The present disclosure relates broadly to an aptamer for dengue virus and related methods, mixtures, kits and nucleic acid molecules.
Dengue is a widespread mosquito-borne viral disease, with four categorized serotypes. Although there is no drug therapy available, early detection and medical care reduce morbidity and mortality. A secondary infection with a different serotype results in more severe disease. A commercially available dengue vaccine has been developed, but not for use in previously uninfected people.
Dengue is an arthropod-borne flavivirus with four main serological types (DEN1-4). Worldwide dengue virus (DENV) infections have been estimated at more than 390 million annually, and the recent dramatic and global increase in incidence suggests that approximately 40% of the world's population is now at risk. The symptoms range from mild in most cases to severe and occasionally fatal. Infection with one DENV serotype provides long-term protection from re-infection with the same serotype, but may enhance disease from a secondary heterotypic infection. A secondary DENV infection is the greatest risk factor for severe disease such as Dengue Hemorrhagic Fever and Dengue Shock Syndrome. Antibody-dependent enhancement (ADE) is thought to be one of the mechanisms responsible for severe dengue. The immune history of a person is important for understanding subsequent disease risk, pathogenesis, and protection, and thus the ability to elucidate previous infected serotype is invaluable to study. Diagnostic methods for serotype identification in previously infected patients are helpful to elucidate whether the sequence of dengue serotype infection affects the severity of the disease.
There is currently no specific treatment for dengue, but early diagnostics prompt proper medical attention and reduce the risk of fatality. Dengvaxia, a dengue vaccine, was developed by Sanofi Pasteur. However, analyses revealed that the vaccination of persons who have never been infected with dengue led to a higher risk of more severe symptoms when they became infected after the vaccination. Consequently, the World Health Organization (WHO) advised the use of the vaccine only in people previously infected with dengue. The effectiveness of the vaccine could be different for people previously infected with different serotypes of dengue, and more research is needed to understand the mechanisms. Therefore, the development of detection methods for not only current infection but also past infection, including the serotype identification, is an urgent worldwide task.
In the early phase of DENV infection (e.g. within one week after fever onset) the viral RNA can be identified by RT-qPCR. Virus-related materials, such as the envelope protein and nonstructural protein 1 (NS1), can also be detected by an enzyme-linked immunosorbent assay (ELISA) or lateral flow assay (LFA), using antibodies to the antigens. RT-qPCR is useful for serotype identification in the early phase, but not in the later phase. For the serotype-specific NS1 detection in the early phase, the generation of antibodies to each NS1 serotype has been described, but these antibodies are not commercially available. In the later phase, the patients' IgM and IgG antibodies to viral-related antigens, such as viral particles and NS1 proteins, are detectable by ELISA or LFA. However, the detection reliabilities are still limited, and the serotype identification remains difficult.
DNA aptamers are single-stranded DNA fragments that bind specifically to target molecules, and are considered to be antibody alternatives. DNA aptamers are initially obtained by an evolutionary engineering method called SELEX (Systematic Evolution of Ligands by EXponential enrichment), involving repetitive cycles of selection and PCR amplification using DNA libraries. Once the appropriate aptamer sequences are determined, they can be chemically synthesized on a large GMP scale. Although many DNA aptamers have been reported, their applications remain limited due to the insufficient affinities to their targets (KD values 10−7-10−9 M).
Thus, there is a need to provide an alternative aptamer for dengue virus and related methods and kits.
In one aspect, there is provided an aptamer for dengue virus (DENV), the aptamer comprising at least one unnatural base.
In one embodiment, the at least one unnatural base resides in a loop structure and/or a bulge of the aptamer.
In one embodiment, the at least one unnatural base is selected from the group consisting of: 7-(2thienyl)imidazo[4,5-b]pyridine (Ds); 7-(2,2′-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss); pyrrole2-carbaldehyde (Pa); 2-nitro-4-propynylpyrrole (Px); 7-(2,2′,5′,2″-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dsss); 2-amino-6-(2-thienyl)purin-9-yl group (5); 2-amino-6-(2,2′-bithien-5-yl)purin-9-yl group (ss); 2-amino-6-(2,2′,5′,2″-terthien-5-yl)purin-9-yl group (sss); 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDsa); 4-(2,2′-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl group (Dsas); 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dsav); 4-(2-thiazolyI)-pyrrolo[2,3-b]pyridin-1-yl group (dDva); 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dvas); 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDia); derivatives thereof; and combinations thereof.
In one embodiment, the aptamer comprises a DNA-based aptamer.
In one embodiment, the dissociation constant of the aptamer for DENV is no more than 200 pM.
In one embodiment, the aptamer is capable of binding to the NS1 protein of DENV.
In one embodiment, the aptamer is capable of binding specifically to a single serotype of DENV selected from the group consisting of serotype 1, serotype 2, serotype 3 and serotype 4.
In one embodiment, the aptamer comprises a sequence set out in the table below:
or; a sequence sharing at least 75% sequence identity thereto; or a sequence differing by one, two, three, four, five, six, seven, eight, nine or ten bases thereto; or portions thereof.
In one aspect, there is provided a mixture of aptamers that are specific to different serotypes, the mixture comprising at least two, at least three or at least four of the aptamers.
In one aspect, there is provided a method of identifying a DENV infection in a subject, the method comprising: contacting a sample of the subject with the aptamer or the mixture of aptamers; and detecting a binding event at the aptamer(s).
In one embodiment, the method is a method of identifying a current DENV infection in the subject, and a binding event at any of the aptamer(s) is indicative of a current DENV infection in the subject, optionally wherein the bound aptamer is specific to single DENV serotype and the binding event is indicative of a current DENV infection of said serotype in the subject.
In one embodiment, wherein where the subject is indicated for a current DENV infection, the method comprises further contacting a sample of the subject with the aptamer or the mixture of aptamers in the presence of a DENV protein; and detecting a binding event at the aptamer(s), wherein an absence of a binding event at any of the aptamer(s) is indicative that the current DENV infection is a secondary or further DENV infection, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.
In one embodiment, wherein the method is a method of identifying a past DENV infection in the subject, the contacting step is performed in the presence of a DENV protein, and an absence of a binding event at any of the aptamer(s) is indicative of a past DENV infection in the subject, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.
In one embodiment, the method comprises a competitive binding assay method.
In one embodiment, the method is carried out within one week following fever onset in the subject.
In one embodiment, the method further comprises administering a DENV treatment regimen to the subject if the subject is indicated for a current DENV infection.
In one aspect, there is provided a method of evaluating a subject's suitability for a DENV vaccine, the method comprising: contacting a sample of the subject with an aptamer or the mixture of aptamers in the presence of a DENV protein; detecting a binding event at the aptamer(s); determining an immune history of the subject based on the binding event at the aptamer(s), wherein an absence of a binding event at any of the aptamer(s) is indicative of a past DENV infection in the subject; concluding the suitability of the subject for the DENV vaccine based on the immune history.
In one aspect, there is provided a kit for identifying a DENV infection in a subject, the kit comprising the aptamer or the mixture of aptamers.
In one embodiment, the kit further comprises a DENV protein.
In one aspect, there is provided a nucleic acid molecule comprising a sequence set out in the table below:
or; a sequence sharing at least 75% sequence identity thereto; or a sequence differing by one, two, three, four, five, six, seven, eight, nine or ten bases thereto; or portions thereof.
The term “aptamer” as used herein broadly refers to a nucleic acid molecule that is capable of binding with high affinity and specificity to a target molecule, in particular to a dengue virus protein. An “aptamer” not only includes nucleic acid molecules composed of natural bases, but also include those comprising unnatural or artificial bases, modified bases and/or nucleic acid analogs. An “aptamer” may also have modifications. Non-limiting examples of such modifications include: terminus modification to increase a stability of the molecule, functional group modification (e.g. amino, thiol, ethyl, diol), conjugation modification (e.g. biotinylation) and phosphorothioate bond modification.
The term “identifying” as used herein in relation to an infection is to be interpreted broadly to encompass determining a presence, an absence, an amount, a level of disease burden, a phase or a nature of the infection. For example, identifying a phase of the infection may comprise determining whether the infection is in a febrile phase, a critical phase or a recovery phase etc. For example, identifying a nature of the infection may comprise determining a serotype of the infection, determining whether the infection is a primary infection or a secondary or subsequent infection and/or determining whether the infection is a current infection or a past infection.
The term “treatment”, “treat” and “therapy”, and synonyms thereof as used herein refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) a medical condition, which includes but is not limited to diseases (such as dengue infection), symptoms and disorders. A medical condition also includes a body's response to a disease or disorder, e.g. inflammation. Those in need of such treatment include those already with a medical condition as well as those prone to getting the medical condition or those in whom a medical condition is to be prevented.
The term “subject” as used herein includes patients and non-patients. The term “patient” refers to individuals suffering or are likely to suffer from a medical condition such as a flavivirus or dengue virus infection, while “non-patients” refer to individuals not suffering and are likely to not suffer from the medical condition. “Non-patients” include healthy individuals, non-diseased individuals and/or an individual free from the medical condition. The term “subject” includes humans and animals. Animals include murine and the like. “Murine” refers to any mammal from the family Muridae, such as mouse, rat, and the like.
The term “micro” as used herein is to be interpreted broadly to include dimensions from about 1 micron to about 1000 microns. When used as a unit prefix, 1 micro (μ) denotes a factor of 10−6.
The term “nano” as used herein is to be interpreted broadly to include dimensions less than about 1000 nm. When used as a unit prefix, 1 nano (n) denotes a factor of 10−9.
The term “particle” as used herein broadly refers to a discrete entity or a discrete body. The particle described herein can include an organic, an inorganic or a biological particle. The particle used described herein may also be a macro-particle that is formed by an aggregate of a plurality of sub-particles or a fragment of a small object. The particle of the present disclosure may be spherical, substantially spherical, or non-spherical, such as irregularly shaped particles or ellipsoidally shaped particles. The term “size” when used to refer to the particle broadly refers to the largest dimension of the particle. For example, when the particle is substantially spherical, the term “size” can refer to the diameter of the particle; or when the particle is substantially non-spherical, the term “size” can refer to the largest length of the particle.
The terms “coupled” or “connected” as used in this description are intended to cover both directly connected or connected through one or more intermediate means, unless otherwise stated.
The term “associated with”, used herein when referring to two elements refers to a broad relationship between the two elements. The relationship includes, but is not limited to a physical, a chemical or a biological relationship. For example, when element A is associated with element B, elements A and B may be directly or indirectly attached to each other or element A may contain element B or vice versa.
The term “adjacent” used herein when referring to two elements refers to one element being in close proximity to another element and may be but is not limited to the elements contacting each other or may further include the elements being separated by one or more further elements disposed therebetween.
The term “and/or”, e.g., “X and/or Y” is understood to mean either “X and Y” or “X or Y” and should be taken to provide explicit support for both meanings or for either meaning.
Further, in the description herein, the word “substantially” whenever used is understood to include, but not restricted to, “entirely” or “completely” and the like. In addition, terms such as “comprising”, “comprise”, and the like whenever used, are intended to be non-restricting descriptive language in that they broadly include elements/components recited after such terms, in addition to other components not explicitly recited. For example, when “comprising” is used, reference to a “one” feature is also intended to be a reference to “at least one” of that feature. Terms such as “consisting”, “consist”, and the like, may in the appropriate context, be considered as a subset of terms such as “comprising”, “comprise”, and the like. Therefore, in embodiments disclosed herein using the terms such as “comprising”, “comprise”, and the like, it will be appreciated that these embodiments provide teaching for corresponding embodiments using terms such as “consisting”, “consist”, and the like. Further, terms such as “about”, “approximately” and the like whenever used, typically means a reasonable variation, for example a variation of +/−5% of the disclosed value, or a variance of 4% of the disclosed value, or a variance of 3% of the disclosed value, a variance of 2% of the disclosed value or a variance of 1% of the disclosed value.
Furthermore, in the description herein, certain values may be disclosed in a range. The values showing the end points of a range are intended to illustrate a preferred range. Whenever a range has been described, it is intended that the range covers and teaches all possible sub-ranges as well as individual numerical values within that range. That is, the end points of a range should not be interpreted as inflexible limitations. For example, a description of a range of 1% to 5% is intended to have specifically disclosed sub-ranges 1% to 2%, 1% to 3%, 1% to 4%, 2% to 3% etc., as well as individually, values within that range such as 1%, 2%, 3%, 4% and 5%. The intention of the above specific disclosure is applicable to any depth/breadth of a range.
Additionally, when describing some embodiments, the disclosure may have disclosed a method and/or process as a particular sequence of steps. However, unless otherwise required, it will be appreciated that the method or process should not be limited to the particular sequence of steps disclosed. Other sequences of steps may be possible. The particular order of the steps disclosed herein should not be construed as undue limitations. Unless otherwise required, a method and/or process disclosed herein should not be limited to the steps being carried out in the order written. The sequence of steps may be varied and still remain within the scope of the disclosure.
Furthermore, it will be appreciated that while the present disclosure provides embodiments having one or more of the features/characteristics discussed herein, one or more of these features/characteristics may also be disclaimed in other alternative embodiments and the present disclosure provides support for such disclaimers and these associated alternative embodiments.
Exemplary, non-limiting embodiments of a nucleic acid molecule, optionally an aptamer for dengue virus (DENV), and related methods, mixtures kits are disclosed hereinafter.
In various embodiments, there is provided a nucleic acid molecule that is capable of recognizing and/or binding to DENV or portions thereof. The nucleic acid molecule may be a polynucleotide or an oligonucleotide. The nucleic acid molecule may be composed of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The nucleic acid molecule may comprise natural bases, unnatural or artificial bases, modified bases and/or nucleic acid analogs (e.g., containing base analogs, sugar analogs and/or a non-native backbone and the like). A nucleic acid molecule may also have modifications, for example, at its terminus or termini. The nucleic acid molecule may be single-stranded. In various embodiments, the nucleic acid molecule is capable of binding to DENV or portions thereof with high affinity and/or high specificity. No particular size is implied by the term “nucleic acid molecule”. In various embodiments, the nucleic acid molecule comprises an aptamer.
In various embodiments therefore, there is provided an aptamer for DENY. The aptamer may be an RNA-based aptamer, or an aptamer comprising ribonucleotide units or it may be a DNA-based aptamer, or an aptamer comprising deoxyribonucleotide units. In one embodiment, the aptamer comprises a DNA-based aptamer. Advantageously, a DNA-based aptamer may have increased stability. A DNA-based aptamer includes one with modification(s).
In various embodiments, the aptamer may comprise natural bases and/or unnatural bases (or artificial bases). A “natural base” refers to a naturally occurring base such as adenine (A), guanine (G), cytosine (C), thymine (T) (for a DNA-based aptamer) and uracil (U) (for an RNA-based aptamer). An “unnatural base” (or “artificial base”) refers to a base which is not a naturally occurring base. Non-limiting examples of an unnatural base (or an artificial base) include isoguanine (iG), isocytosine (iC), 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one (P), 6-amino-5-nitro-2(1H)-pyridone (Z), 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds), pyrrole-2-carbaldehyde (Pa), 2-nitropyrrole (Pn), 2-nitro-4-propynylpyrrole (Px), 7-(2,2′-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl (Dss), 7-(2,2′,5′,2″-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl (Dsss); 2-amino-6-(2-thienyl)purin-9-yl (s); 2-amino-6-(2,2′-bithien-5-yl)purin-9-yl (ss); 2-amino-6-(2,2′,5′,2″-terthien-5-yl)purin-9-yl (sss); 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl (dDsa); 4-(2,2′-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl (Dsas); 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl (Dsav); 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl (dDva); 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl (Dvas); 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl (dDia), 6-methylisoquinoline-1 (2H)-thione (5SICS) or
3-methoxynaphthalen-2-yl (NaM), 2-methoxy-4-methylphenyl (MMO2), derivatives thereof and the like. Examples of derivatives include dihydroxy derivatives such as diol-Px and diol-Pa (e.g. diol1-Px and diol1-Pa).
In some embodiments, examples of Px and Pa derivatives include
wherein R represents any moiety represented by the following formula:
or
an amino-linked, an alkylamino-linked, a diol-linked, an aromatic group-linked, a fluorescent group-linked, a fluorescent dye-linked or a fluorophore-linked Pa or Px derivative; or
a Pa or Px derivative described in (i) Okamoto I, Miyatake Y, Kimoto M, Hirao I. High Fidelity, Efficiency and Functionalization of Ds-Px Unnatural Base Pairs in PCR Amplification for a Genetic Alphabet Expansion System. Okamoto I, Miyatake Y, Kimoto M, Hirao I. 2016 Nov. 18; 5(11):1220-1230. Epub 2016 Feb. 5. PMID: 26814421; (ii) Someya T, Ando A, Kimoto M, Hirao I. Site-specific labeling of RNA by combining genetic alphabet expansion transcription and copper-free click chemistry. Nucleic Acids Res. 2015 Aug. 18; 43(14):6665-76. doi: 10.1093/nar/gkv638. Epub 2015 Jun. 29. PMID:26130718; (iii) Ishizuka T, Kimoto M, Sato A, Hirao I. Site-specific functionalization of RNA molecules by an unnatural base pair transcription system via click chemistry. Chem Commun (Camb). 2012 Nov. 14; 48(88):10835-7. doi: 10.1039/c2cc36293g. Epub 2012 Oct. 3. PMID: 23032097; (iv) Morohashi N, Kimoto M, Sato A, Kawai R, Hirao I. Site-specific incorporation of functional components into RNA by an unnatural base pair transcription system. Molecules. 2012 Mar. 7; 17(3):2855-76. doi: 10.3390/molecules17032855. PMID: 22399139; (v) Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I. Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Res. 2012 March; 40(6):2793-806. doi: 10.1093/nar/gkr1068. Epub 2011 Nov. 24.
PMID: 22121213; (vi) Yamashige R, Kimoto M, Mitsui T, Yokoyama S, Hirao I. Monitoring the site-specific incorporation of dual fluorophore-quencher base analogues for target DNA detection by an unnatural base pair system. Org Biomol Chem. 2011 Nov. 7; 9(21):7504-9. doi: 10.1039/c1ob06118f. Epub 2011 Sep. 20. PMID:21935564. The contents of references (i) to (vi) are also incorporated by reference herein in their entirety.
Examples of Ds derivatives include
wherein R and R′ each independently represent any moiety represented by the following formula:
wherein n1=2 to 10; n2=1 or 3; n3=1, 6, or 9; n4=1 or 3; n5=3 or 6; R1=Phe (phenylalanine), Tyr (tyrosine), Trp (tryptophan), His (histidine), Ser (serine), or Lys (lysine); and R2, R3, and R4=Leu (leucine), Leu, and Leu, respectively, or Trp, Phe, and Pro (proline), respectively.
In various embodiments, a derivative of a molecule or an unnatural base is structurally related to the molecule or the unnatural base. For example, the derivative may share a common structural feature, fundamental structure and/or underlying chemical basis with the molecule or the unnatural base. A derivative is not limited to one produced or obtained from the molecule or the unnatural base although it may be one produced or obtained from the molecule or the unnatural base. In some embodiments, the derivative is derivable, at least theoretically, from the molecule or the unnatural base through modification of the molecule or the unnatural base. In some embodiments, a derivative of a molecule or an unnatural base shares or at least retains to a certain extent a function, chemical property, biological property, chemical activity and/or biological activity associated with the molecule or the unnatural base. A skilled person will be able to identify, on a case by case basis and upon reading of the disclosure, the common structural feature, fundamental structure and/or underlying chemical basis of the molecule or the unnatural base that have to be maintained in the derivative to retain the function, chemical property, biological property, chemical activity, and/or biological activity. A skilled person will also be able to identify assays that can prove the retention of the function, chemical property, biological property, chemical activity, and/or biological activity. For example, a binding assay such as ELISA, EMSA, SPR and bio-layer interferometry (BLI) may be carried out to determine a binding property of an aptamer comprising an unnatural base derivative.
In various embodiments, the unnatural base is compatible with a polymerase, optionally a DNA polymerase. In various embodiments, the unnatural base is compatible with an amplification reaction such as polymerase chain reaction (PCR). In various embodiments, the unnatural base can form a base pair with another unnatural base. For example, Ds may base pair with Pn, Pa or Px. In some embodiments, the unnatural base forms a high fidelity pair with their complementary base in PCR. In various embodiments, the unnatural base is selected from members of an unnatural base pair system. For example, the unnatural base may comprise one or more members selected from Ds-Px pair, Ds-Pa pair, Ds-Pn pair, Dss-Px pair, Dss-Pa pair, Dss-Pn pair, iG-iC pair, P-Z pair, 5SICS-NaM pair, TPT3-NaM pair, 5SICS-MMO2 pair, derivatives thereof and the like.
In some embodiments, the unnatural base is hydrophobic. In some embodiments, the unnatural base is hydrophilic.
In various embodiments, the aptamer comprises from about one to about ten, or from about one to about five unnatural base(s). In various embodiments, the aptamer comprises at least about one, at least about two, at least about three, at least about four or at least about five unnatural base(s). In various embodiments, the aptamer comprises no more than about one, no more than about two, no more than about three, no more than about four or no more than about five unnatural base(s). In various embodiments, the aptamer comprises about one, about two, about three, about four, about five or more unnatural base(s).
The aptamer may comprise a hairpin structure or a stem-loop structure.
The aptamer may further comprise a bulge. In various embodiments, the aptamer comprises at least one hairpin structure or stem-loop structure and/or at least one bulge. In various embodiments, the unnatural base(s) resides in a loop structure of the aptamer. In various embodiments, the unnatural base(s) resides in a bulge of the aptamer. The bulge may or may not be in the loop structure. In various embodiments, the unnatural base(s) resides in a loop structure and/or a bulge of the aptamer. In some embodiments, from about one to about ten, or from about one to about five unnatural base(s) reside in a loop structure and/or a bulge of the aptamer. In some embodiments, at least about one, at least about two, at least about three, at least about four or at least about five unnatural base(s) resides in a loop structure and/or a bulge of the aptamer. In some embodiments, no more than about one, no more than about two, no more than about three, no more than about four or no more than about five unnatural base(s) resides in a loop structure and/or a bulge of the aptamer. In some embodiments, about one, about two, about three, about four, about five or more unnatural base(s) resides in a loop structure and/or a bulge of the aptamer. In some embodiments, all of the unnatural base(s) resides in a loop structure and/or a bulge of the aptamer. In some embodiments, a stem structure of the aptamer is devoid of an unnatural base. In some embodiments, the stem structure of the aptamer consists only of natural bases. In some embodiments, the loop structure and/or a bulge of the aptamer comprises unnatural base(s).
In some embodiments, the unnatural base in the aptamer does not have a binding partner. In some embodiments, the unnatural base in the aptamer does not form a base pair with a natural base. In some embodiments, the unnatural base forms a looped/buldged out region in the aptamer. A bulge may therefore be a portion of a nucleic acid or aptamer that has not been paired. Non-pairing may arise due to non-complementarity/mismatch base-pairing among natural bases, non-complementarity/mismatch base-pairing among unnatural bases, or non-complementarity/mismatch base-pairing among natural base(s) and unnatural base(s). In some examples, non-pairing arises due to the introduction of one or more unnatural base (e.g. in a region of natural bases) that does not form a base pair with natural bases. In some examples, a bulge includes from about 1 to about 20 bases, from about 1 to about 15 bases, from about 1 to about 10 bases or from about 1 to about 5 bases. In some examples, a bulge includes about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 bases.
In various embodiments, the number of bases in the aptamer is from about 20 to about 200, from about 20 to about 100, from about 30 to about 100, from about 40 to about 100, from about 40 to about 90, from about 40 to about 80, from about 40 to about 70 or from about 50 to about 60. Advantageously, embodiments of the aptamer having a short length or small size may have reduced unexpected interactions/toxicity, reduced cost of material/production and improved material quality assurance.
In various embodiments, the unnatural base is selected from the group consisting of: 7-(2thienyl)imidazo[4,5-b]pyridine (Ds); 7-(2,2′-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss); pyrrole2-carbaldehyde (Pa); diol-modified pyrrole2-carbaldehyde (diol-Pa); 2-nitro-4-propynylpyrrole (Px); diol-modified 2-nitro-4-propynylpyrrole (diol-Px); 7-(2,2′,5′,2″-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dsss); 2-amino-6-(2-thienyl)purin-9-yl group (5); 2-amino-6-(2,2′-bithien-5-yl)purin-9-yl group (ss); 2-amino-6-(2,2′,5′,2″-terthien-5-yl)purin-9-yl group (sss); 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDsa); 4-(2,2′-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl group (Dsas); 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dsav); 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDva); 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dvas); 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDia); derivatives thereof and combinations thereof. In various embodiments, the unnatural base is selected from the group consisting of: 7-(2thienyl)imidazo[4,5-b]pyridine (Ds), 7-(2,2′-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss), pyrrole2-carbaldehyde (Pa), diol-modified pyrrole2-carbaldehyde (diol-Pa), 2-nitro-4-propynylpyrrole (Px), diol-modified 2-nitro-4-propynylpyrrole (diol-Px), derivatives thereof and combinations thereof. In some embodiments, the aptamer comprises an unnatural base consisting of Ds, diol-Pa, diol-Px and derivatives thereof. In some embodiments, the aptamer comprises an unnatural base consisting of Ds. In some embodiments, the aptamer comprises more Ds (or derivatives thereof) than diol-Pa (or derivatives thereof) and/or diol-Px (or derivatives thereof).
In various embodiments, the aptamer comprising at least one unnatural base is capable of recognizing and/or binding to DENV, optionally a viral protein of DENV, optionally with high affinity and/or high specificity. In some embodiments, the aptamer comprising at least one unnatural base is capable of recognizing and/or binding to a non-structural protein of DENV, optionally with high affinity and/or high specificity. In some embodiments, the aptamer comprising at least one unnatural base is capable of recognizing and/or binding to a non-structural protein 1 (NS1) of DENV, optionally with high affinity and/or high specificity. In some embodiments, the aptamer comprising at least one unnatural base is capable of recognizing and/or binding to a serotype-specific NS1 of DENV, optionally with high affinity and/or high specificity. In various embodiments, the aptamer comprising at least one unnatural base is capable of forming a complex with DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV. For example, presence of an aptamer-DENV complex may be detected by an electrophoresis gel-mobility shift assay (EMSA). For example, high affinity and/or high specificity may be determined by surface plasmon resonance (SPR) analysis. For example, high affinity and/or high specificity may be determined by an enzyme-linked immunosorbent assay (ELISA). In various embodiments, the aptamer comprising at least one unnatural base is capable of recognizing and/or binding to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV with higher affinity and/or higher specificity than their comparative sequences devoid of an unnatural base (e.g. sequences in which the unnatural base(s) is substituted with natural base(s) at the same position(s) or same relative position(s)).
In various embodiments, the aptamer is capable of distinguishing between DENV of different serotypes. For example, the aptamer is capable of distinguishing dengue fever serotype 1 (DEN1) from dengue fever serotype 2 (DEN2), dengue fever serotype 3 (DEN3) and/or dengue fever serotype 4 (DEN4). For example, the aptamer is capable of distinguishing DEN2 from DEN1, DEN3 and/or DEN4. For example, the aptamer is capable of distinguishing DEN3 from DEN1, DEN2 and/or DEN4. For example, the aptamer is capable of distinguishing DEN4 from DEN1, DEN2 and/or DEN3. For example, the aptamer is capable of recognizing and/or binding to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV of one serotype with substantially higher affinity than that/those of the other serotype(s). In some examples, the aptamer is incapable of recognizing and/or binding to or does not recognize and/or bind to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV of the other serotypes. In various embodiments, the aptamer is capable of binding specifically to a single serotype of DENV selected from the group consisting of serotype 1, serotype 2, serotype 3 and serotype 4.
Advantageously, embodiments of the aptamer possess high affinity for DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV. In various embodiments, the aptamer has a dissociation constant (KD) of no more than about 14 nM, no more than about 13 nM, no more than about 12 nM, no more than about 11 nM, no more than about 10 nM, no more than about 9 nM, no more than about 8 nM, no more than about 7 nM, no more than about 6 nM, no more than about 5 nM, no more than about 4 nM, no more than about 3 nM, no more than about 2 nM or no more than about 1 nM. In various embodiments, the aptamer has a KD of no more than about 800 pM, no more than about 600 pM, no more than about 400 pM, no more than about 300 pM, no more than about 250 pM, no more than about 200 pM, no more than about 190 pM, no more than about 180 pM, no more than about 170 pM, no more than about 160 pM, no more than about 150 pM, no more than about 140 pM, no more than about 130 pM, no more than about 120 pM, no more than about 110 pM, no more than about 100 pM, no more than about 90 pM, no more than about 80 pM, no more than about 70 pM, no more than about 60 pM, no more than about 50 pM, no more than about 40 pM, no more than about 30 pM, no more than about 20 pM or no more than about 10 pM, In one embodiment, the KD of the aptamer for DENV is no more than 200 pM.
In various embodiments, the aptamer comprises a sequence set out in the Table 1 below:
or a sequence set out in Table 2 below:
or a sequence sharing at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity thereto, or a sequence differing by about one, about two, about three, about four, about five, about six, about seven, about eight, about nine, about ten, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24 or about 25 bases or lo nucleotides thereto, or portions thereof, optionally linear portions thereof. In some embodiments, the aptamer comprises a sequence differing by no more than about one, no more than about two, no more than about three, no more than about four, no more than about five, no more than about six, no more than about seven, no more than about eight, no more than about nine, no more than about ten, no more than about 11, no more than about 12, no more than about 13, no more than about 14, no more than about 15, no more than about 16, no more than about 17, no more than about 18, no more than about 19, no more than about 20, no more than about 21, no more than about 22, no more than about 23, no more than about 24 or no more than about 25 bases or nucleotides with a sequence in Table 1, or portions thereof, optionally linear portions thereof.
In some embodiments, the aptamer comprises one or more of a core sequences, stem region(s) and hairpin sequences e.g. mini-hairpin sequences. For example, Table 3 below denotes the core sequences, stem region(s) and hairpin sequences of some of the aptamers, with the core sequences indicated in bold, the stem region(s) indicated by a solid underline and the hairpin sequences indicated by a dotted underline.
AGACGATGCTGCTAAAxTACGCCGTGGTxACGAA
GACAGACAAGC
GGAGTAGTTAGACCGTGAAA
GCACTCC
ATGATATGGTCTACTGAGCGAGACGAT
GCTGCTAAAxTACGCCGTGGTxACGAAGACAGAC
AAGC
GGAGTGTCGCGLAGCG
TGGTGTxCTCGGxATGG
CCATTGACAAGCGGAGTA
GGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTG
CGACAAG
CGGAGTAGTTAGACCGTCAAA
GxCTGGGAACAAGxGGCGGGAGGGAyGGGTGTG
GGTGCGACAAG
CGGAGTAGTTAGACCGTCAAA
GGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTG
CGACAAG
CGGAGTAG
xGGCGGGAGGGAdGGGTGTGGGTGCGACAAG
CG
GAGTAG
GCCxTGTGGTACTGTAACGGC
TGACAAGCGGAGT
AGTTAGACC
CxTATCAAATAxAAACAGCTAATGACAAGCGGAGT
AGTTAGACC
xTATCACGGCxACACACCTGCG
GACAAGCGGAGT
AGTTAGACC
In various embodiments, the core sequences do not comprise hairpin sequences. In various embodiments, the hairpin sequences comprise CGCGLAGCG mini-hairpin sequences. In various embodiments, the hairpin sequences allow for stabilization and biotinylation of the aptamers without substantially affecting or negatively affecting the aptamer binding affinities. In some examples, the stem region(s) in the secondary structure at the 3′- and/or 5′-terminus may be replaced with other bases and/or base pairs without substantially affecting or negatively affecting the aptamer binding affinities.
In various embodiments, the aptamer that is specific to DEN1 comprises a sequence set out in Table 4 below.
In various embodiments, the aptamer that is specific to DEN2 comprises a sequence set out in Table 5 below.
In various embodiments, the aptamer that is specific to DEN3 comprises a sequence set out in Table 6 below.
In various embodiments, the aptamer that is specific to DEN4 comprises a sequence set out in Table 7 below.
In various embodiments, the aptamer may be chemically modified.
In some embodiments, the aptamer comprises a chemical modification at its terminus or termini. In some embodiments, the aptamer comprises a chemical modification at its 3′ end. In some embodiments, the aptamer comprises a chemical modification at its 5′ end. In some embodiments, the chemical modification comprises introducing a mini-hairpin structure/sequence at a terminus, for example at the 3′ terminus. The mini-hairpin structure/sequence may be CGCGTAGCG, or a sequence differeing by no more than about one, no more than about two, or no more than about three nucleotides thereto. The mini-hairpin structure/sequence may increase a stability of the aptamer. For example, the mini-hairpin structure/sequence may protect the aptamer from rapid degradation by nucleases, particularly in a biological sample. Alternative or additional suitable chemical modification(s) may also be made to the aptamers. For example, the aptamer may also be capped at the 3′ or 5′ end with inverted deoxythymidine (idT) and/or locked nucleic acid (LNA) analogue.
In some embodiments, modification(s) may be made to the nucleotide unit(s) of the aptamer. For example, modification(s) may be made to the ribose or sugar moiety. In some examples, modification is made at 2′ position e.g. 2′-fluoro, 2′-methoxy, 2′-O-methyl and/or 2′-amino modification. In some examples, 2′-methoxy modification comprising deoxyribose modification at 2′-H and 2′-O-methyl modification comprising ribose modification at 2′-OH result in the same chemical structure. In some examples, the modification comprises a 4-thio-sugar modification. In some examples, the aptamer may be composed of or may comprise one or more nucleotide analogues such as peptide nucleic acid (PNA), locked nucleic acid (LNA), morpholino nucleotide, threose nucleic acid (TNA), glycol nucleic acid (GNA), arabinose nucleic acid (ANA), 2′-deoxy-2′-fluoro-β-D-arabinonucleic acid (2′ F-ANA), 2′-fluoroarabinose nucleic acid (FANA), 2′-deoxy-2′-fluororibonucleic acid (2′-F RNA or FRNA) cyclohexene nucleic acid (CeNA), anhydrohexitol nucleic acid (HNA), unlocked nucleic acid (UNA), (4′→6′) linked oligo 2′,3′-dideoxy-β-D-glucopyranose nucleic acid (homo-DNA or hDNA), xylonucleic acid (XyNA), deoxy-xylonucleic acids (dXyNA), aminoallyl uridine (aa-UTP), derivatives thereof and the like. In some examples, the aptamer may be composed of or may comprise L-ribose-based nucleotide.
In some embodiments, the modification comprises modification to a phosphate linkage part or a phosphodiester linkage. In some examples, the aptamer comprises one or more of a phosphorothioate linkage, a boranophosphate linkage, a methylphophonate, a phosphorthioate analogue, replacement to triazole linkage and the like.
In one example, the aptamer comprises phosphoramidite nucleotides.
In various embodiments, the modification(s) allows the aptamers to be stabilized against nucleic acid-cleaving/degrading enzymes such as nucleases or DNases. In various embodiments, the modification(s) increase the half-life of the aptamer e.g. in a biological sample such as human blood or serum. In various embodiments, the modification(s) allows the modified aptamers to gain desirable properties. In some embodiments, the modification(s) allows the modified aptamers to acquire desirable pharmacology and/or pharmacokinetic properties. In various embodiments, the modified aptamers are stable in the human body. In various embodiments, the modified aptamers possess desirable systemic clearance properties e.g. low glomerular filtration rate. In various embodiments, the modification(s) does not substantially reduce the affinity and/or specificity of the aptamers for DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV. In various embodiments, the affinity and/or specificity of the modified aptamers for DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV does not substantially differ or is not substantially reduced in comparison to that/those of the unmodified aptamers.
In various embodiments, the unnatural base(s) of the aptamer may also be modified. For example, the unnatural base(s) may be modified to have functional groups such as diol, azide, ethynyl and biotin. In one example, Pa is modified to diol-Pa. In one example, Px is modified to diol-Px. In one example, diol-Px is modified to diol-Pa. In various embodiments, an unnatural base comprising a diol group has enhanced affinity and/or specificity to DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV as compared to the unmodified unnatural base devoid of a diol group or a natural base variant. In some embodiments therefore, the unnatural base(s) comprise a diol group(s).
In various embodiments, the aptamer may be attached/linked/conjugated to one or more molecules. In some examples, functional group modification (e.g. amino, thiol, ethyl, diol etc.) facilitates chemical conjugation to the molecule (e.g. a label, a dye, a reporter, a carrier, a fluorophore, a solid support, a drug, polyethylene glycol (PEG), choresterol, albumin or other materials etc.) via linker. In one example, amino modification using NH2-C6-dT is carried out to introduce a reactive amino group to the aptamer to facilitate chemical conjugation. In some embodiments, the aptamer may be conjugated to a carrier molecule or a reporter molecule. A carrier molecule may allow the aptamer conjugated thereto to attain desirable properties. A reporter molecule may allow the aptamer conjugated thereto to be detectable. An example of a carrier or reporter molecule is biotin. In one example, the thymidine in the mini-hairpin sequence CGCGAAGCG is used as the biotinylation site to generate a biotin-conjugated sequence CGCG(Biotin-T)AGCG which is then attached to the terminus of the aptamers, since the the Biotin-T position in the GAA tri-loop is acceptable to any natural bases (A,G,C adnT). In some examples, biotin-TEG-T (which comprises a tetraethylene glycol spacer arm) is used. Besides a biotinylated T, biotinylation may also be carried out at the 5′ end or 3′ end. In some examples, biotinylation facilitates immobilisation to streptavidin. Alternative or additional carrier molecule or reporter molecule may also be conjugated to the aptamer. In various embodiments, the conjugation does not substantially reduce the affinity and/or specificity of the aptamers for DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV.
Non-limiting examples of modification/modifiers include amino modifiers (e.g. amino modifier C6, amino modifier C12, amino modifier C6 dT, Uni-Link amino modifier etc.), biotinylation (e.g. biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin, desthiobiotin-TEG etc.), thiol modifications (e.g. thiol modifier C3 S—S, dithiol, thiol modifier C6 S—S etc.), alkyne modifier (e.g. 5′ Hexynyl), 5-Octadiynyl dU etc.), Acrydite, adenylation, azide , azide (NHS Ester), cholesterol-TEG, digoxigenin, digoxigenin (NHS ester), I-Linker, fluorophore and dark quencher (e.g. fluorescein, Cy, rhodamine dye, Alexa Fluor dye, ATTO dye, IRDye, FAM, 6-FAM, 6-FAM (NHS ester), 6-FAM (fluorescein), fluorescein dT, Cy3, TAMRA, JOE, JOE (NHS ester), MAX, MAX (NHS ester), TET, Cy5.5, ROX, ROX (NHS ester), TYE 563, Yakima Yellow, HEX, TEX 615, TYE 665, TYE 705, Texas Red-X, Texas Red-X (NHS ester), Lightcycler 640, Lightcycler 640 (NHS Ester), Dy 750, Dy 750 (NHS ester), dark quencher, Iowa Black dark quencher, Iowa Black FQ, Iowa Black RQ, Black Hole Quencher-1, Black Hole Quencher-2, Dabcyl etc.), modified base modification (e.g. locked nucleic acid, 2′-O-methoxy-ethyl base (2′-MOE), 2′-O-methyl RNA base, fluoro base, 2-aminopurine, 5-Bromo dU, deoxyUridine, 2,6-Diaminopurine (2-Amino-dA), dideoxy-C, deoxylnosine, hydroxymethyl dC, inverted dT, iso-dG, iso-dC, inverted dideoxy-T, 5-methyl dC, 5-nitroindole etc.), phosphorylation modification, spacer modification (e.g. C3 spacer, hexanediol, 1′,2′-dideoxyribose (dSpacer), PC spacer, spacer 9, spacer 18 etc.), click chemistry modification (e.g. (i) 5′, Internal, or 3′ azide, (ii) 5′, Internal, or 3′ azide (NHS ester), (iii) 5′ hexynyl, (iv) 5′, Internal, or 3′ 5-Octadiynyl dU, (v) 5′, or Internal biotin, (vi) 5′, or internal biotin (azide), (vii) 5′, or Internal 6-FAM , (viii) 5′, or Internal 6-FAM (azide), (viiii) 5′, or Internal 5-TAMRA, (x) 5′, or Internal 5-TAMRA (azide) etc.), phosphorothioate bonds modification (e.g. phosphorothioated DNA bases, phosphorothioated RNA bases, phosphorothioated 2′-O-methyl bases, phosphorothioated Affinity Plus (locked nucleic acid) bases etc.) and the like. Embodiments of the aptamers may have some inhibitory effects on DENV. Embodiments of the aptamers may also show desirable pharmacology and/or pharmacokinetic properties (e.g. stability and/or low systemic clearance etc.).
In various embodiments, the aptamer is developed or selected from a SELEX (Systematic Evolution of Ligands by EXponential enrichment) method, optionally an ExSELEX (genetic alphabet Expansion for SELEX) method. In various embodiments, the aptamer is capable of recognizing and/or binding to a DENV protein, optionally a DEN-NS1 protein, sharing at least about 95%, at least about 95.5%, at least about 96%, at least about 96.1%, at least about 96.2%, at least about 96.3%, at least about 96.4%, at least about 96.5%, at least about 96.6%, at least about 96.7%, at least about 96.8%, at least about 96.9%, at least about 97%, at least about 97.1%, at least about 97.2%, at least about 97.3%, at least about 97.4%, at least about 97.5%, at least about 97.6%, at least about 97.7%, at least about 97.8%, at least about 97.9%, at least about 98%, at least about 98.1%, at least about 98.2%, at least about 98.3%, at least about 98.4%, at least about 98.5%, at least about 98.6%, at least about 98.7%, at least about 98.8%, at least about 98.9% or at least about 99% sequence identity/homology with a DENV protein, optionally a DEN-NS1 protein, used for selection in the SELEX or ExSELEX method. In various embodiments, the aptamer is capable of recognizing and/or binding to a DENV protein, optionally a DEN-NS1 protein, sharing more than about 95%, more than about 95.5%, more than about 96%, more than about 96.1%, more than about 96.2%, more than about 96.3%, more than about 96.4%, more than about 96.5%, more than about 96.6%, more than about 96.7%, more than about 96.8%, more than about 96.9%, more than about 97%, more than about 97.1%, more than about 97.2%, more than about 97.3%, more than about 97.4%, more than about 97.5%, more than about 97.6%, more than about 97.7%, more than about 97.8%, more than about 97.9%, more than about 98%, more than about 98.1%, more than about 98.2%, more than about 98.3%, more than about 98.4%, more than about 98.5%, more than about 98.6%, more than about 98.7%, more than about 98.8%, more than about 98.9% or more than about 99% sequence identity/homology with a DENV protein, optionally a DEN-NS1 protein, used for selection in the SELEX or ExSELEX method. In various embodiments, the aptamer is capable of recognizing and/or binding to a DENV protein, optionally a DEN-NS1 protein, having no more than about 15 amino acid difference, no more than about 14 amino acid difference, no more than about 13 amino acid difference, no more than about 12 amino acid difference, no more than about 11 amino acid difference, no more than about 10 amino acid difference, no more than about 9 amino acid difference, no more than about 8 amino acid difference, no more than about 7 amino acid difference, no more than about 6 amino acid difference, no more than about 5 amino acid difference, no more than about 4 amino acid difference, no more than about 3 amino acid difference, no more than about 2 amino acid difference or no more than about 1 amino acid difference with a DENV protein, optionally a DEN-NS1 protein, used for selection in the SELEX or ExSELEX method. In some embodiments, the DENV protein, optionally the DEN-NS1 protein, used for selection in the SELEX or ExSELEX method comprises a sequence selected from the group consisting of:
a sequence thereof comprising a histidine tag at the C-terminal (e.g. HHHHHH or HHHHHHHHHH);
a sequence sharing at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity thereto;
parts thereof; and
combinations thereof.
In some embodiments, the DENV protein, optionally the DEN-NS1 protein, used for selection in the SELEX or ExSELEX method comprises a combination of sequences selected from SEQ ID Nos. 1, 2, 3, 4 and 5.
In some embodiments therefore, the aptamer is capable of distinguishing between DENV variants, optionally DEN-NS1 variants, within a single serotype. In one example, the aptamer is capable of recognizing and/or binding to a DEN-NS1 protein sharing more than 96.3% sequence identity/homology with a DEN-NS1 protein used for selection in the SELEX or ExSELEX method but not a DEN-NS1 variant, which can be of the same serotype, having a lower sequence identity/homology. In one example, the aptamer is capable of recognizing and/or binding to a DEN-NS1 protein sharing more than 96.3% sequence identity/homology with SEQ ID NO. 1, but not DEN-NS1 variants having a lower sequence identity/homology. In one example, the aptamer is capable of recognizing and/or binding to a DEN-NS1 protein sharing about 98.9% sequence identity/homology with SEQ ID NO. 1. or a DEN-NS1 protein of SEQ ID NO: 6.
In various embodiments, there is provided a mixture/combination of aptamers that are specific to different serotypes, the mixture comprising at least two, at least three, or at least four of the aptamers. For example, the mixture/combination may comprise an aptamer that is specific to DEN1, an aptamer that is specific to DEN2, an aptamer that is specific to DEN3 and an aptamer that is specific to DEN4. For example, the mixture/combination may comprise any three of the following: an aptamer that is specific to DEN1, an aptamer that is specific to DEN2, an aptamer that is specific to DEN3 and an aptamer that is specific to DEN4. For example, the mixture/combination may comprise any two of the following: an aptamer that is specific to DEN1, an aptamer that is specific to DEN2, an aptamer that is specific to DEN3 and an aptamer that is specific to DEN4. In some embodiments, the mixture/combination of aptamers comprises one or more of SEQ ID NO: 11 (CCCCAGACGGACTGGTGTxCTCGGxATGGCCGTCTGGGGCGCGLAGCG) SEQ ID NO: 12 (GGCTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCG ACAAGCGGACCAGCCCGCGLAGCG), SEQ ID NO: 13 (CCGCTTGTCATCTAxCCTGGCCxTGTGGTACTGTAACGGCTGACAAGCGG CGCGLAGCG), SEQ ID NO: 14 (CGGCGGAGACGTAACGCxTATCAAATCxAAACAGCTTAGGGTCCGCCGCG CGLAGCG), SEQ ID NO: 15 (ITTTCGCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTA CGCCGTGGTxACGAAGACAGACAAGCGGAGTAGTTAGACCGTGAAA) and SEQ ID NO: 16 (GCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCC GTGGTxACGAAGACAGACAAGCGGAGTGTCGCGLAGCG). In various embodiments, the mixture/combination allows for the detection with few amino-acid sequence mutations among dengue NS1 variants beyond serotype identification.
Embodiments of the aptamer or mixture may be used detecting a presence of DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV and/or serotype-specific NS1 of DENV. Embodiments of the aptamer or mixture may be used detecting a presence of DENV, a viral protein of DENV, a non-structural protein of DENV, NS1 of DENV of a particular serotype.
In various embodiments, there is provided a method of identifying a DENV infection in a subject, the method comprising contacting a sample of the subject with the aptamer or the mixture of aptamers. In some embodiments, the method further comprises detecting a binding event at the aptamer(s). In various embodiments therefore, there is provided a method of identifying a DENV infection in a subject, the method comprising: contacting a sample of the subject with the aptamer or the mixture of aptamers and detecting a binding event at the aptamer(s). The method may be a method of identifying a current DENV infection, a method of identifying a past DENV infection and/or a method of identifying a characteristic/nature of a DENV infection (e.g. whether primary, secondary or further infection, serotype identification, disease burden etc.).
In various embodiments, the method may be implemented in the form of a binding assay. In various embodiments, the method may be in the form of a “sandwich” assay, where a first binder or capturing agent (e.g. an aptamer) serves to capture a target analyte (e.g. a DENV protein) and a second binder or detector agent (e.g. an anti-DENV) is used to detect the captured target analyte. Examples of such assays include enzyme immunoassays (EIA)/enzyme-linked immunosorbent assay (ELISA), enzyme-linked aptamers assays (ELAA) /enzyme-linked oligonucleotide assay (ELONA), radioimmunoassay RIA, strip assays, lateral flow assays (LFA), bio-layer interferometry (BLI), the detection through Surface plasmon resonance (SPR), colorimetric changes using gold nanoparticle aggregations, voltammetric, and electrochemical techniques and the like. The suitability of the specific assay to be used would be within the purview of the skill of the person skilled in the art. In some embodiments, the aptamer is immobilized on a solid support, optionally with an anti-DENV being used as the detector agent. In some embodiments, the aptamer is used as the detector agent, optionally with an anti-DENV being immobilized on a solid support. In some embodiments therefore, the detecting step comprises adding a detecting agent to detect a binding event at the aptamer(s).
In various embodiments, the method comprises an ELISA method, such as, but is not limited to direct ELISA, indirect ELISA, competitive ELISA, sandwich ELISA, and the like. In some embodiments, the method comprises a sandwich ELISA method. The sandwich ELISA may be competitive or non-competitive. In some examples, the aptamer may be labelled, for example with biotin, and may be bound to a solid phase e.g. a bead, a surface of a well or other containment body, a chip or a strip, for capturing any DENV protein and an antibody of the DENV protein is used for detecting any captured DENV protein. In some examples, a first antibody of the DENV protein is used as a primary detector agent and a second antibody against the first antibody is used as a secondary detector agent. The detector agent may be labelled, for example, with a dye, radioisotope or a reactive or catalytically active moiety. In one example, the detector agent is labelled with horseradish peroxidase (HRP) and tetramethylbenzidine (TMB) substrate may be added for visualization. It will be appreciated that other suitable labels and substrates may also be used. In some examples, a plate (e.g. microplate, microtiter plate etc.) coated with streptavidin is used for immobilising the biotin-labelled aptamer, which is then used for capturing a DENV protein, and a labelled detector agent (or a primary detector agent and a labelled secondary detector agent) is used for detection. The detector agent may be an anti-immunoglobulin such as anti-IgG (e.g. IgG1, IgG2, IgG3 or IgG4), anti-IgM or anti-IgA. In some examples, the anti-immunoglobulin comprises anti-human IgM, anti-goat IgG, anti-rabbit IgG, and/or anti-mouse IgG. When a primary detector is labelled with biotin, the secondary agent may be an anti-biotin antibody or streptavidin.
In some embodiments, a binding event at any of the aptamer(s) is indicative of a current DENV infection in the subject. In some examples, a binding event is indicated by a chemiluminescence or colorimetric signal/readout/output e.g. resulting from HRP conversion of TMB. In some embodiments, where the aptamer comprises an aptamer that is specific to or that binds specifically to a single DENV serotype, the binding event is indicative of a current DENV infection of said serotype in the subject. For example, where the aptamer is an aptamer specific to DEN1, detection of a binding event at the aptamer (e.g. observation of a colorimetric output in a HRP-TMB system) when the aptamer is contacted with a subject's sample is indicative that the subject has DEN1-protein in his sample, and therefore indicative that the subject has a current DEN1 infection. In this example, the DEN1-specific aptamer immobilised on a solid support, when contacted with the subject's sample, captures any DEN1-protein in the subject sample. The subsequent addition of a detector agent against the DEN1-protein then binds to any captured DEN1-protein. The detector agent gives a colorimetric output, thereby indicating the presence of captured DEN1 protein, and therefore the presence of DEN1 infection in the subject. In some embodiments therefore, where the method is a method of identifying a current DENV infection in the subject, a binding event at any of the aptamer(s) is indicative of a current DENV infection in the subject, optionally wherein the bound aptamer is specific to single DENV serotype, the binding event is indicative of a current DENV infection of said serotype in the subject.
Without wishing to be bound by theory, it is believed that virus-related materials such as the envelope protein and non-structural protein 1 (NS1) are detectable in a febrile phase or any early phase of DENV. Thus, in some embodiments, the binding event is indicative of a current DENV infection in its febrile phase or early phase. In some embodiments, the method is carried out within one week following fever onset in a subject or during a febrile or early phase of DENV infection.
In one example, the method comprises a non-competitive binding assay method. In one example, the method comprises a non-competitive ELISA method. In one example, the method comprises direct detection of DENV protein, optionally DENV-NS1 protein, in the sample.
In some embodiments, where the subject is indicated for a current DENV infection, the method further comprises contacting a sample of the subject with the aptamer or the mixture of aptamers in the presence of a DENV protein, and detecting a binding event at the aptamer(s). In some embodiments, the sample is pre-incubated with the DENV protein and then contacted with the aptamer or the mixture of aptamers.
Without wishing to be bound by theory, it is believed that DENV antigen binding protein, such as anti-DENV IgG, is generated by a subject's body in response to DENV infection. The serotype-specific DENV antigen binding protein may become detectable a number of days after illness onset, for example, one week after fever onset, and remain detectable after recovery. Thus, the detection of a serotype-specific DENV antigen binding protein in subject's sample during an early phase or febrile phase of a current DENV infection (for example, within one week after illness onset) may be indicative that the subject has a past DENV infection. Without wishing to be bound by theory, it is further believed that some of the DENV antigen binding protein generated, for example the anti-DENV IgG generated, are serotype-specific. For example, it is believed that a DENV antigen binding protein generated in response to a DEN1 infection is different from an DENV antigen binding protein generated in response to a DEN2, DEN3 or DEN4 infection. It is also believed that a DENV antigen binding protein generated in response to a DEN1 infection would only recognize and/or bind to a DEN1 protein, for example a DEN1-NS1 protein, and not or less other proteins belonging to DENV of a different serotype, for example, a DEN2-NS1 protein, a DEN3-NS1 protein and a DEN4-NS1 protein.
Without wishing to be bound by theory, it is believed that IgG production continues throughout life after a DENV infection, and thus IgG detection may enable the identification of past infections. In various embodiments therefore, the method comprises detecting the presence of anti-DENV IgG in a subject's sample.
In one example, where a subject is indicated for a current DEN1 infection, a second sample, which can be the same type of sample at the previous sample, can be collected from the subject and contacted with a mixture of aptamers comprising aptamers that are specific to DEN2, DEN3 and DEN4 in the presence of DEN2-NS1, DEN3-NS1 and DEN4-NS1 proteins to determine whether the subject has any DEN2, DEN3 and/or DEN4 past infections. The DEN2-NS1, DEN3-NS1 and DEN4-NS1 protein would normally bind to the DEN2 specific aptamer, the DEN3 specific aptamer and the DEN4 specific aptamer respectively. However, any anti-DEN2-NS1 IgG, anti-DEN3-NS1 IgG and/or anti-DEN4-NS1 IgG present in the sample may bind to the DEN2-NS1, DEN3-NS1 and/or DEN4-NS1 protein respectively and thereby inhibit the latter's binding to the DEN2 specific aptamer, the DEN3 specific aptamer and the DEN4 specific aptamer respectively. Thus, the absence of a binding event at any of the DEN2 specific aptamer, the DEN3 specific aptamer and the DEN4 specific aptamer may be indicative that the subject has anti-DEN2-NS1 IgG, anti-DEN3-NS1 IgG and/or anti-DEN4-NS1 IgG in his/her body, and hence indicative that the subject was previously infected with DEN2, DEN3 and/or DEN4. In some examples, a binding activity at the aptamer may be measured by a signal/output/readout e.g. a colorimetic signal/output/readout. In some examples, an intensity difference in the signal/output/readout associated with the different aptamers gives an indication of the probable serotype of previous infection in the sample.
In various embodiments therefore, an absence of a binding event at any of the aptamer(s) is indicative that the subject has past/primary DENV infection(s). In various embodiments, an absence of a binding event at any of the aptamer(s) in the sample which current infection was confirmed by the other method(s) is indicative that the current DENV infection is a secondary or further DENV infection.
In various embodiments therefore, where the subject is indicated for a current DENV infection, the method further comprises contacting a sample of the subject with the aptamer or the mixture of aptamers in the presence of a DENV protein, and detecting a binding event at the aptamer(s), wherein an absence of a binding event at any of the aptamer(s) is indicative that the current DENV infection is a secondary or further DENV infection, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.
In various embodiments, the contacting step comprises contacting different amounts/volumes/concentrations of the subject's sample with the mixture of aptamers in the presence of a fixed amount/volume/concentration of the DENV proteins. An output/readout e.g. a colorimetic readout, indicative of a binding activity between each amount/volume/concentration of the sample with the DENV proteins, may be measured. The outputs/readouts (which can be transformed into values) may be plotted against the amounts/volumes/concentrations of the sample to obtain a graph. A point on the graph (e.g. the amount/volume/concentration of samples required to give a certain output/readout) may be used as a basis of comparison across the results obtained for each aptamer of the mixture of aptamers to obtain a relative binding activity of a sample for each aptamer of the mixture of aptamers. In some embodiments, the relative binding activity comprises a relative IgG activity of the sample.
As may be appreciated, a secondary or subsequent DENV infection of a different serotype of that of the primary infection may be more severe. For example, a secondary DENV infection is the greatest risk factor for severe disease such as Dengue Hemorrhagic Fever and Dengue Shock Syndrome. Without wishing to be bound by theory, it is believed that antibody-dependent enhancement (ADE) may contribute to severe dengue. Advantageously, embodiments of the method allowing for the determination whether a current DENV infection is a secondary or subsequent infection can facilitate clinical and treatment decisions. For example, a subject indicated to be suffering from a secondary DENV infection may be more closely monitored for development of severe dengue. Early medical care may be provided to the subject if needed, thereby reducing a risk of severe disease progression or fatality.
In one example, the method comprises a competitive binding assay method. In one example, the method comprises a competitive ELISA method. In one example, the method comprises competitive DENV antigen binding protein detection, optionally competitive anti-DENV IgG detection, further optionally anti-DENV-NS1 IgG detection.
In various embodiments, the different serotype-specific aptamers may be disposed or immobilised on different substrates, or they may be disposed or immobilised on the same substrate. For example, each serotype-specific aptamer may be immobilised separately on the supports (e.g. in different wells) as a capture agent. For example, four different serotype-specific aptamers may be immobilised on a single solid support (e.g. in a single well) as capture agents. In the latter example, different detection systems, for example, different colorimetric detection systems, may be employed to distinguish between the binding event(s) at the different serotype-specific aptamers. The four different serotype-specific aptamers may also be disposed at distinct/different/non-overlapping spatial regions on a single solid support (e.g. in a lateral flow assay method) to distinguish between the binding event(s) at the different serotype-specific aptamers.
In various embodiments, the method further comprises administering a DENV treatment regimen to the subject if the subject is indicated for a current DENV infection.
In various embodiments, the method further comprises a step of generating a nucleic acid library, optionally a DNA library, the nucleic acid or the DNA comprising at least one unnatural base. In various embodiments, the method further comprises a step of selecting for a candidate nucleic acid or DNA having high affinity to DENV protein, optionally to DEN-NS1 protein, by subjecting the nucleic acid to SELEX or ExSELEX, and then recovering/isolating any DENV-nucleic acid complex (or DENV-DNA complex) optionally any DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex). In some examples, an enrichment may be observed from the differences in sequence population before and after isolation of the DENV-nucleic acid complex (or DENV-DNA complex) optionally any DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex). In various embodiments, the recovering/isolating step comprises capturing the DENV-nucleic acid complex (or DENV-DNA complex), optionally the DEN-NS1-nucleic acid complex (or DEN-NS1-DNA complex), with an anti-DENV antibody, optionally an anti-DEN-NS1 antibody, or through affinity-tag (e.g. His-tag) in the protein. Any unbound nucleic acid or DNA may be washed away. The candidate nucleic acid or DNA may be isolated from the complex to obtain the aptamer, or it may be subjected to one or more round of selection by SELEX or ExSELEX. An amplification step, for example PCR amplification, may be carried out to amplify the candidate nucleic acid or DNA before the one or more round of selection or at the end of the selection. In some examples, at least about one, at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14 or at least about 15 rounds of SELEX are carried out.
Embodiments of the method based on the detection of DENV antigen binding protein in a subject's sample may also be employed alone, independent of preceding steps of detecting for DENV protein in the sample. Even if a subject is not suffering or not suspected to be suffering from a current DENV infection, embodiments of the method which can determine whether a subject has past DENV infection(s) can be helpful. For example, the immune history may be helpful for understanding subsequent disease risk and protection, and also suitability of the subject for a DENV vaccine.
In various embodiments therefore, wherein the method is a method of identifying a past DENV infection in the subject, the contacting step is performed in the presence of a DENV protein, and an absence of a binding event at any of the aptamer(s) is indicative of a past DENV infection in the subject, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.
In various embodiments therefore, there is provided method of evaluating a subject's suitability for a DENV vaccine, the method comprising: contacting a sample of the subject with an aptamer or the mixture of aptamers in the presence of a DENV protein, detecting a binding event at the aptamer(s), determining an immune history of the subject based on the binding event at the aptamer(s), and concluding the suitability of the subject for the DENV vaccine based on the immune history. In various embodiments, the absence of a binding event at any of the aptamer(s) in indicative of past DENV infection(s) in the subject.
As may be appreciated, some dengue vaccines have been shown to lead to a higher risk of more severe symptoms when a vaccinated subject subsequently becomes infected with DENV. Consequently, the vaccines are advised to be used in only subjects who were previously infected with DENV. Advantageously, embodiments of the method which can establish a subject's DENV immune history, for example whether the person has a past DENV infection, the number of past DENV infection(s), the serotypes of the past DENV infection(s), are therefore helpful in determining the person's suitability for DENV vaccination. For example, if it is determined that the subject does not have any past DENV infection, the subject may not be a suitable candidate for a DENV vaccine advised only for people with prior DENV infections.
In various embodiments, the sample comprises a biological sample. In various embodiments, the biological sample comprises a fluid biological sample or a liquid biological sample. The fluid biological sample or liquid biological sample may be blood, serum, plasma, sputum, lavage fluid, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like. In some embodiments, the fluid biological sample or liquid biological sample comprises whole blood, blood serum, blood plasma or processed fractions thereof. In some embodiments, the fluid biological sample comprises blood serum or blood plasma. In some embodiments, the fluid biological sample comprises antigen binding proteins such as antibodies.
In various embodiments, the sample comprises a sample that is collected from a subject during an acute phase or febrile phase (about 2 days to about 7 days post illness onset (pio)), an early convalescent phase (about 10 days to about 14 days pio), a late convalescent phase (about 1 month pio), an early recovery phase (about 3 months pio), a late recovery phase (about 5 months to about 6 months pio) or a full recovery phase (about 1 year pio). In some embodiments, the sample is collected from a subject when the subject is in an early phase of DENV infection (within about 1 week pio). In some embodiments, the sample is collected from a subject when the subject is in a late phase of DENV infection (after about 1 week pio). In some embodiments, the sample is collected from a subject when subject shows symptoms associated with DENV infection, such as fever (typically high fever), headache, muscle, bone, and joint pain, nausea, vomiting, pain behind the eyes, swollen glands, rash, severe abdominal pain, persistent vomiting, bleeding from gums or nose, blood in urine, stools or vomit, bleeding under the skin, difficult or rapid breathing, cold or clammy skin (shock), fatigue, and irritability or restlessness. In some embodiments, the sample is collected from a subject when the subject is or has become asymptomatic for DENV infection. In some embodiments, the sample is collected from a subject after the subject has recovered from DENV infection.
In various embodiments, the method comprises a diagnostic method. For example, in a direct DENV protein detection method, a binding event at an aptamer may be indicative of DENV infection in the subject.
In various embodiments, the method comprises a prognosis method. In some examples (see e.g.
In various embodiments, the method has high sensitivity and/or specificity. In various embodiments, the method has a sensitivity of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 100%.
In various embodiments, the method has a specificity of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 100%.
In various embodiments, the method comprises an in vitro or an ex vivo method.
In various embodiments, there is provided a kit for identifying a DENV infection in a subject, the kit comprising the aptamer or the mixture of aptamers. In some embodiments, the aptamer or the mixture of aptamers is provided in the form of a plate coated with the aptamer or the mixture of aptamers for capturing DENV protein. In some embodiments, the kit further comprises a DENV protein, optionally a DENV-NS1 protein. In some embodiments, the kit comprises a detector agent and/or a capturing agent.
The kit may be a diagnostic kit or a prognostic kit.
In various embodiments, the subject comprises a mammal. In various embodiments, the subject comprises a human subject.
In various embodiments, there is provided a nucleic acid molecule comprising a sequence set out in Table 1, or a sequence sharing at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity thereto, or a sequence differing by about one, about two, about three, about four, about five, about six, about seven, about eight, about nine, about ten, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24 or about 25 bases or nucleotides thereto, or portions thereof, optionally linear portions thereof. In some embodiments, the aptamer comprises a sequence differing by no more than about one, no more than about two, no more than about three, no more than about four, no more than about five, no more than about six, no more than about seven, no more than about eight, no more than about nine, no more than about ten, no more than about 11, no more than about 12, no more than about 13, no more than about 14, no more than about 15, no more than about 16, no more than about 17, no more than about 18, no more than about 19, no more than about 20, no more than about 21, no more than about 22, no more than about 23, no more than about 24 or no more than about 25 bases or nucleotides with a sequence in Table 1, or portions thereof, optionally linear portions thereof.
In some embodiments, the nucleic acid molecule comprising a sequence set out in Table 1, or a sequence sharing at least 75% sequence identity thereto; or a sequence differing by one, two, three, four, five, six, seven, eight, nine or ten bases thereto; or portions thereof.
In various embodiments, there is provided a method of producing the nucleic acid molecule or the aptamer. In various embodiments, the method comprises a chemical synthesis method. In various embodiments, the method comprises an oligonucleotide synthesis method. In various embodiments, the method comprises a phosphoramidite method of oligonucleotide synthesis. The synthesis can be a solution-phase synthesis or a solid-phase synthesis. In some embodiments, the synthesis comprises a solid-phase synthesis. Other suitable methods of synthesising a nucleic acid molecule or aptamer or oligonucleotide may also be used. For example, the method may comprise a H-phosphonate method and/or a phosphotriester method of oligonucleotide synthesis.
In various embodiments, the method may comprise a step of incorporating one or more modifications to the nucleic acid molecule or the aptamer. The incorporation may be performed during and/or after synthesis of e.g. the oligonucleotide.
In various embodiments, there is provided a method, a kit or a nucleic acid molecule as described herein.
Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following discussions and if applicable, in conjunction with the figures. It should be appreciated that other modifications related to structural, electrical and optical changes may be made without deviating from the scope of the invention. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new exemplary embodiments.
To generate Ds-containing DNA aptamers targeting each DEN-NS1 serotype, the ExSELEX procedure was performed three times (Table E1)33-35,38.
ExSELEX was performed targeting each recombinant DEN-NS1 serotype protein, as follows: DEN1-NS1 (D1), DEN2-NS1 (D2), DEN3-NS1 (D3), and DEN4-NS1 (D4) in the column of PCR cycles. To increase the stringency of the selection conditions, human serum (HS) was added to the binding buffer (additives) and urea in the washing buffer in later rounds.
Four DEN-NS1 serotypes were purchased from The Native Antigen Company (Oxford, UK). In the ExSELEX procedure, a selection method using an anti-DEN-NS1 monoclonal antibody (Ab#D06) was employed (
After 7-10 rounds of selection, enriched DNA libraries were obtained and their high specificities to each DEN-NS1 serotype were confirmed by electrophoresis gel-mobility shift assays (EMSAs) (
indicates data missing or illegible when filed
In Table E2, the oligonucleotide sequences used for the binding analyses against each target DEN-NS1, are summarized with the results of the electrophoresis gel-mobility shift assay (EMSA) and surface plasmon resonance (SPR) analysis. The additional complementary sequences that form stems are underlined. The oligonucleotides containing a mini-hairpin sequence, CGCG-(Biotin-T)-AGCG, at the 3′-terminus have an additional “h” in the aptamer candidate names. In the SPR analysis with 20 nM of each dengue NS1 protein, “specific” means that the oligonucleotide only bound to the target serotype DEN-NS1, and not to the other serotype DEN-NS1, while “less-specific” means the oligonucleotide exhibited binding to not only target serotype NS1 but also to some of the other serotype NS1 proteins. The chemical structures of the unnatural bases, diol-Px (Px) and diol-Pa (Pa), referenced in the table are shown below.
Most of the sequences contained complementary motifs at the 5′- and 3′-regions, and thus the complementary motifs were trimmed to form a clear stem structure. To increase the thermal and enzymatic stabilities of the aptamer candidates, a specific biotin-conjugated DNA sequence (mini-hairpin DNA)40-42, CGCG(Biotin-T)AGCG, was added at their 3′-termini38,43,44 (
A notable case involved some candidates obtained by ExSELEX targeting DEN2-NS1. One of the sequence families (D2-1), which exhibited the highest affinity to DEN2-NS1, contained two Ds and one Px bases (refer to
Each aptamer sequence was finalized by adding the biotin-conjugated mini-hairpin sequence at its 3′-terminus (AptD1 (D1-1-48 h) for DEN1-NS1, AptD2 (D2-1d-72 h) for DEN2-NS1, AptD3 (D3-2-59 h) for DEN3-NS1, and AptD4 (D4-3-57 h) for DEN4-NS1) (
The detection of each DEN-NS1 serotype was examined by a sandwich-type ELISA format, using the antibody Ab#D06 as the primary detector agent and the aptamers as capture agents (
Using blood samples from eleven Singaporean patients (PD1-1-PD4-1) with acute DENV infection, the sensitivity and specificity of the ELISA format to detect each DEN-NS1 serotype were evaluated (
The false-negative results of PD1-2, PD1-3, PD2-2, and PD2-3 were caused by the subtle amino acid differences between the DEN-NS1 present in the samples and those in the DEN-NS1 purchased from The Native Antigen Company, which were used as the targets for the aptamer generation. The amino acid sequences of DEN-NS1 in the patient samples were determined, and many amino acid substitutions were found when compared to those of the target NS1 proteins (
Using the ELISA format, it was found that it can also be used for the detection of serotype-specific anti-NS1 IgG antibodies in patient serum samples. When the ELISA sensitivity of the aptamer-antibody pair for DEN-NS1 detection in the presence of human serum purchased from Sigma-Aldrich was examined, the detection was significantly inhibited (
For the serotype-specific IgG detection, a simple quantification method was developed for the anti-DEN-NS1 IgG activities (
Using this competitive ELISA format and quantification method, the longitudinal changes in the IgG production and the serotype specificities of the patient samples were measured (
The quantitative serotype analysis of PD2-3, PD3-3, and PD4-1 revealed that the initial IgG level reflected mainly the serotypes of the past infection. Even after one week, the production of the IgG antibodies that predominantly recognized the serotype resulting from the past infection increased sharply, as compared to the IgGs produced from the current secondary infection. Although the predominance of the past infection varied depending on the patient, the PD2-3 and PD3-3 patient samples revealed the massive production of the IgG antibodies to the past serotype infection.
As mentioned above, DEN3-NS1 of PD3-4 was not detected by ELISA, using both the antibody-aptamer and antibody-antibody (Ab#D06-Ab#D25) sandwich systems. This is because the serum sample already contained the anti-DEN3-NS1 IgG antibodies resulting from a past infection, which in turn inhibited the aptamer binding, as well as the Ab#D06 and/or Ab#D25 binding to DEN3NS1.
This IgG detection method using the aptamer-antibody sandwich pair exhibited higher sensitivity and serotype specificity, as compared to that using the antibody-antibody sandwich pair. To determine whether the antibody-antibody pair can also be used for IgG detection, the competitive inhibition in ELISA using the combination was compared with the antibody-antibody (Ab#D06-Ab#D25) pair for the patient sera with PD2-3, PD3-3, PD3-4, and PD4-1 (
Presented herein are serotype-specific detection methods for DEN-NS1 and IgG in human serum, using high-affinity and high-specific UB-DNA aptamers. Among the generated UB-DNA aptamers, AptD2, which bound to DEN2-NS1, contained two Ds and one Px bases as the fifth and sixth bases. The high affinity of AptD2 to DEN2-NS1 indicates the importance of the diol group of Px/Pa for the binding. The combination of the hydrophobic Ds and the hydrophilic Px/Pa bases creates a new type of six-letter DNA aptamers with high affinity and specificity to their targets.
The specificities of these UB-aptamers are extremely high, and they recognize the target variants with amino-acid sequences that are at least 96.9% identical to that of the initial targets (purchased from The Native Antigen Company). This degree of homology is much higher than that among the different NS1 serotypes (69-80%). Due to their high specificity, AptD1 and AptD2 could not bind to some of the DEN1-NS1 (PD1-2/1-3) and DEN1-NS2 proteins (PD2-2/2-3) of the Singaporean patients.
Remarkably, there are ten and eleven amino acid differences between the PD1-1 and PD1-2/1-3 DEN1-NS1 and between PD2-1 and PD2-2/2-3 DEN2-NS1 (352 amino acids), respectively. The locations of these amino acid differences suggest that they might participated in the aptamer binding site (
In contrast to the sensitive and direct DEN-NS1 detection, the present method for the serotype-specific IgG antibody detection can be used widely for DENV variants. To knowledge, this is the first simple method capable of identifying the IgG serotype specificities using DNA aptamers, although a direct IgG detection method by ELISA using antibodies has been reported36. A similar IgG detection concept using conventional DNA aptamers was reported, to detect the IgG antibodies to the P48 protein of M. bovis48. However, the affinities of the DNA aptamers to the target were relatively low (KD=16-33 nM), and thus the background in the IgG detection was high and the quantitative analysis was difficult. The IgG detection provides valuable information for the dengue diagnostics and the use of dengue vaccine. The secondary infection can be identified by the IgG detection within several days (during the febrile period) after fever onset. If anti-DEN-NS1 IgG antibodies are detected in patients within one week after fever onset, then this indicates a secondary infection and may warrant close monitoring. Serotype specific IgG detection will also provide valuable information for the usage and analyses of the dengue vaccines, for which documentation of prior infection is important prior to administration, due to the concern of ADE.
The tests using patient samples with secondary DENV infections revealed that the IgG antibodies that responded to the past infection were predominantly produced, even upon secondary infections with different dengue serotypes. The results correlate with other reports11-14,16,17 and support ADE where secondary heterologous infections occasionally result in severe symptoms and why the vaccination of dengue-naive individuals is risky. Patients with a primary infection produced IgG antibodies that mainly targeted the infected serotype. In the secondary infection, the initially produced IgG antibodies reacted more to the NS1 serotype of the past infection, and did not effectively react with the targets of the secondary infection. The application of this test in a larger cohort of dengue patients will allow us to understand the mechanism of dengue pathogenesis, through the serotype-specific sequence of DENV infection. The present method may potentially be expanded to test the efficacy of vaccine development36,37, and to diagnose other diseases and allergies.
High-Specificity Unnatural-Base DNA Aptamers that Selectively Distinguish Dengue NS1 Protein Variants with Several Amino Acid Mutations Beyond the Serotype Specificity
The foregoing described a series of unnatural-base-containing DNA (UB-DNA) aptamers that bind specifically to dengue NS1 protein variants with more than 96.9% amino-acid homologies to the initial targets (purchased from Native Antigen Company, NA) in each serotype of Singaporean patient serums. For example, one of the UB-DNA aptamers targeting the commercially available dengue serotype 1 NS1 protein detected only serotype 1 NS1 protein variants with more than 98.9% homologies in patient serums by the ELISA system (PD1-1 and PD1-5 in
The amino acid sequences of the dengue serotype 1 NS1 protein variants in the patient serums are the same (PD1-2, 1-3, and 1-4 in
Using SIN-D1, seven rounds of ExSELEX (ExSELEX-4) with Ds-containing DNA libraries were performed, using the selection conditions summarized in Table E3.
As the target, the prepared recombinant SIN DEN1-NS1 protein in rounds 1, 2, 3, and 6 were used, while the PD1-4 clinical serums in rounds 4, 5, and 7 were used. After seven rounds of ExSELEX, the binding of the enriched library to the SIN DEN1-NS1 protein in a gel-mobility shift assay (
The isolated 19D1F1 DNA was amplified by PCR in the presence or absence of the unnatural base substrates, dDsTP and dPxTP. The amplified 19D1F1 containing two Ds bases bound specifically to the SIN DEN1-NS1 protein. However, the Ds→NB (natural base) variant lost the binding ability (
Five 19D1F1 derivatives, 19D1F1-1, 19D1F1-2, 19D1F1-3, 19D1F1-4, and 19D1F1-5 (
An ELISA with the sandwich system of the 19D1F1-3 (AptD1b) and an antibody pair was performed, using the clinical samples PD1-1, PD1-2 and PD1-3 (
The sequences related to 19D1F1-3 are useful because the UB-DNA aptamers can be used for the detection of some variants of dengue serotype 1 NS1 proteins.
The DNA fragments, including DNA aptamer variants, DNA libraries, and primers, used in this study were chemically synthesized with an H8 DNA/RNA Synthesizer (K&A Laborgerate) in-house by using phosphoramidites, or purchased from Integrated DNA Technologies. The phosphoramidites of the natural bases were purchased from Glen Research, and the commercially available modified phosphoramidites were purchased from Glen Research, Link Technologies, and ChemGenes Corporation. The Ds and diolPa phosphoramidites were chemically synthesized in-house as described, previously38 for Ds, and in the later chemical synthesis for diol-Pa. The chemically synthesized DNAs were purified by denaturing gel electrophoresis or directly used without further purification (for some primers and probes, which were purchased from IDT). Unnatural-base substrates (dDsTP, diol-dPxTP, Cy5-dPxTP, and dPa′TP) were chemically synthesized as described previously38-41. Recombinant DEN-NS1 (DEN1-NS1, DEN2-NS1, DEN3-NS1, and DEN4-NS1 with a polyhistidine tag) were purchased from The Native Antigen Company (DEN1-NS: Nauru/Western Pacific/1974; DEN2-NS: Thailand/16681 /84; DEN3-NS1: Sri Lanka D3/H/IMTSSA-SRI/2000/1266; DEN4-NS1: Dominica/814669/1981). Recombinant Zika virus NS1 proteins (MR 766 Uganda strain and Brazil strain) were obtained from R&D Systems, Inc. and ACROBiosystems. Anti-dengue NS1 rabbit monoclonal antibodies were prepared in-house by the conventional method. Among the antibodies, Ab#D06 and Ab#D25, which had higher affinities than the others, were chosen. The streptavidin-HRP conjugate (1 mg/ml) was obtained from Jackson ImmunoResearch. The streptavidin, Tween 20, BSA, and anti-mouse IgG HRP conjugate (1 mg/ml) were obtained from Promega. General stock solutions and chemical compounds were purchased from Thermo Fisher Scientific, Nacalai Tesque, 1st BASE, Promega, Sigma-Aldrich, New England Biolabs, and Bio-Rad Laboratories. The TMB-substrate solution (SureBlue Reserve™ TMB 1-Component Microwell Peroxidase Substrate, #5120-0083) was purchased from KPL. Control human serum was purchased from Sigma-Aldrich (Sigma #H4522) or obtained from healthy volunteers recruited at Tan Tock Sen Hospital (TTSH, Singapore), in a study approved by the National Healthcare Group Domain Specific Review Board (NHG DSRB) (Reference 2009/00432). Whole-blood samples were collected in a Serum Separation Transport Tube or EDTA tubes (Becton Dickinson) from dengue patients referred by the Communicable Disease Centre, TTSH. Blood specimens were obtained from patients consenting to the study. All patients provided separate written informed consent. The study protocol was approved by the NHG DSRB (reference 2015/00528 and 2016/00076). The recruited patients were tested and confirmed as NS1 positive from routine hospital diagnostics, using the SD BIOLINE Dengue Duo test, and had fever for less than 5 days from illness onset. They were confirmed to be infected by the dengue virus by an RTqPCR analysis of the samples. Dengue serotypes were also determined by an FTD dengue differentiation RT-qPCR test from Fast Track Diagnostics, using a Bio-Rad CFX96 instrument for the samples, and Sanger sequencing of RT-PCR products (as described later). The samples of a few patients that were followed up longitudinally were tested and samples at the acute phase (7 days post fever) and the convalescent phases (>7 days post fever up to 1 year) of their dengue infection were provided. In the ELISA shown below, serum samples were used for PD1-1, PD1-2, PD1-3, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34, and PD4-1, while a plasma sample was used for PD2-1.
In the first rounds of ExSELEX, two or four nmol of the single-stranded DNA libraries (88-mer, 5′-GCACTCCATGATATGGTCTACTG-N42-GACAAGCGGAGTAGTTAGACCGT-3′) were used, which are a mixture of 74 sub-libraries. Each sub-library contains two Ds bases in the 42-nucleotide randomized sequence region, at predetermined positions. The ExSELEX conditions are summarized in Table E1. In general, the DNA library, diluted in binding buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl2, and 2.7 mM KCl), was denatured by heating at 95° C. for 5 min, immediately cooled on ice for 10 min, and then kept at room temperature (25° C.) for 10 min. To the diluted DNA library solution, Nonidet P-40 (Nacalai Tesque) or Tween 20 was added at the indicated concentrations. The library was incubated with each target protein (DEN1-NS1, DEN2-NS1, DEN3-NS1, or DEN4-NS1) at 25° C. in the presence or absence of additives (BSA and human serum). The DNA-NS1 complexes were separated from the unbound DNA species by using one of four different methods (Methods A-D), as shown in Table E1. Method A is ultrafiltration with Amicon Ultra Centrifugal Filter Units (MWCO: 100 kDa). Method B is capturing the complexes with an anti-DEN-NS1 antibody, Ab#D06, coated on microtiter plates (MaxiSorp™ 96-well plates from Thermo Fisher Scientific). Method C is a pull-down method, using Dynabeads His-Tag Isolation and Pulldown Magnetic Beads (Thermo Fisher Scientific). Method D is an electrophoresis gel-mobility shift assay42. In Methods A, B, and C, the captured DNA-NS1 complexes were washed several times, and the NS1-bound DNA was recovered by a treatment with 150 mM NaOH, followed by desalting with illustra MicroSpin G-25 Columns (GE Healthcare). The recovered DNA was amplified by PCR using forward 5′-PCR and reverse 3′-PCR primers, in the presence of unnatural substrates, dDsTP and diol-dPxTP42,43. The reverse 3′-PCR primer contains a linker and spacer at the 5′-terminus, to differentiate the length of the library and its complementary strands, which allows their separation by denaturing polyacrylamide gel electrophoresis44. The single-stranded Ds-DNA libraries were separated and purified by denaturing 8% PAGE, for the next round of selection. From Round 2, to remove the non-specific DNA binding species, pre-counter selections were performed, by incubating the DNA library solution with the magnetic beads only or in the antibody-coated wells on the plates, before the target binding. In ExSELEX-1 (Rounds 4-9) and ExSELEX-2 (Rounds 4-9), to remove the DNA species that bound to the other serotype NS1 proteins, post-counter selections were performed. In the post-counter selections, the DNA solutions, eluted from the DNA-NS1 complexes (before PCR), were incubated with the non-target serotype NS1 proteins at 25° C. for 30 min, and then the undesired DNA-NS1 complexes were removed from the solution with the magnetic beads. The resultant DNA solutions were subjected to PCR amplification.
The aptamer candidate sequences were determined from the enriched DNA libraries in the final rounds of ExSELEX-1, ExSELEX-2, and ExSELEX-3, by the sequencing method with an Ion PGM system (Thermo Fisher Scientific), as described previously42,43,45. The DNA libraries were amplified by replacement PCR without dDsTP, but with diol-dPxTP or dPa′TP45. After the purification of the PCR products, the sequencing samples were prepared by using an Ion Plus Fragment Library Kit with an Ion Express Barcode Adapters 1-16 Kit and an Ion PGM Hi-Q View OT2 Kit, followed by deep sequencing using an Ion PGM Hi-Q View Sequencing Kit and Ion PGM 314 v2 chips (Thermo Fisher Scientific). The obtained sequence data were processed and clustered into families, and the unnatural base positions in the randomized region of each family were estimated by using in-house perl scripts.
To identify the presence of diol-Px in the 2D-1 clones, the targeted family sequences were first captured from the enriched library in the final round of ExSELEX-3 targeting DEN2-NS1, by using a specific hybridization probe (5′-biotin-CCGCCTCTTGTTCCCAGTCGGAC-3′) (
Px nucleoside is degraded under basic conditions, the DNA fragments decompose at the Px position by a concentrated ammonia treatment at 55° C. for 4 hours. After removing the ammonia solution, the residue was suspended in 20 μl of Hi-Di Formamide (Thermo Fisher Scientific), and 10 μl aliquots were fractionated by denaturing 8% PAGE. The DNA band patterns on the gel were analyzed with a bio-imaging analyzer, LAS4000 (Fuji Film), before and after staining with SYBR Gold. From the digestion pattern on the gel, the Px position in D2-1 were assessed (
The authentic D2-1 aptamer, D2-1y-96, was prepared by using two chemically synthesized fragments (5-half: 5′-ACTCCATGATATGGTCTACTGGTCCG-Ds-CTGGGAACAAG-Ds-GGCGGGAGGGA-3′, 3-half: 5′-GGTCTAACTACTCCGCTTGTCGCACCCACACCC-Ds-TCCCTCCCGCC-3′, the complementary sequences are underlined), via primer extension and PCR amplification. The primer extension (100 μl) was performed by using 2 μM of each 5-half and 3-half in the presence of 50 μM dioldPxTP, followed by purification using a QIAquick Gel Extraction Kit (QIAGEN). By using the primer extension product as the template, 8-cycle PCR was performed in the presence of 50 μM each dDsTP and diol-dPxTP, and the aptamer strand was purified by denaturing 8% PAGE. The binding of the prepared aptamer strand, D2-1y-96, was analyzed by SPR and EMSA.
For the DNA folding, the DNA fragments diluted in binding buffer were heated at 95° C. for 5 min, followed by immediate cooling on ice for 10 min. The DNA solution (50 nM) was mixed with or without the respective NS1 protein (25 nM) in binding buffer supplemented with 0.05% Nonidet P-40, and incubated at 25° C. for 30 min. After the incubation, the samples were mixed with glycerol (final concentration 5%), and the complex formation was analyzed by PAGE (4% polyacrylamide gel containing 44.5 mM Tris-Borate, 1 mM MgCl2, 2.7 mM KCl, 5% glycerol, with or without 2 M urea). Gel electrophoresis was performed at 26-28° C. for 50 min, in the constant temperature mode (at a 3 W setting with a temperature probe set at 30° C.). The DNA band patterns on the gels were detected with the LAS4000 imager after staining with SYBR Gold. The band densities corresponding to free DNAs were quantified using the Multi Gauge software, to quantify the relative shifted ratios for comparing the degrees of complex formation.
Binding affinity profiles were obtained at 25° C. on a Biacore T200 (GE Healthcare), using running buffer (binding buffer supplemented with 0.05% Tween 20). For the immobilization of each ligand (aptamer variant), streptavidin-coated sensor chips were used and the biotinylated aptamer variant was immobilized on the flow cell, by injecting 0.5 nM of the ligand solution in running buffer, at a flow rate of 0.5 μl/min for 960 sec. For some of the Ds-DNA aptamers (D1 and D2 aptamer variants), it was found that the immobilization in the presence of NS1 gave reproducible target binding profiles, which would result from the aptamer immobilization at an appropriately separated distance, to ensure efficient binding with the multimeric NS1 proteins. Binding kinetic profiles were monitored by injecting at least five different concentrations of the analyte solutions (0.625 nM to 20 nM) for 150 sec (binding), at a flow rate of 30 μl/min. The analyte dissociation patterns were then recorded for 600 sec or 1,200 sec (for D1-1-48 h, D21d-72 h, D3-2-59 h, and D4-3-57 h). To regenerate the ligand on the flow cell surface, a denaturation solution (50 mM NaOH) was injected for 5 sec, and then the ligand was equilibrated in running buffer for 10 min. The kinetic parameters for the target binding, association rates (kon), dissociation rates (koff), and dissociation constants (KD=koff/kon), were determined with the BIAevaluation software, version 3.0, by using the double-reference subtraction method and global curve fitting (more than twice at each concentration) to a 1:1 Langmuir model.
All incubations were performed at room temperature. Microtiter plates (Maxisorp™ 96-well plates from Thermo Fisher Scientific) were coated with 100 μl/well of 10 μg/ml streptavidin overnight, in 0.1 M sodium carbonate buffer (pH 9.6). The streptavidin-coated wells were blocked with 300 μl of 10 mg/ml BSA in 1×D-PBS (Nacalai Tesque) for two hours, and then the wells were washed three times with 200 μl of washing buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl2, 2.7 mM KCl, 0.05% Tween 20). Each UB-DNA aptamer was immobilized on the streptavidin-coated wells by a 2-hour incubation with 100 μl of 15 nM D1-1-48 h or 5 nM D2-1d-72 h, D3-3-59 h, or D4-3-57 h in dilution buffer (washing buffer supplemented with 1 mg/ml BSA), and then each well was washed three times with 200 μl of washing buffer. To the aptamer-coated wells, 100 μl of an NS1-Ab#D06 mixture solution was added and incubated for 30 min. The solutions were prepared beforehand at 1:9 ratios (vol/vol), by a 30-min incubation of each NS1 protein in dilution buffer or human serum with 11.1 nM of Ab#D06 in dilution buffer, supplemented with Tween 20 at a 2% final concentration (dilution buffer 2). After washing the wells once, 100 μl of secondary detector solution (anti-rabbit IgG HRP conjugate, diluted 1:2,500 with dilution buffer) was added to each well, and then incubated for 30 min. After washing the wells six times, 100 μl/well of TMB-substrate solution was added and incubated for 30 min. After adding 100 μl of 1 N HCl to the well to stop the reaction, the absorbance of the wells at 450 nm (OD450) was measured with a microplate reader, Cytation 3 (BioTek). The assays under each condition were performed in duplicate (n=2), and the average absorbance data are shown in the graphs with error bars, which represent one standard deviation. When at least one of the two sample wells showed overflow (OD450>4.000), the data are shown in the graphs with wavy lines.
The Ab/Ab ELISA was performed in a similar manner to the Apt/Ab ELISA, with some modifications. Instead of the aptamer-coated plates, the antibody-coated plates were prepared by a 2-hour incubation with 2 μg/ml Ab#D25 (100 μl/well) in 0.1 M sodium carbonate buffer (pH 9.6), followed by blocking with BSA. In the process to prepare the NS1-Ab#D06 mixture solutions with dilution buffer 2, biotinylated Ab#D6 was used. For biotinylation, the Ab#D25 solution (6.67 μM in 1×D-PBS) was mixed with Thermo Scientific™ EZ-Link™ Sulfo-NHS-LC-Biotin (final concentration 117 μM), and the mixture was incubated at room temperature for 30 min. The antibody was then recovered after desalting, using Amicon Ultra-0.5 Centrifugal Filter Units (MWCO: 50 kDa). The biotinylated Ab#D06 solution in 1×D-PBS was kept at 4° C. until use. The secondary detector used was a streptavidin-HRP conjugate, diluted 1:20,000 with dilution buffer, instead of the anti-rabbit IgG HRP conjugate.
Treatment of Control Human Serum with Protein A Resin
To remove the IgG from human serum, protein A resin was utilized. Human serum from Sigma (500 μL, Lot#SLBT0310) was incubated with Amintra Protein A Resin (Expedeon, 500 μl of a slurry, washed three times with 1 ml of dilution buffer) at room temperature for two hours with rotation. After the incubation, the resin was removed by centrifugation, and the supernatant was recovered and kept at 4° C. until use.
For control comparisons, anti-dengue IgG and IgM serology detection and dengue NS1 detection were performed using commercially available lateral flow assays, the Panbio Dengue Duo Cassette (Alere) and the SD BIOLINE Dengeu NS1 Ag rapid test (Alere) (
For the assays with Apt/Ab ELISA, the wells coated with each UB-DNA aptamer as the capture agent were used. For the preparation of loading samples, a serum sample (5 μl, directly or diluted 10-, 25-, 50- or 100-fold with dilution buffer) was first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 350 pg, DEN2-NS1: 350 pg, DEN3-NS1: 450 pg, DEN4-NS1 200 pg). The solution was then mixed with 45 μl of 11.1 nM Ab#D06 in dilution buffer 2, incubated for 30 min, and then loaded into the aptamer-coated well (50 μl) and incubated for 30 min. The subsequent procedures were performed as described above for the Apt/Ab ELISA.
For the assays with the Ab/Ab ELISA, the wells coated with Ab#D25 (overnight) as the capture agent were used. For the preparation of loading samples, a serum sample (5 μL or diluted 10-, 25-, 50- or 100-fold with dilution buffer) was first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 400 pg, DEN2-NS1: 250 pg, DEN3-NS1: 400 pg, DEN4-NS1: 300 pg). The solution was mixed with 45 μl of 11.1 nM biotinylated Ab#D06 in dilution buffer 2. The subsequent procedures were performed as described above for the Ab/Ab ELISA.
From the plots of OD450 against the volume of human serum used in the ELISA, the relative IgG activity was calculated through the normalization of the serum volume to lower the OD450 to 1.0 (5/[the serum volume required for the OD450 to be 1.0]) (
To compare the amino acid sequences of NS1 in the clinical samples with those of the targeted NS1 in the aptamer generation, sequencing analyses of the DENV NS1 gene RT-PCR products were performed, using Sanger capillary sequencing (for PD1-2, PD1-3, PD2-1, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34, and PD4-1) or multiplex PCR followed by deep sequencing (PD1-1), with some modifications of the published protocol46. RNA from the clinical samples was reverse transcribed into cDNA using Superscript III RNase H(−) Reverse Transcriptase (Thermo Fisher Scientific) and specific primers or random hexamers.
The resulting cDNA was then used as the template for PCR amplification, using Taq DNA polymerase (New England Biolabs), AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific), or Q5 HighFidelity DNA polymerase (New England Biolabs). After purification of the PCR products from the agarose gels or directly using a QIAquick gel extraction kit (Qiagen), the products were subjected to a cycle sequencing reaction with a BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) or deep sequencing with an Ion PGM system (Thermo Fisher Scientific), following the manufacturer's instructions. The capillary sequencing was performed on a 3500 Genetic Analyzer (Thermo Fisher Scientific), and the sequence reads were assembled manually. For PD1-1, the reads obtained with the Ion PGM system were mapped and analyzed, using PD1-2 as the reference sequence, with the CLC Genomics Workbench software (CLC bio).
All reagents and solvents were purchased from standard suppliers (Tokyo Chemical Industry Co., Ltd., Sigma-Aldrich, and Merck). Thin layer chromatography was performed using TLC silica gel 60 F254 (Merck). Compounds were visualized by UV shadowing or staining with a sulfuric acid-methanol solution. Nucleoside derivatives were purified on a Gilson HPLC system with a preparative C18 column (μBONDASPHERE, Waters, 19 mm×150 mm). 1H NMR and 31P NMR spectra were recorded on a Bruker magnetic resonance spectrometer. CDCl3 and DMSO-d6 were used as the solvents.
(S)-Pent-4-yne-1,2-diyl dibenzoate (2). Lithium acetylide ethylenediamine complex (8.31 g, 81.2 mmol) was dissolved in hexamethylphosphoric triamide (20 ml) and dry THF (80 ml), and the resulting mixture was cooled to 0° C. Afterwards, (R)-(+)-glycidol, compound 1, (1786 μl, 27 mmol) in dry THF (40 ml) was added dropwise with stirring at 0° C. The reaction mixture was stirred for 15.5 hours at ambient temperature, and then saturated NH4Cl (200 ml) was added. The mixture was extracted with EtOAc (50 ml×3). The combined organic phase was dried over MgSO4 and concentrated under reduced pressure. The residue was co-evaporated with dry pyridine twice. Benzoyl chloride (12.5 ml, 108 mmol) was added to the residue in dry pyridine (60 ml). The resulting mixture was stirred for 19 hours at ambient temperature. The reaction was quenched by the addition of methanol (10 ml) and stirred for 30 min at ambient temperature, prior to concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) were poured into the resulting residue. The organic layer was separated and washed with water (150 ml), saturated aq-NaHCO3 (150 ml), and brine (150 ml). The organic phase was dried over MgSO4 and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (150 g of silica gel, hexane/EtOAc=100:0 to 95:5) to give compound 2 (2.86 g, 9.26 mmol, 34%). 1H NMR (400 MHz, CDCl3) δ 8.08-8.02 (m, 4H), 7.60-7.54 (m, 2H), 7.47-7.41 (m, 4H), 5.58-5.53 (m, 1H), 4.68 (dq, 2H, J=3.9, 12.0 Hz), 2.80 (dd, 2H, J=2.6, 6.2 Hz), 2.08 (t, 1H, J=2.6 Hz).
1-(2-Deoxy-β-D-ribofuranosyI)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2-carbaldehyde (3). A mixture of iodo-dPa (1.94 g, 5.75 mmol), copper iodide (175 mg, 0.92 mmol), tetrakis(triphenylphosphine)palladium(0) (332 mg, 0.288 mmol), triethylamine (1.6 ml, 11.5 mmol), and DMF (30 ml) was stirred and degassed for 10 min under reduced pressure and then flushed with argon. To this mixture was added compound 2 (2.22 g, 7.19 mmol), and the resulting mixture was further degassed for 10 min under reduced pressure and flushed with argon, prior to stirring for 4 hours at ambient temperature. The reaction mixture was concentrated under reduced pressure. The resulting dark liquid mixture was purified by silica gel column chromatography (60 g of silica gel, DCM/methanol=100:0 to 98:2) and C18 RP-HPLC (eluted by a gradient of CH3CN (40-80%) in H2O) to give compound 3 (2.35 g, 4.53 mmol, 79%). 1H NMR (400 MHz, DMSO-d6) δ 9.47 (d, 1H, J=0.9 Hz), 8.00-7.95 (m, 4H), 7.87 (s, 1H), 7.70-7.64 (m, 2H), 7.56-7.50 (m, 4H), 7.08 (d, 1H, J=1.8 Hz), 6.66 (t, 1H, J=6.3 Hz), 5.57-5.52 (m, 1H), 5.27 (d, 1H, J=4.1 Hz), 5.03 (t, 1H, J=5.3 Hz), 4.74-4.70 (dd, 1H, J=3.3, 11.9 Hz), 4.64-4.59 (dd, 1H, J=6.7, 12.0 Hz), 4.24 (m, 1H), 3.81 (dt, 1H, J=3.6, 4.0 Hz), 3.62-3.50 (m, 2H), 3.03 (d, 2H, J=6.4 Hz), 2.32-2.08 (m, 2H).
1-(5-O-DMTr-2-deoxyl-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2carbaldehyde (4). Compound 3 (2.35 g, 4.53 mmol) was co-evaporated with dry pyridine three times. The residue in dry pyridine (40 ml) was mixed with 4,4′-dimethoxytrityl chloride (DMTrCl, 1.84 g, 5.44 mmol). The resulting mixture was stirred for 2 hours at ambient temperature, prior to concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) was poured into the resulting residue. The organic layer was separated and washed with saturated aq-NaHCO3 (150 ml×1) and brine (150 ml×1). After drying with MgSO4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (60 g of silica gel, hexane/EtOAc=100:0 to 70:30) to give compound 4 (2.98 g, 3.63 mmol, 80%). 1H NMR (400 MHz, DMSO-d6) δ 9.47 (d, 1H, J=0.8 Hz), 7.98-7.94 (m, 4H), 7.68-7.63 (m, 3H), 7.57-7.47 (m, 4H), 7.39-7.37 (m, 2H), 7.31-7.19 (m 6H), 7.11 (d, 1H, J=1.8 Hz), 6.89-6.87 (m, 4H), 6.67 (t, 1H, J=5.9 Hz), 5.54-5.49 (m, 1H), 5.36 (d, 1H, J=3.8 Hz), 4.71-4.67 (dd, 1H, J=3.3, 11.9 Hz), 4.60-4.55 (dd, 1H, J=6.7, 12.0 Hz), 4.26 (m, 1H), 3.97-3.93 (m, 1H), 3.73 (d, 6H, J=1.0 Hz), 3.22-3.18 (dd, 1H, J=5.8, 10.4 Hz), 3.14-3.11 (dd, 1H, J=3.1, 10.4 Hz), 2.99 (d, 2H, J=6.4 Hz), 2.36-2.18 (m, 2H).
1-(5-O-DMTr-2-deoxyl3-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2carbaldehyde phosphoramidite (5). Compound 4 (2.98 g, 3.63 mmol) was co-evaporated with pyridine three times and then with dry THF three times. N,N-Diisopropylethylamine (950 μl, 5.45 mmol) and 2cyanoethyl N,N-diisopropylchlorophosphoramidite (893 μl, 4 mmol) were added to the residue in anhydrous THF (35 ml), and the resulting mixture was stirred for 3 hours at ambient temperature. Dry methanol (500 μl) was added to the mixture to quench the reaction. EtOAc/triethylamine (150 ml, 99/1) and saturated aq-NaHCO3 (150 ml) were poured into the resulting residue. The organic layer was separated and washed with aq-NaHCO3 (150 ml) and brine (150 ml). After drying with MgSO4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (80 g, hexane/EtOAc=100/0 to 80/20 containing 1% triethylamine) to give compound 5 (2.84 g, 2.78 mmol, 76%). 1H NMR (400 MHz, DMSO-d6) δ 9.52-9.50 (m, 1H), 7.97-7.94 (m, 4H), 7.69-7.62 (m, 3H), 7.52-7.47 (m, 4H), 7.40-7.36 (m, 2H), 7.31-7.18 (m, 6H), 7.12 (m, 1H), 6.89-6.86 (m, 4H), 6.74-6.68 (m, 1H), 5.55-5.48 (m, 1H), 4.71-4.46 (m, 3H), 4.12-4.04 (m, 1H), 3.73-3.72 (m, 6H), 3.67-3.46 (m, 3H), 3.27-3.17 (m, 2H), 2.99 (t, 2H, J=5.9 Hz), 2.76 (t, 1H, J=5.9 Hz), 2.66 (t, 1H, J=5.9 Hz), 2.49-2.32 (m, 2H), 1.14-0.99 (m, 12H) (
Embodiments of the aptamers are high-affinity and high-specificity unnatural-base (UB) DNA aptamers capable of binding to each serotype of dengue NS1 proteins. In some examples, embodiments of the aptamers have a hKD of between from 30 pM to 182 pM. Embodiments of the aptamers can recognize target dengue NS1 proteins with amino-acid sequences that are more than 96.3% identical to that of the initial targets. Embodiments of the UB-DNA aptamers contain Ds (7-(2-thienyl)imidazo[4,5-b]pyridine) and/or diol-modified Pa (pyrrole-2-carbaldehyde) as a fifth and sixth base components.
Using embodiments of these UB-DNA aptamers, a simple and highly specific method to detect serotype-specific DENV infection is developed. In embodiments of the method, each serotype antigen of DEN-NS1 can be detected using UB-DNA aptamers that bind specifically to each DEN-NS1 serotype, by a sandwich-type ELISA format with an aptamer-antibody combination.
It was also found that anti-DEN-NS1 IgG in the patient's serum samples inhibit the aptamer's binding to the NS1 proteins. Further, from an analysis of sera from Singaporean patients with primary or secondary infection, it was further found that the IgG production initially reflected the serotype of the past infection, rather than that of the recent infection. Leveraging on these findings, a method to quantitatively identify the serotype-specific IgG antibodies to DEN-NS1 in serum was developed. In embodiments of the method, detection of serotype-specific IgG antibodies to dengue NS1 proteins was performed using a competitive ELISA format. In some examples, the detection of anti-DEN-NS1 IgG antibodies in a patient within one week after fever onset (e.g. during a febrile period) is indicative of a secondary infection in the patient, which may warrnt close monitoring.
Embodiments of the method trace serotype-specific dengue infection by detecting both viral NS1 proteins and their IgG antibodies in the early and later phase of dengue infection, by using ELISA with high-affinity DNA aptamers. Embodiments of the method allow the diagnosis of both past and current dengue infection, including serotype identification, and therefore facilitate early medical care and vaccine use decisions and analysis.
Embodiments of the method can potentially be expanded to test the efficacy in vaccine development, as well as the diagnoses of other diseases and allergies.
Number | Date | Country | Kind |
---|---|---|---|
10201905754 W | Jun 2019 | SG | national |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/SG2020/050342 | 6/18/2020 | WO |