Patent Application
20170145077
The invention disclosed herein generally relates to methods of determining minimum hematopoietic stem cell (HSC) chimerism and gene dosage for correction of a hematopoietic disease; in particular, in an in vivo model. The invention also relates to modified SIN lentiviral expression vectors for increasing a viral titer and various methods for increasing such titers as well as expression vectors capable of enhancing such titers. The invention also relates to CHS4 chromatin insulator-derived functional insulator sequences to help increase the safety of integrating vectors and to increase expression. The invention also relates to methods for genetic correction of diseases or reducing symptoms thereof, such as sickle cell anemia and β-thalassemia. The invention further relates to various expression vectors capable of genetically correcting sickle cell anemia or β-thalassemia, or reducing symptoms thereof.
All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
Successful genetic correction of diseases, mediated by hematopoietic stem cells (HSCs), depends upon stable, safe, targeted gene expression of therapeutic quantities. Expression vectors are central to the process of genetic correction and consequently the subject of considerable research. Although significant advances in vector design have improved the efficacy of gene therapy, certain key obstacles have emerged as barriers to successful clinical application. Among those obstacles, vector genotoxicity is among the most formidable, as evidenced by the occurrence of gene therapy related leukemia in patients in X-SCID trials, as disclosed herein. As a result, gamma-retroviral vectors and lentiviral vectors have been modified to a self-inactivating (SIN) design to delete ubiquitously active enhancers in the U3 region of the long terminal repeats (LTR) (as disclosed herein). SIN design has been improved upon to increase vector titers. Several methods of improving transgene expression have been subsequently employed.
As an added measure of stabilizing expression, many vectors are now designed with chromatin insulating elements that reduce chromatin position effects. While these insulators can improve the safety and expression profiles of certain vectors, in some cases an undesirable side effect is decreased titers compared to non-insulated versions. Custom insulators have been designed that provide optimal insulation without lowering titers.
Thus, there is a need in the art for improved expression vector design, aimed at safely stabilizing the expression of transgenes, while maintaining clinically relevant viral titers.
Expressing a tremendous amount of fetal/antisickling hemoglobin will undoubtedly correct disease, as has been demonstrated, but is not practically possible in a clinical setting. As an example, an initial gene therapy for adenosine deaminase (ADA) deficiency was performed using no conditioning, and was not therapeutic, even though few gene-marked stem cells engrafted, and a selective advantage to gene-corrected lymphocytes was evident upon withdrawal of ADA (as disclosed herein). In a subsequent trial, 4 mg/kg busulfan was used before transplantation, as conditioning, resulting in adequate gene-corrected stem cell dose and gene-modified T cells (as disclosed herein). Thus, there is a need in the art to establish methods of determining thresholds for genetic correction before embarking on clinical studies.
Methods and composition described herein are provided by way of example and should not in any way limit the scope of the invention.
Embodiments of the invention encompass mutated human gamma-globin genes. In some embodiments, the mutated human gamma-globin gene can encode a protein including SEQ ID NO:1. In some embodiments, the mutated human gamma-globin gene can have a sequence identity of 70% or greater to SEQ ID NO: 2.
Embodiments of the invention also encompass methods of using a mutated human gamma-globin gene encoding a protein including SEQ ID NO:1 to genetically correct sickle cell anemia or β-thalassemia or reduce symptoms thereof, the method including identifying a subject in need of treatment for sickle cell anemia or β-thalassemia; transfecting autologous hematopoietic stem cells (HSCs) with a modified lentivirus including the mutated human gamma-globin gene encoding a protein including SEQ ID NO:1; and transplanting the transfected HSCs into the subject.
In some embodiments, the subject is a human subject. In some embodiments, the subject is treated with reduced intensity conditioning prior to transplantation.
In some embodiments, the modified lentivirus further includes a heterologous polyA signal sequence downstream from a viral 3′ LTR sequence in a standard SIN lentiviral vector backbone; and one or more USE sequences derived from an SV40 late polyA signal in a U3 deletion region of a standard SIN lentiviral vector backbone. In some embodiments, the modified lentivirus further includes one or more flanking CHS4-derived reduced-length functional insulator sequences. In some embodiments, the modified lentivirus further includes a beta-globin locus control region. In some embodiments, the modified lentivirus further includes an erythroid lineage specific enhancer element.
In some embodiments, post-transplantation fetal hemoglobin exceeds at least 20%; F cells can be at least ⅔ of the circulating red blood cells; fetal hemoglobin per F cells can be for at least ⅓ of total hemoglobin in sickle red blood cells; and at least 20% gene-modified HSCs can re-populate bone marrow of the subject.
Embodiments of the invention also encompass lentiviral expression vectors capable of genetically correcting sickle cell anemia or β-thalassemia or reducing symptoms thereof, includes a mutated human gamma-globin gene encoding a protein in SEQ ID NO:1. In some embodiments, the lentiviral expression vector, further includes a heterologous polyA signal sequence downstream from a viral 3′ LTR sequence in a standard SIN lentiviral vector backbone; and one or more USE sequences derived from an SV40 late polyA signal in a U3 deletion region of a standard SIN lentiviral vector backbone. In some embodiments, the lentiviral expression vector further includes one or more flanking CHS4-derived reduced-length functional insulator sequences. In some embodiments, the lentiviral expression vector further includes one or more elements of a beta-globin locus control region cloned in reverse orientation to a viral transcriptional unit. In some embodiments, the lentiviral expression vector further includes an erythroid lineage specific enhancer element.
Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
All references cited herein are incorporated by reference in their entirety as though fully set forth. Also incorporated herein by reference in their entirety include: U.S. Non-Provisional application Ser. No. 12/928,302, filed on Dec. 6, 2010, and U.S. Provisional Application No. 61/267,008, filed on Dec. 4, 2009. Also incorporated herein by reference in their entirety is a novel human gamma-globin gene vector for genetic correction of sickle cell anemia in a humanized mouse model and critical determinants for successful correction thereof as described in, “A novel human gamma-globin gene vector for genetic correction of sickle cell anemia in a humanized mouse model: critical determinants for successful correction”. Blood (2009) 114: 1174-1185 Perumbeti A, Higashimoto T, Urbinati F, Franco R, Meiselman H et al.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons (New York, N.Y. 2001); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 5th ed., J. Wiley & Sons (New York, N.Y. 2001); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2001), provide one skilled in the art with a general guide to many of the terms used in the present application. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.
As used herein, the term “SIN” is an abbreviation of self-inactivating.
As used herein, the term “HIV” is an abbreviation of human immunodeficiency virus.
As used herein, the term “GFP” is an abbreviation of green fluorescent protein.
As used herein, the term “cDNA” is an abbreviation of complimentary DNA.
As used herein, the term “LTR” is an abbreviation of long terminal repeat.
As used herein, the term “USE sequence” refers to an upstream sequence element.
As used herein, the term “polyA” is an abbreviation of polyadenylation.
As used herein, the term “cHS4” is an abbreviation of chicken hypersensitive site-4 element.
As used herein, the term “HSC” is an abbreviation of hematopoietic stem cells.
As used herein, the term “GOI” is an abbreviation of gene of interest.
As used herein, the term “HbF” is an abbreviation of fetal hemoglobin.
As used herein, the term “RBC” is an abbreviation of red blood cell. As used herein, the term “IDUA” is an abbreviation of alpha-L-iduronidase.
As used herein, the term “LCR” is an abbreviation of locus control region.
As used herein, the term “subject” refers to any member of the animal kingdom. In some embodiments, a subject is a human patient.
As used herein, the terms “treatment,” “treating,” “treat,” “correct,” and the like, with respect to a specific condition, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or can be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. “Treatment,” as used herein, covers any treatment of a disease in a subject, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease and/or relieving one or more disease symptoms. “Treatment” can also encompass delivery of an agent or administration of a therapy in order to provide for a pharmacologic effect, even in the absence of a disease or condition. The term “treatment” is used in some embodiments to refer to administration of a compound of the present invention to mitigate a disease or a disorder in a host, preferably in a mammalian subject, more preferably in humans. Thus, the term “treatment” can include includes: preventing a disorder from occurring in a host, particularly when the host is predisposed to acquiring the disease, but has not yet been diagnosed with the disease; inhibiting the disorder; and/or alleviating or reversing the disorder. Insofar as the methods of the present invention are directed to preventing disorders, it is understood that the term “prevent” does not require that the disease state be completely thwarted (see Webster's Ninth Collegiate Dictionary). Rather, as used herein, the term preventing refers to the ability of the skilled artisan to identify a population that is susceptible to disorders, such that administration of the compounds of the present invention can occur prior to onset of a disease. The term does not mean that the disease state must be completely avoided.
As used herein, the terms “mutated,” “mutation,” “mutant,” and the like, refer to a change in a sequence, such as a nucleotide or amino acid sequence, from a native, wild-type, standard, or reference version of the respective sequence, i.e. the non-mutated sequence. These terms can refer to one or more mutated genes, such as deoxyribonucleic acids, ribonucleic acids, and the like, or one or more mutated gene products, such as proteins. A mutated gene can result in a mutated gene product. A mutated gene product will differ from the non-mutated gene product by one or more amino acid residues.
In some embodiments, a mutated gene which results in a mutated gene product can have a sequence identity of 70%, 75%, 80%, 85%, 90%, 95%, or greater to the corresponding non-mutated nucleotide sequence. In some embodiments, a mutated gene which results in a mutated gene product can have a sequence identity of 96%, 97%, 98%, 99%, or greater to the corresponding non-mutated nucleotide sequence. In some embodiments of the invention, the mutated gene is a mutated human gamma-globin gene. In some embodiments, the mutated human gamma-globin gene encodes a protein comprising SEQ ID NO:1.
In some embodiments, the mutated human gamma-globin gene is used to genetically correct sickle cell anemia or β-thalassemia or reduce symptoms thereof, including the steps of identifying a subject in need of treatment for sickle cell anemia or β-thalassemia; transfecting autologous hematopoietic stem cells (HSCs) with a modified lentivirus comprising the mutated human gamma-globin gene; and transplanting the transfected HSCs into the subject.
In some embodiments, post-transplantation fetal hemoglobin exceeds at least 20%; F cells constitute at least ⅔ of the circulating red blood cells; fetal hemoglobin per F cells account for at least ⅓ of total hemoglobin in sickle red blood cells; and at least 20% gene-modified HSCs re-populate bone marrow of the subject. In some embodiments, post-transplantation fetal hemoglobin exceeds 25%, 30%, 35%, 40%, 45%, 50%, or greater. In some embodiments, post-transplantation fetal hemoglobin exceeds 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater. In some embodiments, F cells constitute at least 70%, 75%, 80%, 85%, 90%, 95%, or greater of the circulating red blood cells. In some embodiments, fetal hemoglobin per F cells account for at least 1/3 of total hemoglobin in sickle red blood cells. In some embodiments, fetal hemoglobin per F cells account for at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or greater of total hemoglobin in sickle red blood cells. In some embodiments, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater gene-modified HSCs re-populate bone marrow of the subject.
As described herein, experimentation was conducted to determine whether lentivirus non-coding cis-sequences played a specific role in the RNA export, packaging or expression of β-globin. The vector life-cycle was studied in self-inactivating (SIN)-lentiviruses, carrying the β-globin gene and locus control region (BG), or GFP cDNA. Systematic analysis started with a completely ‘gutted’ minimal SIN-lentivirus carrying only the packaging region; and SIN-lentiviruses containing increasing HIV cis-elements, along with a SIN-gamma-retrovirus in order to identify optimal cis-elements to include in the SIN-LV backbone. To clone the sSIN-GFP vector, the 3′LTR of a standard SIN-LV backbone previously used, as described herein, was modified to improve transcript termination. Specifically, β-growth hormone polyadenylation signal was added downstream of the 3′LTR and a USE sequence derived from SV40 late polyadenylation signal was added in the U3 deletion.
As further described herein, SIN-gamma-retrovirus or a gutted/minimal SIN-lentivirus encoding GFP generated high titers and mediated high GFP expression. However, SIN-gamma-retrovirus or the gutted SIN-lentivirus encoding either BG or a similar sized large transgene had barely detectable titers compared to the SIN-lentivirus carrying cis-elements. Systematic addition of cis-elements demonstrated that Rev/RRE was most essential, followed by gag and env splice acceptor sequences, for efficient assembly/packaging of lentivirus particles, not mRNA export. However, these HIV cis-sequences were dispensable for smaller transgenes. These studies identify key lentivirus cis-elements and the role they play in vectors carrying large inserts, and have important implications for gene therapy.
In one embodiment, the present invention provides a method of increasing titer of a modified SIN lentiviral expression vector compared to a standard SIN lentiviral expression vector. In another embodiment, the SIN lentiviral expression vector is modified by inserting a heterologous polyadenylation (polyA) signal sequence downstream from a viral 3′ long terminal repeat sequence in a standard SIN lentiviral vector backbone. In another embodiment, the polyA signal is the bovine growth hormone polyA signal sequence. In another embodiment, the SIN lentiviral vector is modified by inserting one or more of an upstream polyA-enhancer sequence (USE sequence) into a 3′LTR of a standard SIN lentiviral vector backbone. In another embodiment, the USE sequence is derived from the SV40 late polyA signal. In another embodiment, 2-3 copies of the USE sequence are inserted into a 3′LTR of a standard SIN lentiviral vector backbone. In another embodiment, 2-10 copies of the USE sequence are inserted into a 3′LTR of a standard SIN lentiviral vector backbone. In another embodiment, 3-5 copies of the USE sequence are inserted into a 3′LTR of a standard SIN lentiviral vector backbone. In another embodiment, one or more copies of the USE sequence is inserted into the U3 region. In another embodiment, the β-growth hormone polyA signal and one or more copies of the USE sequence derived from the SV40 late polyA signal are both incorporated into the expression vector. In another embodiment, the expression vector contains a gene of interest (GOI). In another embodiment, the gene is operably linked to a promoter. In another embodiment, the promoter is a lineage-specific promoter. In another embodiment, the promoter is an erythroid specific promoter. In another embodiment, of the GOI is β-globin. In another embodiment, the GOI is gamma-globin. In another embodiment of the invention the gamma-globin gene is under the control of β-globin regulatory elements. In another embodiment, the vector is used to treat sickle cell anemia via gene therapy. In another embodiment, the vector is used in conjunction with reduced intensity conditioning to treat sickle cell anemia. In another embodiment, the SIN lentivirus comprises a bovine, equine, feline, ovine/caprine or primate derived variety of lentivirus. In another embodiment, the SIN lentivirus is an HIV derived SIN lentivirus. In another embodiment the modified SIN lentiviral vector is introduced into a eukaryotic cell by transfection.
In one embodiment, the present invention provides a method of designing a gutted/minimal, and thus less recombinigenic and safer SIN lentiviral vector for the expression of small therapeutic transgenes that do not require extensive Cis elements for efficiency. In another embodiment the small therapeutic transgenes are equal in size or smaller than green fluorescent protein (GFP). In another embodiment the small therapeutic transgenes are smaller than human β-globin.
As described herein, chromatin insulator elements prevent the spread of heterochromatin and silencing of genes, reduce chromatin position effects and have enhancer blocking activity. These properties are desirable for consistent predictable expression and safe transgene delivery with randomly integrating vectors. Overcoming chromatin position effects can reduce the number of copies required for a therapeutic effect and reduce the risk of genotoxicity of vectors. Vector genotoxicity has become an area of intense study since the occurrence of gene therapy related leukemia in patients in the X-SCID trials. Gamma-retroviral vectors and lentiviral vectors have been modified to a self-inactivating (SIN) design to delete ubiquitously active enhancers in the U3 region of the long terminal repeats (LTR). A 1.2 Kb DNAse hypersensitive site-4 (cHS4) from the chicken p-globin locus has been inserted in the 3′LTR to allow its duplication into the 5′LTR in gamma-retrovirus and lentivirus vectors. Insulated vectors have reduced chromatin position effects and, provide consistent, and therefore improved overall expression. A side-by-side comparison of cHS4 insulated and uninsulated lentivirus vectors carrying hβ-globin and the locus control region was performed, and resulted in the discovery that insulated vectors showed consistent, predictable expression, regardless of integration site in the differentiated progeny of hematopoietic stem cells, resulting in a 2-4 fold higher overall expression. Recent evidence also suggests that cHS4 insulated lentivirus vectors may reduce the risk of insertional activation of cellular oncogenes. Despite the beneficial effects of insulated vectors, they also lead to a significant reduction in titers with insertion of the full-length 1.2 Kb cHS4 insulator element in the 3′LTR of lentivirus vectors. There are similar reports of lowering of viral titers or unstable transmission with gamma-retrovirus vectors containing insertions in the 3′ LTR. This reduction in titers becomes practically limiting for scale up of vector production for clinical trials, especially with vectors carrying relatively large expression cassettes, such as the human β-globin gene (hβ) and locus control region (LCR), that have moderate titers even without insulator elements.
The effects of insertions of exogenous fragments into the LTR on viral life cycle have not been addressed. The mechanism by which insertion of cHS4, or other inserts in the viral 3′LTR lower titers of lentiviral vectors was therefore studied. Large LTR inserts lower titers via a post-entry restriction in reverse transcription, and increased homologous recombination in the LTRs of viral cDNA, thus reducing the amount of virus DNA available for integration. These results have important implications for vector design for clinical gene therapy. Studies on the chicken hypersensitive site-4 (cHS4) element, a prototypic insulator, have identified CTCF and USF-1/2 motifs in the proximal 250 bp of cHS4, termed the “core”, which provide enhancer blocking activity and reduce position effects. However, the core alone does not insulate viral vectors effectively. While the full-length cHS4 has excellent insulating properties, its large size severely compromises vector titers. A structure-function analysis of cHS4 flanking lentivirus-vectors was performed and transgene expression in the clonal progeny of hematopoietic stem cells and epigenetic changes in cHS4 and the transgene promoter were analyzed.
As further described herein, the core only reduced the clonal variegation in expression. Unique insulator activity resided in the distal 400 bp cHS4 sequences, which when combined with the core, restored full insulator activity and open chromatin marks over the transgene promoter and the insulator. These data consolidate the known insulating activity of the canonical 5′ core with a novel 3′ 400 bp element with properties similar to the core. Together, they have excellent insulating properties and viral titers. This data has important implications with respect to understanding the molecular basis of insulator function and design of gene therapy vectors.
In one embodiment, the present invention provides a method of increasing the titer of lentiviral vectors by incorporating one or more reduced-length chromatin insulators containing functional portions of a full-length chromatin insulator. In another embodiment, the functional portions are derived from a single type of full length chromatin insulator. In another embodiment, the reduced-length functional insulator comprises functional portions of two or more separate varieties of chromatin insulators. In another embodiment, the functional reduced-length chromatin insulator is derived from a chicken hypersensitive site-4 (cHS4) element. In another embodiment, the functional reduced-length insulator is a cHS4-derived insulator of 650 base pairs or less. In another embodiment, one or more reduced-length cHS4-derived insulators is combined with other modifications to a SIN lentivirus expression vector in order to increase titer and improve stability of transgene expression. In another embodiment, one or more reduced-length cHS4-derived insulators is added to a vector containing a heterologous polyadenylation (polyA) signal sequence downstream from a viral 3′LTR and a USE sequence in the U3 deletion.
Sickle cell disease (SCD) affects the β-globin gene and is one of the most common genetic defects, resulting in the production of a defective sickle globin (HbS, comprised of two normal α globin and two βsickle globin molecules, denoted as α2βS2). HbS polymerizes upon deoxygenation and changes the shape of discoid red blood cells (RBCs) to bizarre sickle/hook shapes. Sickled RBCs clog the microvasculature, causing painful acute organ ischemic events and chronic organ damage that foreshortens the life span of SCD patients to 45 years. This disease affects over 110,000 Americans, with 1000 newborns with SCD born every year and nearly 1000 babies born with this disease annually in Africa.
Therapeutic options for SCD are extremely limited and involve a bone marrow hematopoietic stem cell transplant (HCT). HCT is available only to 10-15% of patients with matched normal sibling donors and is often associated with serious immune side effects. Fetal hemoglobin (HbF, comprised of α and γ globins, α2γ2) is produced during the fetal life and the first 6-9 months of age and has strong anti-sickling properties and protects the infant from sickling in the first year of life. Indeed, individuals with hereditary persistence of HbF that have SCD are asymptomatic. Hydroxyurea, a chemotherapeutic drug that increases HbF, is FDA-approved for ameliorating symptoms of SCD. However, hydroxyurea does not work for all patients, and due to daily life-long intake, is associated with poor compliance. Hence, better therapeutic options are needed for SCD.
Genetic correction of autologous bone marrow stem cells (hematopoietic stem cells) with a lentivirus vector encoding the γ-globin gene would be able to permanently result in production of the anti-sickling HbF, thereby preventing RBC sickling. This method has advantages over currently available therapies, including its availability to all patients, particularly those who do not have a matched sibling donor, and the fact that it would be a one-time treatment, resulting in lifelong correction and devoid of any immune side effects. An effective gene therapy approach will revolutionize the way SCD is treated and improve the outcomes of patients with this devastating disorder.
As disclosed herein, lentiviral delivery of human γ-globin under β-globin regulatory control elements in HSCs results in sufficient postnatal HbF expression to correct SCA in mice. The amount of HbF and transduced HSCs was then de-scaled, using reduced-intensity conditioning and varying multiplicity of infection (MOI), to assess critical parameters needed for correction. A systematic quantification of functional and hematologic RBC indices, organ pathology, and life span were critical to determine the minimal amount of HbF, F cells, HbF/F cell, and gene-modified HSCs required for reversing the sickle phenotype.
As further disclosed herein, amelioration of disease occurred when HbF exceeded 10%, F cells constituted two-thirds of the circulating RBCs, and HbF/F cell was one-third of the total hemoglobin in RBCs; and when approximately 20% sGbG modified HSCs repopulated the marrow. Genetic correction was sustained in primary or secondary transplant recipients followed long-term. The present study describes a method of determining minimum HSC chimerism for correction of a hematopoietic disease in an in vivo model, which would contribute to design of cell dose and conditioning regimens to achieve equivalent genetically corrected HSCs in human clinical trials. Moreover, this study addresses the gene dosage and the gene-modified hematopoietic stem cell dosage required for correction of a genetic defect.
In one embodiment, the present invention provides a method of determining minimum HSC chimerism for correction of a hematopoeitic disease in an in vivo model. In another embodiment, reduced intensity conditioning prior to transplantation is used as a method of varying HSC chimerism. In another embodiment, the proportion of transduced HSCs and vector copy/cell is varied by transducing the cells at a range of MOI (30-100). In another embodiment, the MOI is 20-120. In another embodiment, the minimum determined chimerism and gene dosage can be used to design cell dose and conditioning regimens to achieve equivalent genetically corrected HSCs in human clinical trials. In another embodiment, reduced intensity conditioning is used prior to transplantation in a clinical setting to reduce transplantation-related morbidity. In another embodiment, the hematopoeitic disease is sickle cell anemia. In another embodiment, the hematopoeitic disease is β-thalassemia.
As disclosed herein, an improved mutant γ-globin gene has been engineered from a lentivirus vector, sGbGM. This vector has a higher tendency to form HbF and improved anti-sickling properties, resulting in superior correction of SCD in stringent homozygous SCD mouse models. The engineered γ-globin gene has an increased affinity to bind a-globin without altering its function, thereby greatly improving the efficiency of HbF formation in RBCs and resulting in a far more efficient anti-sickling effect that will correct the SCD phenotype.
As further disclosed herein, the engineered sGbGM vector has a two-fold higher tendency to form HbF than the native γ-globin gene from the sGbG vector and readily corrects the UAB sickle mice efficiently. Both vectors correct SCD in Berkeley sickle mice. Thus, the sGbGM vector provides twice the amount of HbF per vector copy in sickle mice as compared to the sGbG vector. In addition to providing an increased amount of HbF, the mutant HbF produced from the sGbGM vector also confers sickle RBCs with much longer lifespans as compared to natural HbF, due to reduced sickling. Accordingly, this vector can efficiently correct SCD in human patients.
One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.
The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.
This study investigated whether lentivirus non-coding cis-sequences played a specific role in the RNA export, packaging or expression of β-globin. The vector life-cycle was studied in self-inactivating (SIN)-lentiviruses, carrying the β-globin gene and locus control region (BG), or GFP cDNA. Systematic analysis started with a completely ‘gutted’ minimal SIN-lentivirus carrying only the packaging region; and SIN-lentiviruses containing increasing HIV cis-elements, along with a SIN-gamma-retrovirus. It was discovered that (i) SIN-gamma-retrovirus or a gutted/minimal SIN-lentivirus encoding GFP generated high titers and mediated high GFP expression. (ii) However, SIN-gamma-retrovirus or the gutted SIN-lentivirus encoding either BG or a similar sized large transgene had barely detectable titers compared to the SIN-lentivirus carrying cis-elements. (iii) Systematic addition of cis-elements demonstrated that Rev/RRE was most essential, followed by gag and env splice acceptor sequences, for efficient assembly/packaging of lentivirus particles, not mRNA export. However, these HIV cis-sequences were dispensable for smaller transgenes. These studies identify key lentivirus cis-elements and the role they play in vectors carrying large inserts, and have important implications for gene therapy.
It has been postulated that γRV are unable to successfully express hβ-globin due to transcriptional interference between the strong γRV LTR promoter/enhancer elements and the internal LCR enhancer. SRS11.SF is a SIN-γRV that encodes the GFP cDNA under control of an internal Spleen Focus-Forming Virus (SFFV) promoter/enhancer. The SFFV-GFP in SRS11.SF was replaced with BG, an expression cassette that was successfully utilized in a standard SIN-LV to achieve therapeutic human β-globin expression in thalassemia, to generate SRS11.BG. The rationale for using SRS.11, despite the notoriety of β-globin γRV was: (i) it contains the minimal packaging region (ψ), lacks gag sequences and can carry a larger vector payload, yet retains extremely high titers; (ii) it carries a large 400 bp U3 deletion of the 3′LTR, comparable to the deletion in SIN-LV. (iii) Large LCR elements have never been tested in γRV due to restrictions on vector payload.
Infectious titers and expression of SRS11.BG and SRS11.SF γRV vectors were compared on the murine erythroleukemia (MEL) cell line. Human p-globin protein expression was almost undetectable from SRS11.BG-transduced MEL cells, in contrast to the high expression of GFP in cells transduced with SRS.11 SF. The unconcentrated viral titers of SRS11 BG versus SRS11.SF vector were 6.8±5×103 IU/mL versus 4±0.2×106 IU/mL. Viral RNA (vRNA) transcripts were barely detectable in 293T cells with the SRS11.BG via northern blot analysis (data not shown). Therefore, production of BG vRNA and viral particles from γRV, even those optimized for a SIN design and high vector payload was severely impaired.
In contrast to the SIN-γRV used herein, the “standard” SIN-LV commonly used retains relatively large portions of viral sequences amounting to about 20-25% of the HIV genome. These cis elements are: the LTR (634 bp for wt HIV LTR or 235 bp for SIN-LV LTR), the packaging signal ψ(150 bp), 5′ portion of the gag gene (300 or 600 bp), env sequences including the rev response element (RRE, 840 bp) and the central flap/polypurine tract (cPPT) from the pol gene (120 bp).
To examine the requirement of cis-sequences for GFP versus BG, the CMV-GFP cassette was cloned in a) the “standard” SIN-LV containing cis sequences listed above (sSIN-GFP), and b) a ‘gutted’ minimal SIN-LV where the gag, RRE and the rest of the env sequences were deleted and only the ψ region was retained (dsSIN-GFP;
To study which particular LV cis sequences were important for this effect, and what step of the vector life cycle they affected, a series of ten SIN-LV vectors were cloned; all of them carrying the BG cassette but carrying different lentiviral non-coding cis elements (
The first vector (sBG-1) maintained only the packaging signal (containing the 5′ splicing donor site) and the cPPT/flap (
The vectors without the RRE element (sBG-1, sBG-9 and sBG-10) had a concentrated titer ranging from 5.5±2.1×105 IU/mL to 1.7±1.4×106 IU/mL, which was 2-3 orders of magnitude lower than vectors that carry the RRE sequence (sBG-2 to sBG-8; p<0.01). Indeed when only the RRE sequence was added to sBG-1 to generate sBG-2, the titer increased by more than a 100-fold (5.5±2.1×105 IU/mL versus 8.7±6.5×107 IU/mL; p<0.01;
Addition of the env fragment containing the SA site increased vector titers 3-5 fold: 2.9±0.9×108 IU/mL for sBG-3 versus 8.7±0.7×107 IU/mL for sBG-2 (p<0.01). This effect was specific to the SA, since titers of sBG-4 vector, which contains the env sequence with a mutated SA were 1.1±0.61×108 IU/mL, and were similar to that of sBG-2 carrying only the RRE (sBG4 vs. sBG-3 p<0.01). The addition of a long and short fragment of gag to env (RRE and SA) containing vectors sBG-5 and sBG-6, respectively, showed a further increase in titers by ˜4-5 fold, with titers from sBG-6 reaching 6.3×108 IU/mL (sBG-4 vs. sBG-5 and sBG-6 p<0.01). The data suggested that the longer portion of gag was not necessary for high BG titers. However, titers of vectors carrying only the short/long gag fragments, without the RRE and env SA were low (sBG-9 and sBG-10), as compared to those containing the RRE as well (sBG-7 and sBG-8; p<0.01). Titers of sBG-7, 8, 9, and 10 ranged from 9.4±4.7×105 IU/mL to 1.4±0.4×108 IU/mL. Titers improved further by 3-5 fold with the inclusion of env SA. Thus, the gag fragment alone, or the combination gag/RRE was not sufficient to confer optimal titers to BG vectors, suggesting HIV-1 cis sequences acted cooperatively.
To study whether the strong effect of the RRE on viral titers was Rev-dependent, the sBG-6 vector was packaged with and without Rev. In these experiments, the packaging system was changed from 3-plasmid to a 4-plasmid system, wherein Rev and Gag-Pol were provided from different plasmids. The titers of sBG-6 were approximately 400-fold higher with Rev (3.8±0.3×107 IU/mL) than without the Rev protein (9.4x±5.8×104 IU/ml; p<0.01), showing that interaction of Rev with RRE was necessary for high titers.
Taken together, these data indicate that HIV-1 Rev/RRE, gag and env SA were critical for high titers of LV carrying a large cargo such as BG or FIG, although they are dispensable for small GFP based cassettes.
In order to assess the role of LV cis-elements in proviral stability and expression a genomic Southern blot analysis on transduced MEL cells was performed.
Surprisingly, given previous difficulties with genomic rearrangements of hβ-globin-containing γRV, only one proviral band of the expected size was detected in most of the LV
In order to determine whether LV cis-sequences affected the level of expression of integrated BG proviruses, MEL cells were transduced with vectors sBG-1 through sBG-10 at a range of multiplicity of infection. Mean fluorescence intensity (MFI) was compared in MEL cell pools with a similar percentage of hβ-globin expressing cells (15-20%), except in vectors with low titers, where only a small percentage of gene transfer could be achieved. The MFI of the transduced MEL cell population was comparable among all the vectors (ranging from 62 to 110 arbitrary units), including that of the low titer vectors (
In order to determine the role of RRE, gag and env SA in vRNA production and cytoplasmic export the steps of vector life cycle that could impair generation of full-length vRNA in the packaging cells, its subsequent cytoplasmic export, assembly and packaging into vector particles was studied.
Total, cytoplasmic and nuclear RNA was fractionated from 293T packaging cells transfected with sBG-1 through sBG-10.
Significantly, all vectors with very low titers, including sBG-1, sBG-9 and sBG-10 that do not contain RRE, produced vRNA in quantities that were comparable to, or higher than the highest titer vectors (sBG-5 and sBG-6). Since this finding was unexpected, the northern blot was repeated in a separate experiment, with fractionation of total and cytoplasmic RNA, with identical results.
Rev/RRE has been best characterized for export of full-length vRNA to the cytoplasm. Therefore, the next step was to determine if RRE contributed to high titers via vRNA export. Northern blot analysis showed similar amounts of vRNA in the cytoplasm of analogous vectors without or with RRE (sBG-1 versus sBG-2, sBG10 versus sBG-8, and sBG-9 versus sBG-7;
The effect of cis sequences on the packaging efficiency was next determined by analyzing vRNA, p24 levels and viral associated reverse transcriptase (RT) in purified virus particles from all ten vectors processed identically.
There were some exceptions that suggested cis-sequences may have some effect on steps following target cell entry: RNA in 293T cells and the infectious titers of sBG-2 and sBG-4 were comparable, although sBG-4 vRNA was 4-times higher. It seems that sBG-4 vRNA, even when packaged more efficiently, may not be stable post-target cell entry due to the absence of env SA, which is known to stabilize RNA. sBG-6 and sBG-7 had the same amount of vRNA but the titer of sBG-7 was 4-5 times lower; here again sBG-7 did not have the env SA. sBG-5, containing the inhibitory region of gag, had higher vRNA, but lower titers.
Overall, the amount of BG vRNA packaged in viral particles correlated with the transduction/infectious titers in target cells, despite high levels of mRNA produced in packaging cells with all 10 vectors. The p24 activity was similar in all the concentrated virus preparations (
Titers of the standard LV carrying BG are low to begin with, and require extensive concentration. However, the titers fall precipitously (by three orders of magnitude) with the removal of LV cis-elements. Perhaps these LV sequences protect large vRNA from degradation in packaging cells while promoting assembly, while the short GFP vRNA gets efficiently packaged without such requirements. The low titer of the ‘gutted’ BG LV are not from anti-sense RNA arising from the β-globin gene promoter inserted in the reverse orientation with respect to the 5′LTR vRNA transcript in 293T cells. There was no antisense transcript in the northern blot with any of the vectors. Besides, β-globin transcripts are erythroid-specific, and are not produced in 293T cells. Furthermore, the FIG cassette that was similar in size to BG, but in sense orientation also had the same effect on titers as BG.
Several unique, rather unexpected results emerged from this study: (i) in packaging cells, large amounts of transcripts were produced with all BG LV in contrast to barely detectable RNA with BG γRV. One possibility is that LV minimal sequences (R, U5 and Ψ regions) confer stability to BG vRNA in specific sub-cellular compartments. Therefore, high amounts of vRNA are seen in 293T cells even from the gutted LV, an essential difference from the BG γRV. (ii) BG vRNA was of the expected size and efficiently exported into the cytoplasm even in the absence of Rev/RRE, contradicting the belief that the success of ‘ globin genes’ in LV is secondary to the archetypal functions of RRE of preventing splicing and vRNA export. (iv) vRNA was efficiently packaged into virions when the gutted LV encoded a small transgene such as GFP. This data confirms LV cis-sequences, other than the minimal packaging sequence, are dispensable for small transgenes.
Rev/RRE interaction was most critical for packaging and high titer virus production, while the well-established function of Rev/RRE in the export of the genomic vRNA and suppression of spliced message was not prominent in BG LV. In wild type HIV virus, the presence of Rev/RRE is required along the entire mRNA transport and utilization pathway for the stabilization, correct subcellular localization, and efficient translation of RRE-containing mRNA. The data presented here confirms and extends a recent study that shows that RRE had a minor effect on cytoplasmic vRNA levels, but reduced viral titers approximately 100-fold. It further shows that Rev/RRE requirement is specific for large transgenes, but dispensable for small expression cassettes. Unlike a previous report in the literature, the present research did not see a role of RRE in vRNA stabilization, since equal or higher amounts of vRNA was seen with vectors without RRE. The likely mechanism is the capacity of RRE to be involved in viral assembly and packaging.
Presence of the env SA has been shown to stabilize the viral genome, resulting in a higher virus production. Presence of SA may also stabilize the vRNA at a post-entry level, since some vectors without the env SA, when compared to analogous vectors with the env SA had the same v-RNA but had lower transduction/titer in target cells. The gag sequence, with a start codon mutation to prevent the translation of the gag protein, helps the production of LV during viral packaging. In this study it was determined that this requirement was specific to large transgene cassettes. It was also demonstrated that removal of an inhibitory sequence present between 414 bp and 631 bp of the gag gene that has been previously shown to decrease the stability of gag-containing RNAs, increased titers by 3.5-fold.
In conclusion, this research describes the steps in the viral life-cycle affected by the non-coding cis-sequences when LV encodes large transgene cassettes; and their dispensability for smaller transgenes such as GFP. These results provide new insight in the design of LV vectors. Gutted/minimal LV could be designed for small therapeutic transgenes, which would be less recombinogenic and safer in gene therapy applications.
LV: To clone the sSIN-GFP vector, the 3′LTR of a standard SIN-LV backbone previously used was modified to improve transcript termination: β-growth hormone polyadenylation signal was added downstream the 3′LTR and a USE sequence derived from SV40 late polyadenylation signal was added in the U3 deletion. The dsSIN-GFP was obtained by removing the ClaI-NruI fragment from the sSIN-GFP plasmid. A multi-cloning site (MCS-ClaI-Eco47III, XhoI, SmaI, SalI, EcoRI: CCATCGATAGCGCTCTCGAGCCCGGGGTCGACGAATTCC) was cloned in the ClaI and EcoRI sites of sSIN. The β-globin-LCR (BG) cassette was cloned in reverse orientation into the XhoI and SmaI sites and this parent construct was termed sSIN-BG. sBG-0 was obtained removing the region between Eco47III and NruI, leaving behind only HIV-1 packaging sequence (ψ) following the 5′LTR from sSIN-BG. cPPT was cloned into sBG-0 ClaI site (sBG-1). PCR fragments for RRE, RRE-env, short gag (360 bp), long gag (630 bp) were cloned in XhoI blunted site, and these vectors were termed sBG-2, sBG-3, sBG-10, sBG-9, respectively. Primers sequences, where F denotes forward primers and R denotes reverse primers:
A frame-shift mutation was inserted in the 5′ sequence of gag in the start codon to disable the gag start site, using the primer Gag F that inserts the dinucleotide CA in the gag ATG. Vectors sBG-7 and sBG-8 were obtained cloning long gag and short gag PCR fragments into XhoI site of sBG-2. A point mutation to disrupt the SA site in the env sequence was performed using MutSA_F (TATCGTTTCGAACCCACCTCC) and MutSA_R (GGAGGTGGGTTCGAAACGATA) primers to generate sBG-4 (the wt SA sequence CAG inside the Env fragment was mutated into CGA). sBG-5 was obtained cloning the long gag PCR fragment into the XhoI site of sBG-3. γRV: SRS11.SF γRV plasmid was kindly provided by Drs. Axel Schambach and Christopher Baum, (Hannover, Germany). In SRS11.BG vector, the human β-globin-LCR (BG), was cloned in reverse orientation into the PstI site of SRS11.SF retroviral vector plasmid. All vector cartoons are depicted in
LV was produced by transient co-transfection of 293T cells, as previously described using the vector plasmids, the packaging (Δ8.9) and the envelope (VSV-G) plasmids; virus-containing supernatant was collected at 60 hours after transfection and concentrated by ultracentrifugation. All vectors in an experiment were packaged simultaneously and the virus was concentrated 1400-fold from all viral supernatants by ultracentrifugation at 25,000 rpm. Viral titers were determined by infecting mouse erythroleukemia (MEL) cells or HT1080 cells with serial dilution of concentrated virus, differentiating them, and analyzing them for HbA or GFP expression by fluorescence-activated cell-sorter (FACS) as previously described. γRV were produced similarly but not concentrated. All transfections and subsequent titration were performed in triplicate. Packaging of vectors, with and without Rev, was performed following a similar method, except that the packaging plasmid Δ8.9 was replaced with pMDLg/pRRE and pRSV-Rev. The ratio of vector plasmid:pMDLg/pRRE:pRSV-Rev:VSV-G was 4:4:3:1.
Murine erythroleukemia cell (MEL) line and 293T cells were maintained in Dulbecco modified Eagle Medium (DMEM, Mediatech, Inc., Herndon, Va.) supplemented with 10% heat inactivated fetal bovine serum (FBS) (U.S. Bio-technologies, Inc, Parker Ford, Pa.). MEL cells were induced to differentiate in DMEM containing 20% FBS and 5 mM N,N′-hexamethylene bisacetamide (Sigma), as previously described in the art.
The methodology used to label human β-globin using the anti-human HbA antibody was as previously described. Briefly, cells were fixed in 4% paraformaldehyde for 60 minutes at room temperature, washed once with phosphate-buffered saline (PBS), and the pellet resuspended in 100% methanol for 5 minutes. The fixed cells were then washed with PBS, and nonspecific antibody (Ab) binding was blocked using 5% nonfat dry milk for 10 minutes at room temperature. Subsequently, cells were washed in PBS, pelleted, and permeabilized. The cells were divided into 2 tubes and stained with either anti-zeta globin-fluorescein isothiocyanate (FITC) Ab (1 μg/106 cells) as a negative control or anti-HbA-FITC Ab (0.1 μg/106 cells) (Perkin Elmer, Waltham, Mass.) for 30 minutes at room temperature in the dark. Unbound Ab was removed by a final wash with PBS before they were analyzed on FACS Calibur (Becton Dickinson, Franklin Lakes, N.J.).
293T cells were harvested and washed in PBS 72 hours after transfection. Isolation of nuclear and cytoplasmic RNA is obtained with a 7 minutes incubation on ice with NEB buffer (10 Mm Tris-HCl pH 7.4; 10 mM NaCl, 3 mM MgCl2; 5% IGEPAL). After centrifugation RNA-STAT (Tel-Test, INC, Texas) was added to the supernatant that contains cytoplasmic RNA, and proceeded with RNA extraction following manufacturer's instructions. Total RNA was extracted from 293T cells using RNA-STAT. Northern Blot was then performed according to standard protocol. The blot was hybridized with a 32P labeled β-globin probe. To normalize the loading of the RNA, membranes were then stripped and re-probed with a 32P labeled 18S probe. To test the purity of cytoplasmic RNA membranes were stripped and re-probed with a 32P labeled probe specific for GAPDH intron probe that detected no intronic transcript in the cytoplasmic preparation.
Genomic DNA was performed on DNA isolated from transduced MEL cells and 10 μg of genomic DNA was digested with AflII enzyme and Southern Blot performed according to standard protocol. The blot was hybridized with a HS2 fragment of the β-globin LCR probe. RNA dot blot vRNA was extracted from same volumes of concentrated viruses using the QIAamp vRNA Mini Kit (Qiagen) following the manufacturer's instructions. Briefly the virus was lysed under highly denaturing conditions and then bound to a silica-gel-based membrane. Two washing steps efficiently washed away contaminants and vRNA was eluted in 30 μl of DEPC-water. After elution vRNA was treated for 20 min at room temperature with DNAse I, amplification grade DNase I (Invitrogen, Carlsbad, Calif.) was inactivated by incubating the sample at 65°. vRNA was then denatured in 3 vol of denaturation buffer (65% formamide, 8% formaldehyde, MOPS 1×) for 15 min at 65°. After denaturation 2 vol. of ice-cold 20×SSC were added and the RNA was bound to a nylon membrane by aspiration through a dot-blot apparatus. The blot was hybridized with a 32P labeled β-globin specific probe and an X-ray film was exposed overnight.
Chromatin insulators separate active transcriptional domains and block the spread of heterochromatin in the genome. Studies on the chicken hypersensitive site-4 (cHS4) element, a prototypic insulator, have identified CTCF and USF-1/2 motifs in the proximal 250 bp of cHS4, termed the “core”, which provide enhancer blocking activity and reduce position effects. However, the core alone does not insulate viral vectors effectively. The full-length cHS4 has excellent insulating properties, but its large size severely compromises vector titers. A structure-function analysis of cHS4 flanking lentivirus-vectors was performed and transgene expression in the clonal progeny of hematopoietic stem cells and epigenetic changes in cHS4 and the transgene promoter were analyzed. The core only reduced the clonal variegation in expression. Unique insulator activity resided in the distal 400 bp cHS4 sequences, which when combined with the core, restored full insulator activity and open chromatin marks over the transgene promoter and the insulator. These data consolidate the known insulating activity of the canonical 5′ core with a novel 3′ 400 bp element with properties similar to the core. Together, they have excellent insulating properties and viral titers. This data has important implications with respect to understanding the molecular basis of insulator function and design of gene therapy vectors.
Self-inactivating lentivirus vectors were designed to incorporate either the 5′ 250 bp “core” (sBGC), two tandem repeats of the core (sBG2C), 5′ 400 bp (sBG400), 5′ 800 bp (sBG800) or the full-length 1.2 Kb cHS4 insulator (sBG-I). All vectors carried the human (h)β-globin gene and promoter and the locus control region enhancer. The different insulator fragments were cloned in the forward orientation into the U3 region of 3′ LTR, so that upon reverse transcription, integrated provirus in target cells has the insulated 3′ LTR copied to the 5′LTR, and flanks the hβ-globin expression cassette at both ends. To assess whether elements outside the 5′ 250 bp core merely provided a spatial scaffold, vectors with inert DNA spacers downstream of the core, sBG400S and sBG800S, were also tested. All vectors were compared to the uninsulated control, sBG (
First, MEL cells were infected with each of the lentivirus vectors and single integrant MEL clones were identified (
Consistent with previous results, a very high % of hβ+ cells were present in the sBG-I single-integrant clones compared to control sBG clones (P<0.01); the % of hβ+ cells in sBGC, sBG2C, sBG400 and sBG800 clones were not significantly different from the sBG control clones (
Another phenomenon seen with transgene expression is clonal variegation, defined as varying levels of expression in daughter cells with the same integration site. A quantitative way to determine clonal variegation is by FACS analysis of transduced clones and calculation of the coefficient of variation (CV) of expression of the transgene around the average expression of the transgene in the clone. The CV is a unit-less measure of variability calculated as ratio between sample standard deviation (SD) and the sample average. A high CV was observed in the uninsulated sBG clones (
It was notable that PCR for insulator sequences showed absence of the insulator sequences only in sBG2C proviruses, with 6 of 24 clones (25%) MEL clones having both copies of the core deleted from both LTRs. There was no observed deletion of the insulator sequences in clones from all other vectors. Southern blot analysis of sBG2C MEL pools confirmed deletion of one/both copies of the core in the majority of cells. Reverse transcription of repeat sequences, known to result in recombination events in retroviral vectors likely caused unstable transmission of the vector with repeat core sequences. This effect of the core versus the full-length cHS4 was confirmed in vivo, in thalassemia mice. Peripheral blood RBC were analyzed for hβ-globin expression 6 months following transplant. FACS analysis in RBC from sBG, sBGC, sBG2C, sBG400 and sBG-I groups of mice (representative plots shown in
The chromatin position effects were next confirmed in single copy secondary CFU-S. The secondary colony forming units-spleen (CFU-S) assay is considered the most stringent assay that is a ‘gold-standard’ for studying epigenetic effects of chromatin insulator elements in cells derived from hematopoietic stem cells. Notably, no transduced CFU-S that was positive by PCR for vector-specific sequences that did not express hβ-globin by FACS were observed, consistent with results reported on lack of transgene silencing with erythroid-specific SIN lentivirus vectors. FACS analysis for (1) % hβ+ cells and (2) TER-119 positive erythroblasts showed no difference in the percentage of TER-119+ cells between different vector groups (not shown). However, significantly higher % of hβ+ cells were only present in secondary CFU-S with the sBG-I vector. Again, the CV was significantly lower in CFU-S transduced with all the vectors carrying the core, compared to uninsulated sBG transduced CFU-S (
Next the epigenetic modifications that accompany the specific effects seen with the various insulator regions were determined by comparing the relative levels of active histone marks acH3, acH4 and H3K4me2 and repressive histone marksH3K9me3 and H3K27me3 between different proviruses in MEL clones. ChIP analysis was performed on the cHS4 core in three representative clones that were pooled together for each vector (clones chosen are shown as filled circles in
Histone modifications were analyzed over the hβ-globin promoter in the uninsulated vector (sBG) and all other vectors, which carried the “core”, to assess whether differences in histone patterns over the transgene promoter in vectors may have contributed to the reduced clonal variegation. There was a small but significant reduction in repressive chromatin patterns H3K27me3 with sBGC, sBG400 and sBG800 proviruses, compared to the uninsulated sBG provirus (
These data show that the “core” sequences and extension of the core up to the 5′ 800 bp of cHS4 reduced activation marks over the transgene promoter to a small extent. However, a major reduction in repressed histone modifications over cHS4 and the transgene promoter region only occurred when the distal 3′ 400 bp sequences of cHS4 were present in addition.
The anemia, reticulocytosis and other RBC indices were improved even with the sBG vector (
HPLC analysis for hβ-globin protein in blood confirmed significantly higher hβ-globin expression only in the sBG-I mice: 43±3% of the total hemoglobin in RBC was derived from hβ-globin (hβ2mα2) in sBG-I mice as compared to 19±6% in the sBG mice, while that in sBGC, sBG400 and sBG2C group of mice was not significantly different from control (
Since the 5′ 800 bp of cHS4 only reduced the CV, while full insulator activity was restored with the full-length 1.2 Kb insulator. A vector was generated carrying only the distal/3′ 400 bp region of the cHS4 (sBG3′400) derived MEL clones and mice were transplanted with sBG3′400-transduced LSK cells. Note that unlike vectors described earlier, this vector does not contain the 5′250 bp “core” sequences (
The amount of hβ-globin protein in the sBG3′400 mice, determined by HPLC analysis, was not significantly different from sBG (17.5±3% versus 19.5±5.6%), but was at least 2-fold lower than that seen in the sBG-I mice (43±3%; P<0.01) (
When the 5′ 250 bp core and the 3′ 400 bp sequences of cHS4 insulator (sBG650 vector;
The chromatin configuration of the distal 3′ 400 bp portion of cHS4 have not been previously studied. The histone patterns were first analyzed over the 3′ 400 bp region (sBG3′400) when present alone (sBG3′400), or when in combination with the 5′ core (in sBG650 and sBG-I) (
The 3′ 400 bp region, however, has no known CTCF or USF-1 motifs, that have been shown to impart enhancer blocking and barrier activity, respectively, to cHS4. It is conceivable; however that CTCF and/or USF-1 may perhaps be recruited to the 3′400 region. Using antibodies to USF-1 and CTCF, chromatin was immunoprecipitated from sBGC, sBG3′400, sBG650 and sBG-I proviruses from MEL clones. ChIP analysis was performed using semi-quantitative PCR and qPCR. When primers to the core region were used to amplify ChIP products, CTCF and USF-1 recruitment to the 5′ core region was evident (
The 1.2 Kb cHS4 remarkably lowers titers of SIN-lentivirus vectors, limiting large-scale virus production for human trials. It has been recently shown that the mechanism of reduction in titers is specifically due to the length of the insert in the 3′LTR. Compared to sBG, sBG650 had very reasonable titers that were only 2.5±0.9 fold lower than sBG, in contrast to 10.4±2 fold lower titers of sBG-I (n=3). Therefore, this optimized insulator can be used for the design of safer gene therapy vectors which would provide uniform and therefore higher expression and be scalable to large-scale production.
The full-length cHS4 insulator has been previously shown by us and by others to protect viral vectors against chromosomal position effects. The profound deleterious effects on viral titers however, have precluded its utility. Attempts to use only the 5′ 250 bp of cHS4, characterized to be the core of the insulator, have failed in viral vectors despite significant activity of the core in plasmid based systems, and loss of insulator activity with mutations in these regions.
Regions surrounding the cHS4 insulator and β-globin promoter have been shown to constitutively higher marks of active chromatin in the native location. The cHS4 prevents the spread of heterochromatin to the β-globin domain, even when adjacent heterochromatin domains have high repressive histone marks, H3K9me3 and H3K27me3. Clones carrying the sBG-I vector integrants showed an enrichment of the active chromatin marks and a striking decrease in repressive chromatin marks over the cHS4 core compared to sBGC, sBG400 and sBG800 vectors, where no significant differences in these epigenetic marks were observed.
Mechanistically, the USF-1/2 element in the insulator has been shown to recruit histone modifying enzymes to the core, and interact with histone lysine methyl transferase SET7/9 and p300/CREB-binding protein-associated factor (PCAF), thus increasing active chromatin marks. However, No such increase was observed in acH3, acH4 and H3K4me2 over the core or the 3′ 400 bp when they flanked the transgene in the sBGC, sBG400, sBG800 and sBG3′400 vectors. This effect required the vector carrying the full length cHS4 (sBG-I,
Models proposed to explain the effect of the cHS4 on surrounding chromatin include protection against transgene silencing by exclusion of methyl-CpG-binding proteins; indeed, cHS4 has been shown to block silencing by retroviral vectors. No extinction of β-globin expression over time was observed, even with the uninsulated vector in mice, or MEL clones maintained up to 6 months in culture (data not shown) This may be due to several USF-1 elements in the β-globin LCR hypersensitive sites, that have been shown to interact with the E-box elements located in HS2 and in the β-globin gene promoter. It is conceivable that this resistance to silencing conferred by the LCR may override any activity seen with the cHS4 core. These results contrast those by Panell et al that retroviruses including those derived from HIV-1, dominantly silence a linked locus control region (LCR) beta-globin reporter gene in transgenic mice. Methylation was analyzed and it was subsequently reported that there was a lack of CpG methylation and extinction in expression with erythroid-specific SIN-lentivirus vectors in vivo, in primary and secondary recipients. This data suggests that in erythroid vectors, which otherwise resist silencing via promoter methylation, the full-length cHS4 was able to modify the histone patterns over the transgene promoter, and over itself to reduce position effects.
Intriguingly, the in silico analysis of the 3′ 400 bp region revealed no CTCF or USF1 binding sites, but sites for multiple known transcription factors. Any of these transcription factors, or perhaps a novel protein may be the interacting partner with the CTCF and/or USF-1. CTCF directly regulates the balance between active and repressive chromatin marks via binding to the cohesin complex. This data reveals that the 3′ 400 bp region can also interact with CTCF: although co-immunoprecipitate the 3′400 bp and CTCF from the sBG3′400 provirus (
Interestingly, the 3′400 bp co-immunoprecipated with USF-1 antibody only when the 5′ core sequences were additionally present, suggesting that USF-1 likely forms a bridge between the 5′ and 3′ end of cHS4 to reduce position effects. Whether elements within the 3′ 400 bp recruit histone acetylases that bind USF-1 or cohesin and/or nucleophosphmin complexes to affect position effects would be important to determine.
Ultimately, a systematic genetic and epigenetic analysis of insulator activity of the cHS4 in vitro and in vivo was performed and novel “core-like” activity in the 3′ 400 bp was identified. The 3′ 400 bp of cHS4, which contains no consensus sites for USF or CTCF, nevertheless binds CTCF, while USF-1 appears to bind and bridge the 5′ core and the 3′ 400 bp of cHS4. New vector systems flanked by the optimized ‘650 bp’ cHS4 sequence, can provide excellent insulation of the transgene without significant loss in viral titers and have important safety and efficacy implications for gene therapy.
All vectors were obtained by cloning the different insulator fragments into NheI/EcoRV sites in the U3 3′LTR region of the lentivirus plasmid, as described. This plasmid carried the human (h)β-globin gene and its regulatory elements (BG). All insulator fragments were amplified by PCR using the insulator plasmid pJCI3-1 (kindly provided by Dr. Gary Felsenfeld, NIH, MD) and verified by sequencing, as described. Cloning of the hβ-globin vector with and without the 1.2 kb cHS4 insulator has been described previously. The sBG1C vector was cloned by inserting EcoRI/XbaI 250 bp core insulator PCR product into sBG into BamHI/EcoRI restriction sites of the pBS plasmid. A second copy of the 250 bp core was then added into the pBS 1-core plasmid into EcoRI/KpnI sites, thus obtaining the pBS 2-core plasmid. The two tandem copies of the 250 bp core were then isolated digesting the pBS-2core plasmid with KpnI/XbaI, and then cloned into the sBG vector, obtaining sBG2C. The sBG400 and sBG800 vectors were obtained by cloning the 2 PCR products into the sBG NheI/EcoRV sites. The vectors containing DNA spacers were obtained amplifying different sizes of λ-phage DNA using the following primer combinations: spacerF1 and spacerR1, spacerF1 and spacerR2, amplifying 150 bp, 550 bp X-DNA, respectively. ClaI/EcoRI digested PCR fragments were ligated into EcoRI/ClaI sites in the pBS-1 core plasmid, and 400 bp and 800 bp fragments from the pBS-1 core plasmid were restricted with HincII/XbaI and XbaI/XhoI, respectively, and cloned into NheI/EcoRV sites of sBG. Virus was produced by transient co-transfection of 293T cells and titrated on MEL cells.
MEL cells and 293T cells were maintained in DMEM (Mediatech, Inc) supplemented with 10% heat-inactivated fetal bovine serum (FBS; U.S. Bio-technologies, Inc.) and differentiated as described. MEL cells were transduced to achieve less than 5% transduction efficiency for each of the vectors tested and cloned. Approximately 400 clones, derived from three independent transductions from each vector were screened by PCR for hβ-globin gene; positive clones were screened for an intact insulator region. Clones thus identified were then subjected to qPCR for single integrants, expanded and cryopreserved. An entire set of clones was thawed, differentiated and analyzed concurrently by FACS.
Hbbth3/+ thalassemia mice were used for transplants. All animal studies were done using protocols approved by the Institutional Animal Use and Care Committee. Enrichment of lineage-Sca-1+c-kit+ (LSK) hematopoietic stem/progenitor cells was performed on single cell suspension of bone marrow by immunomagnetic separation and FACS sorting (details in supplementary Materials and Methods S1) LSK cells were transduced in Stem Span (Stem Cell Technologies Inc, Vancouver, BC) with concentrated vector supernatants at an MOI of 10, twice at 12 h intervals as previously described. 10,000 transduced LSK cells were co-transplanted with 2×105 LK cells into 10.75Gy irradiated thalassemia recipients. CFU-S assay: Discrete spleen colony forming units (CFU-S) were dissected at day 12 after transplant of bone marrow cells from primary mice 24 wk after transplant, as described earlier.
Complete blood counts were performed on a Hemavet (Drew Scientific, Inc, Oxford, Conn., USA). Reticulocyte count was analyzed by staining 1 μl of whole blood with 200 μl of Retic-COUNT reagent (BD Biosciences, CA) and enumerated on the FACSCalibur (BD). Quantitative analysis of hβ-globin protein in RBC was performed on hemolysates of blood by high performance liquid chromatography (HPLC), as previously described and mRNA analysis quantified by real-time RT-PCR using validated primers and probes specific to hβ-globin (ABI Biosystems) using murine a-globin for normalization. FACS analysis following intracellular staining for hβ-globin was done as described before.
ChIP analysis was performed on MEL clones as described with minor modifications. Briefly, DNA samples from input and antibody-bound chromatin fraction were analyzed by qPCR using SYBR green (Applied Biosystems) using primer sets in triplicate, and data analyzed as previously described. The enrichment ratio was determined by calculating the ratio of DNA-ChIP to DNA-input and histone modification data normalized to the “no antibody” (IgG) control and primers corresponding to the necdin 5′ region and promoter region, as controls for repressed chromatin, to normalize the efficiency of immunoprecipitation. All the DNA-ChIP to DNA-input ratios were calculated as: 2[Ct (Input)−Ct (ChIP)] divided with [dilution rate (ChIP)/dilution rate (Input)]. Ct values of all PCR products were determined by the SDS 1.2 software (Applied Biosystems). Mean and SEM values were determined for the fold difference, and two-tailed paired t tests to determine statistical significance (p<0.05).
Ligation-mediated (LM) polymerase chain reaction was performed as described by Modlich et al to map integration sites using primers and conditions described (Arumugam, Mol Ther 2009, in press citation).
Vectors were compared to the sBG vector Student's ‘t” test (unpaired and two tailed). ANOVA (Dunnett multiple comparison test) was also performed between groups for multiple comparisons. Data was expressed as mean±SEM. P<0.05 was considered significant.
Self-inactivating lentiviruses flanked by the 1.2 Kb chicken hypersensitive site-4 insulator element (cHS4) provide consistent, improved expression of transgenes, but have significantly lower titers. Lengthening the lentivirus transgene cassette by an additional 1.2 Kb by an internal cassette caused no further reduction in titers. However, when cHS4 sequences or inert DNA spacers of increasing size were placed in the 3′LTR, infectious titers decreased proportional to the length of the insert. The stage of vector life-cycle affected by vectors carrying the large cHS4 3′LTR insert was compared to a control vector: There was no increase in read-through transcription with insertion of the 1.2 Kb cHS4 in the 3′LTR. Equal amount of full-length viral mRNA was produced in packaging cells and viral assembly/packaging was unaffected, resulting in comparable amounts of intact virus particles produced by either vectors. However, lentiviruses carrying cHS4 in the 3′LTR were inefficiently processed following target-cell entry, with reduced reverse transcription and integration efficiency, and hence lower transduction titers. Therefore, vectors with large insertions in the 3′LTR are transcribed and packaged efficiently, but the LTR insert hinders viral-RNA processing and transduction of target cells. These studies have important implications in design of integrating vectors.
One objective of the study was to determine if reduction in titers by cHS4 was secondary to additional lengthening of the viral genomes in the otherwise large hp-LCR (BG) lentivirus vector. Large viral RNA genomes are known to be packaged less efficiently in integrating vectors. Replication competent gamma-retroviruses delete added sequences and recombine to revert back to their original viral size. In gamma-retrovirus vectors that exceed the natural size of the virus, reduction in titers occurs at multiple steps of the viral life cycle—generation of full length genome, viral encapsidation/release and post-entry recombination events. Notably, BG lentiviruses contain transgene inserts of ˜7 Kb, and therefore do not produce viral-RNA genomes larger than the natural size/packaging capacity of the wild type HIV-1 virus. In lentivirus vectors, however, lowering of viral titers from transgene inserts 6 Kb or larger has been shown to occur from reduced packaging efficiency.
Uninsulated vectors BG and BGM were recently compared with analogous insulated vectors BG-I and BGM-I for position effects. The BG lentivirus vector carries the hβ and LCR, while a similar vector BGM additionally carries a PGK promoter driven methylguanine methyl transferase (P140K) cDNA (PGK-MGMT) insert downstream of the hp-LCR. The PGK-MGMT cassette is 1.2 Kb in size. The BG-I and BGM-I vectors carry the 1.2 Kb cHS4 insulator in the 3′LTR in addition. Virus was produced and processed identically from all four vectors and infectious titers were determined, as previously described. The titers of the concentrated BG vector were 2±0.5×108 IU/mL, while that of BGM, carrying an additional 1.2 Kb internal cassette were slightly higher at 5±0.8×108 IU/mL (n=4). In contrast, addition of the 1.2 Kb cHS4 in the 3′LTR to the BG vector, termed BG-I resulted in reduction in titers by nearly 6-fold to 3.8±0.8×107 IU/mL. A further addition of a 1.2 Kb PGK-MGMT internal cassette to the BG-I vector, termed BGM-I, did not reduce the titers any further (
Although the LV vectors used did not exceed the natural size of the HIV-1 virus, the size of the cHS4 insert (1.2 Kb) exceeded the natural size of the wild type LTR (note that the wt LTR carries an additional 400 bp U3 enhancer, which is deleted from the self-inactivating 3′LTR). Experimentation was conducted to determine whether lowering of viral titers was due to lengthening of the SIN LTR beyond its natural capacity (400 bp), or whether titers were lower due to specific sequences in the insulator, which may potentially affect viral-RNA folding/binding to cellular proteins and thus limit packaging. A series of p-globin vectors were constructed in a self-inactivating lentivirus backbone, sSIN, carrying different length fragments of cHS4 in the 3′LTR (
Virus was generated from sBG, sBGC, sBG400, sBG2C, sBG800, sBG-I plasmids by concurrent transient transfections and concentration, and titered by flow cytometry of mouse erythroleukemia (MEL) cells infected with serial dilutions of the viruses, as described. MEL cells support adult type globin production. Each experiment was replicated four times.
It was determined that as the size of the cHS4 insert in the 3′LTR increased, viral titers dropped (
To ensure that reduction in titers was not from specific cHS4 sequences but an effect of the size of the LTR insert, three additional vectors were constructed, sBG400-S, SBG800-S and sBG1200-S. These vectors were analogous to sBG400, sBG800 and sBG-I, except that they contained spacer elements from the 2 phage DNA downstream of the cHS4 core to generate 3′ LTR inserts of 400 bp, 800 bp and 1.2 Kb, respectively (
In order to detect if recombination events occurred in the LTRs from insertion of 2 copies of the core or different size fragments in the LTR, ˜12-20 MEL cell clones transduced with the entire series of insulated vectors (sBGC, sBG400, sBG2C, sBG800 and sBG-I) were generated. All clones that had a single copy of integrated provirus were identified using qPCR, as previously described. The 250 bp core from the genomic DNA of each clone was then amplified, by a standard PCR. The insulator core sequences could be amplified from clones derived from all vectors except those derived from sBG2C transduced cells. In sBG2C MEL clones, the insulator core was undetectable in 6 of 24 (25%) single copy clones by PCR, suggesting deletion of both tandem repeats of cHS4 core sequences in the 5′ and 3′ LTR of the provirus (
Large viral genomes in RNA vectors have been shown to be limited at the level of RNA packaging. In the present study, there was no effect on titers with increasing the virus payload by 1.2 Kb, but titers decreased with increasing length of the insert in the LTR. Next, the mechanism by which this affected viral titers was explored. The following steps in the viral life cycle were studied: 1) characteristics of viral-RNA produced in packaging cells, 2) virus particle production, 3) post-entry steps: reverse transcription, nuclear translocation, integration and proviral integrity. For all of these studies, the vector with the largest insert, sBG-I was compared to the vector without the insulator, sBG.
Northern blot analysis was performed on RNA derived from the 293T packaging cells after transient transfection with sBG, sBG-I vector plasmids, along with packaging plasmids (D8.9 and VSV-G). The blot was probed with hp fragment.
Experimentation was conducted to determine if the cHS4 insert upstream of the viral polyadenylation signal in the LTR could impair transcript termination of the viral RNA. Read-through transcripts have been shown to be excluded from encapsidation, and can lower viral titers. Although the northern blot in
Plasmid constructs were cloned, in which the wild type HIV-1 LTR, the SIN HIV-1 3′LTR with or without the insulator (from sBG-I or sBG vectors, respectively) were placed downstream of EF1-α promoter. A promoter-less IRES-cre cassette was placed downstream of the LTRs, so that cre expression would occur only from transcriptional read-through from the LTR. An EF1a-IRES-cre plasmid served as a positive control. Equal amounts of these plasmids were transfected into the reporter cell line, TE26, which expresses β-galactosidase proportional to cre expression. A GFP plasmid was co-transfected with the read-through plasmid constructs to normalize β-galactosidase activity for transfection efficiency. A plasmid carrying the truncated rat nerve growth factor receptor served as a negative control. A standard curve was generated that showed a linear correlation of the amount of the positive control IRES-cre plasmid transfected into cells and the β-galactosidase activity measured by spectrophotometer. No significant increase was observed in β-galactosidase activity from transfected constructs containing the insulated SIN lentivirus LTR, as compared to those carrying the SIN LTR without the cHS4 insulator. The results from the β-galactosidase assay were identical when confirmed by Lac-Z staining of TE26 cells plated on cover slips. These results showed that the insertion of cHS4 element upstream of the viral polyadenylation signal did not increase read-through transcription from the LTR.
To determine whether viral-RNA was encapsidated effectively into virions, p24 levels, virus associated reverse transcriptase (RT) activity and viral-RNA levels (
The present results with large inserts into the LTR are in contrast to those by Sutton and colleagues where lentivirus vectors with lengthened internal transgene cassettes are inefficiently packaged into virions. Equal amounts of virus particles produced from the sBG and sBG-I vectors, but significantly lower infectious/transduction titers suggests a post-entry block of large LTR insert bearing viruses, resulting in less integrated units.
Post-entry steps were investigated; including reverse transcription, nuclear translocation, integration and proviral integrity. Reverse Transcription: the steps of reverse transcription, location of qPCR primers and probes and the viral DNA products are summarized in
To assess reverse transcription efficiency, MEL cells were infected with equal amounts of sBG and sBG-I viral particles, based upon p24 levels, and cells collected at different time points post infection. Absence of plasmid contamination was confirmed by a qPCR for the ampicillin resistance gene present in the plasmid backbone (data not shown). Kinetics of early reverse transcription (production of −sssDNA) were studied using primers and probe spanning the R/U5 region (
It is conceivable, however, that when RT switches templates (minus strand jump) to reverse transcribe the 3′ LTR, alteration of secondary structure from the presence of an insert in the U3 region would reduce reverse transcription products. Quantitative PCRs amplifying the U3/R and ψ regions were performed to quantify the amount of intermediate and late reverse transcribed viral cDNA in cells infected with sBG and sBG-I vectors, respectively (
Nuclear translocation: After the viral DNA is synthesized in the cytoplasm, it is translocated into the nucleus of infected cells, where it can be found as linear DNA or circular DNA (1-LTR and 2-LTR circles) (
In order to detect the nuclear translocation, the amount of 2-LTR circles in both vectors were analyzed using a qPCR on DNA from infected MEL cells at different time points in sBG versus sBG-I infected cells. As shown in
Integration: It is also conceivable, however, that two copies of large U3 inserts provide a template for homologous recombination, and the rate of homologous recombination between the two LTRs prior to integration increases, resulting in more 1-LTR circles and reduced 2-LTR circles (as proposed in the cartoon in
It is conceivable that the integration machinery is also directly affected by the presence of foreign sequences in the LTR. Therefore, sBG and sBG-I viruses were packaged using an integrase defective packaging plasmid, so that effect of the insulator on reverse transcription, nuclear localization, and 1LTR circle formation could be studied independent of integration. The same analysis was performed as with active integrase containing viruses: a q-PCR to study the late reverse transcription product (using psi primers), 2LTR circles and a genomic Southern blot analysis to determine 1LTR circles and other forms of viral cDNA. The results were identical to those seen with sBG and sBG-I packaged with active integrase (shown in
Finally, the integrated sBG and sBG-I provirus were analyzed for stability of transmission and efficiency of integration. The Southern blot analysis in
The overall reduced viral integration was primarily from a combination of inefficient reverse transcription and increased homologous recombination that hinder the availability of proviral DNA for integration. Since insulators are important for generating viral vectors that would be safe and provide consistent predictable expression, it is important to find a solution to the problem of low viral titers with insulated viruses. One way to overcome the problem would be to flank the internal expression cassette with cHS4 on either end, since further lengthening of the internal cassette did not decrease titers. However, this approach was not tried because repeat elements within retroviruses are known to result in recombination. Since HIV RT is known to have low processivity and frequently dissociate from its template, an attempt was made to increase the amount of RT delivered per vector particle, to assess if that would improve reverse transcription from large LTR inserts. RT was co-packaged in the virions as vpr-RT fusion protein. No significant increase in titers was observed when providing more RT in the virion. The next step was an attempt to increase the integrase (IN) per virion using the same strategy, and copackaged RT-IN-vpr fusion protein in the virion. There was a slight increase in titers providing RT-IN in the viral particle, but the difference was not significant.
Next, a detailed structure-function analysis of the 1.2 Kb cHS4 insulator was performed and a defined 650 bp sequences were determined as the minimum necessary sequences for full insulation effect. The titers of sBG650 were 3.6×108IU/mL, compared to a titer of 8.2×108 IU/mL and 9.8×107 IU/mL of the sBG and sBG-I vectors (
Ultimately it was determined that low transduction titers were not from an increase in size of the provirus, but increased length of the 3′LTR. The quantity and quality of viral RNA genomes produced were unaffected and viral-RNA encapsidation/packaging was comparable in vectors with and without a 1.2 Kb LTR insert. Reduced viral titers occurred from post-entry steps, from inefficient reverse transcription, increased homologous recombination in the LTRs of viral DNA, making less viral DNA available for integration. Improvements in vector design were made by including smaller insulator inserts that contained essential elements necessary for optimal insulator activity.
The present studies have important implications for future design of vectors with inserts within the 3′LTR, given the usefulness of chromatin insulator elements, customized lineage specific LTR vectors or double copy vectors.
The cloning of the BG, BGM, BG-I and BGM-I vectors has been previously described. All other vectors were cloned into the sSIN backbone (details provided in Urbinati F, Xia P and Malik P, manuscript in review). All the vectors were obtained cloning the different insulator fragments into a unique Nhe I/EcoR V site was inserted in the U3 3′LTR region of the sSIN LV vector plasmid, which carried the human beta-globin gene and the hypersensitive site 2, 3 and 4 fragments, as previously described. Insulator fragments were amplified by PCR using the insulator plasmid pJCI3-1 as a template. All amplicons were sequenced following the PCR, and after insertion into the 3′LTR. The cloning of the uninsulated beta-globin vector and one that carrying the full length 1.2 Kb cHS4 insulator has been described previously. Briefly, the 1.2 Kb insulator fragment was obtained by digesting pJCI3-1 plasmid with Xba I and cloned into the Nhe I/EcoR V restriction site of sBG. sBGC was cloned inserting into sBG vector the fragment EcoR I/Xba I containing the 250 bp core from the pBS 1 core plasmid. The latter was obtained cloning the 250 bp core Insulator PCR product (using Core 1F and Core 1R primers, as described herein) into BamH I/EcoR I restriction sites of a pBS plasmid. A second copy of the 250 bp core was then added into the pBS 1 core plasmid, cloning into EcoR I/Kpn I sites the PCR product (Core 2F and Core 2R), obtaining the pBS 2 core plasmid. 2 tandem copies of the 250 bp core were then isolated digesting the latter plasmid with Kpn I/Xba I, and then cloned into the sBG vector, obtaining sBG2C. The sBG400 and sBG800 vectors were obtained cloning the 2 PCR products (using InsF and Ins400R primers and InsF and Ins800R primers, respectively) into the sBG Nhe I/EcoR V sites. sBG650 vector was obtained cloning the 3′ 400 fragment of the insulator in EcoRV/BspEI sites of sBG1c vector. The 3′ 400 fragment was PCR amplified from the plasmid pJCI3-1 using the following primers: 3′ 400 R (BspEI) and 3′ 400 F (EcoRV).
The vectors containing the λ DNA spacers were obtained amplifying different size λ phage DNA using the following primer combinations: spacerF1 and spacerR1, spacerF1 and spacerR2 and spacerF1 and spacerR3 amplifying a 150 bp, 550 bp and 950 bp λ DNA fragments, respectively. The three PCR fragments were digested with Cla I and EcoR I restriction enzymes and ligated into EcoR I/Cla I sites in the pBS-1 core plasmid, The 400 bp, 800 bp and 1200 bp fragments were digested from the pBS-1 core plasmid with HincII and XbaI for the 400 bp fragment, and with Xba I and Xho I for the remaining two fragments, and cloned into the EcoR V/Nhe I restriction sites in the sBG vector. All the vectors cloned were confirmed by sequencing. The list of all the primers is available in (
Murine erythroleukemia cell (MEL) line and 293T cells were maintained in Dulbecco modified Eagle Medium (DMEM, Mediatech, Inc) supplemented with 10% heat inactivated fetal bovine serum (FBS) (U.S. Bio-technologies, Inc.). MEL cells were induced to differentiate in DMEM containing 20% FBS and 5 mM N, N′-hexamethylene bisacetamide (Sigma), as previously described. To derive single integrant clones, transduced MEL cells were cloned and clones were screened for β-globin sequences by PCR to identify transduced clones. Single copy clones were identified by qPCR for lentivirus y-sequences, and a PCR for the cHS4 core sequences was performed on the single integrant clones to confirm presence of insulator sequences in the provirus.
The staining using the anti-human HbA antibody was as previously described. Briefly, cells were fixed in 4% paraformaldehyde for 60 minutes at room temperature, washed once with phosphate-buffered saline (PBS), and the pellet resuspended in 100% methanol for 5 minutes. The fixed cells were then washed with PBS, and nonspecific antibody (Ab) binding was blocked using 5% nonfat dry milk for 10 minutes at room temperature. Subsequently, cells were washed in PBS, pelleted, and permeabilized. The cells were divided into 2 tubes and stained with either anti-Zeta globin-fluorescein isothiocyanate (FITC) (1 μg/106 cells) as a negative control or anti-HbA-FITC (0.1 μg/106 cells) (Perkin Elmer) for 30 minutes at room temperature in the dark. Unbound Ab was removed by a final wash with PBS before they were analyzed on FACS Calibur (Becton Dickinson).
Virus was produced by transient cotransfection of 293T cells, as previously described, using the vector plasmids, the packaging (Δ8.9 or Δ8.2 for active or inactive integrase respectively) and the VSV-G envelope plasmids; virus-containing supernatant was collected at 60 hours after transfection and concentrated by ultracentrifugation. All vectors in an experiment were packaged simultaneously. Virus was treated with DNase and/or DpnI to remove plasmid DNA contamination and layered on a 20% sucrose cushion to obtain purified viral particles for specific experiments on vector life cycle indicated in the results. Virus was concentrated 1400-fold from all viral supernatants after ultracentrifugation at 25,000 rpm for 90 minutes. Viral titers were determined by infecting mouse erythroleukemia (MEL) cells with serial dilutions of concentrated virus, differentiating them, and analyzing them for HbA expression by fluorescence-activated cell-sorter scanner (FACS).
Total RNA was extracted from 293T cells using RNA-STAT (Tel-Test, INC, Texas), 72 hours after transfection. Northern Blot was then performed according to standard protocol. The blot was hybridized with a 32-P labeled β-globin probe.
Viral-RNA was extracted from same volumes of concentrated viruses using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, Calif.) following the manufacturer's instructions. Briefly the virus was lysed under a highly denaturing condition and then bound to a silica-gel-based membrane. Two washing steps efficiently washed away contaminants and v-RNA was eluted in 30 μl of DEPC-H2O. After elution viral-RNA was treated for 20 min. at room temperature with amplification grade DNAse I (Invitrogen). DNase was inactivated incubating the sample at 65°. Viral RNA was then denatured in 3 volumes of denaturation buffer (65% formamide, 8% formaldehyde, MOPS 1×) for 15 min at 65°. After denaturation 2 volumes of ice-cold 20×SSC were added and the RNA was bound to a nylon membrane by aspiration through a dot-blot apparatus. The blot was hybridized with a 32-P labeled β-globin specific probe and a film was exposed overnight. Quantification of the dots was performed with a phosphoimager (Biorad, Hercules, Calif.).
Concentrated virus (1 μL), and serial dilutions (1:10, 1:100, 1:1000) were lysed and processed following the “Reverse transcriptase (RT) assay, colorimetric” Kit (Roche) protocol. Briefly concentrated viral particles were lysed with lysis buffer and viral-RNA reverse transcribed using digoxigenin and biotin-labeled nucleotides. The detection and quantification of synthesized DNA as a parameter of RT activity followed a sandwich ELISA protocol: biotin-labeled DNA was bound to the surface of microplate modules that were pre-coated with streptavidin. In the next step, an antibody to digoxigenin, conjugated to peroxidase (anti-DIG-POD), was bound to the digoxigenin-labeled DNA. In the final step, the peroxidase substrate ABTS was added, that resulted in a colored reaction product that was quantified using an ELISA reader at a wavelength of 405 nm. The amount of colored product directly correlated to the level of RT activity in the sample.
P24 antigen concentration was determined by HIV-1 p24 Antigen EIA Kit (Beckman Coulter). Briefly, serially diluted virus was lysed and incubated onto p24 antigen coated microwells, and washed following manufacturer's protocol. Color absorbance was measured using a spectrophotometer at a wavelength of 450 nm. p24 assay was performed in duplicate.
To analyze the integrity of the provirus we infected MEL cells, expanded them for 21 days and extracted DNA using Qiagen Blood and Cell culture DNA Mini Kit (Qiagen). 10 μg of DNA was digested with Afl II, an enzyme that cuts in the LTRs. To determine presence of viral linear DNA, genomic DNA was extracted 72 h after infection of MEL cells and restricted with Stu I, an enzyme that cuts twice within the provirus. The DNA was separated on a 0.8% agarose gel, transfer to a nylon membrane, and probed overnight with a β-globin fragment.
The same amount of p24 was used to transduce MEL cells with sBG and sBG-I vectors, in DMEM media, in the presence of 8 μg/mL polybrene. Cells were harvested at different time point (0.5 h, 3 h, 6 h, 8 h, 12 h, 24 h, 48 h, 72 h) and DNA extracted using Qiagen Blood and Cell culture DNA Mini Kit (Qiagen). Genomic DNA (50 ng) from a single copy MEL clone (confirmed by Southern for a single integrant) was diluted with untransduced DNA to generate copy number standards (1-0.016 copies/cell). The primers and the probe for RT product were designed using the Primer Express Software from Applied Biosystems, Foster City, Calif. Primers and probe sequence for early RT products (R/U5) qPCR assay are: forward primer 5′-GAACCCACTGCTTAAGCCTCAA-3′, reverse primer: 5′-ACAGACGGGCACACACTACTTG-3′ The reaction was carried out with TaqMan MGB Probe: 5′-AAAGCTTGCCTTGAGTGC-3′. Primers and probe sequence for intermediate RT products (U3/R) qPCR assay are: forward primer 5′-CCCAGGCTCAGATCTGGTCTAA-3′, reverse primer: 5′-TGTGAAATTTGTGATGCTATTGCTT-3′ The reaction was carried out with TaqMan MGB Probe: 5′-AGACCCAGTACAAGCAAAAAGCAGACCGG-3′. For the late RT product assay (psi) the primers were designed to recognize the ψ region of the provirus: forward primer: 5′-ACCTGAAAGCGAAAGGCAAAC-3′, reverse primer: 5′-AGAAGGAGAGAGATGGGTGCG-3′. The reaction was carried out with TaqMan Probe: 5′-AGCTCTCTCGACGCAGGACTCGGC-3′ with TAMRA dye as quencher. Normalization for loading was carried out using mouse apoB gene controls. The cycling conditions were 2 min at 50° C. and 10 min at 95° C., then 40 cycles of 95° C. for 15s and 60° C. for 1 min. The primers and probe for 2LTR circle were as previously described. The PCR mixture was thermo cycled according to the thermal cycler protocol for 96 well plates in Applied Biosystems 7900HT Fast Real-Time PCR System Base Unit.
Sickle cell anemia (SCA) results from a point mutation in the-globin gene (βS), resulting in sickle hemoglobin (HbS). HbS polymerizes upon deoxygenation resulting in sickle-shaped RBCs that occlude microvasculature. Patients with SCA have intermittent acute vascular occlusions and cumulative organ damage, reducing the life span to 42 to 58.5 years. Besides sickling, excessive hemolysis and a state of chronic inflammation exist. SCA patients account for approximately 75,000 hospitalizations per year, resulting in an estimated annual expenditure of $1.2 billion dollars in the United States alone. Worldwide, SCA is second only to thalassemia in incidence of monogenic disorders, with more than 200,000 children born annually in Africa.
Current therapies include supportive care for episodic sickling, chronic transfusions with iron chelation, and hydroxyurea to induce fetal hemoglobin (HbF). These therapies impact disease morbidity, but their effectiveness is variable and dependent on compliance to an indefinite treatment regimen. A matched allogeneic hematopoietic stem cell (HSC) transplantation is curative, but restricted by the availability of matched related donors 5 and has potential serious complications. A meta-analysis of 187 SCA transplantations shows 6% to 7% conditioning-related peritransplantation mortality, 7% to 10% acute rejection, and 13% to 20% chronic graft-versus host disease (GVHD) in recipients.
Gene therapy of autologous HSCs followed by transplantation could result in a one-time cure, avoid adverse immunologic consequences, and not be limited by availability of donors; it may also not require myeloablative-conditioning regimens, and thereby have lower toxicity. The amount of HbF/anti-sickling globin required to correct SCA via a transgene is unknown.
Expression of HbF postnatally can be therapeutic, as is evident by the protective effect of HbF in neonatal sickle RBCs and in patients with hereditary persistence of HbF and SCA. The proportion of genetically corrected HSCs, the amount of exogenously expressed HbF, and the proportion of F cells that will correct the pathophysiology are unknown. Complete correction of human thalassemia major in vitro, and in xenografted mice in vivo, with a lentivirus vector carrying the β-globin gene and locus control region (LCR) elements has been demonstrated. In this report, this β-globin lentivirus vector was modified to encode γ-globin exons and murine sickle HSCs were transduced. Functional correction was characterized first, with a careful and detailed quantification of RBC sickling, half-life, and deformability, with sickle to normal transplantations and high HbF production to define parameters of correction. Next, using reduced-intensity conditioning and varying the percentage of transduced HSCs, transplantations were performed on sickle mice with significant organ damage and demonstrate the proportions of (1) genetically corrected HSCs, (2) HbF, and (3) F cells, and (4) percentage of HbF/F cell required for correction of the sickle RBC and amelioration of organ damage in SCA.
It has been demonstrated that a β-γ-globin hybrid gene carrying lentivirus vector, I8H β/γW,11 expresses high γ-globin mRNA in erythroid cells expressing “adultlike” globins. All β-globin coding sequences were changed to γ-globin using site-directed mutagenesis and the γ-β-globin hybrid gene, and LCR elements were cloned in reverse orientation to the viral transcriptional unit to generate sGbG lentivirus vector. Virus was made with cotransfection of 293T cells.
Bone marrow from 6- to 20-week-old BERK sickle mice was harvested and lineage depleted with biotinylated CD5, CD8, B220, Mac-1, CD11b,Gr-1, and TER-119 antibodies and magnetic beads. The bead-free cells were stained with antibodies to Sca-1, c-kit. Cells that were 7-AAD−, Lineage−, c-kit+ then Sca-1+ (LSK cells) were sorted on FACSVantage (BDBiosciences). All experiments using Berkeley transgenic sickle mice and C57/BL6 mice were performed according to protocols approved by the Cincinnati Children's Hospital Medical Center.
Myeloablative transplantations were performed from BERK3C57B1/6 mice because of ease of transplantation and ready availability of normal recipients (9.5+/− 0.6 weeks old) after 11.75 Gy radiation. Radiation control experiments showed that BERK mice receiving 8 to 9 Gy radiation survived without receiving LSK cells; and the lethal dose was lower than in C57Bl/6 mice. BERK mice receiving more than 10.5 Gy died when no LSK cells were given; those given LSK rescue survived long term. BERK mice are difficult to breed in large numbers at a given time, therefore 2 mice/radiation dose level were to determine the sublethal dose. All BERK recipients (12.9+/− 0.4 weeks old) received 3 peritransplantation RBC transfusions (days 1-7). Organ pathology in BERK recipients 1 year after transplantation was compared with 12-week-old BERK mice that did not undergo transplantation. The radiation was higher than classical reduced intensity radiation dose of 4 Gy to allow a large degree of donor HSC chimerism. A range of MOI was used to vary the proportion of transduced donor HSCs in the graft. LSK cells were prestimulated overnight and transduced twice at an MOI of 30 for BERK3C57BL/6 transplants and MOI of 30 to 100 for BERK→BERK transplants for 22 to 24 hours; 10,000 to 24,000 LSK cells and untransduced LK cells were cotransplanted into recipient C57BL/6 or BERK mice.
Copy number analysis was done on genomic DNA by real-time polymerase chain reaction using primers and probes described previously.
Hematologic analysis was obtained on Hemavet 950FS (Drew Scientific) under mouse settings. Reticulocyte analysis was performed as follows: 0.1 μL blood and 200 μL BD Retic-COUNT Reagent were mixed (Becton Dickinson), incubated at room temperature for 30 minutes, and analyzed by fluorescence-activated cell sorting (FACS).
Hemoglobin electrophoresis was performed on cellulose acetate plates, as described previously. Ion exchange high-performance liquid chromatography (HPLC) was performed with an Alliance 2690 HPLC machine (Waters) using a PolyCATAcolumn (item no. 3.54CT0510; Poly LC Inc).
Irreversibly sickled cells (ISCs) were enumerated by scoring 500 RBCs in consecutive fields. Graded deoxygenation was performed using tonometry. RBC deformability was determined using a laser-assisted optical rotational cell analyzer (LORCA; RR Mechatronics).
Mice were injected with 3 mg Sulfo-NHS biotin (Sigma) in 300 μL PBS as 2 separate injections 1 hour apart; 2 to 5 μL blood was drawn at serial times, and stained with APC-Cy7-conjugated streptavidin.
Spleen, liver, bones, brain, and kidney were harvested and placed in 5 mL of 10% formalin. Paraffin blocks were sectioned and stained with hematoxylin and eosin.
The sGbG vector carries γ-globin exons and β-globin noncoding and regulatory regions. Based upon a previously studied sBG vector, which expresses high levels of human β-globin, 13 sGbG-transduced LSK cells from Berkeley sickle (BERK) mice were transplanted into lethally irradiated (myeloablated) normal C57Bl/6J mice (termed sGbG mice). Mock transductions on BERK LSK cells from the same bone marrow pool followed by transplantation resulted in mice with SCA. The majority of RBCs in sGbG mice expressed HbF. Only sGbG mice with 100% donor (HbS+) RBCs, with no evidence of residual recipient murine hemoglobin by electrophoresis and HPLC, were analyzed for hematologic, functional, and pathologic analysis. sGbG mice with a small proportion of recipient murine RBCs, were used only to assess HbF/vector copy and frequency of transduced HSCs. The percentage of HbF (HbF/HbS+HbF) in blood, quantified by FACS, was approximately 40% in primary mice followed for 6 months and in secondary recipients followed for 7.5 months (
High white blood cell (WBC) counts in humans with SCA and BERK mice reflect the baseline inflammation in this disease. WBC returned to normal levels in sGbG mice (
Notably, WBC counts were lower in the mock mice compared with BERK mice that did not undergo transplantation, likely because in the former, sickle HSCs were transplanted into a normal “noninflamed” C57/BL6 background. Indeed, 6 weeks after transplantation, WBC counts in mock group of mice were nearly normal, then gradually rose to high levels seen in SCA (
Bone marrow, spleen, liver, and kidneys at 24 weeks showed complete prevention of organ pathology. There was reduced erythroid hyperplasia in bone marrow and spleen, decreased spleen size, and preservation of the splenic follicular architecture, compared with obliterated follicular architecture from the severe erythroid hyperplasia in mock mice. The focal tubular atrophy and segmental glomerular infarction seen in mock mice were absent in the sGbG mouse kidneys. Infarctions and extramedullary hematopoiesis seen in livers of mock mice were absent in livers of sGbG mice (
The life span of BERK sickle mice is significantly reduced, as in humans with SCA before modern treatment. Kaplan-Meier survival curves showed a 100% survival of the sGbG mice at 24 weeks, in contrast to 20% survival in mock mice (n=14, P<0.001).
Myeloablative conditioning allows noncompetitive repopulation of gene-corrected donor HSCs, resulting in high transgene-modified HSC engraftment and transgene expression. It was hypothesized that high levels γ-globin expression achieved by myeloablative conditioning may not be necessary for correction, and if so, would reduce transplantation-related morbidity.
Reduced-intensity transplantation was accomplished by transplanting gene-modified BERK LSK cells into sublethally irradiated, but with significantly high radiation dose, BERK mice. The proportion of transduced HSCs and vector copy/cell in the graft was varied by transducing LSK cells with at a range of MOI (30-100). Since the half-life of BERK RBCs was 1.5 to 2 days (
Hematologic parameters stabilized at 18 weeks, due to persistent transfused RBCs in the early posttransplantation period. There was a significant improvement in hematologic parameters in the sGbG≧10 group of mice (
Sickling: There was a very significant reduction in ISCs in sGbG≧10 mice (P<0.005) and a small, but significant reduction in ISCs in sGbG<10 mice compared with mock/BERK controls (P<0.05,
Taken together, the sGbG vector resulted in significant and consistent hematologic and functional correction of SCA, when the HbF production exceeded 10% of the total hemoglobin. Notably, the improvement in phenotype was comparable with that achieved with myeloablative conditioning.
One unique feature of this BERK→BERK transplantation model was presence of significant sickle pathology in recipients at the time of transplantation (determined using BERK controls of comparable age as recipient mice when they underwent transplantation). Therefore, the potential for reversal of organ pathology after gene therapy could be assessed. Organ pathology in the surviving mice at approximately 50 weeks after transplantation was compared with 3-month-old BERK mice that did not undergo transplantation (
There was a significant improvement in overall survival in the sGbG≧10 mice compared with sGbG<10 or mock mice (
Using biotin surface labeling and intracellular HbF staining, the survival of F cells and non-F cells was studied in the same animal, which allowed quantification of the HbF/F cell necessary for improved sickle RBC survival and deformability. F cells showed a selective prolonged survival, as anticipated (
Therefore, the half-life of F cells in mice was determined, grouped by the percentage of HbF/F cell. sGbG mice with low (16%; n=2), intermediate (33%; n=4), and very high (89%; n=2) HbF/F cell was injected with biotin and followed by periodic blood sampling. It was determined that mice with low HbF/F cell had no improvement in RBC half-life over BERK controls (
To confirm the impact of percentage of circulating F cells on overall RBC deformability, mice from both the myeloablative and reduced-intensity experiments (n=34) were grouped into 3 groups: mice with less than 33% circulating F cells, 33% to 65% F cells, and 66% or more F cells and measured RBC deformability. Only data from the low (3 Pa) and high (28 Pa) shear rates are plotted in
The proportion of HSCs transduced with sGbG in sGbG mice was analyzed by the secondary spleen colony-forming unit (CFU-S) assay performed at 6 months in both models (
Importantly, 3 mice with 16%, 20%, and 22% transduced CFU-S's had more than 10% HbF (HbF was 20%, 11%, and 18%, respectively) and showed complete phenotypic correction. A vector copy number analysis was performed concurrently at 24 weeks on bone marrow cells and showed 1 to 3 copies/cell and 1 to 2.5 copies/cell in sGbG mice that underwent transplantation using the myeloablative conditioning and reduced-intensity conditioning models, respectively. When corrected for HSC transduction, there were 1.5 to 5 vector copies/cell.
The percentage of gene-modified HSCs necessary for effective gene therapy is critical in this disease. In vitro studies on SCA marrow can be done only on a small scale, and would read out correction in progenitors, not HSCs. HSC correction was shown in humanized models of SCA with long-term analysis. The extremely limited numbers of RBCs produced from injecting human thalassemia bone marrow CD34+ cells are prohibitive for studies on sickling Therefore, lentivirus transduction into normal human CD34+ cells was optimized for a preclinical scale-up, using a GFP lentivirus vector and the severe combined immunodeficient (SCID)-repopulating assay. Granulocyte colony-stimulating factor-mobilized peripheral blood CD34+ cells transduced with a GFP lentivirus vector were transplanted into nonobese diabetic (NOD)/LtSz-scid IL2Rynull (NSG) mice. Here, mock mice were those that received a transplant of untransduced CD34+ cells immediately after selection, as controls for the effect of transduction on engraftment and clonogenicity. At 6 weeks, CFUs were plated from bone marrow derived from NSG mice, and 36 individual CFUs/mouse were analyzed for the percentage of gene-marked colonies. The 18-hour transduction did not affect engraftment or clonogenicity (data not shown). A 77% gene transfer on average was observed in the SCID-repopulating cell assay, similar to previous data in human thalassemia CD34+ cells.
The data from this study indicates that lentiviral delivery human γ-globin under β-globin regulatory control elements in HSCs results in sufficient postnatal HbF expression to correct SCA in mice. The amount of HbF and transduced HSCs was then de-scaled, using reduced-intensity conditioning and varying MOI, to assess critical parameters needed for correction. A systematic quantification of functional and hematologic RBC indices, organ pathology, and life span were critical to determine the minimal amount of HbF, F cells, HbF/F cell, and gene-modified HSCs required for reversing the sickle phenotype.
Results indicate the following: (1) Amelioration of disease occurred when HbF exceeded 10%, F cells constituted two-thirds of the circulating RBCs, and HbF/F cell was one-third of the total hemoglobin in RBCs; and when approximately 20% sGbG modified HSCs repopulated the marrow. (2) Genetic correction was sustained in primary or secondary transplant recipients followed long-term. (3) There is a method of determining minimum HSC chimerism for correction of a hematopoietic disease in an in vivo model, which would contribute to design of cell dose and conditioning regimens to achieve equivalent genetically corrected HSCs in human clinical trials.
One novel aspect of this study is that it addresses, for the first time, the gene dosage and the gene-modified hematopoietic stem cell dosage required for correction of a genetic defect. Expressing a tremendous amount of fetal/antisickling hemoglobin will undoubtedly correct disease, as has been shown by others, but is not practically possible in a clinical setting. As an example, an initial gene therapy for adenosine deaminase (ADA) deficiency was performed using no conditioning, and was not therapeutic, even though few gene-marked stem cells engrafted, and a selective advantage to gene-corrected lymphocytes was evident upon withdrawal of ADA. In a subsequent trial, 4 mg/kg busulfan was used before transplantation, as conditioning, resulting in adequate gene-corrected stem cell dose and gene-modified T cells. Although these pioneering studies provided us with invaluable information, they underscore the critical importance of determining thresholds for genetic correction before embarking on clinical studies.
Although disease has been corrected at 1 to 3 copies/cell, the present study indicates that the percentage of transduced stem cells in this setting of lethal irradiation/transplantation is very high (average HSCs transduced are 50%, as analyzed by a stringent secondary CFU-S assay). This level of HSC transduction would likely not be achieved in the clinical setting unless myeloablation is performed.
Therefore a novel model (BERK to BERK transplantation) was developed to address the minimal gene transfer needed, and answer questions of correction of SCA in a mouse with significant sickle pathology at 12 weeks of life (
BERK mice have some degree of thalassemia. Therefore one concern in using this model for genetic therapy studies for sickle cell anemia is that correction of thalassemia would obscure improvements made by the antisickling effects of HbF. Surprisingly no significant change in MCH in sGbG<10 or sGbG≧10 mice, including mice with HbF/F cell as high as 89% were seen (as disclosed herein). These results were surprising, but showed that the correction of sickling in RBCs was not secondary to correction of thalassemia, as seen in murine thalassemia model, where increasing MCH was seen with increases in HbF of 4% or higher. Conceivably, HbF is produced at the expense of HbS.
Although BERK mice exclusively carry human hemoglobin, the total hemoglobin in the mouse RBCs is one-third of a human RBC. Therefore, HbF and HbF/F cell were expressed as a percentage, rather than in absolute amounts, to best compare murine data to human. An increase of HbF from 3.6% to 13.6% has been shown to reduce acute sickle events in patients on decitabine. Similar improvement in sickle events occurs with 25% or more HbF/F cell in patients responsive to hydroxyurea. Data presented here, indicating improvement with 33% HbF/F cell, is concordant with these reports, but more closely resemble RBCs in infants with SCA, where less than one-third HbF/F cell at 10 to 12 months is considered a threshold for intracellular sickle polymerization. The most remarkable effect of γ-globin production with the sGbG vector was a dramatic absence of chronic organ damage and an improved survival of the sickle mice when HbF exceeded 10%. Patients with high HbF have an improved survival, confirmed by the multicenter study on hydroxyurea. HbF expressed from the sGbG vector was comparable with, or even better than, effective hydroxyurea treatment. The potential of a one-time correction, where responsiveness to hydroxyurea and compliance to daily life-long administration would not be limiting factors, would be a tremendous advantage of gene therapy. Indeed, we did not anticipate we would get the same conclusion with gene therapy, as derived from collective knowledge on (1) transgenic mice, in which every RBC has the same amount of HbF although we were imposing HbF on SS RBCs; (2) chimeric transplantations, in which normal amounts of HbA-producing RBCs (AA RBC) are present mixed with SS RBCs17,37,38; or (3) SCD patients on hydroxyurea, in whom macrocytosis induced by hydroxyurea would dilute HbS and reduce the threshold for sickling. A much higher threshold of genetically corrected sickle HSCs necessary for F-cell repopulation and correction of SCA phenotype was expected, as HbF was exogenously imposed into a sickle cell with normal amounts of HbS. Notably, despite these distinct differences in transgenics/chimeras, conclusions were similar with exogenous γ-globin expression: Indeed expressing exogenous HbF in RBCs at concentrations from 33% to as high as 89% resulted in no significant increase in MCV or MCH, yet corrected sickling. This data suggests that genetic delivery of HbF decreases endogenous HbS.
The percentage of transduced HSCs in the setting of lethal irradiation/transplantation is very high (50% on average, as analyzed by a stringent secondary CFU-S assay at 24 weeks), a number that would be difficult to achieve in a clinical setting. The BERK→BERK transplantation model, however, shows that 20% autologous HSC correction may suffice for a significant amelioration of sickling, organ damage, and survival. However, whether this percentage of gene-modified HSCs necessary for effective gene therapy is achievable is critical to determine, since there is no survival advantage to the gene-modified HSCs in this disease. High human HSC transduction has been a limitation of gene therapy with the traditional gamma retrovirus vectors. Lentivirus vectors can overcome this barrier: a 20% long-term transduction has been shown in adrenoleukodystrophy with a lentivirus vector. Lentivirus transduction into human CD34+ cells was optimized, using the SCID-repopulating cell assay and achieved approximately 75% gene transfer in SCID-repopulating cell, on average, similar to previous data in human thalassemia CD34+ cells, where 70% transduction was seen 3 to 4 months after transplantation into immune-deficient mice. Notably, this level of gene transfer in the SCID mice is encouraging, and indeed higher than the gene transfer observed in NOD-SCID mice with the adrenoleukodystrophy lentivirus vector in preclinical studies.
Gene therapy using this approach could also overcome the toxicity and immunologic consequences of the traditional allogeneic bone marrow transplantation/reduced-intensity transplantation. Mismatched mixed chimerism of normal and sickle marrow in murine transplantations shows that a near complete chimerism is typically necessary for correction of organ damage. It is encouraging that, in a clinical series, reduced-intensity conditioning (RIC) transplantation with 8 mg/kg busulfan along with fludarabine, antithymocyte globulin, and total lymphoid irradiation in SCA patients has shown an average allogeneic engraftment of 78% at 2 to 8.5 years after transplantation, with correction of SCA phenotype. This high level of donor chimerism even in an allogeneic RIC setting, where immune rejection can occur, suggests that high gene transfer efficiency into autologous CD34+ cells followed by RIC may be a potentially safer alternative to myeloablative conditioning. 77% gene transfer efficiency in human stem/progenitors was demonstrated using a NOD-SCID repopulating cell assay, as well a correction of phenotype in mice with 1.3 to 1.5 copies per cell and approximately 20% gene-marked CFU-Ss (
Significantly, correction occurred at 1 to 3 vector copies per cell, a clinically achievable goal. Flanking the sGbG virus with a chromatin insulator is expected to increase HbF/vector copy by 2- to 4-fold. In experimental models, the insulator appears to reduce clonal dominance, although whether the insulator element lowers the risk of insertional oncogenesis is unknown. The risk of insertional oncogenesis observed with randomly integrating vectors has been shown to be lower with a lentivirus vector than a gammaretrovirus vector. It would be further lowered when the enhancer element is active only in a restricted erythroid lineage
Since HbF is the hemoglobin with the highest anti-sickling effect, a lentivirus vector, sGbG, that carries a normal human γ-globin gene was used to produce HbF in Berkeley sickle mice. As disclosed herein, a lentivirus vector incorporating γ-globin exons and β-globin non-coding regions and regulatory elements, sGbG, was designed. This vector showed complete correction of the sickle phenotype in Berkeley sickle mice following transfer of the sGbG vector into HSCs and myeloablative transplants (Example 65,
The critical parameters necessary to correct SCA pathophysiology using a reduced intensity transplant were then determined. Complete correction of the hematological and functional RBC parameters, inflammation, and organ pathology was observed in SCD mice following myeloablative-conditioning and transplant. Correction was sustained long-term in primary and secondary transplant recipients. The critical parameters necessary to correct SCA pathophysiology using a reduced intensity transplant were also determined. There was 100% 6-month survival of genetically-corrected Berkeley sickle mice, compared to 20% survival of mock-transplanted Berkeley sickle mice.
Using reduced-intensity conditioning and simulating conditions of autologous transplant, different proportions of gene-modified Berkeley sickle HSC were transplanted into sub-lethally irradiated Berkeley sickle mice. The minimal proportions of genetically-corrected HSC, HbF, HbF-containing RBC (F-cells) and HbF/F-cell required for correction of sickle cell anemia were then defined. With 15-20% gene modified HSC repopulating the Berkeley sickle mouse bone marrow, approximately 2 vector copies per cell, >10% HbF, and >66% F cells, there was complete correction of the sickle phenotype, including organ pathology and survival. With 15-20% gene-modified HSCs repopulating the Berkeley sickle mouse bone marrow, approximately 2 vector copies per cell, >10% HbF, and >66% F cells, there was complete correction of the sickle phenotype, including organ pathology and survival.
Expression of HbF via lentivirus vectors carrying the human γ-globin gene has been previously shown (Persons et al. Blood 10:2175-83 (2003); Pestina et al. Mol. Ther. 17:245-52 (2009)). In order to confirm the ability of the sGbG vector to correct β-thalassemia, thalassemia mice (Hbbth3/+) were treated using the same approach as used in sickle transgenic mice. Thalassemia mice were transplanted with thalassemia stem/progenitor cells (Lin− Sca+ Kit+ [LSK] cells) transduced twice about 8 hours apart with sGbG (MOI of 2×20). Control (Mock) animals were concurrently treated with media only. Approximately 10,000 transduced LSK+ cells were injected/co-transplanted with 200,000 irradiated Lin-Sca-Kit− cells into lethally irradiated thalassemia recipient mice (split dose of 700+375 rads). The primary animals were monitored over a period of 7-8 months, and secondary transplants were performed thereafter for a total follow up of 18 months.
The vector resulted in increased HbF to 22±3% (mean±SEM); which corrected the thalassemia phenotype (
As described above, production of >10% HbF was shown to correct the SCD phenotype in the mouse model. While the sGbG vector efficiently corrected the phenotype in the Berkeley sickle mouse model (Example 65,
The Berkeley sickle mice are transgenic for the human α- and βS-globin transgenes, and knock-out of mouse globins and the human transgenes leads to imbalanced globin chain production. Berkeley sickle mice have a relative excess of human α globin chains, as compared to βS globin chains, allowing the γ-globin produced by the sGbG vector to form HbF (α2γ2) readily, in the presence of βS globin that also binds a-globin to form HbS (α2βS2). The UAB mice, on the other hand, are knock-ins for human α in place of the mouse α globin and human βS in place of the mouse βmajor globin gene, producing human globins in place of mouse globins. These mice therefore have completely balanced human α and βS chains and resemble patients with homozygous sickle cell anemia (Hb SS disease). Patients with homozygous SCD (and the UAB knock-in sickle mouse model) have balanced (equal amounts of) α and βS molecules, and the genetically introduced γ-globin has to compete with βS for a-globin. Hence, a far excess of γ-globin is required to outcompete βS globin to form HbF.
Accordingly, in Berkeley sickle mice, γ-globin produced by this vector effectively binds the excess a globin to form HbF, without much competition from βS globin, which binds with a globin to form HbS. Hence, in Berkeley sickle mice, at clinically achievable vector copies, correction of disease is observed. However, in UAB mice, the a globin chains become rate limiting due to equal amounts of competing βS globin chains. Therefore, a high level/excess of vector-derived γ globin is required to be able to out compete βS globin to form HbF.
To address this, several changes were made to the gene transfer protocol and strategy. The γ-globin gene was modified with a GA point mutation at bp 50 in exon 1. This modification changes the amino acid glycine (GGC) to aspartic acid (GAC) in order to improve its affinity for a-globin without altering its functional properties, so that HbF is formed at higher efficiency than HbS in RBCs. The ability of the original γ globin vector (sGbG) was then compared to that with a point mutation in the γ globin coding sequence (sGbGM) in sickle mice. The annotated vector map for the sGbGM is depicted in
Comparative studies between the sGbG and sGbGM vectors were done in Berkeley sickle mice and in UAB sickle mice, where lineage depleted, Sca+ Kit+ (LSK) cells, that are highly enriched in hematopoietic stem cells, were sorted, transduced with medium alone (mock), the sGbG vector, or the sGbGM vector, and transplanted into sub-lethally irradiated Berkeley or UAB sickle recipient mice, as previously described for the sGbG efficacy studies (Perumbeti et al., Blood 114:1174-85 (2009)). Mice were bled at 6, 12, and 24 weeks post-transplant to assess hematological parameters and HbF expression, and six to eight mice per arm were then followed for 6-12 months. The 12-week data in Berkeley sickle mice are shown in
Comparative results between Berkeley and knock-in UAB sickle mice are shown in
The HbF generated from the sGbGM vector was functional, showing correction of sickling, a superior reduction in reticulocytosis, and a rise in hemoglobin in both types of sickle mice. Correction of anemia was observed in UAB mice transplanted with the sGbGM vector but not the sGbG vector. Some of these mice have now been followed for nearly one year, and the expression is stable. Much better correction of RBC half-life and RBC membrane deformability was also observed with the sGbGM vector as compared to the sGbG vector when HbF levels are the same.
These results demonstrate that the point-mutated γ-globin gene in the sGbGM vector prevents sickling and therefore prolongs sickle RBC half-life, leading to lower reticulocyte counts (
The various methods and techniques described above provide a number of ways to carry out the invention. Of course, it is to be understood that not necessarily all objectives or advantages described may be achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that the methods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as may be taught or suggested herein. A variety of advantageous and disadvantageous alternatives are mentioned herein. It is to be understood that some preferred embodiments specifically include one, another, or several advantageous features, while others specifically exclude one, another, or several disadvantageous features, while still others specifically mitigate a present disadvantageous feature by inclusion of one, another, or several advantageous features.
Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be mixed and matched by one of ordinary skill in this art to perform methods in accordance with principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.
Although the invention has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments of the invention extend beyond the specifically disclosed embodiments to other alternative embodiments and/or uses and modifications and equivalents thereof.
Many variations and alternative elements have been disclosed in embodiments of the present invention. Still further variations and alternate elements will be apparent to one of skill in the art. Among these variations, without limitation, are the specific number of genes or targeted by a therapeutic product, the type of gene, the type of genetic disease or deficiency, and the gene(s) specified. Various embodiments of the invention can specifically include or exclude any of these variations or elements.
In some embodiments, the numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the invention may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the invention (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the invention can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this invention include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
All patents, patent applications, publications of patent applications, and other material, such as articles, books, specifications, publications, documents, things, and/or the like, referenced herein are hereby incorporated herein by this reference in their entirety for all purposes, excepting any prosecution file history associated with same, any of same that is inconsistent with or in conflict with the present document, or any of same that may have a limiting affect as to the broadest scope of the claims now or later associated with the present document. By way of example, should there be any inconsistency or conflict between the description, definition, and/or the use of a term associated with any of the incorporated material and that associated with the present document, the description, definition, and/or the use of the term in the present document shall prevail.
In closing, it is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that can be employed can be within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present invention are not limited to that precisely as shown and described.
The present application claims the benefit of priority 35 U.S.C. §119(e) to U.S. Provisional Application No. 61/933,788, filed on Jan. 30, 2014, which is hereby incorporated by reference in its entirety
This invention was made with government support under HL070595, HL70135-01, HL073104, and HL06-008 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2015/013960 | 1/30/2015 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 61933788 | Jan 2014 | US |
