Angiogenic factors and use thereof in treating cardiovascular disease

Abstract

The present invention relates to novel VEGF protein products, and nucleic acids encoding these novel protein products, comprising exons 1-6 and 8 of the VEGF gene, and derivatives thereof, and these uses in treating the cardiovascular system and its diseases through effects on anatomy, conduit function, and permeability. VEGF145 and its derivatives have been found to be active mitogens for vascular endothelial cells and to function as angiogenic factors in-vivo. VEGF145 and its derivatives have novel properties compared with previously characterized VEGF species with respect to cellular distribution, susceptibility to oxidative damage, and extra-cellular matrix (ECM) binding ability. The present invention also relates to derivatives of VEGF145 which have altered properties in that they have altered biological activity and altered heparin-binding activity when compared to VEGF145. The present invention provides methods of treating the cardiovascular system, enhancing endothelialization of diseased vessels, and enhancing drug permeation by providing the novel VEGF protein products. The invention also provides expression vectors, compositions, and kits for use in the methods of the invention.

Description

The present invention relates to the treatment of the cardiovascular system and its diseases through effects on anatomy, conduit function, and permeability, and more particularly to a method of treating cardiovascular disease by stimulating vascular cell proliferation using a growth factor thereby stimulating endothelial cell growth and vascular permeability.

Cardiovascular diseases are generally characterized by an impaired supply of blood to the heart or other target organs. Myocardial infarction (MI), commonly referred to as heart attacks, are a leading cause of mortality as 30% are fatal in the in the first months following the heart attack. Heart attacks result from narrowed or blocked coronary arteries in the heart which starves the heart of needed nutrients and oxygen. When the supply of blood to the heart is compromised, cells respond by generating compounds that induce the growth of new blood vessels so as to increase the supply of blood to the heart. These new blood vessels are called collateral blood vessels. The process by which new blood vessels are induced to grow out of the existing vasculature is termed angiogenesis, and the substances that are produced by cells to induce angiogenesis are the angiogenic factors.

Unfortunately, the body's natural angiogenic response is limited and often inadequate. For this reason, the discovery of angiogenic growth factors has lead to the emergence of an alternative therapeutic strategy which seeks to supplement the natural angiogenic response by supplying exogenous angiogenic substances.

Attempts have been made to stimulate angiogenesis by administering various growth factors. U.S. Pat. No. 5,318,957 to Cid et al. discloses a method of stimulating angiogenesis by administering haptoglobins (glyco-protein with two polypeptide chains linked by disulfide bonds). Intracoronary injection of a recombinant vector expressing human fibroblast growth factor-5 (FGF-5) (i.e., in vivo gene transfer) in an animal model resulted in successful amelioration of abnormalities in myocardial blood flow and function. (Giordano, F. J., et. al. Nature Med. 2:534-539, 1996). Recombinant adenoviruses have also been used to express angiogenic growth factors in-vivo. These included acidic fibroblast growth factor (Muhlhauser, J., et. al. Hum. Gene Ther. 6:1457-1465, 1995), and one of the VEGF forms, VEGF 165 (Muhlhauser, J., et. al. Circ. Res. 77:1077-1086, 1995).

One of the responses of heart muscle cells to impaired blood supply involves activation of the gene encoding Vascular Endothelial Growth Factor (“VEGF”) (Banai, S., et. al. Cardiovasc. Res. 28:1176-1179, 1994). VEGFs are a family of angiogenic factors that induce the growth of new collateral blood vessels. The VEGF family of growth factors are specific angiogenic growth factors that target endothelial (blood vessel-lining) cells almost exclusively. (Reviewed in Ferrara et al., Endocr. Rev. 13:18-32 (1992); Dvorak et al., Am. J. Pathol. 146:1029-39 (1995); Thomas, J. Biol. Chem. 271:603-06 (1996)). Expression of the VEGF gene is linked in space and time to events of physiological angiogenesis, and deletion of the VEGF gene by way of targeted gene disruption in mice leads to embryonic death because the blood vessels do not develop. It is therefore the only known angiogenic growth factor that appears to function as a specific physiological regulator of angiogenesis.

In vivo, VEGFs induce angiogenesis (Leung et al., Science 246:1306-09, 1989) and increase vascular permeability (Senger et al., Science 219:983-85, 1983). VEGFs are now known as important physiological regulators of capillary blood vessel formation. They are involved in the normal formation of new capillaries during organ growth, including fetal growth (Peters et al., Proc. Natl. Acad. Sci. USA 90:8915-19, 1993), tissue repair (Brown et al., J. Exp. Med. 176:1375-79, 1992), the menstrual cycle, and pregnancy (Jackson et al., Placenta 15:341-53, 1994; Cullinan & Koos, Endocrinology 133:829-37, 1993; Kamat et al., Am. J. Pathol. 146:157-65, 1995). During fetal development, VEGFs appear to play an essential role in the de novo formation of blood vessels from blood islands (Risau & Flamme, Ann. Rev. Cell. Dev. Biol. 11:73-92, 1995), as evidenced by abnormal blood vessel development and lethality in embryos lacking a single VEGF allele (Carmeliet et al., Nature 380:435-38, 1996). Moreover, VEGFs are implicated in the pathological blood vessel growth characteristic of many diseases, including solid tumors (Potgens et al., Biol. Chem. Hoppe-Seyler 376:57-70, 1995), retinopathies (Miller et al., Am. J. Pathol. 145:574-84, 1994; Aiello et al., N. Engl. J. Med. 331:1480-87, 1994; Adamis et al., Am. J. Ophthalmol. 118:445-50, 1994), psoriasis (Detmar et al., J. Exp. Med. 180:1141-46, 1994), and rheumatoid arthritis (Fava et al., J. Exp. Med. 180:341-46, 1994).

Using the rabbit chronic limb ischemia model, it has been shown that repeated intramuscular injection or a single intra-arterial bolus of VEGF can augment collateral blood vessel formation as evidenced by blood flow measurement in the ischemic hindlimb (Pu, et al., Circulation 88:208-15, 1993; Bauters et al., Am. J. Physiol. 267:H1263-71, 1994; Takeshita et al., Circulation 90 [part 2], II-228-34, 1994; Bauters et al., J. Vasc. Surg. 21:314-25, 1995; Bauters et al., Circulation 91:2802-09, 1995; Takeshita et al., J. Clin. Invest. 93:662-70, 1994). In this model, VEGF has also been shown to act synergistically with basic FGF to ameliorate ischemia (Asahara et al., Circulation 92: [suppl 2], II-365-71, 1995). VEGF was also reported to accelerate the repair of balloon-injured rat carotid artery endothelium while at the same time inhibiting pathological thickening of the underlying smooth muscle layers, thereby maintaining lumen diameter and blood flow (Asahara et al., Circulation 91:2793-2801, 1995). VEGF has also been shown to induce EDRF (Endothelin-Derived Relaxin Factor (nitric oxide))-dependent relaxation in canine coronary arteries, thus potentially contributing to increased blood flow to ischemic areas via a secondary mechanism not related to angiogenesis (Ku et al., Am. J. Physiol. 265:H586-H592, 1993).

Activation of the gene encoding VEGF results in the production of several different VEGF variants, or isoforms, produced by alternative splicing wherein the same chromosomal DNA yields different mRNA transcripts containing different exons thereby producing different proteins. Such variants have been disclosed, for example, in U.S. Pat. No. 5,194,596 to Tischer et al. which identifies human vascular endothelial cell growth factors having peptide sequence lengths of 121, and 165 amino acids (i.e., VEGF 121 and VEGF 165 ). Additionally, VEGF 189 and VEGF 206 have also been characterized and reported (Neufeld, G., et. al. Cancer Metastasis Rev. 15:153-158, 1996).

As depicted in FIG. 1 , the domain encoded by exons 1-5 contains information required for the recognition of the known VEGF receptors KDR/flk-1 and flt-1 (Keyt, B. A., et. al. J Biol Chem 271:5638-5646, 1996), and is present in all known VEGF isoforms. The amino-acids encoded by exon 8 are also present in all known isoforms. The isoforms may be distinguished however by the presence or absence of the peptides encoded by exons 6 and 7 of the VEGF gene, and the presence or absence of the peptides encoded by these exons results in structural differences which are translated into functional differences between the VEGF forms (reviewed in: Neufeld, G., et. al. Cancer Metastasis Rev. 15:153-158, 1996).

Exon 6 can terminate after 72 bp at a donor splice site wherein it contributes 24 amino acids to VEGF forms that contain it such as VEGF 189 . This exon 6 form is referred to as exon6a. However, the VEGF RNA can be spliced at the 3′ end of exon 6 using an alternative splice site located 51 bp downstream to the first resulting in a larger exon 6 product containing 41 amino-acids. The additional 17 amino-acids added to the exon 6 product as a result of this alternative splicing are referred to herein as exon 6b. VEGF 206 contains the elongated exon 6 composed of 6a and 6b, but this VEGF form is much rarer than VEGF 189 . (Tischer, E., et al., J. Biol. Chem. 266:11947-11954; Houck, K. A., et al., Mol. Endocrinol., 12:1806-1814, 1991).

A putative fifth form of VEGF, VEGF 145 , has been noted in the human endometrium, using PCR. The authors state that the sequence of the cDNA of the VEGF 145 splice variant indicated that it contained exons 1-5, 6 and 8. However, it is uncertain whether the authors found that the splice variant contained exons 6a and 6b as in VEGF 206 , exon 6a as in VEGF 189 , or exon 6b. The authors state that since the splice variant retains exon 6 it is probable that it will be retained by the cell as are the other members of the family that contain this exon. (Charnock-Jones et al., Biology of Reproduction 48:1120-1128 (1993). See also, Bacic M, et al. Growth Factors 12:11-15, 1995). The biologic activity of this form has not heretofore been established. (Cheung, C. Y., et al., Am J. Obstet Gynecol., 173:753-759, 1995); Anthony, F. W. et al., Placenta, 15:557-561, 1994). The various isoforms, and the exons that encode the isoforms, are depicted in FIG. 1 .

The four known forms of VEGF arise from alternative splicing of up to eight exons of the VEGF gene (VEGF 121 , exons 1-5, 8; VEGF 165 , exons 1-5, 7, 8; VEGF 189 , exons 1-5, 6a, 7, 8; VEGF 206 , exons 1-5, 6a, 6b, 7, 8 (exon 6a and 6b refer to 2 alternatively spliced forms of the same exon)) (Houck et al., Mol. Endocr., 5:1806-14 (1991)). All VEGF genes encode signal peptides that direct the protein into the secretory pathway. For example, VEGF 165 cDNA encodes a 191-residue amino acid sequence consisting of a 26-residue secretory signal peptide sequence, which is cleaved upon secretion of the protein from cells, and the 165-residue mature protein subunit. However, only VEGF 121 and VEGF 165 are found to be readily secreted by cultured cells whereas VEGF 189 and VEGF 206 remain associated with the producing cells. These VEGF forms possess an additional highly basic sequence encoded by exon 6 corresponding to residues 115-139 in VEGF 189 and residues 115-156 in VEGF 206 . These additions confer a high affinity to heparin and an ability to associate with the extracellular matrix (matrix-targeting sequence) (Houck, K. A. et al., J. Biol. Chem. 267:26031-37 (1992) and Thomas, J. Biol. Chem. 271:603-06 (1996)). The mitogenic activities of VEGF 121 and VEGF 165 are similar according to the results of several groups (Neufeld, G., et al., Cancer Metastasis Rev. 15:153-158 (1996) although one research group has shown evidence indicating that VEGF 121 is significantly less active (Keyt, B. A., et al., J. Biol. Chem. 271:7788-7795 (1996). It is unclear whether the two longer VEGF forms, VEGF 189 and VEGF 206 , are as active or less active than the two shorter forms since it has not been possible to obtain them in pure form suitable for quantitative measurements. This failure is due in part to their strong association with producing cells and extracellular matrices which is impaired by the presence of exon-6 derived sequences apparently acting in synergism with exon-7 derived sequences groups (Neufeld, G., et al., Cancer Metastasis Rev. 15:153-158 (1996).

As described in more detail herein, each of the VEGF splice variants that have heretofore been characterized have one or more of the following disadvantages with respect to stimulating angiogenesis of endothelial cells in the treatment of cardiovascular diseases: (i) failure to bind to the extracellular matrix (ECM) resulting in faster clearance and a shorter period of activity, (ii) failure to secrete into the medium (i.e. remaining cell-associated) so as to avoid reaching and acting on the endothelial cells, and (iii) susceptibility to oxidative damage thereby resulting in shorter half-life.

Accordingly, there is a need for a new form of VEGF that avoids the aforementioned disadvantages and that can be usefully applied in stimulating angiogenesis in cardiovascular disease patients would be most desirable.

SUMMARY OF THE INVENTION

The present invention relates to a novel VEGF protein product, and a nucleic acid encoding the novel protein product comprising exons 1-6a and 8 of the VEGF gene, (hereinafter “VEGF 145 ”) and the use thereof in treating the cardiovascular system and its diseases through effects on anatomy, conduit function, and permeability. VEGF 145 has been found to be an active mitogen for vascular endothelial cells and to function as an angiogenic factor in-vivo. VEGF 145 was favorably compared with previously characterized VEGF species with respect to cellular distribution, susceptibility to oxidative damage, and extra-cellular matrix (ECM) binding ability. Previous research relating to the binding affinities of the various VEGF isoforms found that VEGF 165 , which lacks exon 6, binds relatively weakly to heparin and also binds very weakly to the extracellular matrix, (Park, J. E., et al., Mol. Biol. Cell 4:1317-1326 (1993). VEGF 145 , which binds as weakly as VEGF 165 to heparin, binds much better than VEGF 165 to the extracellular matrix. However, unlike VEGF 189 , VEGF 145 is secreted from producer cells and binds efficiently to the ECM. This combination of properties render VEGF 145 the only known VEGF variant that is secreted from producing cells retaining at the same time extracellular matrix binding properties. Hence, it will likely diffuse towards the target blood vessels, while some of the produced VEGF 145 will be retained by extracellular matrix components along the path of diffusion. This ECM bound pool will dissociate slowly allowing a longer period of activity. Furthermore, the biological activity of VEGF 145 is protected against oxidative damage unlike VEGF forms such as VEGF 121 thereby giving it a longer half-life.

In sum, VEGF 145 clearly possesses a unique combination of biological properties that distinguish it from the other VEGF forms. This unique combination of properties of VEGF 145 renders it a preferred therapeutic agent for the treatment of the cardiovascular system and its diseases as well as other diseases characterized by vascular cell proliferation. In particular, the cDNA may be employed in gene therapy for treating the cardiovascular system and its diseases.

Endothelial cell proliferation, such as that which occurs in angiogenesis, is also useful in preventing restenosis following balloon angioplasty. The balloon angioplasty procedure often injuries the endothelial cells lining the inner walls of blood vessels. Smooth muscle cells often infiltrate into the opened blood vessels causing a secondary obstruction in a process known as restenosis. The proliferation of the endothelial cells located at the periphery of the balloon-induced damaged area in order to cover the luminal surface of the vessel with a new monolayer of endothelial cells would potentially restore the original structure of the blood vessel.

Thus, the present invention provides a method of treating cardiovascular disease in a mammal comprising the step of transfecting cells of said mammal with a polynucleotide which encodes VEGF 145 . In preferred aspects, the polynucleotide is cloned into a vector. In further preferred aspects, the vector is an adenovirus vector. The adenovirus vector is preferably delivered to the mammal by injection; preferably, about 10 10 to about 10 14 adenovirus vector particles are delivered in the injection. More preferably, about 10 11 to about 10 13 adenovirus vector particles are delivered in the injection. Most preferably, about 10 12 adenovirus vector particles are delivered in the injection.

In further preferred aspects, the polynucleotide which encodes VEGF 145 is delivered to the heart of a mammal. The delivery of the polynucleotide is preferably by intracoronary injection into one or both arteries, preferably according to the methods set forth in PCT/US96/02631, published Sep. 6, 1996 as WO96/26742, hereby incorporated by reference herein. Preferably, the intracoronary injection is conducted about 1 cm into the lumens of the left and right coronary arteries.

In other preferred aspects of the invention, the cells of the mammal are transfected in vivo. In other preferred aspects, the cells are transfected ex vivo.

In yet other preferred aspects of the invention, the polynucleotide may be introduced into the mammal through a catheter.

In one embodiment of the invention, the polynucleotide which encodes VEGF 145 comprises a base sequence as defined in the Sequence Listing by SEQ ID No. 1. In preferred embodiments, the polynucleotide sequence encoding VEGF 145 is present in an expression vector. Thus, in a preferred aspect of the invention, the invention provides an expression vector comprising a polynucleotide sequence encoding VEGF 145 species, said species being selected from the group consisting of:

(a) VEFG 145 ;

(b) a biological active fragment of VEGF 145 ; and

(c) a biologically active derivative of VEGF 145 , wherein an amino acid residue has been inserted, substituted or deleted in or from the amino acid sequence of the VEGF 145 or its fragment. In preferred aspects, the polynucleotide encodes VEGF 145 . In more preferred aspects, the polynucleotide comprises a base sequence as defined in the Sequence Listing by SEQ ID No. 1.

In a preferred embodiment of the invention, the polynucleotide encoding VEGF 145 is present in an adenovirus expression vector, thus, in preferred aspects, the polynucleotide is flanked by adenovirus sequences. In yet other preferred aspects, the polynucleotide sequence is operably linked at its 5′ end to a promoter sequence that is active in vascular endothelial cells. In preferred expression vectors, the expression vector further comprises a partial adenoviral sequence from which the EIA/EIB genes have been deleted.

Also provided in the present invention are kits for intracoronary injection of a recombinant vector expressing VEGF 145 comprising:

a polynucleotide encoding VEGF 145 cloned into a vector suitable for expression of said polynucleotide in vivo,

a suitable container for said vector, and

instructions for injecting said vector into a patient. In more preferred aspects, the polynucleotide is cloned into an adenovirus expression vector.

In other preferred embodiments of the invention, the methods, compositions, and vectors of the present invention may be used to treat cardiovascular disease in a mammal comprising the step of administering to said mammal VEGF 145 in a therapeutically effective amount to stimulate angiogenesis. In other preferred embodiments, the methods, compositions, and vectors of the present invention may be used to treat vascular disease in a mammal comprising the step of administering to said mammal VEGF 145 in a therapeutically effective amount to stimulate vascular cell proliferation. In yet other preferred embodiments of the present invention, the methods, compositions, and vectors of the invention may be used to enhance endothelialization of diseased vessels comprising the step of administering to a mammal a therapeutically effective amount of VEGF 145 . Preferably, endothelialization comprises reendothelialization after angioplasty, to reduce or prevent restenosis. Those of skill in the art will recognize that patients treated according to the methods of the present invention may be treated with or without a stent.

In yet other preferred embodiments of the present invention, the methods, compositions, and vectors of the invention may be used to enhance drug permeation by tumors comprising administering to a patient a nucleic acid molecule coding for VEGF 145 . The VEGF 145 may be delivered directly to a tumor cell, or it may be delivered into the vascular system, preferably at a site located close to the site of the tumor. Thus, delivery of VEGF 145 in conjunction with chemotherapy to remove or reduce the size of a tumor, will help to enhance the effectiveness of the chemotherapy by increasing drug uptake by the tumor. The VEGF 145 delivered in this method may either be through direct delivery of the polypeptide or protein, or through gene therapy.

In another embodiment of the invention is provided a therapeutic composition comprising a pharmaceutically acceptable carrier and VEGF 145 in a therapeutically effective amount to stimulate vascular cell proliferation.

In other preferred embodiments of the invention is provided a filtered injectable adenovirus vector preparation, comprising: a recombinant adenoviral vector, said vector containing no wild-type virus and comprising:

a partial adenoviral sequence from which the EIA/EIB genes have been deleted, and

a transgene coding for a VEGF 145 , driven by a promoter flanked by the partial adenoviral sequence; and

a pharmaceutically acceptable carrier.

In other preferred aspects, the invention provides a recombinant plasmid comprising a polynucleotide which codes for VEGF 145 . In yet other preferred aspects, the invention provides a transformed microorganism transformed with the recombinant plasmid.

With the foregoing and other objects, advantages and features of the invention that will become hereinafter apparent, the nature of the invention may be more clearly understood by reference to the following detailed description of the invention, the figures, and the appended claims.

Also provided within the scope of the present invention are VEGF 145 polypeptides wherein at least one amino acid of exon 6a is deleted. These polypeptides and their derivatives, nucleic acids encoding for these polypeptides and their derivatives, expression vectors comprising such nucleic acids, and host cell expressing such expression vectors may be used in the methods described herein for VEGF 145 and derivatives of VEGF 145 . Preferred polypeptides include Mut-I (VEGF 145-I ), Mut-II (VEGF 145-II ), and Mut-III (VEGF 145-III ). The VEGF 145-II polypeptide is most preferred. VEGF 145-II has greater biological activity than VEGF 145 and binds less efficiently to heparin than VEGF 145 . However, VEGF 145-II binds to the extracellular matrix as efficiently as VEGF 145 . This mutant is expected to bind in-vivo to extracellular matrixes like VEGF 145 and to be slowly released from them. However, it has an advantage as it is expected to stick less to cell surface heparan-sulfates and be more diffusible than VEGF 145 as a result. It also has a higher biological potency as a mitogen for endothelial cells, which is expected to result in better angiogenic properties in-vivo.

Thus, in one preferred aspect of the invention is provided a purified polypeptide comprising a VEGF 145 polypeptide wherein said polypeptide comprises a deletion of at least one amino acid residue of exon 6a. Preferably, said polypeptide comprises a deletion of from 1 to 6 amino acid residues of VEGF 145 exon 6a. Preferably, the polypeptide comprises a deletion of at least 4, more preferably at least 6, amino acid residues of exon 6a.

Preferably said deletions are within Domain I or Domain III of exon 6a, more preferably said deletions are within Domain II of exon 6a.

Most preferably, an entire domain, Domain I, II, or III, is deleted. Preferably the polypeptides comprise the amino acid sequences of FIG. 14 ( a ): (Mut-I; VEGF 145-I ); FIG. 14 ( b ): (Mut-II; VEGF 145-II ); or FIG. 14 ( c ): (Mut-III; VEGF 145-III ).

In another aspect of the invention are provided purified and isolated nucleic acid molecules coding for the purified VEGF 145 deletion polypeptides of the invention.

Preferably such nucleic acid molecules code for an amino acid sequence comprising an amino acid sequence depicted in FIG. 14 . More preferably, such nucleic acid molecules code for the amino acid sequence of FIG. 14 ( b ). Although such nucleic acid sequences preferably comprise the nucleic acid sequence of FIG. 13 , those of ordinary skill in the art will recognize that, due to degeneracy of the genetic code, the nucleic acids of the invention are not limited to the specific sequence disclosed in FIG. 13 . Moreover, one of ordinary skill in the art can determine a nucleic acid sequence coding for the polypeptides of the invention by reviewing the diagram of FIG. 12 in view of the VEGF 145 sequence of FIG. 2 .

Use of the term “isolated” indicates that a DNA, RNA or protein has been removed from its naturally occurring environment. Thus, the sequence may be in a cell-free solution or placed in a different cellular environment. The term does not imply that the sequence is the only nucleotide chain or polypeptide present, but that it is essentially free (about 90-95% pure at least) of non-nucleotide or non-peptide material naturally associated with it. The term “purified” does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively purer than in the natural environment (compared to the natural level, this level should be at least 2-5 fold greater, e.g., in terms of mg/ml).

Also within the scope of the invention are derivatives of VEGF 145-I , VEGF 145-II , and VEGF 145-III . These derivatives are biologically active and comprise a derivative of VEGF 145-I , VEGF 145-II , or VEGF 145-III wherein an amino acid residue has been inserted, substituted, or deleted in or from the sequence of the VEGF 145-I , VEGF 145-II , or VEGF 145-III . These derivatives of VEGF 145-I , VEGF 145-II , or VEGF 145-III may be used in all of the aspects and embodiments of the present invention.

The invention also provided expression vectors comprising the nucleic acid molecules of the invention.

Preferably such expression vectors further comprise adenovirus sequences. More preferably, the nucleic acid of such an expression vector is operably linked to a promoter sequence that is active in vascular endothelial cells.

More preferably, the expression vector is an adenovirus vector. Most preferably, the expression vector further comprises a partial adenoviral sequence from which the EIA/EIB genes have been deleted.

Also provided within the scope of the present invention are kits for the intracoronary injection of a recombinant vector expressing VEGF-A 145-I , VEGF-A 145-II , or VEGF-A 145-III comprising:

a nucleic acid molecule encoding a polypeptide selected from the group consisting of VEGF-A 145-I , VEGF-A 145-II , and VEGF-A 145-III cloned into a vector suitable for expression of said nucleic acid molecule in vivo,

a suitable container for said vector, and

instructions for injecting said vector into a patient. Preferably, such kits comprise a recombinant vector comprising a nucleic acid molecule coding for VEGF 145-II , comprising the nucleotide sequence of FIG. 13 . Preferably, the nucleic acid molecule is cloned into an adenovirus expression vector.

Also provided within the scope of the present invention is a method of treating cardiovascular disease in a mammal comprising the step of transfecting cells of said mammal with a nucleic acid molecule which encodes a polypeptide selected from the group consisting of VEGF-A 145-I , VEGF-A 145-II , and VEGF-A 145-III . Preferably, said nucleic acid molecules is cloned into a vector. More preferably, said vector comprises adenovirus particles. More preferably, the adenovirus vector particles are delivered to said mammal by injection. More preferably, the number of said adenovirus particles is between about 10 10 to about 10 14 , preferably between about 10 11 to about 10 13 . Preferred transfected cells of the method are selected from the group consisting of myoblasts, myocytes, cardiocytes, cardioblasts, and smooth muscle cells. More preferably, the transfected cells are coronary artery cells and the injection is intracoronary injection.

Preferably, the adenovirus particles are injected at about 1 cm into the lumens of the left and right coronary arteries.

The method may include the transfection of cells in vivo or ex vivo.

In one preferred embodiment, the nucleic acid molecule is introduced into the coronary artery cells by a catheter inserted into the artery. Preferably, the catheter comprises an inflatable balloon having an outer surface adapted to engage the inner wall of the artery, and the nucleic acid molecule is disposed upon the balloon outer surface. More preferably, the nucleic acid molecule comprises the nucleotide sequence of FIG. 13 . The method will be understood to apply to any mammal, preferably a human.

In another aspect of the invention is provided a transformed or transfected host cell comprising an expression vector of the invention.

Also provided within the present invention is a method of producing a VEGF 145 polypeptide comprising growing, under suitable conditions, a host cell transformed or transfected with the recombinant DNA expression vector of the invention in a manner allowing expression of said polypeptide, and isolating said polypeptide from the host cell.

In another aspect of the invention is provided a method of treating a patient suffering from an ischemic condition comprising a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III . The method may preferably be enhanced by administering an agent that potentiates the therapeutic effect of VEGF 145-I , VEGF 145-II , and VEGF 145-III . Preferably the potentiating agent is an angiogenic FGF or other angiogenic factor. Such angiogenic factors are known in the art and include, for example, prostaglandins, and other VEGFs such as VEGF 165 or VEGF 121 . More preferably, the potentiating agent is selected from the group consisting of FGF-1, FGF-2, FGF-4, FGF-5, and FGF-6.

Preferably, the ischemic condition is selected from the group consisting of: cardiac infarction, chronic coronary ischemia, chronic lower limb ischemia, stroke, and peripheral vascular disease.

In another preferred aspect of the invention is provided a method of altering vascular permeability comprising administering a therapeutic amount of a pharmaceutical composition comprising a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III , in a suitable carrier. Also provided is a method for treating a patient suffering from a wound comprising administering a therapeutic amount of a pharmaceutical composition comprising a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III in a suitable carrier.

In yet another aspect of the invention is provided a method of treating vascular disease in a mammal comprising the step of administering to said mammal a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III , in a therapeutically effective amount to stimulate vascular cell proliferation.

In another preferred embodiment of the invention is provided a method for enhancing endothelialization of diseased vessels comprising the step of administering to a mammal a therapeutically effective amount of a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III . Preferably endothelialization is reendothelialization after angioplasty. Preferably, the reendothelialization reduces or prevents restenosis.

The method may preferably be enhanced by administering a potentiating agent that potentiates the angiogenic effect of said polypeptide. Preferably, the potentiating agent is an angiogenic FGF or other angiogenic factor as described herein. More preferably, the potentiating agent is selected from the group consisting of FGF-1, FGF-2, FGF-4, FGF-5, and FGF-6. The patient may be treated with or without a stent.

Preferably, an inflatable balloon catheter coated with a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III is employed to administer said VEGF 145-I , VEGF 145-II , or VEGF 145-III . Preferably, the administration comprises gene therapy. Preferably, an inflatable balloon catheter coated with a polynucleotide encoding a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III is employed to administer said gene therapy.

Also provided in the present invention are methods of enhancing drug permeation by tumors comprising administering to a patient a nucleic acid molecule coding for a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III . Preferably, the VEGF-A 138 , VEGF-A 162 , or VEGF-A 182 IS delivered directly into a tumor cell.

The present invention also provides therapeutic compositions comprising a pharmaceutically acceptable carrier and a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III in a therapeutically effective amount to stimulate vascular cell proliferation. Also provided are filtered injectable adenovirus vector preparations, comprising: a recombinant adenoviral vector, said vector containing no wild-type virus and comprising:

a partial adenoviral sequence from which the ElA/ElB genes have been deleted.

and a transgene coding for a polypeptide selected from the group consisting of VEGF 145-I , VEGF 145-II , and VEGF 145-III , driven by a promoter flanked by the partial adenoviral sequence; and

a pharmaceutically acceptable carrier.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a graphic depiction of the exons that encode various VEGF isoforms.

FIG. 2 is a nucleotide sequence of VEGF 145 cDNA protein coding region [SEQ ID No. 1]. Underlined is the sequence coding for a signal sequence for secretion that is cleaved off the mature protein.

FIG. 3 is the amino acid protein sequence of a mature VEGF 145 monomer [SEQ. ID. No. 2].

FIG. 4 is a photograph showing expression of reduced and non-reduced recombinant VEGF 145 and comparison to VEGF 145 , VEGF 145 and VEGF 165 were produced in Sf9 insect cells infected by recombinant baculoviruses encoding VEGF 145 and VEGF 165 as indicated. Conditioned medium containing recombinant VEGF was collected, and 10 μl aliquots were either reduced using 0.1 M dithiotreitol (panel A) or not reduced (panel B). Proteins were separated by SDS/PAGE (12% gel) and transferred by electroblotting to nitrocellulose. Filters were blocked for 1 h at room temperature with buffer containing 10 mM tris/HCl pH 7. 0.15M NaCl, and 0.1% Tween 20 (TBST) supplemented with 10% low-fat milk. The filters were incubated for 2 hours at room temperature with rabbit anti-VEGF polyclonal antibodies in TBST (23), washed three times with TBST, and incubated with anti-rabbit IgG peroxidase conjugated antibodies for 1 h at room temperature. Bound antibody was visualized using the ECL detection system.

FIG. 5 is a photograph showing the binding of VEGF 145 mRNA as seen in a reverse PCR type experiment analyzing mRNA isolated from two-cancerous cell lines derived from the female reproductive system (HeLa and A431 cells). Total RNA from HeLa and A431 cells was translated into cDNA and amplified by PCR using radioactively labeled nucleotides as described in materials and methods. Plasmids containing the VEGF 121 cDNA, the VEGF 165 cDNA, and the VEGF 145 recombinant cDNA were included in separate PCR reactions using the primers described in materials and methods. Shown is an autoradiogram of the gel.

FIG. 6 is a graph that describes an experiment showing that recombinant VEGF 145 is mitogenic to vascular endothelial cells. VEGF 145 stimulates the proliferation of endothelial cells: HUVEC cells were seeded in 24 well dishes (20,000 cells/well), and increasing concentrations of VEGF 121 (⋄), VEGF 145 (▪) and VEGF 165 (□) were added every other day as described in materials and methods. Cells were counted in a Coulter counter after 4 days.

FIG. 7 is a photograph of an experiment showing that VEGF 145 binds to the KDR/flk-1 VEGF receptor but not to two VEGF 165 specific VEGF receptors found on vascular endothelial cells. Effect of VEGF 145 on 125 I-VEGF 165 binding to endothelial cells. 125 I-VEGF 165 (10 ng/ml) was bound to confluent HUVEC cells grown in 5 cm dishes for 2 h at 4° C. in the presence of 1 μg/ml heparin and the following concentrations of VEGF 145 (μg/ml): Lane 1, 0; Lane 2, 0.05; Lane 3, 0.1; Lane 4, 0.25; Lane 5, 0.5; Lane 6, 1; Lane 7, 2; Lane 8, 3. Lane 9 received 2 mg/ml of VEGF 121 . Bound 125 I-VEGF165 was subsequently cross-linked to the cells using DSS, and cross-linked complexes were visualized by autoradiography.

FIG. 8 describes two experiments showing that VEGF 145 binds to the ECM produced by bovine corneal endothelial cells but VEGF 165 does not.

a. ECM-coated 96 well dishes were incubated with increasing concentrations of VEGF 145 (▪) or VEGF 165 (□). The amount of ECM-bound VEGF was quantified using the M-35 anti-VEGF monoclonal antibody as described in materials and methods.

b. 125 I-VEGF 145 (Lanes 1 and 2, 30 ng/ml or 125 I-VEGF 165 (Lane 3, 50 ng/ml) was bound to ECM coated wells. Heparin (10 μg/ml) was added with the VEGF 145 in Lane 2. The binding and the subsequent extraction of bound growth factors were done as described in materials and methods. Extracted growth factors were subjected to SDS/PAGE (12% gel) followed by autoradiography.

c. The 125 I-VEGF 145 used in the experiment shown in panel B (0.2 ng) was chromatographed under reducing conditions on a 12% SDS/PAGE gel. Shown is an autoradiogram of the gel.

FIG. 9 is a description of an experiment showing the effects of heparinase digestion of an ECM produced by bovine corneal endothelial cells on the binding of VEGF 145 and bFGF to the ECM.

a. Effect of heparin and heparinase on growth factor binding: ECM coated wells are incubated with or without 0.1 u/ml heparinase-II in binding buffer for 2 h at 37° C. Subsequently, 125 I-VEGF 145 (40 ng/ml) or 125 I-bFGF (114 ng/ml) were added to the wells in the presence or absence of 10 μg/ml heparin. Following incubation for 3 h at 25° C., the wells were washed and ECM-associated iodinated growth factors were dissociated by digestion with trypsin for 15 min at 37° C. The amount of bound growth factor was determined using a gamma-counter (100% binding was 15,000 and 25,000 CPM/well for 125 I-VEGF 145 and 125 I-FGF respectively).

b. Effect of heparin and heparinase-II on the release of bound growth factors from the ECM. 125 I-VEGF 145 or 125 I-bFGF were bound to ECM coated wells as described above. The wells were washed and re-incubated in binding buffer alone, with 10 μg/ml heparin, or with 0.1 U/ml heparinase-II in a final volume of 50 μl. Following 12 h of incubation at 25° C., the integrity of the ECM was verified by microscopy, and 45 μl aliquots were taken for counting in a gamma-counter. NaOH was then added to the wells and the amount of ECM-associated growth factors determined. The experiment was carried out in parallel to the experiment described in panel A above. The experiments in panels A and B were carried out in duplicates and variation did not exceed 10%. Shown are the mean values. The experiments were repeated 4 times with similar results.

FIG. 10 is a graph showing that VEGF 145 bound to the ECM is biologically active. Wells of 24 well dishes were coated with an ECM produced by BCE cells cultured in the presence of 30 mM chlorate. The ECM coated wells were incubated with increasing concentrations of VEGF 145 (▪) or VEGF 165 (□) as indicated, and washed extensively as described. HUVEC cells (15,000 cells/well) were seeded in the ECM coated wells in growth medium lacking growth factors. Cells were trypsinzed and counted after three days. The numbers represent the average number of cells in duplicate wells.

FIG. 11 is a photograph showing clusters of alginate beads containing cells expressing or not expressing VEGF 145 . Clusters containing VEGF 145 expressing cells are gorged with blood. VEGF 145 stimulates angiogenesis in vivo: The angiogenic activity of VEGF 145 was determined using the alginate assay. Stable clones of BHK-21 cells transfected with the MIRB expression vector (MIRB) or with the VEGF 145 expression vector MIRB/VEGF 145 , were trypsinized and suspended in DMEM to a concentration of 2.7×10 7 cells/ml. Sodium alginate (1.2%, 0.66 ml) was mixed with 1.33 mil of cell suspension. Beads of 1 μl diameter were formed by contact with a solution of 80 mM CaCl 2 . The beads were washed three times with saline. Each Balb/c mouse out of a group of 4 was injected subcutaneously with 400 μl of packed beads containing a given cell type. Clusters of beads were excised after 4 days and photographed. Blood-rich areas appear as dark areas in the photograph.

FIG. 12 is a schematic description of the VEGF 145 deletion mutants Mut-I, Mut-II, and Mut-III. In Mut-I, amino acids in Domain I (as indicated by the Roman numeral above the sequence) are deleted. In Mut-II, amino acids in Domain II are deleted. In Mut-III, amino acids in Domain III are deleted. Arrows denote different PCR primers used to carry out deletions.

FIG. 13 depicts the nucleotide sequence of Mut-II. Underlined is the sequence coding for a signal sequence for secretion that is cleaved off the mature protein. An asterisk indicates the site of the deleted sequence of Domain II.

FIG. 14 depicts the amino acid sequences of (a)Mut-I, (b)Mut-II, and (c) Mut-III. An asterisk indicates the site of the deleted sequence in each mutant.

FIG. 15 is a photograph showing the baculovirus expression products of Mut-I, Mut-II, and Mut-III in comparison to recombinant monomers of VEGF 145 and VEGF 165 . The methods used were as in the description of FIG. 4 .

FIG. 16 is a photograph of the results of the heparin-sepharose chromatography of Mut-II, as expressed in the baculovirus expression system. Shown is a Western blot of different fractions that eluted from a heparin-sepharose column using a salt gradient.

FIG. 17 is a graph that depicts the results of an experiment showing that Mut-II is mitogenic to vascular endothelial cells. Mut-II (-▪-) has a greater biological potency as compared to VEGF 145 (-□-). The methods used were as in the description of FIG. 6 .

FIG. 18 is a graph that depicts the binding of Mut-II (-⋄-) to the ECM as compared to VEGF 145 (-□-) and VEGF 165 (-▪-).

FIG. 19 is a graphical depiction of Regional Contractile Function and Regional Myocardial Blood Flow (perfusion). Bars represent mean values, error bars denote 1 SD. Analyses were performed without knowledge of treatment group. P values from two-tailed t-test.

FIG. 20 is a graphical documentation of protein expression. A monoclonal antibody directed against VEGF 165 , which also identifies VEGF 145 was used in immunoblots conducted on homogenates of left ventricle from two animals that had received VEGF 145 gene transfer (277 and 282) and from an animal that had not received gene transfer (160). Recombinant VEGF 145 (r-VEGF) was used as a positive control (not shown).

DETAILED DESCRIPTION OF THE INVENTION

The following abbreviations are used herein.

BCE                              Bovine corneal endothelial cells
bFGF                             Basic fibroblast growth factor
ECM                              Extracellular matrix
HUVEC                            Human umbilical vein derived endothelial
                                 cells
VEGF                             Vascular endothelial growth factor
VEGF                                                                        xxx Vascular endothelial growth factor form
                                 containing a designated number (xxx) of
                                 amino-acids.

The present invention relates to a novel VEGF protein product, and nucleic acids encoding the novel protein product (FIG. 2 ), comprising exons 1 - 6 and 8 of the VEGF gene, and its use thereof in treating cardiovascular disease. As used herein “cardiovascular disease” means disease which results from a cardiovascular insufficiency, including, but not limited to, coronary artery disease, congestive heart failure, and peripheral vascular disease. The methods of the present invention relate to the treatment of mammalian patients, preferably humans.

The VEGF 145 protein forms active homodimers bound by disulfide bridges (FIG. 3 ). VEGF 145 is an active mitogen for vascular dendothelial cells and to function as an angiogenic factor in-vivo. VEGF 145 was compared with previously characterized VEGF species with respect to cellular distribution, susceptibility to oxidative damage, and extra-cellular matrix (ECM) binding ability. VEGF 145 is secreted from producer cells and can bine efficiently to the ECM, rendering it the only known VEGF variant having both of these attributes.

As used herein, “vascular endothelial cell growth factor,” or “VEGF” refers to a family of angiogenic growth factors encoded by the human VEGF gene.

“VEGF 145 ” refers to a VEGF form containing about 145 amino-acids created as a result of alternative splicing of VEGF mRNA and containing the peptides encoded by exons 1 - 5 , 6 a and 8 of the VEGF gene. The term “VEGF 145 ” also refers to derivatives and functional equivalents of the native VEGF 145 monomers comprise the amino acids sequence. Mature VEGF 145 monomers comprise the amino acid sequence shown in FIG. 3 . However, as used herein, the term VEGF 145 refers to both the mature form and the pro-form of VEGF 145 , including a signal sequence, or derivatives or functional equivalents thereof. VEGF 145 is expressed in several cell lines ( FIG. 4 ) and was shown to be expressed in OC238 ovarian carcinoma cells using sequencing of the region encompassing exons 5 - 8 of VEGF cDNA prepared from the OC238 cells.

“Derivatives” of a VEGF 145 polypeptide or subunit or VEGF 145-I , VEGF 145-II , or VEGF 145-III polypeptide or subunit are functional equivalents having similar amino acid sequence and retaining, to some extent, the activities of the original polypeptide or subunit (VEGF 145 , VEGF 145-I , VEGF 145-II , or VEGF 145-III ). By “functional equivalent” is meant the derivative has an activity that can be substituted for the activity of the original polypeptide or subunit. Preferred functional equivalents retain the full level of activity of the original polypeptide or subunit as measured by assays known to these skilled in the art, and/or in the assays described herein. Preferred functional equivalents have activities that are within 1% to 10,000% of the activity of the original polypeptide or subunit, more preferably between 10% to 1000%, and more preferably within 50% to 200%. Derivatives have at least 50% sequence similarity, preferably 70%, more preferably 90%, and even more preferably 95% sequence similarity to the original polypeptide or subunit. “Sequence similarity” refers to “homology” observed between amino acid sequences in two different polypeptides, irrespective of polypeptide origin.

The ability of the derivative to retain some activity can be measured using techniques described herein and/or using techniques known to those skilled in the art for measuring the activity of other VEGF isoforms. Derivatives include modification occurring during or after translation, for example, by phosphorylation, glycosylation, crosslinking, acylation, proteolytic cleavage, linkage to an antibody molecule, membrane molecule or other ligand (see Ferguson et al., 1988, Annu. Rev. Biochem. 57:285-320).

Specific types of derivatives also include amino acid alterations such as deletions, substitutions, additions, and amino acid modifications. A “deletion” refers to the absence of one or more amino acid residue(s) in the related polypeptide. An “addition” refers to the presence of one or more amino acid residue(s) in the related polypeptide. Additions and deletions to a polypeptide may be at the amino terminus, the carboxy terminus, and/or internal. Amino acid “modification” refers to the alteration of a naturally occurring amino acid to produce a non-naturally occurring amino acid. A “substitution” refers to the replacement of one or more amino acid residue(s) by another amino acid residue(s) in the polypeptide. Derivatives can contain different combinations of alterations including more than one alteration and different types of alterations.

Although the effect of an amino acid change varies depending upon factors such as phosphorylation, glycosylation, intra-chain linkages, tertiary structure, and the role of the amino acid in the active site or a possible allosteric site, it is generally preferred that the substituted amino acid is from the same group as the amino acid being replaced. To some extent the following groups contain amino acids which are interchangeable: the basic amino acids lysine, arginine, and histidine; the acidic amino acids aspartic and glutamic acids; the neutral polar amino acids serine, threonine, cysteine, glutamine, asparagine and, to a lesser extent, methionine; the nonpolar aliphatic amino acids glycine, alanine, valine, isoleucine, and leucine (however, because of size, glycine and alanine are more closely related and valine, isoleucine and leucine are more closely related); and the aromatic amino acids phenylalanine, tryptophan, and tyrosine. In addition, although classified in different categories, alanine, glycine, and serine seem to be interchangeable to some extent, and cysteine additionally fits into this group, or may be classified with the polar neutral amino acids.

Although proline is a nonpolar neutral amino acid, its replacement represents difficulties because of its effects on conformation. Thus, substitutions by or for proline are not preferred, except when the same or similar conformational results can be obtained. The conformation conferring properties of proline residues may be obtained if one or more of these is substituted by hydroxyproline (Hyp).

Examples of modified amino acids include the following: altered neutral nonpolar amino acids such as amino acids of the formula H 2 N(CH 2 ) n COOH where n is 2-6, sarcosine (Sar), t-butylalanine (t-BuAla), t-butylglycine (t-BuGly), N-methyl isoleucine (N-MeIle), and norleucine (Nleu); altered neutral aromatic amino acids such as phenylglycine; altered polar, but neutral amino acids such as citrulline (Cit) and methionine sulfoxide (MSO); altered neutral and nonpolar amino acids such as cyclohexyl alanine (Cha); altered acidic amino acids such as cysteic acid (Cya); and altered basic amino acids such as ornithine (Orn).

Preferred derivatives have one or more amino acid alteration(s) that do not significantly affect that receptor-binding activity of the original polypeptide or subunit. In regions of the original polypeptide or subunit polypeptide sequence not necessary for the original polypeptide or subunit activity, amino acids may be deleted, added or substituted with less risk of affecting activity. In regions required for the original polypeptide or subunit activity, amino acid alterations are less preferred as there is a greater risk of affecting the original polypeptide or subunit activity. Such alterations should be conservative alterations. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent.

Conserved regions tend to be more important for protein activity than non-conserved regions. Standard procedures can be used to determine the conserved and non-conserved regions important for receptor activity using in vitro mutagenesis techniques or deletion analyses and measuring receptor activity as described by the present disclosure.

Derivatives can be produced using standard chemical techniques and recombinant nucleic acid molecule techniques. Modifications to a specific polypeptide may be deliberate, as through site-directed mutagenesis and amino acid substitution during solid-phase synthesis, or may be accidental such as through mutations in hosts which produce the polypeptide. Polypeptides including derivatives can be obtained using standard techniques such as those described in Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989). For example, Chapter 15 of Sambrook describes procedures for site-directed mutagenesis of cloned DNA.

In one aspect the invention features a nucleic acid molecule, or poly nucleotide encoding VEGF 145 . In some situations it is desirable for such nucleic acid molecule to be enriched or purified. By the use of the term “enriched” in reference to nucleic acid molecule is meant that the specific DNA or RNA sequence constitutes a significantly high fraction (2-5 fold) of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. This could be caused by a person by preferential reduction in the amount of other DNA or RNA present, or by a preferential increase in the amount of the specific DNA or RNA sequence, or by a combination of the two. However, it should be noted that enriched does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased. The term significant here is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to other nucleic acids of about at least 2 fold, more preferably at least 5 to 10 fold or even more. The term also does not imply that there is no DNA or RNA from other sources. The other source DNA may, for example, comprise DNA from a yeast or bacterial genome, or a cloning vector such as pUC19. This term distinguishes from naturally occurring events, such as viral infection, or tumor type growths, in which the level of one mRNA may be naturally increased relative to other species of mRNA. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired nucleic acid.

The nucleic acid molecule may be constructed from an existing VEGF nucleotide sequence by modification using, for example, oligonucleotide site-directed mutagenesis, or by deleting sequences using restriction enzymes, or as described herein. Standard recombinant techniques for mutagenesis such as in vitro site-directed mutagenesis (Hutchinson et al., J. Biol. Chem. 253:6551, (1978), Sambrook et al., Chapter 15, supra), use of TAB® linkers (Pharmacia), and PCR-directed mutagenesis can be used to create such mutations. The nucleic acid molecule may also be synthesized by the triester method or by using an automated DNA synthesizer.

The invention also features recombinant DNA vectors preferably in a cell or an organism. The recombinant DNA vectors may contain a sequence coding for VEGF 145 protein or a functional derivative thereof in a vector containing a promoter effective to initiate transcription in a host cell. The recombinant DNA vector may contain a transcriptional initiation region functional in a cell and a transcriptional termination region functional in a cell. Where the DNA vector contains sufficient control sequences, such as initiation and/or termination regions, such that the inserted nucleic acid molecule may be expressed in a host cell, the vector may also be called an “expression vector.”

The present invention also relates to a cell or organism that contains the above-described nucleic acid molecule or recombinant DNA vector and thereby is capable of expressing a VEGF 145 peptide. The peptide may be purified from cells which have been altered to express the polypeptide. A cell is said to be “altered to express a desired polypeptide” when the cell, through genetic manipulation, is made to produce a protein which it normally does not produce or which the cell normally produces at lower levels. One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or synthetic sequences into either eukaryotic or prokaryotic cells.

A nucleic acid molecule, such as DNA, is said to be “capable of expressing” a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide. The precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5′-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.

For example, the entire coding sequence of VEGF 145 may be combined with one or more of the following in an appropriate expression vector to allow for such expression: (1) an exogenous promoter sequence (2) a ribosome binding site (3) a polyadenylation signal (4) a secretion signal (5) a promiscuous or tissue specific enhancer. Modifications can be made in the 5′-untranslated and 3′-untranslated sequences to improve expression in a prokaryotic or eukaryotic cell; or codons may be modified such that while they encode an identical amino acid, that codon may be a preferred codon in the chosen expression system. The use of such preferred codons is described in , for example, Grantham et al., Nuc. Acids Res., 9:43-74 (1981), and Lathe, J. Mol. Biol., 183:1-12 (1985) hereby incorporated by reference herein in their entirety.

If desired, the non-coding region 3′ to the genomic VEGF 145 protein sequence may be operably linked to the nucleic acid molecule encoding VEGF 145 . This region may be used in the recombinant DNA vector for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 3′-region naturally contiguous to the DNA sequence encoding VEGF, the transcriptional termination signals may be provided. Alternatively, a 3′ region functional in the host cell may be substituted.

An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression. Two DNA sequences (such as a promoter region sequence and a VEGF145 protein sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation in the coding sequence, (2) interfere with the ability of the promoter region sequence to direct the transcription of VEGF 145 protein gene sequence, or (3) interfere with the ability of the VEGF 145 protein gene sequence to be transcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence. Thus, to express a VEGF 145 transcriptional and translational signals recognized by an appropriate host are necessary.

Those skilled in the art will recognize that the VEGF 145 protein of the present invention may also be expressed in various cell systems, both prokaryotic and eukaryotic, all of which are within the scope of the present invention.

Although the VEGF 145 protein of the present invention may be expressed in prokaryotic cells, which are generally very efficient and convenient for the production of recombinant proteins, the VEGF 145 produced by such cells will not be glycosylated and therefore may have a shorter half-life in vivo. Prokaryotes most frequently are represented by various strains of E. coli . However, other microbial strains may also be used, including other bacterial strains. Recognized prokaryotic hosts include bacteria such as E. coli , Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. The prokaryotic host must be compatible, with the replicon and control sequences in the expression plasmid.

In prokaryotic systems, plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host may be used. Examples of suitable plasmid vectors may include pBR322, pUC118, pUC119 and the like; suitable phage or bacteriophage vectors may include ygt10, ygt11 and the like; and suitable virus vectors may include pMAM-neo, pKRC and the like. Preferably, the selected vector of the present invention has the capacity to replicate in the selected host cell.

To express VEGF 145 polypeptides or subunits (or a functional derivative thereof) in a prokaryotic cell, it is necessary to operably link the VEGF 145 protein sequence to a functional prokaryotic promoter. Such promoters may be either constitutive or, more preferably, regulatable (i.e., inducible or repressible). Examples of constitution promoters include the int promoter of bacteriophage λ, the bla promoter of the β-lactamase gene sequence of pBR322, and the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage λ (P L and P R ), the trp, recA, λacZ, λacI, and gal promoters or E. coli , the α-amylase (Ulmanen et al., J. Bacteriol . 162;176-182 (1985) and the ç-28-specific promoters of B. subtilis (Gilman et at., Gene sequence 32:11-20(1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli , Academic Press, Inc., N.Y. (1982)), and Streptomyces promoters (Ward et at., Mol. Gen. Genet . 203:468-478 (1986)). Prokaryotic promoters are reviewed by Glick ( J. Ind. Microbiot . 1:277-282(1987)); Cenatiempo ( Biochimie 68:505-516 (1986)); and Gottesman ( Ann. Rev. Genet . 18:415-442 (1984)).

Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream of the gene sequence-encoding sequence. Such ribosome binding sites are disclosed, for example, by Gold et at. ( Ann. Rev. Microbiol . 35:365-404(1981)). The ribosome binding site and other sequences required for translation initiation are operably linked to the nucleic acid molecule coding for VEGF 145 by, for example, in frame ligation of synthetic oligonucleotides that contain such control sequences. For expression in prokaryotic cells, no signal peptide sequence is required. The selection of control sequences, expression vectors, transformation methods, and the like, are dependant on the type of host cell used to express the gene.

As used herein, “cell”, “cell line”, and “cell culture” may be used interchangeably and all such designations include progeny. Thus, the words “transformants” or “transformed cells” include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. VEGF 145 expressed in prokaryotic cells is expected to comprise mixture of properly initiated VEGF 145 protein peptides with the N-terminal sequence predicted from the sequence of the expression vector, and VEGF 145 protein peptides that have an N-terminal methionine resulting from inefficient cleaving of the initiation methionine during bacterial expression. Both types of VEGF 145 peptides are considered to be within the scope of the present invention as the presence of an N-Terminal methionine is not expected to affect biological activity. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell.

Preferred prokaryotic vectors include plasmids such as those capable .of replication in E. coli (such as, for example, pBR322, ColEl, pSC101, pACYC 184, nVX. Such plasmids are, for example, disclosed by Sambrook (cf. “ Molecular Cloning: A Laboratory Manual ”, second edition, edited by Sambrook, Fritsch, & Maniatis, Cold Spring Harbor Laboratory, (1989)). Bacillus plasmids include pC194, pC221, pT127, and the like. Such plasmids are disclosed by Gryczan ( In: The Molecular Biology of the Bacilli , Academic Press, NY (1982), pp. 307-329). Suitable Streptomyces plasmids include plJ101 (Kendall et al., J. Bacteriol . 169:4177-4183 (1987)), and streptomyces bacteriophages such as φC31 (Chater et al., In: Sixth International Symposium on Actinomycetales Biology , Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54). Pseudomonas plasmids are reviewed by John et al. ( Rev. Infect. Dis . 8:693-704(1986)), and Izaki ( Jpn. J. Bacteriol . 33:729-742(1978)).

Eukaryotic host cells that may be used in the expression systems of the present invention are not strictly limited, provided that they are suitable for use in the expression of VEGF 145 Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian cells either in vivo, or in tissue culture. Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO or CHO-Kl, or cells of lymphoid origin and their derivatives.

The VEGF 145 proteins of the present invention may also be expressed in human cells such as human embryo kidney 293EBNA cells, which express Epstein-Barr virus nuclear antigen 1, as described, for example, in Olofsson, H. et al., Proc. Natl. Acad. Sci . USA 93:2576-2581, (1996). The cells are transfected with the expression vectors by using calcium phosphate precipitation, and the cells are then incubated for at least 48 hours. The VEGF 145 peptides may then be purified from the supernatant as described in Example 3.

In addition, plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, and nopaline synthase promoter and polyadenylation signal sequences. Another preferred host is an insect cell, or example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used. Rubin, Science 240:1453-1459 (1988).

Any of a series of yeast gene sequence expression systems can be utilized which incorporate promoter and termination elements from the actively expressed gene sequences coding for glycolytic enzymes are produced in large quantities when yeast are grown in mediums rich in glucose. Known glycolytic gent sequences can also provide very efficient transcriptional control signals. Yeast provides substantial advantages in that it can also carry out post-translational peptide modifications. A number of recombinant DNA strategies exist which utilize strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian gene sequence products and secretes peptides bearing leader sequences (i.e., pre-peptides). For a mammalian host, several possible vector systems are available for the expression of VEGF 145 peptides.

A wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host. The transcriptional and translational regulatory signals may be derived from vital sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression. Alternatively, promoters from mammalian expression products, such as actin, collagen, myosin, and the like, may he employed. Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated. Of interest are regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.

Expression of VEGF 145 in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al., J. Mol. Appl. Gen . 1:273-288(1982)); the TK promoter of Herpes virus (McKnight, Cell 31:355-365 (1982)); the SV40 early promoter (Benoist et al., Nature (London) 290:304-310(1981)); the yeast gal4 gene sequence promoter (Johnston et al., Proc. Natl. Acad. Sci . (USA) 79:6971-6975(1982); Silver et al., Proc. Natl. Acad. Sci . (USA) 81:5951-5955 (1984)).

Translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence that encodes a VEGF 145 (or a functional derivative thereof) does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG). The presence of such codons results either in a formation of a fusion protein (if the AUG codon is in the same reading frame as the VEGF 145 protein coding sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as the VEGF 145 protein coding sequence).

A VEGF 145 nucleic acid molecule and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a nonreplicating DNA (or RNA) molecule, which may either be a linear molecule ox, more preferably, a closed covalent circular molecule. Because such molecules are incapable of autonomous replication, the expression of the gene may occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced DNA sequence into the host chromosome.

A vector may be employed that is capable of integrating the desired gene sequences into the host cell chromosome. Cells that have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers that allow for selection of host cells which contain the expression vector. The marker may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of single chain binding protein mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include these described by Okayama, Molec. Cell. Biol . 3:280(1983).

The introduced nucleic acid molecule can be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to “shuttle” the vector between host cells of different species.

In preferred methods of the invention, the vector is a viral vector or a lipid-based vector, preferably a viral vector. The vector can be a targeted vector, especially a targeted vector that preferentially binds to ventricular myocytes. Presently preferred viral vectors are derived from adenovirus (Ad) or adeno-associated virus (AAV). Both human and non-human viral vectors can be used but preferably the recombinant viral vector is replication-defective in humans. Where the vector is an adenovirus, it preferably comprises a polynucleotide having a promoter operably linked to a gene encoding an angiogenic protein or peptide, and is replication-defective in humans.

Presently preferred replication-defective adenoviral vectors have deletions that remove the E1A and E1B genes, or have deletions that remove the E1A E1B and E4 genes. Preferably about 10 10 to 10 14 adenovirus vector particles, more preferably about 10 11 to 10 13 vector particles, most preferably about 10 12 vector particles, are introduced into a blood vessel, preferably a blood vessel supplying the myocardium.

For AAV vectors, the vector preferably comprises a polynucleotide having a promoter operably linked to a gene encoding an angiogenic protein or peptide, and preferably, the gene encoding the angiogenic protein or peptide is flanked by AAV inverted terminal repeats (ITRs). Preferably, the AAV vector is replication-defective in humans. Presently preferred replication-defective AAV vectors have deletions affecting one or more AAV replication or encapsidation sequences. Alternatively, the vector can be a lipid-based vector comprising a gene encoding an angiogenic protein or peptide as described herein.

Once the vector or nucleic acid molecule containing the construct(s) has been prepared for expression, the DNA construct (s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, lipofection, calcium phosphate precipitation, direct microinjection, DEAE-dextran transfection, and the like. The most effective method for transfection of eukaryotic cell lines with plasmid DNA varies with the given cell type. After the introduction of the vector, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene molecule(s) results in the production of a VEGF 145 or a VEGF 145 derivative. This can take place in the transformed cells as such, or following the induction of these cells to differentiate (for example, by administration of bromodeoxyuracil to neuroblastoma cells or the like). A variety of incubation conditions can be used to form the peptide of the present invention. The most preferred conditions are those which mimic physiological conditions.

Production of the stable transfectants, may be accomplished by, for example, by transfection of an appropriate cell line with a eukaryotic expression vector, such as pCEP4, in which the coding sequence for the VEGF protein has been cloned into the multiple cloning site. These expression vectors contain a promoter region, such as the human cytomegalovirus promoter (CMV), that drive high-level transcription of desired DNA molecules in a variety of mammalian cells. in addition, these vectors contain genes for the selection of cells that stably express the DNA molecule of interest. The selectable marker in the pCEP4 vector encodes an enzyme that confers resistance to hygromycin, a metabolic inhibitor that is added to the culture to kill the nontransfected cells.

Cells that have stably incorporated the transfected DNA may be identified by their resistance to selection media, as described above, and clonal call lines will be produced by expansion of resistant colonies. The expression of a VEGF protein by these cell lines may be assessed by methods known in the art, for example, by RNAse protection assay, Northern blot, or western blot analysis.

Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-micron circle, and the like, or their derivatives. Such plasmids are well known is the art (Botstein et al., Miami Wntr. Symp . 19:265-274(1982); Broach, Ind.: “ The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance ”, Cold spring Harbor Laboratory, Cold Spring Harbor, N.Y., p. 445-470 (1981); Broach, Cell . 28:203-204 (1982); Bollon et al., J. Clip. Hematol. Oncol . 10:3948 (1980) ; Maniatis, In: Cell Biology: A Comprehensive Treatise , Vol. 3, Gene Sequence Expression, Academic Press, NY, pp. 563-608(1980).

Once the vector or nucleic acid molecule containing the construct(s) has been prepared for expression, the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protaplast fusion, electroporation, particle gun technology, lipofection, calcium phosphate precipitation, direct microinjection, DEAE-dextran transfection, and the like. The most effective method for transfection of eukaryotic cell lines with plasmid DNA varies with the given cell type. After the introduction of the vector, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells, Expression of the cloned gene molecule(s) results in the production of VEGF 145 . This can take place in the transformed cells as such, or following the induction of these cells to differentiate (for example, by administration of bromodeoxyuracil to neuroblastoma cells or the like). A variety of incubation conditions can be used to form the peptide of the present invention. The most preferred conditions are those which mimic physiological conditions.

Production of the stable transfectants, may be accomplished by, for example, by transfection of an appropriate cell line with a eukaryotic expression vector, such as pCEP4, in which the coding sequence for VEGF 145 has been cloned into, the multiple cloning site. These expression vectors contain a promoter region. such as the human cytomegalovirus promoter (CMV), that drive high-level transcription of desired DNA molecules in a variety of mammalian cells. In addition, these vectors contain genes for the selection of cells that stably express the DNA molecule of interest. The selectable marker in the pCEP4 vector encodes an enzyme that confers resistance to hygromycin, a metabolic inhibitor that is added to the culture to kill the nontransfected cells.

Cells that have stably incorporated the transfected DNA may be identified by their resistance to selection media, as described above, and clonal cell lines will be produced by expansion of resistant colonies. The expression of VEGF 145 by these cell lines may be assessed by methods known in the art; for example, by RNase protection assay, solution hybridization and Northern blot, or western blot analysis.

Pharmaceutical Compositions and Therapeutic Uses

One object of this invention is to provide VEGF 145 is a pharmaceutical composition suitable for therapeutic use. Thus, in one aspect the invention, provides a method for stimulating vascular cell proliferation in a patient by administering a therapeutically effective amount of pharmaceutical composition comprising VEGF 145 .

By “therapeutically effective amount” is meant an amount of a compound that produces the desired therapeutic effect in a patient. For example, in reference to a disease or disorder, it is the amount which reduces to some extent one or more symptoms of the disease or disorder, and returns to normal, either partially or completely, physiological or biochemical parameters associated or causative of the disease or disorder. When used to therapeutically treat a patient it is an amount expected to be between 0.1 mg/kg to 100 mg/kg, preferably less than 50 mg/kg, mere preferably less than 10 mg/kg, more preferably less than 1 mg/kg. The amount of compound depends on the age, size, and disease associated with the patient.

The optimal formulation and mode of administration of compounds of the present application to a patient depend on factors known in the art such as the particular disease or disorder, the desired effect, and the type of patient. While the compounds will typically be used to treat human patients, they may also be used to treat similar or identical diseases in other mammals such as other primates, farm animals such as swine, cattle and poultry, and sports animals and pets such as horses, dogs and cats.

Preferably, the therapeutically effective amount is provided as a pharmaceutical composition. A pharmacological agent or composition refers to an agent or composition in a form suitable for administration into a multicellular organism such as a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should allow the agent or composition to reach a target cell whether the target cell is present in a multicellular host or in culture. For example, pharmacological agents or compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms which prevent the agent or composition from exerting its effect.

The claimed compositions can also be formulated as pharmaceutically acceptable salts (e.g., acid addition salts) and/or complexes thereof. Pharmaceutically acceptable salts are non-toxic salts at the concentration at which they are administered. The preparation of such salts can facilitate the pharmacological use by altering the physical-chemical characteristics of the composition without preventing the composition from exerting its physiological effect. Examples of useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing the solubility to facilitate the administration of higher concentrations of the drug.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, hydrochloride, phosphate, sulfonate, sulfamate, sulfate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclolexylsulfonate, cyclohexylsulfamate and quinate. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, sulfuric acid, phosphoric acid, sulfonic acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclcohexylsulfonic acid, cyclohexylsulfamic acid, and quinic acid. Such salts may be prepared by, far example, reacting the free acid or base forms of the product with one or more equivalents of the appropriate base or acid in a solvent or medium in which the salt is insoluble, or in a solvent such as water which is then removed in vacuo or by freeze-drying or by exchanging the ions of an existing salt for another ion on a suitable ion exchange resin.

Carriers or excipients can also be used to facilitate administration of the compound. Examples of carriers and excipients include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. The compositions or pharmaceutical composition can be administered by different routes including intravenously, intraperitoneal, subcutaneous, and intramuscular, orally, topically, or transmucosally.

The desired isotonicity may be accomplished using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, polyols (such as mannitol and sorbitol), or other inorganic or organic solutes. Sodium chloride is preferred particularly for buffers containing sodium ions.

The compounds of the invention can be formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences , 18th Edition, Mack Publishing Co., Easton, Pa., 1990. See also Wang, Y. J. and Hanson, M. A. “ Parenteral Formulations of Proteins and Peptides: Stability and Stabilizers”, Journal of Parenteral Science and Technology , Technical Report No. 10, Supp. 42:2S (1988). A suitable administration format may best be determined by a medical practitioner for each patient individually.

For systemic administration, injection is preferred, e.g., intramuscular, intravenous, intraperitoneal, subcutaneous, intrathecal, or intracerebroventricular. For injection, the compounds of the invention are formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. Alternatively, the compounds of the invention are formulated in one or more excipients (e.g., propylene glycol) that are generally accepted as safe as defined by USP standards. They can, for example, be suspended in an inert oil, suitably a vegetable oil such as sesame, peanut, olive ail, or other acceptable carrier. Preferably, they are suspended in an aqueous carrier, for example, in an isotonic buffer solution at a pH of about 5.6 to 7.4, These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH buffering agents. Useful buffers include for example, sodium acetate/acetic acid buffers. A form of repository or “depot” slow release preparation may be used so that therapeutically effective amounts of the preparation are delivered into the bloodstream over many hours or days following transdermal injection or delivery. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.

An inflatable balloon catheter with VEGF 145 protein coating the balloon may also be employed to deliver the substance to a targeted artery.

Alternatively, the compounds may be administered orally. For oral administration, the compounds are formulated into conventional oral dosage forms such as capsules, tablets and tonics.

Systemic administration can also be by transmucosal or transdermal means, or the molecules can be administered orally. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation, Transmucosal administration may be, for example, through nasal sprays or using suppositories. For oral administration, the molecules are formulated into conventional oral administration dosage forms such as capsules, tablets, and liquid preparations.

For topical administration, the compounds of the invention are formulated into ointments, salves, gels. or creams, as is generally known in the art.

If desired solutions of the above compositions may be thickened with a thickening agent such as methyl cellulose. They may be prepared is emulsified form, either water in oil or oil in water. Any of a wide variety of pharmaceutically acceptable emulsifying agents may be employed including, for example, acacia powder, a non-ionic surfactant (such as a Tween), or an ionic surfactant (such as alkali polyether alcohol sulfates or sulfonates, e.g., a Triton).

Compositions useful in the invention are prepared by mixing the ingredients following generally accepted procedures. For example, the selected components may be simply mixed in a blender or other standard device to produce a concentrated mixture which may then be adjusted to the final concentration and viscosity by the addition of water or thickening agent and possibly a buffer to control pH or an additional solute to control tonicity.

The amounts of various compounds of this invention to be administered can be determined by standard procedures. Generally, a therapeutically effective amount is between about 1 nmole and 3 μmole of the molecule, preferably between about 10 nmole and 1 μmole depending on the age and size of the patient, and the disease or disorder associated with the patient. Generally, it is an amount between about 0.1 and 50 mg/kg, preferably 1 and 20 mg/kg of the animal to be treated.

For use by the physician, the compositions will be provided in dosage unit form containing an amount of a VEGF 145 .

Gene Therapy

VEGF 145 will also be useful in gene therapy (reviewed in Miller, Nature 357:455-460 (1992)). Miller states that advances have resulted in practical approaches to human gene therapy that have demonstrated positive initial results. The basic science of gene therapy is described in Mulligan, Science 260:926-931 (1993). One example of gene therapy is presented in Example VII, which describes the use of adenovirus-mediated gene therapy.

As another example, an expression vector containing the VEGF 145 coding sequence may be inserted into cells, the cells are grown in vitro and then infused in large numbers into patients. In another example, a DNA segment containing a promoter of choice (for example a strong promoter) is transferred into cells containing an endogenous VEGF 145 in such a manner that the promoter segment enhances expression of the endogenous VEGF 145 gene (for example, the promoter segment is transferred to the cell such that it becomes directly linked to the endogenous VEGF 145 (gene).

The gene therapy may involve the use of an adenovirus vector including a nucleotide sequence coding for VEGF 145 , or a naked nucleic acid molecule coding for VEGF 145 . Alternatively, engineered cells containing a nucleic acid molecule ceding for VEGF 145 may be injected. Example VII illustrates a method of gene therapy using an adenovirus vector to provide angiogenesis therapy.

Expression vectors derived from viruses such as retroviruses, vaccinia virus, adenovirus adeno-associated virus, herpes viruses, several RNA viruses, or bovine papilloma virus, may be used for delivery of nucleotide sequences (e.g., cDNA) encoding recombinant VEGF 145 into the targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors containing coding sequences. See, for example, Nabel, E. G., Circulation, 91, 541-548 (1995), the techniques described in Maniatis et al., Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, N.Y. (1989), and in Ausubel et al., Current Protocols in Molecular Biology , Greene Publishing Associates and Wiley Interscience, N.Y. (1989). Alternatively, recombinant nucleic acid molecules encoding protein sequences can be used as naked DNA or in reconstituted system e.g., liposomes or other lipid systems for delivery to target cells (See e.g., Felgner et al., Nature 337:387-8, 1989). Several other methods for the direct transfer of plasmid DNA into cells exist for use in human gene therapy and involve targeting the DNA to receptors on cells by complexing the plasmid DNA to proteins. See, Miller, Nature 357:455-60, 1992.

In its simplest form, gene transfer can be performed by simply injecting minute amounts of DNA into the nucleus of a cell, through a process of microinjection. Capecchi, M. R., Cell 22:479-88 (1980). Once recombinant genes are introduced into a cell, they can be recognized by the cells normal mechanisms for transcription and translation, and a gene product will be expressed. Other methods have also been attempted for introducing DNA into larger numbers of cells. These methods include: transfection, wherein DNA is precipitated with CaPO 4 and taken into cells by pinocytosis (Chen, C. and Okayama, H., Mol. Cell Biol. 7:2745-52 (1987)); electroporation, wherein cells are exposed to large voltage pulses to introduce holes into the membrane (Chu, G. et al., Nucleic Acids Res. , 15:1311-26 (1987)); lipofection/liposome fusion, wherein DNA is packaged into lipophilic vesicles which fuse with a target cell (Felgner, P. L., et al., Proc. Natl. Acad. Sci. USA. 84:7413-7 (1987)); and particle bombardment using DNA bound to small projectiles (Yang, N. S., et al., Proc. Natl. Acad. Sci. 87:9568-72 (1990)). Another method for introducing DNA into cells is to couple the DNA to chemically modified proteins.

It has also been shown that adenovirus proteins are capable of destabilizing endosomes and enhancing the uptake of DNA into cells. The admixture of adenovirus to solutions containing DNA complexes, or the binding of DNA to polylysine covalently attached to adenovirus using protein crosslinking agents substantially improves the uptake and expression of the recombinant gene. Curiel, D. T., et al., Am. J. Respir. Cell. Mol. Biol. , 6:247-52 (1992).

A balloon catheter, such as those used in angioplasty, may be employed wherein the balloon is coated with the VEGF 145 DNA or vectors as described in Riessen, R., Human Gene Therapy , 4, 749-758 (1993) incorporated herein by reference.

As used herein “gene transfer” means the process of introducing a foreign nucleic acid molecule into a cell. Gene transfer is commonly performed to enable the expression of a particular product encoded by the gene. The product may include a protein, polypeptide, anti-sense DNA or RNA, or enzymatically active RNA. Gene transfer can be performed in cultured cells or by direct administration into animals. Generally gene transfer involves the process of nucleic acid molecule contact with a target cell by non-specific or receptor mediated interactions, uptake of nucleic acid molecule into the cell through the membrane or b endocytosis, and release of nucleic acid molecule into the cytoplasm from the plasma membrane or endosome. Expression may require, in addition, movement of the nucleic acid molecule into the nucleus of the cell and binding to appropriate nuclear factors for transcription.

As used herein “gene therapy” is a form of gene transfer and is included within the definition of gene transfer as used herein and specifically refers to gene transfer to express a therapeutic product from a cell in vivo or in vitro. Gene transfer can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid molecule or nucleic acid-protein complex into the patient.

In another preferred embodiment, a vector having nucleic acid molecule sequences encoding VEGF 145 is provided in which the nucleic acid molecule sequence is expressed only in a specific tissue. Methods of achieving tissue-specific gene expression as set forth in International Publication No. WO 93/09236, filed Nov. 3, 1992 and published May 13, 1993.

In all of the preceding vectors set forth above, a further aspect of the invention is that the nucleic acid sequence contained in the vector may include additions, deletions or modifications to some or all of the sequence of the nucleic acid, as defined above.

In another preferred embodiment, a method of gene replacement is set forth. “Gene replacement” as used herein means supplying a nucleic acid molecule sequence which is capable of being expressed in vivo in an animal and thereby providing or augmenting the function of an endogenous gene which is missing or defective in the animal.

Clinical Applications

Stimulating angiogenesis in mammals by transfecting the endothelial cells with a polynucleotide coding for VEGF 145 may be accomplished, for example, according to the procedure described by Giordano et al. in “ Intracoronary Gene Transfer of Fibroblast Growth Factor -5 Increases Blood Flow an Contractile Function in an Ischemic Region of the Heart ”, Nature Medicine, Vol. 2 No. 5, pp. 534-539, May 1996 which is incorporated herein by reference.

VEGF 145 will be released from cells infected by adenovirus vectors directing expression of VEGF 145 in cells of the heart. This releasability is also found in VEGF 121 and VEGF 165 but not in VEGF 199 or VEGF 206 . However, VEGF 145 in contrast to VEGF 121 or VEGF 165 , will be partially retained by ECM molecules as it diffuses towards target endothelial cells in adjacent blood vessels. The bound VEGF 145 may be slowly released later thus prolonging the angiogenic effect as compared to VEGF 121 or VEGF 165 . Furthermore, the ECM bound VEGF 145 is active, and will support the newly synthesized blood vessels during the critical period of blood vessel muturation, until the existence of blood vessels is no longer dependent upon the presence of angiogenic growth factors. Thus, VEGF 145 will be more effective than any other VEGF form as a therapeutic agent to be used for induction of collateral blood vessels. These advantages may be critical when usage of adenovirus based expression vectors for gene therapy delivery of angiogenic agents is considered. An advantage of using adenovirus based vectors is that they are generally safe. The virus is lost quickly after the initial infection, and this is accompanied with a decrease in the production of the recombinant protein (Kass-Eisler, A., et. al. Proc. Natl. Acad. Sci. USA 90, 11498-11502, 1993). Because the VEGF 145 binding characteristics allow it to clear at a slower rate compared to other secreted VEGF forms, VEGF 145 should be a more effective therapeutic agent compared to the other VEGF forms.

Vectors for Gene Delivery In Vivo

In general, the gene of interest is transferred to the target organ, preferably the heart, including cardiac myocytes, or skeletal muscle, including skeletal myocytes in vivo and directs production of the encoded protein. Preferably such production is relatively constitutive. A variety of different gene transfer vectors, including viral as well as non-viral systems, can be employed to deliver transgenes for use in the present invention.

Preferred vectors for use in the present invention include viral vectors, lipid-based vectors and other vectors that are capable of delivering DNA to non-dividing cells in vivo. Presently preferred are viral vectors, particularly replication-defective viral vectors (including, for example replication-defective adenovirus vectors and adeno-associated virus (AAV) vectors. For ease of production and use in the present invention, replication-defective adenovirus vectors are presently most preferred.

References describing a variety of other gene delivery vectors are known in the art, some of which are cited herein. Such other vectors include, for example, other viral vectors (such as adeno-associated viruses (AAV), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a host cell. As described above and in the cited references, vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. Such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e. positive/negative) markers (see, e.g., Lupton, S., WO 92/08796, published May 29, 1992; and Lupton, S., WO 94/28143, published Dec. 8, 1994). Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts. A large variety of such vectors are known in the art and are generally available (see, e.g., the various references cited above).

Additional references describing adenovirus vectors and other viral vectors which could be used in the methods of the present invention include the following: Horwitz, M. S., Adenoviridae and Their Replication, in Fields, B., et al. (eds.) Virology, Vol. 2, Raven Press New York, pp. 1679-1721, 1990); Graham, F., et al., pp. 109128 in Methods in Molecular Biology, Vol. 7: Gene Transfer and Expression Protocols, Murray, E. (ed.), Humana Press, Clifton, N.J. (1991); Miller, N., et al., FASEB Journal 9:190-199, 1995; Schreier, H, Pharmaceutica Acta Heivetiae 68:145-159, 1994; Schneider and French, Circulation 88:1937-1942, 1993; Curiel D. T., et al., Human Gene Therapy 3:147-154, 1992; Graham, F. L., et al., WO 95/00655 (Jan. 5, 1995); Falck-Pedersen, E. S., WO 95/16772 (Jun. 22, 1995); Denefle, P. et al., WO 95/23867 (Sep. 8, 1995): Haddada, H. et al., WO 94/26914 (Nov. 24, 1994); Perricaudet, M. et al., WO 95/02697 (Jan. 26, 1995): Zhang, W., et al., WO 95/25071 (Oct. 12, 1995). A variety of adenovirus plasmids are also available from commercial sources, including, e.g., Microbix Biosystems of Toronto, Ontario (see, e.g., Microbix Product Information Sheet: Plasmids for Adenovirus Vector Construction, 1996).

Additional references describing AAV vectors which could be used in the methods of the present invention include the following: Carter, B., Handbook of Parvoviruses, vol. 1, pp. 169-228, 1990; Berns, Virology, pp. 1743-1764 (Raven Press 1990); Carter, B., Curr. Opin. Biotechnol., 3:533-539, 1992; Muzyczka, N., Current Topics in Microbiology and Immunology, 158:92-129, 1992; Flotte, T. R., et al., Am. J. Respir. Cell Mol. Biol. 7:349-356, 1992; Chatterjee et al., Ann. NY Acad. Sci., 770:79-90, 1995; Flotte, T. R., et al., WO 95/13365 (May 18, 1995); Trempe, J. P., et al., WO 95/13392 (May 18, 1995); Kotin, R., Human Gene Therapy, 5:793-801, 1994; Flotte, T. R., et al., Gene Therapy 2:357-362, 1995; Allen, J. M., WO 96/17947 (Jun. 13, 1996); and Du et al., Gene Therapy 3:254261, 1996.

Additional references describing non-viral vectors which could be used in the methods of the present invention include the following: Ledley, F D, Human Gene Therapy 6:11 29-1144, 1995; Miller, N., et al., FASEB Journal 9:190-199, 1995; Chonn, A., et al., Curr. Opin. in Biotech. 6:698-708, 1995; Schofield, J P, et al., British Med. Bull. 51:56-71, -1995; Brigham, K. L., et al., J. Liposome Res. 3:31 49, 1993; Brigham, K. L., WO 91/06309 (May 16, 1991); Feigner, P. L., et al., WO 91/17424 (Nov. 14, 1991); Solodin et al., Biochemistry 34:12537-13544, 1995; WO 93/19768 (Oct. 14, 1993); Debs et al., WO 93125673; Feigner, P. L., et al., U.S. Pat. No. 5,264,618 (Nov. 23, 1993); Epand, R. M., et al., U.S. Pat. No. 5,283,185 (Feb. 1, 1994); Gebeyehu et al., U.S. Pat. No. 5,334,761 (Aug. 2, 1994); Feigner, P. L., et al., U.S. Pat. No. 5,459,127 (Oct. 17, 1995); Overell, R. W., et al., WO 95/28494 (Oct. 26, 1995); Jessee, WO 95/02698 (Jan. 26, 1995); Haces and Ciccarone, WO 95/17373 (Jun. 29, 1995); Lin et al., WO 96/01840 (Jan. 25, 1996).

Helper Independent Replication Deficient Human Adenovirus 5 System

In general, the gene of interest is transferred to the heart (or skeletal muscle), including cardiac myocytes (and skeletal myocytes), in vivo and directs constitutive production of the encoded protein. Several different gene transfer approaches are feasible. Preferred is the helper-independent replication deficient human adenovirus 5 system. Using this system, it has been demonstrated transfection greater than 60% of myocardial cells in vivo by a single intracoronary injection (Giordano and Hammond, Clin. Res. , 42:123A, 1994). Non-replicative recombinant adenoviral vectors are particularly useful in transfecting coronary endothelium and cardiac myocytes resulting in highly efficient transfection after intracoronary injection. The same will be true for transfecting desired cells of the peripheral vescular system.

Helper-independent replication-defective human adenovirus 5 system can be used effectively to transfect a large percentage of myocardial cells in vivo by a single intracoronary injection. Such a delivery technique can be used to effectively target vectors to the myocardium of a large mammal heart. Additional means of targeting vectors to particular cells or tissue types are described below and in the art.

Adenovirus vectors may be used that are based on the human adenovirus 5 (as described by McGrory W J, et al., Virology 163:614-617, 1988) which are missing essential early genes from the adenovirus genome (usually ElA/ElB), and are therefore unable to replicate unless grown in permissive cell lines that provide the missing gene products in trans. In place of the missing adenovirus genomic sequences, a transgene of interest can be cloned and expressed in tissue/cells infected with the replication-defective adenovirus. Although adenovirus-based gene transfer does not generally result in stable integration of the transgene into the host genome (less than 0.1% adenovirus-mediated transfections result in transgene incorporation into host DNA), adenovirus vectors can be propagated in high titer and transfect non-replicating cells; and, although the transgene is not passed to daughter cells, this is suitable for gene transfer to adult cardiac myocytes, which do not actively divide. Retrovirus vectors provide stable gene transfer, and high titers are now obtainable via retrovirus pseudotyping (Burns, et al., Proc Natl Acad Sci (USA) 90:8033-8037, 1993), but current retrovirus vectors are generally unable to efficiently transduce nonreplicating cells.

An advantage associated with nondividing cells such as myocytes is that the viral vector is not readily “diluted out” by host cell division. To further enhance the duration of transgene expression in the heart, however, it is also possible to employ various second generation adenovirus vectors that have both E1 and E4 deletions, which can be used in conjunction with cyclophosphamide administration (See, e.g., Dai et al., Proc. Nat'l Acad Sci. (USA) 92:1401-1405, 1995). To further increase the extent of initial gene transfer, multiple infusions, or infusion in an isolated coronary circuit can also be employed.

Human 293 cells, which are human embryonic kidney cells transformed with adenovirus ElA/ElB genes, typify useful permissive cell lines for the production of such replication-defective vectors. However, other cell lines which allow replication-defective adenovirus vectors to propagate therein can also be used, such as HeLa cells.

The recombinant adenoviral vectors based on the human adenovirus 5 ( Virology , 163:614-617, 1988) are missing essential early genes from the adenoviral genome (usually ElA/ElB), and are therefore unable to replicate unless grown in permissive cell lines that provide the missing gene products in trans. In place of the missing adenoviral genomic sequences, a transgene of interest can be cloned and expressed in tissue/cells infected with the replication deficient adenovirus. Although adenovirus-based gene transfer does not result in integration of the transgene into the host genome (less than 0.1% adenovirus-mediated transfections result in transgene incorporation into host DNA), and therefore is not stable, adenoviral vectors can be propagated in high titer and transfect non-replicating cells. Although the transgene is not passed to daughter cells, this is acceptable for gene transfer to adult skeletal muscle and cardiac myocytes, which do not divide. Retroviral vectors provide stable gene transfer, and high titers are not obtainable via retrovirus pseudotyping (Burns, et al., Proc. Natl. Acad. Sci. ( USA ), 90:8033-8037, 1993), but current retroviral vectors are unable to transduce nonreplicating cells (adult skeletal muscle and cardiac myocytes) efficiently. In addition, the potential hazards of transgene incorporation into host DNA are not warranted if short-term gene transfer is sufficient. Indeed, the limited duration expression of an angiogenic protein is sufficient for substantial angiogenesis, and transient gene transfer for cardiovascular disease and peripheral disease processes is therapeutically adequate.

Human 293 cells, which are human embryonic kidney cells transformed with adenovirus ElA/ElB genes, typify useful permissive cell lines. However, other cell lines which allow replication-deficient adenoviral vectors to propagate therein can be used.

Construction of Recombinant Adenoviral Vectors

All adenoviral vectors used in the present invention can be constructed by the rescue recombination technique described in Graham, Virology , 163:614-617, 1988. Briefly, the transgene of interest is cloned into a shuttle vector that contains a promoter, polylinker and partial flanking adenoviral sequences from which ElA/ElB genes have been deleted. As the shuttle vector, plasmid pACl ( Virology , 163:614-617, 1988) (or an analog) which encodes portions of the left end of the human adenovirus 5 genome ( Virology , 163:614-617, 1988) minus the early protein encoding ElA and ElB sequences that are essential for viral replication, and plasmid ACCMVPLPA ( J. Biol. Chem. , 267:25129-25134, 1992) which contains polylinker, the CMV promoter and SV40 polyadenylation signal flanked by partial adenoviral sequences from which the ElA/ElB genes have been deleted can be exemplified. The use of plasmid pACl or ACCMVPLA facilitates the cloning process. The shuttle vector is then co-transfected with a plasmid which contains the entire human adenoviral 5 genome with a length too large to be encapsidated, into 293 cells. Co-transfection can be conducted by calcium phosphate precipitation or lipofection ( Biotechniques , 15:868-872, 1993). Plasmid JM17 encodes the entire human adenovirus 5 genome plus portions of the vector pBR322 including the gene for ampicillin resistance (4.3 kb). Although JMl7 encodes all of the adenoviral proteins necessary to make mature viral particles, it is too large to be encapsidated (40 kb versus 36 kb for wild type). In a small subset of co-transfected cells, rescue recombination between the transgene containing the shuttle vector such as plasmid pACl and the plasmid having the entire adenoviral 5 genome such as plasmid pJMl7 provides a recombinant genome that is deficient in the ElA/ElB sequences, and that contains the transgene of interest but secondarily loses the additional sequence such as the pBR322 sequences during recombination, thereby being small enough to be encapsidated. With respect to the above method, successful results have been reported (Giordano, et al., Circulation , 88: I-139, 1993, and Giordano and Hammond, Clin. Res. , 42:123A, 1994). The CMV driven β-galactosidase encoding adenovirus HCMVSP11acZ ( Clin. Res. , 42:123A, 1994) can be used to evaluate efficiency of gene transfer using X-gal treatment.

The initial mode of gene transfer uses adenoviral vectors as delineated above. The advantages of these vectors include the ability to effect high efficiency gene transfer (more than 60% of target organ cells transfected in vivo), the ease of obtaining high titer viral stocks and the ability of these vectors to effect gene transfer into cells such as cardiac myocytes which do not divide.

Balloon angioplasty is a major treatment of ischemic heart disease which involves the inflation of a balloon in a clogged blood vessel in order to open the blocked blood vessel. Unfortunately, this method of treatment frequently results in injury to the endothelial cells lining the inner walls of blood vessels. Smooth muscle cells often infiltrate into the opened blood vessels causing a secondary obstruction in a process called restenosis. VEGF 145 may be employed to induce proliferation of the endothelial cells located at the periphery of the balloon induced damaged area in order to cover the luminal surface of the vessel with a new monolayer of endothelial cells, hoping to restore the original structure of the blood vessel. Adenovirus mediated gene-therapy may also be applicable in this case as a method aimed at the delivery of inducers of endothelial cells proliferation to the lesion created by the balloon angioplasty procedure. The ability to bind to the ECM may offer several advantages for this application.

To prevent restenosis following balloon angioplasty, two types of approaches may be considered. It is possible to deliver a protein, or deliver an expression vector which will direct the expression of such a protein to the site of occlusion using the balloon that is used to open the clogged vessel. Such a protein will also inhibit the proliferation of the non-endothelial cells which invade the reopened blood vessel until the endothelial cells on both sides of the wounded endothelial cells monolayer have a chance to re-grow. This can be combined with the delivery of a protein or a vector such as a recombinant adenovirus which will speed the re-growth of the endothelial cell layer. However, growth factors such as FGF-5, bFGF or HGF are also mitogenic to smooth muscle cells, and will induce their proliferation, which is the opposite of the desired effect. VEGFs on the other hand are specific for endothelial cells. VEGF 145 will be especially useful in this context, because of its ECM binding properties. Following application, for example, by infection of adjacent cells with adenovirus encoding the protein, direct transfection with plasmid DNA encoding the protein, or the direct delivery of the protein, VEGF 145 will stick to the exposed extracellular matrix in the balloon treated vessel, and will promote proliferation and re-growth of endothelial cells specifically at the site of the lesion. Thus, VEGF 145 will localize and concentrate in the very region where its activity is required, making it a particularly attractive candidate for the treatment of restenosis.

Coronary angioplasty is frequently accompanied by deployment of an intravascular stent to help maintain vessel function and avoid restenosis. Stents have been coated with heparin to prevent thrombosis until the new channel formed by the stent can endothelialize. VEGF 145 can be applied directly to the stent, or nucleic acids encoding VEGF 145 such as plasmids, cDNA, or adenovirus vectors, may be applied to the stent for direct transfection of neighboring cells, using methods known to those of skill in the art. VEGF 145 that is locally applied, or produced through transfection, will enhance endothelialization of the stent and thus reduce thrombosis and re-stenosis.

Other applications for use of the growth factor of the present invention are contemplated. One example is for the treatment of ulcers. An ulcer is in effect a wound residing in the stomach. It was shown that angiogenic growth factors may be effective for the treatment of duodenal ulcers, and that stabilization of angiogenic growth factors may be a mechanism by which some therapeutic agents such as sucralfate produce their beneficial effects (Szabo, S., et. al. Gastroenterology 106, 1106-1111, 1994). Since VEGF is an angiogenic growth factor that is very stable under acidic conditions, its employment for the treatment of stomach and duodenal ulcers is contemplated. The heparin binding ability of VEGF 145 which acts to preserve it in an active state, and its expected ability to bind to exposed ECM at the wound site, indicate that VEGF 145 may be more suitable than other VEGF forms for treating stomach and duodenal ulcers.

Further aspects of the present invention incluse methods of inhibiting the expression of one of the various VEGF 145 (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) polypeptides of the invention. Such methods may be desired where one wishes to inhibit angiogenesis, such as in certain treatments of tumors and other cancers. Such methods employ methods known to those of ordinary skill in the art. Gene and oligonucleotide therapy methods of the present invention include the use of nucleic acid encoding functioning VEGF 145 and the use of inhibitory oligonucleotides. Inhibitory oligonucleotides include antisense nucleic acids and ribozymes. Gene and oligonucleotide therapy can be performed ex vivo on cells which are then transplanted into a patient, or can be performed by direct administration of the nucleic acid or nucleic acid-protein complex into the patient.

Antisense oligonucleotides and ribozymes can be administered to a patient using different techniques such as by naked nucleic acid, nucleic acid compositions (for example, encapsulated by a liposome) and by retroviral vectors. Miller, Nature 357; 455-460, hereby incorporated by reference herein. Antisense oligonucleotides and ribozymes can also be introduced into a cell using nucleic acid encoding the antisense nucleic acid or ribozyme.

The present invention also contemplates antibodies and immunoassays useful for detecting the presence or amount of a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ), or a protein fragment of a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ). These antibodies have various uses such as being used as therapeutic agents to modulate a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) activity; as diagnostic tools for determining the level of a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) expression in a particular tissue and/or the VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) functional integrity to diagnose a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) or thermogenic-related disease; and as research tools for studying a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) synthesis, structure, and function. For example, antibodies targeted to a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) are useful to elucidate which portion of a VEGF 145 , polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) a particular compound, such as a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) regulatory compound, binds.

The general methodology and steps of antibody assays are described by Greene, U.S. Pat. No. 4,376,110, entitled “Immunometric Assays Using Monoclonal Antibodies; Antibodies, A Laboratory Manual , Cold Spring Harbor Laboratory, Chapter 14 (1988); Radioimmunoassay and related methods”, A. E. Bolton and W. M. Hunter, Chapter 26 of Handbook of Experimental Immunology , . Volume I, Immunochemistry, edited by D. M. Weir, Blackwell Scientific Publications, 1986; “Enzyme immunoassays: heterogeneous and homogeneous systems”, Nakamura, et al., Chapter 27 of Handbook of Experimental Immunology , Volume 1, Immunochemistry, edited by D. M. Weir, Blackwell Scientific Publications, 1986; and Current Protocols in Immunology , Chapter 2, Section I, Edited by John E. Coligan, et al., (1991). In all such assays controls are preferably performed, which are designed to give positive and negative results. For example, the test may include a known VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) peptide and a non- VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) peptide negative control.

One such immunoassay is a sandwich immunoassay, and comprises the steps of (1) reacting an immobilized anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) antibody, preferably a monoclonal antibody, and a labeled anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) antibody, preferably a monoclonal antibody, which recognizes a different site from that recognized by the immobilized antibody, with a sample containing or suspected of containing VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) so as to form a complex of immobilized antibody- VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ), and (2) detecting the presence or amount of a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) by determining the presence or amount of label in the complex. In this process the reaction of the immobilized antibody and labeled antibody with the sample may be carried out either simultaneously or separately.

Antibodies that recognize a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) can be prepared from hybridomas by the following method. A VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) protein, peptides, or fragments thereof in an amount sufficient to promote formation of antibodies, are emulsified in an adjuvant such as Freund's complete adjuvant. The immunogen may be either crude or partially purified, and is administered to a mammal, such as mice, rats or rabbits, by intravenous, subcutaneous, intradermic, intramuscular, or intraperitoneal injection. In the preparation of polyclonal antibodies, after completion of the immunization protocol, sera are recovered from the immunized animals. In the preparation of monoclonal antibodies, after completion of the immunization protocol, animal spleens are harvested and myeloma cells having a suitable marker such as 8-azaguanine resistance can be used as parent cells which are then fused with the antibody-producing spleen cells to prepare hybridomas. Suitable media for the preparation of hybridomas according to the present invention include media such as Eagle's MEM, Dulbecco's modified medium, and RPMI-1640. Myeloma parent cells and spleen cells can be suitably fused at a ratio of approximately 1:4. Polyethylene glycol (PEG) can be used as a suitable fusing agent, typically at a concentration of about 35% for efficient fusion. Resulting cells may be selected by the HAT method. (Littlefield, J. W., Science 145:709 (1964)). Screening of obtained hydridomas can be performed by conventional methods, including an immunoassay using culture supernatant of the hybridomas to identify a clone of hybridoma producing the objective immunoglobulin. The antibody-producing hybridoma obtained can then be cloned using known methods such as the limiting dilution method.

In order to produce, for example, the anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) monoclonal antibodies of the present invention, the hybridoma obtained above may be cultured either in vitro or in vivo. If the hybridoma is cultured in vitro, the hybridoma may be cultured in the above-mentioned media supplemented with fetal calf serum (FCS) for 3-5 days and monoclonal antibodies recovered from the culture supernatant. If the hybridoma is cultured in vivo, the hybridoma may be implanted in the abdominal cavity of a mammal, and after 1-3 weeks the ascites fluid collected to recover monoclonal antibodies therefrom. Much larger quantities of the monoclonal antibodies can efficiently be obtained using in vivo cultures rather than in vitro cultures and, thus, in vivo cultures are preferred. The monoclonal antibody obtained from the supernatant or ascites fluids can be purified by conventional methods such as ammonium sulfate-fractionation, Protein G-Sepharose column chromatography, or their combinations.

Antibodies, or the desired binding proteins thereof including F(ab) and Fv fragments, along with antibody-based constructs such as single chain Fv's can also be generated using processes which involve cloning an immunoglobulin gene library in vivo. See, e.g., Huse et al., Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda, (1989) Science 246:1275-1281. Using these methods, a vector system is constructed following a PCR amplification of messenger RNA isolated from spleen cells with oligonucleotides that incorporate restriction sites into the ends of the amplified product. Separate heavy chain and light chain libraries are constructed and may be randomly combined to coexpress these molecules together and screened for antigen binding. Single chain antibodies and fragments may also be prepared by this method.

Antibodies according to the present invention can suitably be immobilized on commercially available carriers for the antigen-antibody reaction including beads, balls, tubes, and plates made of glass or synthetic resin. Suitable synthetic resins include polystyrene and polyvinyl chloride. Anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) monoclonal antibodies are suitably absorbed onto the carrier by allowing them to stand at 2-8° C. overnight in 0.05M carbonate buffer, pH 9-10 preferably about pH 9.5. The immobilized anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , VEGF 145-III ) monoclonal antibody can be stored cold in the presence of preservatives such as sodium azide. Both monoclonal and polyclonal antibodies can be immobilized onto carriers using this method.

Labeled VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) antibodies in accordance with the present invention can suitably be prepared by labeling anti-VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) antibodies with any substance commonly used for an immunoassay including radioisotopes, enzymes, and fluorescent substrates. Radioisotopes and enzymes are preferably used. When radioisotopes are used as labels, the antibody is preferably labeled with 125 I using conventional methods such as the Chloramine T method (Hunter et al., Nature (1962) 194:495) and the Bolton-Hunter method. When enzymes are used as labels, the antibody is labeled with an enzyme such as horseradish peroxidase, β-D-galactosidase, or alkaline phosphatase by conventional methods including the maleimide method and the Hingi method. Ishikawa et al, (1983) J. Immunoassay 4:1.

The acvtivity of the label can be detected by conventional methods. If radioisotopes are used as labels, the activity of the label can be detected using an appropriate instrument such as a scintillation counter. If enzymes are used as labels, the activity of the label can be detected by measuring absorbance, fluorescence intensity, or luminescence intensity after reacting the enzyme with an appropriate substrate.

The present invention also provides a kit for assaying the amount of VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ), in either biological samples and samples of a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) proteins. One example of such a kit comprises an immobilized anti- VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) monoclonal antibody and a labeled anti- VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) monoclonal antibody. When a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) proteins are assayed using this kit, a VEGF 145 polypeptide (including VEGF 145-I , VEGF 145-II , and VEGF 145-III ) protein becomes sandwiched between the immobilized monoclonal antibody and the labeled monoclonal antibody.

To assist in understanding the present invention, the following Examples are included that describe the results of a series of experiments. The experiments relating to this invention should not, of course, be construed as specifically limiting the invention and such variations of the invention, now known or later developed, which would be within the purview of one skilled in the art are considered to fall within the scope of the invention as described herein and hereinafter claimed.

EXAMPLE I

Isolation and Characterization of VEGF 145

Reverse PCR analysis of mRNA from OC-238 human epithelial ovarian carcinoma cells as well as HeLa cells and A431 cells ( FIG. 5 ) detected a VEGF mRNA form corresponding in size to the predicted size of a VEGF mRNA form encoding a putative mature protein of 145 amino-acids. A reverse PCR product from OC-238 cells were sequenced and found to contain the exon structure 1 - 5 , 6 a , 8 which is the expected structure of mRNA encoding VEGF 145 . The cDNA which was sequenced was obtained using the primers GGAGAGATGAGCTTCCTACAG (Seq. I.D. No. 3) and TCACCGCCTTGGCTTGTCACA (Seq. I.D. No. 4), corresponding to the sequences encoding amino-acids 92-98 of VEGF (common to all VEGF forms) and to the six carboxyl-terminal amino-acids of VEGF encoded by exon 8 of the VEGF gene. In all these cells lines the putative 145 amino acid-encoding cDNA appeared to be expressed at levels comparable to those of VEGF 165 and higher than those of VEGF 189 , The mRNA encoding this VEGF form was not detected in several other transformed cell lines such as C6 glioma cells and U937 cells. Sequence analysis of the putative PCR product from the OC-238 cells showed that the mRNA contains exons 1-5, 6 and 8 of the VEGF gene in sequence (VEGF 145 ).

In order to produce recombinant VEGF 145 , a VEGF 145 cDNA construct was prepared by deleting the oligonucleotides encoded by exon 7 out of VEGF 189 cDNA. Primers used to amplify exons 1-6 of the VEGF cDNA were the external primer, GCTTCCGGCTCGTATGTTGTGTGG (Seq. I.D. No. 5), corresponding to a puc118 sequence and the internal primer, ACGCTCCAGGACTTATACCGGGA (Seq. I.D. No. 6), corresponding to a sequence at the 3′ end of exon 6. Primers used to amplify the 3′ end of the VEGF cDNA were complementary to the puc118 sequence GGTAACGCCAGGGTTTTCCCAGTC (Seq. I.D. No. 7) and to the 3′ end of the exon-6 sequence (underlined) and to the start of exon 8 (CGGTATAAGTCCTGGAGCGT-ATGTGACAAGCCGAGGCGGTGA (Seq. I.D. No. 8)). Following amplification, the PCR products were precipitated, and the products reamplified using only the puc118 derived external primers. The product was gel purified, sublconed into the PCR-II vector and sequenced using the Sequenase-II kit obtained from U.S. Biochemical Corp. (Cleveland, Ohio). This cDNA was further used for protein expression studies.

This recombinant VEGF 145 cDNA was used to construct a recombinant baculovirus containing the VEGF 145 cDNA. The virus was used to infect Sf9 cells as described for VEGF 165 by Cohen, T., et. al. Growth Factors. 7:131-138, 1992, incorporated herein by reference. Most of the VEGF 145 produced by the infected Sf9 cells were found in the conditioned medium as a homodimer of ˜41 kDa, with small amounts of monomeric VEGF 145 (FIG. 4 ). The VEGF 145 dimers dissociated into monomers upon reduction with dithiotreitol. VEGF 145 was partially purified using heparin-sepharose. The protein was eluted from the column using a stepwise salt gradient. Most of the VEGF 145 was eluted at 0.6-0.7 M NaCl, indicating that the heparin binding affinity of VEGF 145 is similar to that of VEGF 165 . The recominant VEGF 145 was biologically active and induced the proliferation of human umbilical vein derived endothelial cells (HUVEC cells). The ED 50 of VEGF 145 was 30 ng/ml, whereas the ED 50 of VEGF 165 was 6 fold lower (FIG. 6 ).

EXAMPLE II

Proliferation of Endothelial Cells and Angiogenesis

To confirm that VEGF 145 can induce angiogenesis in vivo, the VEGF 145 cDNA was subcloned into the Bam-HI site of the mammalian expression vector MIRB using the technique described by Macarthur, C. A., et. al. Cell Growth Differ. 6:817-825, 1995, which is incorporated herein by reference. The MIRB/VEGF 145 plasmid was transfected into BHK-21 hamster kidney derived cells, and stable cell lines producing VEGF 145 isolated. The VEGF 145 produced by the mammalian cells was biologically active and was secreted into the growth medium. A stable clone producing 0.1 mg VEGF 145 per 10 6 cells was isolated. The VEGF 145 expressing cells were embedded in alginate beads, and the beads were implanted under the skin of balb/c mice using the method described by Plunkett, M. L. et. al., Lab.Invest. 62, 510-517, 1990, which is incorporated herein by reference. Alginate pellets containing the entrapped cells were removed after four days and photographed (FIG. 11 ). Clusters of alginate beads containing VEGF 145 , expressing cells were dark red with blood, while beads containing cells transfected with vector alone had a much lower content of blood. When examined under higher magnification, pellets containing VEGF 145 producing cells appeared much more vascularized than pellets containing control cells. These results are consistent with the expected behavior of an vascular cell proliferation or angiogenesis-promoting factor.

EXAMPLE III

Receptor Binding Characteristics

VEGF 165 binds to three VEGF receptors on HUVEC cells while VEGF 123 only binds to the large of these receptors. The common receptor to which both VEGF 121 and VEGF 165 bind is the KDR/flk-1 VEGF receptor (Gitay-Goren, H., et al. J. Biol. Chem. 271, 5519-5523, 1996). In order to determine the receptor recognition pattern of VEGF 145 . 125 I-VEGF 165 (produced as described in Gitay-Goren, H., et. al. J. Biol. Chem. 271, 5519-5523, 1996, incorporated by reference herein) was bound to HUVEC cells in the presence of 1 μg/ml of heparin and increasing concentrations of VEGF 145 . Bound 125 I-VEGF 165 was subsequently covalently cross-linked to the VEGF receptors. VEGF 145 inhibited the binding of 125 I-VEGF 165 to the KDR/flk-1 receptor of the HUVEC cells but not to the two smaller VEGF 165 specific receptors of the cells (FIG. 7 ). This result was verified in a cell free binding experiment in which VEGF 145 completed with 125 I-VEGF 165 for binding to a soluble fusion protein containing the extracellular domain of the flk-1 receptor. In contrast, VEGF 145 competed rather ineffectively with 125 I-VEGF 165 for binding to the two smaller VEGF receptors, indicating that the affinity of VEGF 145 towards these two receptors is substantially lower than that of VEGF 165 . It follows that the behavior of VEGF 145 differs from that of VEGF 165 . The presence of exon-6 is not sufficient to enable efficient binding of VEGF 145 to these two receptors, despite the heparin binding properties that exon-6 confers on VEGF 145 .

EXAMPLE IV

ECM Binding Characteristics

VEGF 189 binds efficiently to the ECM produced by CEN4 cells, while VEGF 165 binds to it very weakly and VEGF 121 does not bind to it at all. The fact that VEGF 189 bind heparin with high affinity led to the suggestion that the interaction of VEGF 189 with the ECM is mediated by heparin-sulfate proteoglycans (Houck, K. A., et al., J. Biol. Chem. 267, 26031-26037 (1992); Park, J. E., et al., Mol. Biol. Cell 4, 1317-1326 (1993)). The heparin binding affinities of VEGF 145 and VEGF 165 are similar, and substantially lower than the heparin binding affinity of VEGF 189 and VEGF 145 was therefore expected to bind poorly to ECM. Surprisingly, experiments in which VEGF 145 was bound to an ECM produced by bovine corneal endothelial cells showed that VEGF 145 bound efficiently whereas the binding of VEGF 165 was marginal. In these experiments, the results of which are shown in FIG. 8 , it can be seen that VEGF 145 binds efficiently to the ECM while VEGF 165 binds much less efficiently if at all. The binding of 125 I-VEGF 145 to the ECM was substantially, but not completely, inhibited by 10 g/ml heparin. The 125 I-VEGF 145 used in these experiments contained some impurities, but the major iodinated protein that was recovered from the ECM had a mass corresponding to that of 125 I-VEGF 145 (see FIG. 8 b ). To make sure that 125 I-VEGF 145 binds to the ECM and not to exposed plastic surfaces, the ECM was scraped off, washed by centrifugation, and the amount of adsorbed 125 I-VEGF 145 in the pellet determined. The ECM contained ˜70% of the adsorbed 125 I-VEGF 145 . Based on the aforementioned, it appears that the presence of the exon-6 derived peptide in VEGF 145 enables efficient binding to the ECM, while the exon-7 derived peptide of VEGF 165 does not provide this property. Thus, VEGF 145 differs substantially in this respect from VEGF 121 or VEGF 165.

EXAMPLE V

ECM Binding Characteristics

The above described experiments indicated that VEGF 145 binds to the ECM while VEGF 165 binds to it much less efficiently. VEGF 145 and VEGF 165 bind with similar affinities to heparin suggesting that the binding to the ECM is not mediated by heparin-like molecules. The interaction of bFGF with the ECM is mediated by heparin-sulfate proteoglycans. To determine whether VEGF 145 interacts with the ECM using a bFGF like binding mechanism, 125 I-VEGF 145 was bound to ECM coated dishes in the presence of 10 μg/ml heparin. The binding of VEGF 145 was inhibited by ˜60% while the binding of 125 I-bFGF to the ECM was inhibited by 80%. The binding of 125 I-VEGF 145 to the ECM was also inhibited by 80% in the presence of 0.8 M salt, indicating that the interaction is not hydrophobic. These results are compatible with the expected behavior of proteins that bind to the ECM via heparin-like molecules. However, unexpectedly, 125 I-VEGF 145 was also able to bind efficiently to an ECM that was digested with heparinase-II. In contrast, there was almost no binding of 125 I-bFGF to the heparinase-II treated ECM ( FIG. 9 a ). This observation indicates that VEGF 145 does not bind to the ECM by binding to ECM associated heparin-like molecules.

In order to further investigate the mode of interaction of VEGF 145 with the ECM, the ability of heparin and heparinase treatment to release pre-bound VEGF 145 from the ECM was tested. Similar differences were observed when ECM containing bound 125 I-VEGF 145 or 125 I-bFGF was incubated with heparin or digested with heparinase-II. When the ECM coated wells were incubated for two hours at 37° C. with binding buffer, 20% of the bound 125 I-bFGF and 13% of the bound 125 I-VEGF 145 dissociated from the ECM. This release may be attributed in part to aproteolytic activity residing in the ECM. When 10 μg/ml heparin were included in the buffer, only 33% of 125 I-VEGF 145 was released from the matrix, as compared with the release of 78% of pre-bound 125 I-bFGF. An even sharper difference was observed when heparinase-II was added to the binding buffer. The enzyme released 72% of the bound 125 I-bFGF, but only 17% of the bound 125 I-VEGF 145 ( FIG. 9 b ). Similar results were obtained when the experiment was performed with unlabeled VEGF 145 using a commercial monoclonal anti-VEGF antibody to detect VEGF bound to the ECM.

To assess the efficiency of the heparinase-II digestion, the ECM was metabolically labeled with 35 S-sulfate and the labeled ECM was digested with heparinase-II. The digestion released 80-85% of the labeled sulfate residues. To determine whether VEGF 145 can bind to ECM depleted of sulfated glycosaminoglycans, BCE cells were grown in the presence of 30 mM chlorate, an inhibitor of glycosaminoglycan sulfation in the manner described by Miao, H. Q., et. al. J. Biol Chem 271, 4879-4886, 1996. ECM's produced in the presence or absence of chlorate, were further digested with a mixture of heparinases I, II and III. Neither of these treatments inhibited significantly the binding of VEGF 145 to the ECM, despite a >95% decrease in the content of sulfate moieties in the ECM.

The ECM produced by BCE cells contains bFGF, which is mitogenic for endothelial cells. However, endothelial cells do not proliferate when they are seeded on ECM produced in the presence of chlorate sinc bFGF does not bind to ECM depleted of sulfated heparin-like molecules. VEGF 145 binds to ECM produced in the presence of chlorate, VEGF 145 bound to such ECM was examined to determine whether it retains its biological activity. Wells coated with ECM produced in the presence of chlorate were incubated with increasing concentrations of either VEGF 145 or VEGF 165 . The wells were subsequently washed extensively and HUVEC cells were seeded in the wells. ECM incubated with VEGF 145 induced proliferation of vascular endothelial cells while ECM incubated with VEGF 165 did not, indicating ECM associated VEGF 145 is biologically active (FIG. 10 ).

EXAMPLE VI

Comparison of VEGF 145 with other VEGF Forms

TABLE 1
Overview of differences between VEGF 145 and the
other VEGF forms.
	VEGF 121	VEGF 145	VEGF 165	VEGF 189	VEGF 206
Exons	1-5, 8	1-5, 6a,	1-5,	1-5, 6a,	1-5, 6b,
		8	7, 8	7, 8	7, 8
Mitogen for	+	+	+	+	+
endothelial
cells
Angiogenic	+	+	+	n.d.	n.d.
activity
Binding to	+	+	+	n.d.	n.d.
Flk-1 and
Flt-1
receptors
Binding to	−	−	+	n.d.	n.d.
two small
VEGF
receptors of
endothelial
cells
Binding to	−	+	−	+	+
ECM
Protection	−	+	+	n.d.	n.d.
against
oxidative
damage by
heparin-like
molecules
Secretion	+	+	+	−	−
from pro-
ducing cells

a. Comparison with VEGF 165

VEGF 165 contains exons 1-5, 7 and 8 of the VEGF gene, and lacks exon 6. It binds heparin with an affinity similar to that of VEGF 145 . VEGF 145 binds to a single VEGF receptor on human umbilical vein derived endothelial cells, which was identified as the KDR/flk-1 VEGF receptor. In contrast, VEGF 165 binds to two additional high affinity receptors which are present on vascular endothelial cells and on several other cell types (Neufeld, G., et. al. Cancer Metastasis Rev. 15:153-158, 1996). It is not clear yet if these VEGF 165 binding, but if they do, than endothelial cells should display a more restricted biological response to VEGF 145 as compared to VEGF 165 . VEGF 165 is susceptible to oxidative agents. These are especially abundant in inflamed tissue and in situations such as wounding. However, when VEGF 165 damaged by oxidation binds to heparin-like molecules found on endothelial cells the activity of the damaged VEGF 165 is restored (Gitay-Goren, H., et. al. J. Biol. Chem. 271, 5519-5523, 1996). This property is also shared by VEGF 145 . In addition, VEGF 165 binds very weakly to ECM, if at all. The residual binding of VEGF 165 to the ECM is inhibited further following digestion of the ECM with heparinase. In contrast, the binding of VEGF 145 to the ECM is not altered by prior digestion of the ECM by heparinase. Thus despite the similar heparin-binding affinities of VEGF 165 and VEGF 145 surprisingly, VEGF 145 is secreted and binds efficiently to the ECM, unlike VEGF 165.

b. Comparison with VEGF 121

VEGF 121 does not contain exons 6 and 7 of the VEGF gene. In contrast to VEGF VEGF 121 does not bind to heparin. Like VEGF 145 and VEGF 121 does not bind to the two smaller VEGF receptors found in the endothelial cells and in various types of cancer cells. Both VEGF 121 and VEGF 145 are secreted from cells, but VEGF 121 does not bind to the ECM. VEGF 121 is inactivated by oxidation like VEGF 165 and VEGF 145 but the activity of VEGF 121 is not restored by binding to heparin-like molecules.

c. Comparison with VEGF 189 and VEGF 206

VEGF 189 contains peptides encoded by exon-6 and by exon 7 of the VEGF gene. It binds to heparin with a higher affinity as compared to VEGF 145 . It also binds very well to the ECM. However, unlike VEGF 145 , VEGF 189 is not secreted into the medium of VEGF 189 producing cells and remains cell associated. The properties of VEGF 206 are similar to those of VEGF 189 .

Although heparin is able to release VEGF 145 from ECM, as observed for VEGF 189 , it is likely that VEGF 145 does not use ECM resident heparin-sulfates to bind to the matrix. An angiogenic response with intact VEGF 189 has so far not been demonstrated. This may be due to the tight association of VEGF 189 with the VEGF 189 producing cells, and with the ECM found in close proximity to the VEGF 189 producing cells. VEGF 145 is released from producing cells and promotes angiogenesis in-vivo. This observation indicates that the affinity of VEGF 145 to ECM is probably lower than that of VEGF 189 . Thus, VEGF 145 possesses a unique combination of properties that may render it a more suitable therapeutic agent in certain situations as compared to other VEGF forms.

EXAMPLE VII

Gene-Transfer-Mediated Angiogenesis Therapy Using VEGF 145

DNA encoding VEGF 145 is used for gene-transfer-mediated angiogenesis therapy as described, for example, in International Patent Application No. PCT/US96/02631, published Sep. 6, 1996, as WO96/26742, hereby incorporated by reference herein in its entirety.

Adenoviral Constructs

A helper independent replication deficient human adenovirus 5 system may be used for gene-transfer. A nucleic acid molecule coding for VEGF 145 may be cloned into the polylinker of plasmid ACCMVPLPA which contains the CMV promoter and SV40 polyadenylation signal flanked by partial adenoviral sequences from which the E1A and E1B genes (essential for viral replication) have been deleted. This plasmid is co-transferred (lipofection) into 293 cells with plasmid JM17 which contains the entire human adenoviral 5 genome with an additional 4.3 kb insert making pJM17 too large to be encapsidated. Homologous rescue recombination results in adenoviral vectors containing the transgene in the absence of E1A/E1B sequences. Although these recombinants are nonreplicative in mammalian cells, they can propagate in 293 cells which have been transformed with E1A/E1B and provided these essential gene products in trans. Transfected cells are monitored for evidence of cytopathic effect which usually occurs 10-14 days after transfection. To identify successful recombinants, cell supernatant from plates showing a cytopathic effect is treated with proteinase K (50 mg/ml with 0.5% sodium dodecyl sulfate and 20 mM EDTA) at 56° C. for 60 minutes, phenol/chloroform extracted and ethanol precipitated. Successful recombinants are then identified with PCR using primers ( Biotechniques, 15:868-72, 1993) complementary to the CMV promoter and SV40 polyadenylation sequences to amplify the VEGF 145 nucleic acid insert and primers ( Biotechniques, 15:868-72, 1993) designed to concomitantly amplify adenoviral sequences. Successful recombinants then are plaque purified twice. Viral stocks are propagated in 293 cells to titers ranging between 10 10 and 10 12 viral particles, and are purified by double CsCl gradient centrifugation prior to use. The system used to generate recombinant adenoviruses imposed a packing limit of 5 kb for transgene inserts. The VEGF 145 genes, driven by the CMV promoter and with the SV40 polyadenylation sequences are well within the packaging constraints. Recombinant vectors are plaque purified by standard procedures. The resulting viral vectors are propagated on 293 cells to titers in the 10 10 -10 12 viral particles range. Cells are infected at 80% confluence and harvested at 36-48 hours. After freeze-thaw cycles the cellular debris is pelleted by standard centrifugation and the virus further purified by double CsCl gradient ultracentrifugation (discontinues 1.33/1.45 CsCl gradient; cesium prepared in 5 mM Tris, 1 mM EDTa (pH 7.8); 90,000×g (2 hr), 105,000×g (18 hr)). Prior to in vivo injection, the viral stocks are desalted by gel filtration through Sepharose columns such as G25 Sephadex. The resulting viral stock has a final viral titer approximately in the 10 10 -10 12 viral particles range. The adenoviral construct should thus be highly purified, with no wild-type (potentially replicative) virus.

Porcine Ischemia Model for Angiogenesis

A left thoracotomy is performed on domestic pigs (30-40 kg) under sterile conditions for instrumentation. (Hammond, et. al., J Clin Invest 92: 2644-52, and Roth, et al., J. Clin. Invest. 91:939-49, 1993). Catheters are placed in the left atrium and aorta, providing to means to measure regional blood flow, and to monitor pressures. Wires are sutured on the left atrium to permit ECG recording and atrial pacing. Finally, an amaroid is placed around the proximal LCx. After a stable degree of ischemia develops, the treatment group receives an adenoviral construct that includes a VEGF 145 gene driven by a CMV promoter. Control animals receive gene transfer with an adenoviral construct that includes a reporter gene, lacZ, driven by a CMV promoter.

Studies are initiated 35±3 days after amaroid placement, at a time when collateral vessel development and pacing-induced dysfunction are stable (Roth, et al., Am. J. Physiol 253:1-11279-1288, 1987, and Roth, et al., Circulation 82:1778-89). Conscious animals are suspended in a sling and pressures from the LV, LA and aorta, and electrocardiogram are recorded in digital format on-line (at rest and during atrial pacing at 200 bpm). Two-dimensional and M-mode images are obtained using a Hewlett Packard ultrasound imaging system. Images are obtained from a right parasternal approach at the mid-papillary muscle level and recorded on VHS tape. Images are recorded with animals in a basal state and again during right atrial pacing (HR=200 bpm). These studies are performed one day prior to gene transfer and repeated 14±1 days later. Rate-pressure products and left atrial pressures should be similar in both groups before and after gene transfer, indicating similar myocardial oxygen demands and loading conditions. Echocardiographic measurements are made using standardized criteria (Sahn, et al., Circulation 58:1072, 1978). End-diastolic wall thickness (EDWth) and end-systolic wall thickness (ESWTh) are measured from 5 continuous beats and averaged. Percent wall thickening (%WTh) is calculated [(EDWTh-ESWTh)/EDWTh]×100. Data should be analyzed without knowledge of which gene the animals had received. To demonstrate reproducibility of echocardiographic measurements, animals should be imaged on two consecutive days, showing high correlation (r 2 =0.90; p=0.005).

35±3 days after amaroid placement, well after amaroid closure, but before gene transfer, contrast echocardiographic studies are performed using the contrast material (Levovist) which is injected into the left atrium during atrial pacing (200 bprn). Studies are repeated 14±1 days after gene transfer. Peak contrast intensity is measured from the video images using a computer-based video analysis program (Color Vue II, Nova Microsonics, Indianapolis, Ind.), that provides and objective measure of video intensity. The contrast studies are analyzed without knowledge of which gene the animals have received.

At completion of the study, animals are anesthetized and midline thoracotomy performed. The brachycephalic artery is isolated, a canula inserted, and other great vessels ligated. The animals receive intravenous heparin (10,000 IU) and papaverine (60 mg). Potassium chloride is given to induce diastolic cardiac arrest, and the aorta cross-clamped. Saline is delivered through the brachycephalic artery cannula (120 mmHg pressure), thereby perfuming the coronary arteries. Glutaraldehyde solution (6.25%, 0.1 M cacodylate buffer) was perfused (120 mmHg pressure) until the heart is well fixed (10-15 min). The heart is then removed, the beds identified using color-coded dyes injected anterograde through the left anterior descending (LAD), left circumflex (LCx), and right coronary arteries. The amaroid is examined to confirm closure. Samples taken from the normally perfused and ischemic regions are divided into thirds and the endocardial and epicardial thirds are plastic-imbedded. Microscopic analysis to quantitate capillary number is conducted as previously described (Mathieu-Costello, et al., Am. J. Physiol 359:H204, 1990). Four 1 μm thick transverse sections are taken from each subsample (endocardium and epicardium of each region) and point-counting is used to determine capillary number per fiber number ratio at 40O× magnification. Twenty to twenty-five high power fields are counted per subsample. Within each region, capillary number to fiber number rations should be similar in endocardium and epicardium so the 40-50 field per region should be averaged to provide the transmural capillary to fiber number ratio.

To establish that improved regional function and blood flow result from transgene expression, PCIR and PT-PCR may be used to detect transgenic VEGF 145 DNA and mRNA in myocardium from animals that have received VEGF 145 gene transfer. Using a sense primer to the CMV promoter (GCAGAGCTCGTTTAGTGAAC (Seq. I.D. No. 9)) and an antisense primer to the internal VEGF 145 gene sequence PCIR is used to amplify the expected 500 bp fragment. Using a sense primer to the beginning of the VEGF 145 sequence and an antisense primer to the internal VEGF 145 gene sequence RT-PCR is used to amplify the expected 400 bp fragment.

Finally, using an antibody directed against VEGF 145 . VEGF 145 protein expression may be demonstrated 48 hours as well as 14±1 days after gene transfer in cells and myocardium from animals that have received gene transfer with a VEGF 145 gene.

The helper independent replication deficient human adenovirus 5 system is used to prepare transgene containing vectors. The material injected in vivo should be highly purified and contain no wild-type (replication competent) adenovirus. Thus adenoviral infection and inflammatory infiltration in the heart are minimized. By injecting the material directly into the lumen of the coronary artery by coronary catheters, it is possible to target the gene effectively. When delivered in this manner there should be no transgene expression in hepatocytes, and viral RNA should not be found in the urine at any time after intracoronary injection.

Injection of the construct (4.0 ml containing about 10 11 viral particles of adenovirus) is performed by injecting 2.0 ml into both the left and right coronary arteries (collateral flow to the LCx bed appeared to come from both vessels). Animals are anesthetized, and arterial access acquired via the right carotid by cut-down; a 5P Cordis sheath is then placed. A 5F Multipurpose (A2) coronary catheter is used to engage the coronary arteries. Closure of the LCx amaroid is confirmed by contrast injection into the left main coronary artery. The catheter tip is then placed 1 cm within the arterial lumen so that minimal material is lost to the proximal aorta during injection. This procedure is carried out for each of the pigs.

Once gene transfer is performed, three strategies are used to establish successful incorporation and expression of the gene: (1) Some constructs may include a reporter gene (lacZ); (2) myocardium from the relevant beds is sampled, and immunoblotting is performed to quantitate the presence of VEGF 145 protein; and (3) PCR is used to detect VEGF 145 mRNA and DNA.

The regional contractile function data obtained should show that control pigs show a similar degree of pacing-induced dysfunction in the ischemic region before and 14±1 days after gene transfer. In contrast, pigs receiving VEGF 145 gene transfer should show an increase in wall thickening in the ischemic region during pacing, demonstrating that VEGF 145 gene transfer in accordance with the invention is associated with improved contraction in the ischemic region during pacing. Wall thickening in the normally perfused region (the interventricular septum) should be normal during pacing and unaffected by gene transfer. The percent decrease in function measured by transthoracic echocardiography should be very similar to the percentage decrease measured by sonomicrometry during atrial pacing in the same model (Hammond, et al. J. Clin. Invest. 92:2644, 1993), documenting the accuracy of echocardiography for the evaluation of ischemic dysfunction.

EXAMPLE VIII

Intracoronary Gene Transfer of Vascular Endothelial Growth Factor-145 Increases Blood Flow and Contractile Function in an Ischemic Region of the Heart

Using an animal model of myocardial ischemia, the degree of pacing-induced myocardial dysfunction and inadequate regional blood flow was quantified. Gene transfer was then performed by intracoronary injection of a recombinant adenovirus expressing VEGF 145 . Two weeks later, pacing-induced dysfunction and regional blood flow were again quantified. Gene transfer with VEGF 145 ameliorated regional myocardial contractile dysfunction and improved regional blood flow.

Animals and Model: Publications disclosed in this Example are hereby incorporated by reference herein in their entirety. The use of animals was in accordance with institutional guidelines. Seven domestic pigs (Sus scrofa) weighing 39±3 kg were used. Animals had catheters placed in the left atrium, pulmonary artery, and aorta, and an ameroid constrictor placed around the proximal left circumflex coronary artery. The ameroid model of myocardial ischemia in pigs was used (Roth, D. M., et al., Am. J. Physiol. 253:H1279-88 (1987); Roth, D. M., et al., Circulation 82, 1778-89 (1990)). An ameroid constrictor is placed around the proximal portion of the left circumflex coronary artery. The ameroid material is hygroscopic and slowly swells, leading gradually to complete closure of the artery ten days after placement, with minimal infarction (<1% of the left ventricle) (Roth, D. M., et al., Circulation 82:1778-89 (1990); White, F. C., et al., Circ. Res. 71:1490-500 (1992); Hammond, H. K., et al., J. Clin. Invest. 92, 2644-2652 (1993)) due to the development of collateral blood vessels. Myocardial function and blood flow are normal at rest in the region previously perfused by the occluded artery (the ischemic region), but blood flow is insufficient to prevent ischemia when myocardial oxygen demands increase. Collateral vessel development is complete within twenty-one days of ameroid placement and remains unchanged for at least four months (Roth, D. M., et al., Am. J. Physiol. 253:H1279-88 (1987)). These procedures have been described in detail elsewhere (Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993); Hammond, H. K., & McKirnan, M. D., J. Amer. Coll. Cardiol. 23:475-482 (1994)).

Transgene Delivery: Thirty±two days after ameroid placement, animals underwent studies to define pacing-induced regional function and blood flow and then received recombinant adenovirus expressing VEGF 145 delivered by intracoronary injection. For intracoronary delivery of the transgene, animals were anesthetized, and a 5F arterial sheath placed into the carotid artery. A 5F multipurpose (A2, end hole only) coronary catheter was inserted through the sheath and into the coronary arteries. Closure of the ameroid was confirmed in all animals by contrast injection into the left coronary artery. The catheter tip was then placed 1 cm within the arterial lumen so that minimal material would be lost to the proximal aorta during injection. Five ml containing 5.0×10 11 viral particles of recombinant adenovirus expressing VEGF 145 were delivered by slowly injecting 3.0 ml into the left and 2.0 ml into the right coronary arteries. Fourteen±one days later studies to define pacing-induced regional function and blood flow were repeated, animals were killed and tissues collected.

Gene transfer was performed with recombinant adenovirus expressing human VEGF 145 after a stable but limited collateral circulation had developed. Previous experiments had demonstrated that animals receiving a recombinant adenovirus expressing lacZ (β-galactosidase) did not show improved regional function, perfusion, or capillary angiogenesis (Giordano F, et al., Nature Medicine 2:534-539 (1996)). These studies excluded the possibility that the adenovirus itself, independent of the expression of an angiogenic protein was augmenting regional myocardial perfusion or function. This also controlled for possible continued collateral vessel development unrelated to gene transfer. Gene transfer was performed after endogenous angiogenesis was quiescent and inducible myocardial ischemia, analogous to angina pectoris in patients, was present. The animals have no ischemia at rest, but develop ischemia during activity or atrial pacing. Atrial pacing at 200 bpm was used to induce myocardial ischemia.

Regional Contractile Function and Perfusion. Two-dimensional and M-mode images were obtained from a right parasternal approach at the papillary muscle level (Hewlett Packard Sonos 1000). Conscious animals were studied suspended in a comfortable sling to minimize body movement. Images were recorded with animals in a basal state and again during left atrial pacing (200 bpm). These studies were performed one day prior to gene transfer and repeated fourteen days later. Rate-pressure products and left atrial pressures were similar in both groups before and after gene transfer, indicating similar myocardial oxygen demands and loading conditions. Echocardiographic measurements were made using standardized criteria (Sahn, D. J., et al., Circulation 58:1072-83 (1978)). The reproducibility of echocardiographic measurements and the interobserver variability have been shown (Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993)); Hammond, H. K., & McKirnan, M. D., J. Amer. Coll. Cardiol. 23, 475-482 (1994)). The percent decrease in function measured by transthoracic echocardiography and sonomicrometry in this model are similar (Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993)); Hammond, H. K., & McKirnan, M. D., J. Amer. Coll. Cardiol. 23:475-482 (1994)) documenting the accuracy of echocardiography for evaluation of ischemic dysfunction.

Regional Contractile Function: Basal wall thickening in the ischemic region was normal (not shown), but atrial pacing (200 bpm) was associated with reduced wall thickening. Two weeks after VEGF 145 gene transfer there was a 2.5 fold increase in wall thickening in the ischemic region during pacing (p<0.0001).

Regional Myocardial Blood Flow: Contrast echocardiography was used to assess regional perfusion. Left atrial injection of contrast material (microaggregates of galactose) increase the echogenicity (whiteness) of the echocardiographic image. The microaggregates distribute into the coronary arteries and myocardial walls in a manner that is proportional to blood flow. The peak intensity of contrast enhancement is correlated with myocardial blood flow as measured by microspheres (Skyba, D. M., et al., Circulation 90:1513-21 (1994)). Thirty days after ameroid placement, well after ameroid closure, but before gene transfer, contrast echocardiographic studies were performed during atrial pacing (200 bpm). Studies were repeated fourteen days after gene transfer. Peak contrast intensity was measured from the video images using a computer-based video analysis program that provided an objective measure of video intensity. Data were expressed as the ratio of the peak video intensity in the ischemic region (LCx bed) divided by the peak video intensity in the interventricular septum, a region receiving normal blood flow through the unoccluded left anterior descending coronary artery. Prior to gene transfer, animals showed a deficit in blood flow in the ischemic region during pacing. Two weeks after VEGF 145 gene transfer, the animals showed improved contrast enhancement in the LCx region, indicating improved flow (p=0.0045). The differences in regional blood flow during atrial pacing measured by contrast echocardiography were similar to the differences measured by microspheres in this same model (Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993)); Hammond, H. K., & McKirnan, M. D., J. Amer. Coll. Cardiol. 23:475-482 (1994)) documenting the accuracy of echocardiography for the evaluation of regional myocardial blood flow.

Recombinant Adenovirus Production. A helper-independent replication-deficient human adenovirus-5 was used (Giordano F, et al., Nature Medicine, 2:534-539 (1996); McGrory, W. J., et al., Virology 163:614-617 (1988)). The full length cDNA for human VEGF 145 was isolated from a cDNA library which was constructed from mRNA of human epithelial ovarian cancer cells (OC-238 cells). The cDNA that encodes VEGF 145 is 0.5 kb; the protein has 171 amino acids that includes a 26 amino acid signal peptide at the N-terminal (Poltorak Z, et al., J. Biol. Chem. 272:7151-7158 (1997)). VEGF 145 cDNA was subcloned as a Bam H1 fragment, into the adenovirus shuttle vector pACCMVpLpASR (pACSR for simplicity) at the Eco R1 site. The shuttle vector contains a CMV promoter, a polylinker, and SV40 polyadenylation sequences flanked by partial human adenovirus-5 sequences. This construct was co-transfected (calcium phosphate) into HEK 293 cells with plasmid JM17 that contains the entire human adenovirus-5 genome with an additional 4.3 kb insert, making pJM17 too large to be encapsidated into mature adenovirus virions. The cells were then overlaid with nutrient agarose. Adenovirus plaques formed as a result of homologous recombination and were picked 10-12 days later. Recombinant adenovirus from individual plaques was propagated in HEK 293 cells, and adenovirus DNA was isolated and then characterized by restriction analysis. The recombinant adenovirus construct is devoid of E1A/E1B sequences and is replication-deficient. Plaque-purified virus was amplified on HEK 293 cells, concentrated and purified by cesium chloride ultracentrifugation, and desalted by column filtration through Sephadex G-25 equilibrated with phosphate buffered saline. Final adenovirus amounts (virus particles) were determined by optical densitometry and infectiousness (plaque forming units) were determined by plaque titration.

Transgene Expression: Following gene transfer, left ventricular homogenates underwent studies to document transgene expression. A monoclonal antibody directed against VEGF 145 which also identified VEGF 145 was used in immunoblots of protein from the medium and from lysates of HEK 293 cells 48 hours after gene transfer using recombinant adenovirus expressing VEGF 145 compared with cells infected with non-expressing isolate from the same original recombination. Methods for Western blotting have been described in detail elsewhere (Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993); Roth, D. A., et al., J. Clin. Invest. 91:939-949 (1993); Ping, P. & Hammond, H. K. Am. J. Physiol. 267:H2079-H2085 (1994)). These preliminary studies ( FIG. 20 ) show that VEGF 145 was detectable in the heart of animals that had received VEGF gene transfer and that the control animal showed no transgene expression in the heart.

To examine the transgene for mitogenic activity in vitro, COS-7 cells were infected with recombinant adenovirus expressing VEGF 145 or lacZ or were not infected. Lysates were incubated with human umbilical vein endothelial cells for 96 hr proliferation and tritiated thymidine incorporation were measured (Giordano F, et al., Nature Medicine 2:534-539 (1996); Poltorak Z, et al., J. Biol. Chem. 272:7151-7158 (1997); Tsai, P. S., et al., Endocrinology 136:3831-38 (1995)).

Assessment of Inflammation: Hematoxylin and eosin and Masson's trichrome stains were used to detect inflammatory cell infiltrates, cell necrosis, and fibrosis in sections obtained from heart and liver.

Statistical Analysis: Data are expressed as mean±1 SD. Measurements made before and after gene transfer with VEGF 145 were compared using Student's t-test for paired data (two tails). The null hypothesis was rejected when p<0.05.

Two measurements were used to assess whether gene transfer of VEGF 145 was effective in treating myocardial ischemia: regional contractile function and perfusion, assessed before and after gene transfer.

Regional Contractile Function and Blood Flow: Thirty±two days after ameroid placement, animals showed impaired wall thickening during atrial pacing. Two weeks after VEGF 145 gene transfer there was a 2.5 fold increase in wall thickening in the ischemic region during pacing (p<0.0001; FIG. 19 and Table 1).

Associated with improved function in the ischemic region was improved regional blood flow. As shown in FIG. 19 and Table 1, before gene transfer there was reduction in the peak contrast ratio (LCx/LAD), denoting decreased perfusion of the ischemic bed. Two weeks after VEGF 145 gene transfer there was improved contrast enhancement, indicating improved blood flow in the ischemic region (p=0.0045).

Protein Expression: After having established favorable effects of VEGF 145 gene transfer on regional myocardial function and perfusion, expression of the transgene in the heart was demonstrated. Immunoblotting showed VEGF 145 protein in myocardium samples from two animals that had received VEGF 145 gene transfer (FIG. 20 ). VEGF 145 was not detected in myocardium from a control animal. In additional experiments using cultured COS-7 cells, it was shown that gene transfer of VEGF 145 conferred the ability of these cells to synthesize VEGF 145 . Lysates from cultured cells infected with recombinant adenovirus expressing VEGF 145 produced a proliferative response in endothelial cells (2.9-fold increase vs control). Thymidine incorporation (4 hr incubation) was increased 3-fold in endothelial cells incubated with lysate from COS-7 cells infected with VEGF 145 compared to lysates of uninfected cells. These studies document successful gene transfer and expression, and demonstrate the biological activity of the transgene protein.

Assessment of Inflammation: Microscopic inspection of heart and liver from five of the animals that had received recombinant adenovirus expressing VEGF 145 have been completed. Transmural sections of hearts of these animals did not show inflammatory cell infiltrates, cell necrosis, or increased fibrosis. The liver sections also showed no evidence for inflammation.

In this model of stress-induced myocardial ischemia, intracoronary injection of a recombinant adenovirus expressing human VEGF 145 resulted in protein expression of the transferred gene. Two weeks after gene transfer, regional abnormalities in stress-induced function and blood flow were improved, to a degree that was statistically indistinguishable from normal perfusion and function.

The ameroid model of myocardial ischemia (Roth, D. M., et al., Am.J. Physiol. 253:H1279-88 (1987); Roth, D. M., et al., Circulation 82:1778-89 (1990); White, F. C., et al., Circ. Res. 71:1490-500 (1992); Hammond, H. K., et al., J. Clin. Invest. 92:2644-2652 (1993); Hammond, H. K., & McKirnan, M. D., J. Amer. Coll. Cardiol. 23:475-482 (1994)) was used for gene transfer experiments with recombinant adenovirus expressing human VEGF 145 after a stable but limited collateral circulation had developed. In previous experiments, it was shown that control animals that received a recombinant adenovirus expressing lacZ (β-galactosidase) showed no improvement over time, excluding the possibility that the adenovirus itself might cause similar alterations (Giordano F, et al., Nature Medicine 2:534-539 (1996)). This also controlled for possible continued collateral vessel development unrelated to gene transfer. Improved regional myocardial blood flow and function following VEGF 145 gene transfer is likely to have resulted from angiogenesis. Indeed, in previous studies using the same model but gene transfer of FGF-5, it was shown that capillary angiogenesis occurs in the hearts of animals two weeks after gene delivery.

Inflammatory infiltrates have been documented in the heart after direct intramyocardial injection through a needle inserted into the myocardial wall (Yang, Y., et al., Proc. Natl. Acad. Sci. ( U.S.A. ) 91:4407-11 (1994); French, B. A., et al., Circulation 90:2414-24 (1994)). However, direct intramyocardial injection is likely to expose the myocardium to virus titers much higher than those achieved after intracoronary delivery and diffuse dispersion of the virus throughout the myocardium. This may explain why myocardial inflammation may result after intramyocardial injection, but not after intracoronary injection. Indeed, Barr et al (Barr, E., et al., Gene Therapy 1:51-58 (1994)), using intracoronary delivery of recombinant adenovirus expressing lacZ, also found no inflammatory infiltrates or necrosis in the heart. Cytotoxic T-cells have not been found in the hearts of animals that had received adenovirus (Giordano F., et al., Nature Medicine 2:534-539 (1996)) confirming that, despite widespread transgene expression, intracoronary delivery of recombinant adenovirus is not associated with an inflammatory response in the heart in the amounts used in this study, over the time course studied in this species.

TABLE 1
Regional Function and Perfusion: Effect of
Intracoronary Delivery of Adv. VEGF 145
	PEAK
	CONTRAST RATIO
	LCx Bed/LAD
	% WALL THICKENING	Bed, 200 bpm
	LCx Bed, 200 bpm		14d Post-
Pig Number	Pre-Gene	14d Post-Gene	Pre-Gene	Gene
277	26	59	0.36	0.49
279	23	53	0.45	0.72
280	15	34	0.39	0.42
281	24	56	0.26	0.61
282	16	54	0.45	0.69
283	15	59	0.36	0.64
284	25	56	0.46	0.54

LCx, Left Circumflex coronary artery; LAD, Left Anterior Descending coronary artery

EXAMPLE IX

VEGF 145 Derivatives VEGF 145-I , VEGF 145-II , and VEGF 145-III

This example describes the construction and activity of particular VEGF 145 derivatives. Other derivatives are within the scope of the present invention as will be readily apparent to those of ordinary skill in the art.

Deletion mutants VEGF 145-I , VEGF 145-II and VEGF 145-III each contain a deletion of Domain I, II, or III, respectively, of Exon 6a. These domains of Exon 6a are depicted in FIG. 12 .

FIG. 12 also depicts the target of PCR primers used to carry out deletions. However, any method known in the art may be used to construct these deletion derivatives, including these described herein, and including the synthesis de novo of the nucleotide sequence coding for the VEGF 145 derivative. FIGS. 13 and 14 depict the nucleotide and amino acid sequences of VEGF 145-I , VEGF 145-II , and VEGF 145-III .

Deletion of Region II from Exon 6 of VEGF 145 and Expression of the Mut-II Deletion Mutant (VEGF 145-II )

Primer 268 which contains sequences derived from exon 1 of VEGF (5′ CGAATTCTGCCTTGCTGCTCTACCTCCACCAT (Seq. I.D. No. 10)) and primer 3 (5′ CCCCTTTCCCTTTCCTCG (Seq. I.D. No. 11)) were used to amplify a region derived from VEGF 145 and containing region I ( FIG. 12 ) by the polymerase chain reaction (PCR). Primers 269 (5′ CGGGATCCCCTCATTCATTCATCACCGCCTCGG (Seq. I.D. No. 12)) and primer 4 (5′ CGAGGAAAGGGAAAGGG -GTCCCGGTATAAGTCCTGG (Seq. I.D. No. 13)) were used to amplify a region III containing area from VEGF 145 (FIG. 12 ). The underlined sequence is complementary to primer 3. Following amplification, the products were purified, combined, and re-amplified using primers 268 and 269. The ligated product containing exon 6a cDNA with a deletion in region II of exon 6a (Mut-II) was ligated by TA cloning into the pGEM-T vector (Promega). A region from a plasmid containing VEGF 145 cDNA was cut with Bsm-I and Sac-I so that it contained the whole cDNA of VEGF 145 from the 5′ ATG to the internal Bsm-I site at nucleotide 403 (with exon 4). The pGEM-T vector containing the Mut-II amplified sequence was cut with the same restriction enzymes and the VEGF 145 cDNA-derived sequence was introduced into the plasmid to generate VEGF 145 mutant lacking region II of axon-6a (Mut-II) (FIG. 12 ).

The Mut-II deletion mutant was subcloned into pVL-1393 (Invitrogen) and used to generate a recombinant baculovirus essentially as previously described (Poltorak et al., J. Biol. Chem. 272:7151-7158 (1997)). The baculovirus was used to infect sF9 insect cells and to generate Mut-II protein as described for VEGF 145 . A similar procedure was used to generate Mut-I and Mut-III proteins. The sizes of the proteins expressed by the Mut-I, Mut-II, and Mut-III deletion mutants are compared in FIG. 15 .

Partial Purification of Mut-II

Serum free conditioned medium containing Mut-II was diluted 1:1 with 20 mM Tris pH-7 and applied to a hepatin-sepharose column pre-equilibrated with 10 mM Tris/HCl pH-7 and 50 mM NaCl. The column was washed stepwise with same buffer containing 150, and 340 mM salt. The salt concentration at which Mut-II elutes from the heparin-sepharose column is −300 mM Nacl, as compared to −700 mM for VEGF 145 . These results indicate that Mut-II has a much lower affinity to heparin than does VEGF 145 . The 300 mM fraction containing most of the Mut-II protein ( FIG. 16 ) was diluted with sodium-phosphate buffer (20 mM pH-6) (NaPi) to 50 mM NaCl and loaded onto an SP-sepharose column. The column was washed with NaPi containing 50 mM and 200 mM NaCl and the Mut-II protein was eluted with NaPi buffer containing 0.5 M NaCl. This preparation was about 50% pure and was used for further experiments.

The concentration of Mut-II was determined by ELISA using anti-VEGF antibodies as previously described (Poltorak et al., 1997). The mitogenic effect of Mut-II was compared with that of full length VEGF 145 using an endothelial cell proliferation assay as described (Poltorak et al., 1997). It was found that Mut-II was 6.5 fold more active than VEGF 145 in this assay ( FIG. 17 ) despite its significantly lower affinity to heparin ( FIG. 16 ) (Poltorak et al., 1997).

Mut-II was then assayed for its ability to bind an extracellular matrix prepared from bovine corneal endothelial cells (Poltorak et al., 1997). The binding of Mut-II and VEGF 145 to the extracellular matrix was monitored using anti-VEGF antibodies as described in Poltorak, Z., et al., ( J. Biol. Chem. 272:7151-7158 (1997)). The results indicate that Mut-II binds to this extracellular matrix as well as VEGF 145 and that Mut-II binds to the ECM better than VEGF 145 (FIG. 18 ).

Mut-II thus retains the extracellular matrix binding ability of VEGF 145 which is the hallmark of VEGF 145 despite its reduced heparin binding ability. The half maximal stimulation of biological activity of Mut-II is at ˜2 ng/ml. Surprisingly, its biological potency is increased as compared to VEGF 145 (Poltorak et al., 1997) and is similar to that of VEGF 165 and VEGF 121 . This mutant is expected to bind in-vivo to extracellular matrixes like VEGF 145 and to be slowly released from them. However, it has an advantage as it is expected to stick less to cell surface heparan-sulfates and be more diffusible than VEGF 145 as a result. It also has a higher biological potency as a mitogen for endothelial cells, which is expected to result in better angiogenic properties in-vivo. The Mut-II cDNA can be subcloned to generate adenovirus vectors for use in gene therapy as described herein.

Although preferred embodiments are specifically described herein, it will be appreciated that many modifications and variations of the present invention are possible in light of the above teachings and within the purview of the appended claims without departing from the spirit and intended scope of the invention.

17 1 516 DNA Homo sapiens 1atgaactttc tgctgtcttg ggtgcattgg agccttgcct tgctgctcta cctccaccat 60gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240atgcgatgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg 360agcttcctac agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420aaaaaatcag ttcgaggaaa gggaaagggg caaaaacgaa agcgcaagaa atcccggtat 480aagtcctgga gcgtatgtga caagccgagg cggtga 516 2 145 PRT Homo sapiens 2Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120 125Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Cys Asp Lys Pro Arg 130 135 140Arg145 3 21 DNA Homo sapiens 3ggagagatga gcttcctaca g 21 4 21 DNA Homo sapiens 4tcaccgcctt ggcttgtcac a 21 5 24 DNA Homo sapiens 5gcttccggct cgtatgttgt gtgg 24 6 23 DNA Homo sapiens 6acgctccagg acttataccg gga 23 7 24 DNA Homo sapiens 7ggtaacgcca gggttttccc agtc 24 8 42 DNA Homo sapiens 8cggtataagt cctggagcgt atgtgacaag ccgaggcggt ga 42 9 20 DNA Homo sapiens 9gcagagctcg tttagtgaac 20 10 32 DNA Homo sapiens 10cgaattctgc cttgctgctc tacctccacc at 32 11 18 DNA Homo sapiens 11cccctttccc tttcctcg 18 12 33 DNA Homo sapiens 12cgggatcccc tcattcattc atcaccgcct cgg 33 13 36 DNA Homo sapiens 13cgaggaaagg gaaaggggtc ccggtataag tcctgg 36 14 495 DNA Homo sapiens 14atgaactttc tgctgtcttg ggtgcattgg acccttgcct tgctgctcta cctccaccat 60gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240atgcgatgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg 360agcttcctac agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420aaaaaatcag ttcgaggaaa gggaaagggg tcccggtata agtcctggag cgtatgtgac 480aagccgaggc ggtga 495 15 138 PRT Homo sapiens 15Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys1 5 10 15Pro Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Tyr Lys 115 120 125Ser Trp Ser Val Cys Asp Lys Pro Arg Arg 130 135 16 138 PRT Homo sapiens 16Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Ser Arg Tyr Lys 115 120 125Ser Trp Ser Val Cys Asp Lys Pro Arg Arg 130 135 17 137 PRT Homo sapiens 17Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120 125Arg Lys Lys Cys Asp Lys Pro Arg Arg 130 135

Claims

1. An isolated polynucleotide comprising exons 1-5, 6a and 8 of the VEGF gene, wherein said polynucleotide does not comprise exon 6b or exon 7 of the VEGF gene, and wherein said polynucleotide is operably linked to a regulatory sequence.

2. The polynucleotide according to claim 1 wherein said VEGF is a splice variant.

3. The polynucleotide according to claim 1, wherein the polynucleotide comprises a variant exon 6a lacking one or more codons.

4. The polynucleotide according to claim 3, wherein said polynucleotide codes for a VEGF selected from the group consisting of VEGF145-I, VEGF145-II and VEGF145-III.

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises the nucleotide sequence of SEQ. ID. NO: 3.

6. The polynucleotide according to claim 1 wherein said regulatory sequence is a promoter.