor proteins by cleavage at a consensus recognition site (Arg/Lys-(X)n-Lys/Arg-Arg, n=0, 2, 4 or 6) (Seidah and Chretien (1997) Curr opin Biotechnol;, 602-607). The common mammalian PCs described are furin, PC7, PACE4, PC5, PC1/3, PC2, and PC4. While PC1 and PC2 are important in the endocrine pathway, and PC4 only functions in germinal cells, furin, PC7, PACE4, and PC5 have a wide tissue distribution and proteolytically process precursors in the constitutive secretory pathway. It has been shown that furin can cleave pro-E-cadherin (Posthaus et al. (1998) FEBS Lett 438; 306-310), rendering the molecule functionally adhesive, and precursor N-cadherin, like other classical cadherins, has a consensus cleavage site for PCs (Koch et al. (2004) Structure 12: 793-805; Posthaus et al. (1998) FEBS Lett 438; 306-310) at the C-terminal end of the prodomain. PC5 is expressed as either the A or B isoform. The reagents used herein do not distinguish between these isoforms and the terms PC5, PC5A, PC5B, PC5/6, and PC5/6B are used interchangeably herein.
We therefore looked at the expression of furin, PC7, PACE4 and PC5 in the tumor cells to determine whether differences in levels of these enzymes might underlie the mechanism leading to surface expression of proN (also referred to as proNCAD or precursor N-cadherin; these terms are used interchangeably herein). Since only 45% of the highly invasive glioma cells, compared to 70% of metastatic melanoma cells expressed cell surface proN, this suggested that there may be additional mechanisms associated with malignant glioma cell invasion. Semiquantitative RT-PCR revealed similar levels of PC7 in U343 and U251 cells, and expression of PACE4 was not detected in either cell line (
The contrasting expression of PC5 was quite intriguing, especially since it was demonstrated that E-cadherin was processed in furin-deficient LoVo cells indicating that another convertase can also process N-cadherin (Posthaus et al. (1998) FEBS Lett 438; 306-310). This led us to inspect the N-cadherin sequence for another PC cleavage site. We identified a strong putative site for PC5 or PACE4 where the molecule would be cleaved at position 28 in EC1, downstream of the consensus site (see
To determine the effects on cellular behavior by furin we carried out knockdown experiments in U343 cells using siRNAs specific for furin and gain of function experiments where U251 cells were stably transfected with furin. Cells were successfully transfected with siRNA (
To determine whether N-cadherin can be cleaved at the second site and by which convertase, we carried out a series of transient co-transfections in HeLa cells, which are deficient for PC5A (Essalmani et al. (2006) Molec Cell Biol 26; 354-361). In these experiments, we were able to detect whether N-cadherin was cleaved at the first or second site by identifying cleavage peptides in the conditioned medium using the proN antibody. Our results demonstrate that two cleavage products, one at 17 kDa, and one at 20 kDa are detected when HeLa cells are transfected with N-cadherin and full length (FL) PC5A (
Transfection of HeLa cells with N-cadherin and convertase constructs was verified by running Western blots of total cell lysates using a myc (9E10) antibody to detect N-cadherin expression, and a V5 antibody to detect convertase expression (see
We then looked at localization of PC5A in transfected HeLa cells. PC5A is localized to the cell surface in cells that are transfected with FL-PC5A and stained under non-permeabilizing conditions (
We investigated at which site(s) N-cadherin is processed by endogenous PCs in glioma cells by transfecting these cells with the N-cadherin construct. We were able to detect N-cadherin processing mostly at the second site in U251 cells, and to a much lesser extent at the consensus site (
Thus relatively high furin levels and low PC5A levels would be expected to render brain tumor cells less invasive and more adhesive to one another since cells would be cleaved at the consensus site, and the contrary would be true for highly invasive brain tumor cells expressing low furin and high PC5A levels.
We looked at the localization of endogenous PC5A by immunocytochemistry, and detected substantial levels of the enzyme at the cell surface of U251 cells, but very low levels at the surface of U343 cells (
To determine the effects on cellular behavior by furin and PC5A, we carried out gain of function experiments where U251 cells were stably transfected with furin, and U343 cells were stably transfected with PC5A or a catalytically inactive PC5A mutant (PC5A-R84A; (Nour et al. (2003) J Biol Chem 278; 2886-2895). Transfected cells exhibited colocalization of furin or PC5A with EGFP (
We also carried out knockdown experiments using siRNAs specific for PC5A or furin. Cells were successfully transfected with siRNA (
Together, these results demonstrate that furin expression appears to inhibit glioma cell migration, and PC5A expression promotes glioma cell migration.
To demonstrate the functional importance of N-cadherin processing by PC5A or furin, we engineered another N-cadherin mutant where the second cleavage site was abolished (Ncad-II), but the consensus site was intact (
We investigated the surface proN profile as well as PC5A and furin levels in human brain tumor biopsies and several types of carcinoma cell lines (prostate, bladder, squamous cell, and breast) that undergo an E-to-N transition. We found that a high proportion of surface proN was present in highly aggressive glioblastoma multiforme (GBM) cells (˜80%,
We also determined quantitative expression levels of furin and PC5A in the same carcinoma cell lines as well as in a series of human brain tumor biopsies. We found that the metastatic carcinoma cells, including WM266 metastatic melanoma, expressed low furin levels and low PC5A levels (
These results indicate that it may be possible for N-cadherin to be cleaved by furin intracellulary, and then inactivated by PC5A at the cell surface in cells expressing both enzymes. Sequential cleavage of a precursor protein by PC enzymes has been previously demonstrated. Pro-BMP-4 undergoes serial cleavage at two sites in its prodomain, and differential use of the upstream site determines the activity of the mature protein partially via regulating protein stability (Cui et al. (2006) Genes Develop. 15; 2797-2802). Therefore in a proportion of highly aggressive tumor cells, N-cadherin may be cleaved sequentially by furin and PC5A.
Taken together, our results indicate that cleavage of N-cadherin by furin and PC5A convertases appears to have opposing effects on intercellular adhesion and cellular motility. Furthermore, it appears that PC5A expression is important for cells that are actively invading, and in the process of metastasis, but not for tumor cells that have successfully metastasized to a secondary site. Cleavage of N-cadherin by PC5A has a profound effect on cell motility and is key for invasion. Our results suggest also that a decrease in PC5A expression is an early event necessary for cells to associate with their neighbors and stop invading.
Using a rabbit polyclonal antibody specifically against the NCAD prodomain (anti-proN) (Koch et al., 2004), we examined a panel of carcinoma cell lines derived from post-metastatic sites (prostate (PC3 and PPC-1), bladder (T24 and JCA-1), squamous cell (NC1-H226), and breast (MDA-MB-436)) for surface proNCAD expression. We found that proNCAD could be detected on the surface of these metastatic carcinoma cell lines in cell surface biotinylation experiments and the ratio of surface versus total cell ranged from 40% to 80% (
To this end, we made use of melanoma cell lines representing different stages of transformation. WM115 was derived from VGP melanoma at the primary tumor site and WM266 was derived from metastatic melanoma at a secondary site in the same patient. We also used the U343 and U251 glioma cell lines, isolated from a grade III anaplastic astrocytoma, and a GBM, respectively. The U343 and U251 cell lines exhibit different degrees of invasiveness in a collagen gel matrix. U343 cells only invade approximately 500 μm compared to 1400 μm for U251 cells 5 days post-implantation (
Since NCAD is an abundant component of melanoma and glioma cell lines, we wanted to examine the intercellular adhesive activity of these cells. We observed greater aggregation in less invasive U343 glioma cells and in WM115 VGP melanoma cells, compared to highly invasive U251 cells and WM266 metastatic melanoma cells, respectively (
These results strongly suggest that aberrant cell-surface expression of non-adhesive proNCAD is important for tumor cell migration and invasion.
Since NCAD expression has been shown to correlate with increased motility and proNCAD lacks adhesive function, we hypothesized that loss of adhesion due to aberrant surface expression of proNCAD may serve as a mechanism for enhanced motility in brain tumor cells, even in the presence of mature NCAD. We engineered an NCAD construct (proNCAD) where the endogenous consensus proprotein convertase cleavage site (Koch et al., 2004) was replaced with a serum coagulation Factor Xa recognition site in the linker sequence (
We investigated the effect of surface expressed proNCAD in vivo. U343 glioma and WM266 melanoma cells were transfected with mock vector, wild type (wt) NCAD-myc, or mutant proNCAD-myc, and transfectants were selected. We carried out intracerebral injections of U343 transfectants in the striatum of SCID mice. Tumor growth was analyzed 30 days post-injection using an antibody specifically against human nuclei to detect solid tumor masses and single cells (
We carried out intra-peritoneal (IP) injections of transfected melanoma cells, and observed tumor growth 30 days post-injection. Pigmented subdermal tumors and several polyps associated with the peritoneum or the small intestine, liver, or spleen, were detected in mice injected with WM266-myc cells (
Altogether our results demonstrate that during malignant glioma and melanoma transformation there are significant amounts of non-adhesive proNCAD that appear on the cell surface, in addition to functional NCAD (
Human WM115, and WM266-4 melanoma cell lines, human U343, and U251 glioma cell lines, and NC1-H226 (squamous cell), and MDA-MB-436 (breast) carcinoma cell lines were purchased from American Type Culture Collection (Rockville, Md.). PPC-1, PC3, JCA-1, and T24 cell lines were the kind gift of Dr. A. Bokhoven.WM115 is a vertical growth phase (VGP) melanoma, and WM266 is a metastatic melanoma. Human U343 and U251 cells, as well as L cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco). Human WM115 and WM266 cells were cultured in MEM (Gibco) supplemented with 2 mM L-glutamine, Earle's BSS, and 10% FBS, and adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids and 1.0 mM sodium pyruvate. Human MDA-MB-436 cells were cultured in DMEM supplemented with 10% FBS, 10 mcg/ml insulin, and 16 mcg/ml glutathione. Human NC1-H226 cells were cultured in RPMI 1640 medium with 2 mM L-glutamine, 10% FBS, , and adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate. PPC-1, PC3, JCA-1, and T24 human cell lines were cultured in Ham's F12K medium with 2 mM L-glutamine, and 10% FBS, and adjusted to contain 1.5 g/L sodium bicarbonate. All cell lines were cultured in 100 U/ml penicillin, and 100 mg/ml streptomycin, and maintained at 37° C. in a humidified atmosphere of 5% CO2.
N- or E-cadherin-expressing (also referred to herein as NCAD or ECAD expressing, respectively) mouse L cells were generated as previously described (Koch et al. (2004) Structure 12: 793-805). Lipofectamine Plus transfection reagent (Invitrogen) was used to transfect WM115, WM266, and U343 cells with mutant N-cadherin, as well as for transient transfections of HeLa cells and glioma cells. For selection of stable cell lines, cells were seeded in complete DMEM containing 800 μg/ml of Geneticin G418 (GIBCO), the day following transfection.
To assess 2D migration of brain tumor cell lines, 3×105 cells were seeded in chamber slides (Lab Tek), and allowed to grow to confluence. Monolayers were disrupted by scraping with a fine pipette tip, and migration was monitered. Factor Xa was added at a concentration of 0.4 U/ml, where applicable.
Confluent monolayers of tumor cell lines were dissociated and spheroids were prepared using the hanging drop method as previously described (55-58). Spheroids were implanted into 4-well culture dishes containing 0.5 ml aliquots of a collagen type I solution (Vitrogen 100, Cohesion, Palo Alto, Calif.), using a Pasteur pipette. After polymerization at 37° C. for 60 min, the gel was overlaid with 0.5 ml supplemented DMEM. Cell invasion was assessed daily using an inverted phase contrast light microscope. The number of cells invading at increasing distances away from the spheroid was assessed using a concentric grid system (Northern Eclipse 6.0). Factor Xa was added at 0.4 U/ml during spheroid preparation and post-implantation into the collagen gel.
To assess cellular invasion, 3×105 cells were seeded on the upper chamber of Matrigel coated membranes (8 μm pore size) (Millipore). Conditioned medium was made by incubating NIH 3T3 cells in DMEM with 0.1% bovine calf serum (BCS) and 50 pg/ml ascorbic acid for 24 h, and was applied to the bottom chamber, serving as a chemoattractant. The cells were allowed to invade the Matrigel substrate for 24 h. The remaining cells that did not migrate through the membrane pores were removed with a cotton swab, and the number of invaded cells was counted in three independent experiments. Factor Xa was added at a concentration of 0.4 U/ml, where applicable.
RNA was extracted from human cell lines and human brain tumor biopsies using RNeasy mini kit (Qiagen). cDNAs were prepared using the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas). Human brain tumor tissue was kept frozen at −80° C. until RNA extraction was performed. Semi-quantitative PCR was carried out to determine furin, PC5, PC7, and PACE4 expression, and GAPDH was used as a normalizing control. Real-time PCR was carried out to quantify furin and PC5 expression relative to S14 expression, as previously described (Dubuc et al. (2004) Arterioscler Thromb Vasc Biol 24; 1454-1459). Primers for semi-quantitative and real-time PCR are listed in Table 1.
To assess N-cadherin proteolytic processing, we devised an assay where N-terminal cleavage products were detected in the conditioned medium of cells using the proN antibody. Cells were transiently transfected with the appropriate construct(s), the conditioned medium was collected 36 h later, concentrated, and total protein concentration was determined using a Lowry assay (Biorad). Conditioned medium (15 μg protein) was run on a 15% gel, and cleavage products detected were as follows: a 17 kDa band corresponded to cleavage at the consensus site, and a 20 kDa band represented cleavage at the second site.
Pre-designed, small interfering RNA (siRNA) for furin (# 105594 and # 112945), PC5A (# 17520 and # 144223), GAPDH, and Cy3-labeled negative control #1 were purchased from Ambion. U343 and U251 cells were transfected with furin siRNA (80 nM) and PC5 siRNA (80 nM), respectively, using Lipofectamine plus reagent. Cells were used in experiments 3 days after transfection.
Descriptive statistics including mean, standard error of the mean, analysis of variance (ANOVA), independent sample t-tests and Tukey's test for multiple comparisons, were used to determine significant differences between pairs. P values less than 0.05 were considered significant.
The following primary antibodies were used for Western blots and immunocytochemistry: rabbit affinity purified polyclonal anti-N-cadherin cytoplasmic domain, and anti-N-cadherin pro-region (Koch et al. (2004) Structure 12: 793-805); generated in Dr. D. R. Colman's laboratory), rat monoclonal anti-N-cadherin extracellular domain (NEC2) (Dr. Takeichi, RIKEN, Japan), mouse monoclonal anti -GFP (Clontech/BD), rabbit polyclonal anti-PC 5A, anti-propC5A, anti-furin, and anti-PC7 (Dr. N.G. Seidah), mouse monoclonal anti-myc (9E10; Sigma), mouse monoclonal anti-erk (Upstate Biotechnology), mouse monoclonal anti-V5 (Invitrogen), mouse monoclonal anti-tubulin (Upstate), rabbit polyclonal anti-nestin (Chemicon), and mouse monoclonal anti-β-catenin (Upstate). Fluorescent-conjugated secondary antibodies were from Chemicon. DAKO (cytomation fluorescence mounting media; Dakocytomation) was used to mount coverslips on glass slides. Lipophilic dye Dil (1,1-dioctadecyl-3,3,3,3,-tetramethylindocarbocyanine), and DiO (3,3-dioctadecyloxacarbocyanine perchlorate) were purchased from Molecular Probes. Decanoyl-Arg-Val-Lys-Arg-chloromethylketone (Dec-cmk) was purchased from Bachem.
The following primary antibodies were used for Western blots, immunocytochemistry, and immunohistochemistry: rabbit affinity purified polyclonal anti-NCAD cytoplasmic domain, and anti-NCAD pro-region ((Koch et al., 2004); generated in D. R. C. laboratory), rat monoclonal anti-NCAD extracellular domain (NEC2) (Dr. M. Takeichi, RIKEN, Japan), mouse monoclonal anti -GFP (Clontech/BD), mouse monoclonal anti-myc (9E10; Sigma), mouse monoclonal anti-ERK (Upstate Biotechnology), rabbit polyclonal anti-furin (N. G. S. laboratory), mouse monoclonal anti-tubulin (Upstate), rabbit polyclonal anti-nestin (Chemicon), mouse monoclonal anti-p-catenin (Upstate), mouse monoclonal anti-human nuclei (Chemicon), and rabbit polyclonal anti-Ki 67 (MIB-1) (Abcam). Fluorescent-conjugated secondary antibodies were from Chemicon. Fluorescence mounting media (DAKO) was used to mount coverslips on glass slides. Primary antibody enhancer, HRP polymer secondary solution (anti-mouse and anti-rabbit), and the AEC chromogen were from Lab Vision. Aquatex mounting media was from EMD Chemicals. Lipophilic dye Dil (1,1-dioctadecyl-3,3,3,3,-tetramethylindocarbocyanine), and DiO (3,3-dioctadecyloxacarbocyanine perchlorate) were purchased from Molecular Probes.
A wild type N-cadherin cDNA, and a mutant N-cadherin myc- or GFP-tagged cDNA (Ncad-1) was as previously described (Koch et al. (2004) Structure 12: 793-805). An N-cadherin myc-tagged cDNA mutated at the second cleavage site (Ncad-II) was generated using QuickChange II XL site-directed mutagenesis kit (Stratagene), according to manufacturer instructions. Mutagenesis primers were as follows: 5′GTCAGAATCAGGTCTGATGCAGATAAAAACCTTTCCC 3′ (forward), and 5′ GGGAAAGGTTTTTATCTGCATCAGACCTGATTCTGAC 3′ (reverse). Wild type PC5A, and PACE4 EGFP— and V5-tagged cDNA, as well as cDNAs of PC5A and PACE4 with the CRD deleted, were as previously described (Nour et al. (2005) Mol. Biol. Cell 16: 5215-26). V5-tagged furin cDNA and PC7 cDNA were cloned into the pIRES2-EGFP vector (Seidah et al. (1999) Ann N Y Acad Sci 885; 57-74).
For protein extraction, subconfluent monolayers were washed with PBS, dissociated using 2 mM EDTA in PBS (as above), and pelleted at 1000 rpm for 5 min. Lysates were obtained using RIPA lysis buffer (150 mM NaCl, 20 mM Tris-HCl, pH 7.5, 1% NP-40, 1% Triton X-100) with protease inhibitors (complete mini, Roche Diagnostics) on ice for 30 min. After cell lysis, samples were centrifuged for 15 min at 15,000 rpm and the supernatants were transferred to clean tubes. Protein concentration was determined using the Lowry assay (Biorad DC protein assay) and samples were run on a 4-15% linear gradient SDS-PAGE gel (Biorad), transferred to nitrocellulose, membrane-blocked with 5% milk protein, and incubated overnight with primary antibodies at 4° C. Blots were then incubated with HRP-conjugated secondary antibodies, and routine washes were carried out. Blots were developed with the chemiluminescence system (Pierce Biotechnology). Alternatively, for signal quantification, the chemifluorescence kit was employed (Pierce Biotechnology) and the Storm Imager.
Subconfluent monolayers were washed three times with ice cold PBS containing 2 mM MgCl2, and incubated with 0.2 mg/ml EZ-Link NHS-SS-Biotin (Pierce Biotechnology) solution in PBS for 30 min at 4° C. to inhibit endocytosis. Excess biotin was quenched by washing three times with ice cold TBS (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM MgCl2, and 2 mM CaCl2), followed by 3 washes with ice cold PBS. Cells were scraped off the plate with 0.5 ml RIPA buffer and lysis was carried out as above, followed by protein concentration determination of lysate supernatants. Immunopure Immobilized Streptavidin beads (Pierce) were added to 30 or 60 μg of total protein, the volume brought up to 0.5 ml with RIPA buffer. Binding of biotinylated proteins to streptavidin beads occurred during a 2h incubation at 4° C., with gentle rocking. Streptavidin beads were pelleted (13 000 rpm, 4° C.), the supernatant was discarded and beads were washed with 1 ml RIPA buffer three times. The supernatant from the last wash was discarded and 2×SDS sample buffer containing 100 mM DTT was added to dissociate the biotinylated proteins from the streptavidin beads via reduction of the disulfide bond in the biotin molecule. Samples were run on SDS-PAGE gels and immunoblotting was carried out as outlined above. Anti-N-cadherin cytoplasmic antibody was used to detect total N-cadherin protein (mature and precursor), anti-proN antibody was used to detect precursor N-cadherin, and anti-erk was used as a cell surface biotinylation control.
Cells were plated onto poly-L-lysine coated coverslips in supplemented DMEM (see above). Cells were fixed in 4% paraformaldehyde, permeabilized in 0.3% TritonX, PBS, and blocked in 5% BSA, 5% goat serum, PBS. Cells were then incubated for 1 h in primary antibody diluted in 1% BSA, 0.02% TritonX, PBS, followed by a 40 min incubation in fluorescent-conjugated secondary antibodies. Three washes with PBS were performed before fixation, as well as following each step. Coverslips were mounted and examined by confocal laser microscopy using the Zeiss LSM 510 microscope and 60×oil immersion objective.
Live-cell staining was carried out by incubating cells plated on coverslips with primary antibody diluted in medium without serum at 4° C. for 1 h. The cells were washed with PBS and fixed in 4% paraformaldehyde. Following washes with PBS, cells were incubated with fluorescent-conjugated secondary antibody diluted in 1% BSA, 0.02% TritonX, PBS, for 40 min at room temperature. Coverslips were then mounted and examined as above. For surface PC5A staining, cells were washed twice with ice-cold PBS, fixed with freshly prepared 3.7% paraformaldehyde for 10 min on ice, washed 3 times with PBS, incubated in 150 mM glycine for 5 min, washed once with PBS, blocked for 30 min in 1% BSA, incubated in primary antibody overnight at 4° C., washed 4 times with PBS, incubated with secondary antibody for 40 min at room temperature, and washed 4 times with PBS. Coverslips were mounted and examined as above.
Briefly, sections were air dried for 30 min to 2h, washed with PBS for 5 min, blocked in PBS containing 10% FBS and 0.5% triton-X-100 for 90 min, and incubated with primary antibody in blocking solution overnight at 4° C. in a humidified chamber. Sections were then washed three times in PBS, incubated in secondary antibody in blocking solution for 90 min at room temperature in a humidified chamber, and washed two times in PBS. Slides were mounted and examined by confocal laser microscopy using the Zeiss LSM 510 microscope. Alternatively, sections were incubated in 0.1% Triton X-100 for 10 min, in 0.3% v/v hydrogen peroxide, and blocked in 1% goat serum in PBS for 30 min. Blocked slides were rinsed in PBS and incubated with primary antibodies overnight at 4° C. The slides were incubated in the HRP polymer solution, and developed with the AEC chromogen solution according to the manufacturer's recommendations. Sections were counterstained with hematoxylin and coverslipped .
Monolayer cultures were treated with 2 mM EDTA in PBS for 5 min at 37° C. The cells were then washed gently in HCMF (Hepes-buffered Ca2+-Mg2+-free Hanks' Solution) supplemented with 1 mM CaCl2 and 1% BSA for 30 min at 37° C., to dissociate the monolayer into single cells while leaving cadherins intact on the cell surface. Following cell dissociation, 5×105 cells per well were transferred to 24-well low-adherent dishes (VWR), and brought up to a final volume of 0.5 ml HCMF containing 1% BSA with or without 1 mM Ca2+. The plates were rotated at 80 rpm at 37° C. for 40 min. At t=0 min, t=20 min, and t=40 min, 50 μl of the fixed aggregates were removed, placed on a slide, covered with a coverslip, and examined by light microscopy. For mixed aggregation analysis, tumor cells were labeled with dye Dil, and L cells either expressing N-cadherin or E-cadherin were labeled with DiO. Stock solutions of Dil were made by dissolving 2.5 mg Dil in 1 ml of 100% ethanol, and stocks of DiO were made by dissolving 2.5 mg DiO in 1 ml of 90% ethanol, 10% dimethylsulfoxide. The stock solutions were sonicated and filtered before use. Cell monolayers were labeled with these dyes by incubating them overnight in serum-containing DMEM with either 15 μg/ml Dil or 10 μg/ml DiO. Cells were washed extensively with PBS containing calcium, single cell suspensions were obtained as described above, and 5×105 cells per well of each of two types were transferred to a 24-well dish. The dishes were rotated and aggregates were examined by fluorescent microscopy. Where applicable, Factor Xa (0.4 U/ml, Sigma) was added before and after cell dissociation.
Primary Tumour Cell Cultures from Human Patient Resections
Primary cell cultures were prepared from human brain tumour resections carried out at the Montreal Neurological Hospital (Quebec, Canada) by Dr. Rolando F. Del Maestro. All patients signed a written consent form prior to the operation. Pathology reports classified tumors from patients OP-128 and OP-132 as GBMs, OP-122 as an anaplastic astrocytoma, OP-133 as a recurrent anaplastic oligodendroglioma, and OP-109 as a low grade glioma. Single cell suspensions from these tumour resections were obtained by serial trypsinization. Briefly, the tissue was mechanically dissociated using a scalpel, in a Petri dish containing PBS, placed in a conical tube with 0.25% trypsin, and DMEM (1:1), shaken, and placed in a 37° C. water bath for 5 min, allowing the tissue to settle to the bottom of the tube. The supernatant, containing suspended tumour cells, was transferred to a clean tube, pelleted, resuspended in supplemented DMEM with 20% FBS, and plated. Two more rounds of trypsinization were carried out on the remaining tissue pieces, and each time the pelleted cells were plated.
The tissue biopsy samples were kept at −80° C. in the Brain Tumor Tissue Bank, in the Brain Tumor Research Centre (BTRC), Montreal Neurological Institute (MNI), and used for RNA isolation and determination of furin and PC5 expression: CT-01-001 and OP-132 were GBM, OP-122 was an anaplastic astrocytoma (III), OP-71 was a low grade glioma, CT-04-005 was a ganglioglioma, and OP-113 was a metastatic breast carcinoma.
Intra-peritoneal injections were completed using female, 6 week old, CD1 nu/nu athymic mice (Charles River Canada). 1×106 melanoma cells were suspended in 500 μl of phosphate buffered saline (PBS) and injected into the left lower quadrant of the abdomen.
Stereotactic intra-cerebral tumor cell injections were completed as described (Martuza et al. (1991) Science 252: 854-856). Briefly, female, 6 week old, CD1 nu/nu athymic mice (Charles River Canada) were anaesthetized by intra-peritoneal injection using a cocktail containing ketamine, xylazine and acepromazine. The animal was placed in a stereotactic frame (Kopf Instruments) and a small incision at the midline of the skull was made. A burr hole was drilled 0.5 mm anterior and 2 mm lateral to bregma. A microliter syringe (Hamilton Company) was slowly lowered through the burr hole to a depth of 4.4 mm and a cell suspension consisting of 1×105 cells, as counted by a hemocytometer, in 3 μl of PBS was injected over a 12 minute period. The syringe was slowly withdrawn and the animals were given saline subcutaneously to aid in recovery. Animals were euthanized at one month and tumor invasion was analyzed as described below. All animal experimentation was approved by the Institutional Animal Care Committee and conformed to the guidelines of the Canadian Council of Animal Care.
Animals were anaesthetized with 2.5% Avertin and perfused intraventricularly using a 4% paraformaldehyde (Pfa) solution. the brain was removed and placed in 4% PFA solution for 15 minutes before being transferred to a 30% sucrose solution overnight at 4° C. The tissue was then embedded into optimal cutting temperature (OCT) and left to freeze overnight at −80° C. 20 μm serial sections of these frozen blocks were taken using a cryostat (Leica Microsystems) and prepared for immunohistochemistry.
All morphometric analysis including 3D reconstruction, invasion distance calculations and tumor foci counts were completed using Neurolucida (MBF Bioscience).
Descriptive statistics including mean, standard error of the mean, analysis of variance (ANOVA), independent sample t-tests and Tukey's test for multiple comparisons, were used to determine significant differences between pairs. P values less than 0.05 were considered significant.
1(+)-ATCCCAGGAATGAGTTGTC
2(−)-CTCACCCTGTCCTATAATCG
1(+), forward primer;2(−), reverse primer
The contents of all documents and references cited herein are hereby incorporated by reference in their entirety.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA2008/001949 | 11/3/2008 | WO | 00 | 8/26/2010 |
| Number | Date | Country | |
|---|---|---|---|
| 60996119 | Nov 2007 | US |