This application contains a sequence listing in paper format and in computer readable format, the teachings and content of which are hereby incorporated by reference.
The present application relates to cDNA clones of anti-nicotinamide phosphoribosyltransferase antibody (anti-NAMPT) genes. More particularly, this disclosure relates to cDNA clones of anti-NAMPT genes encoding monomers of the single chain variable fragment (scFv) formed from both the heavy (VH) and light (VL) chains of immunoglobulin's and the construction of antibodies using such clones.
NAMPT is a pleiotropic protein, originally named pre-B-cell colony enhancing factor (PBEF) after its function to promote pre-B-cell colony formation. NAMPT is the rate-limiting enzyme in the salvage pathway of mammalian NAD biosynthesis that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. NAMPT was also formerly known as VISFATIN, an adipokine produced by visceral fat that mimics the effects of insulin. NAMPT is a pleiotropic protein with functions in innate immunity, inflammation, apoptosis and oxidative stress, etc. The gene that codes for NAMPT is an essential one, thought to be critical for survival. Homozygous NAMPT knockout mice are embryonically lethal and adult mice with Tamoxifen induced Cre deletion of its two copies die within a few days.
Because of its pleiotropic and essential functions, dysregulation of the NAMPT gene has been implicated in the susceptibility and pathogenesis of several human diseases and conditions such as acute respiratory distress syndrome, arthritis, cancer, coronary artery disease, and diabetes. In particular, studies have demonstrated that NAMPT is overexpressed in neutrophils of both patient and animal models of acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). In addition, a multitude of experimental and clinical data point to the causative role of neutrophils in lung injury. Activation and transmigration of neutrophils is a hallmark event in the progression of ALI and ARDS. Since NAMPT has an antiapoptotic role, it functions to prolong neutrophil presence at the site of inflammation, and hence results in hyperinflammatory tissue damage because of the neutrophil's capacity for the production of toxic mediators.
Studies have also demonstrated that NAMPT mediates inflammatory response and tissue destruction. NAMPT is known to be up-regulated in both Juvenile idiopathic arthritis (JIA) and rheumatoid arthritis (RA) and is a key biomarker in arthritis. Knockdown of NAMPT in RAW 264.7 macrophage has been shown to attenuate their differentiation into osteoclasts. Knockdown of NAMPT has also been shown to significantly attenuate the immune response and bone erosion in mice having collagen-induced arthritis. NAMPT is believed to mediate inflammatory response and tissue destruction in multiple cell types, including synovial fibroblasts, macrophages and neutrophils.
Pulmonary surfactant is a complex mixture of phospholipids, lipids, and proteins that lines the alveolar regions of the lungs, thereby stabilizing the surface of the air-blood barrier and improving gas exchange. Surfactant protein B (SP-B) is a critical component of pulmonary surfactant which is secreted by two types of lung epithelial cells, the alveolar type II cell and club cell. SP-B is the only surfactant protein strictly required for breathing, its absence is associated with a lethal respiratory failure in mice and humans. TNF-α inhibits expression of pulmonary surfactant protein in epithelial cells. The decrease in SP-B protein concentration is considered to contribute to the severity of lung inflammation and injury following infection. On the other hand, anti-inflammatory properties as well as protection from oxygen-induced and endotoxin (LPS)-induced lung injuries also have been described for SP-B.
ALI and ARDS are common syndromes with a high mortality rate and characterized by pulmonary inflammation. Abnormal surfactant function is thought to play a central role in the evolution of ALI/ARDS. SP-B was low in the bronchoalvelolar lavage (BAL) of patients at risk for ARDS before the onset of clinically defined lung injury, and in patients with established ARDS. Although SP-B involvement and down-regulation in inflammatory processes has been generally recognized, the exact mechanism behind that has not yet been elucidated.
NAMPT is a novel biomarker in ARDS with genetic variants conferring ARDS susceptibility. In vivo, overexpression of NAMPT aggravated ALI and IL-1β or TNF-α mediated cell permeability and IL-8 secretion in epithelial cells and endothelial cells, while knockdown of NAMPT expression attenuated ventilator induced lung injury (VILI) and IL-1β or TNF-α mediated cell permeability and IL-8 secretion. These findings indicate that NAMPT regulates epithelial functions upon ALI.
Because NAMPT is an essential gene, it is not feasible to undertake ubiquitous knockdown of NAMPT without affecting its normal physiological function in other organs of the body. However, knockdown of NAMPT in neutrophils would enhance neutrophil apoptosis and shorten the life of neutrophils, which could ameliorate long lasting neutrophil-related inflammatory damage. Accordingly, there is a need for the ability to knockdown NAMPT in specific cell types, rather than in an entire organ or throughout the body. In particular, there is a need for a neutrophil-specific NAMPT gene knockdown, as well as a fibroblast specific NAMPT gene knockdown, as well as a macrophage specific NAMPT gene knockdown.
The present disclosure broadly concerns two unique anti-NAMPT antibody genes. Each of the genes encodes a single-chain fragment variable (scFv) antibody, designated scFv1 or scFv2. Each of these antibody fragments is a fusion protein of the variable regions of the heavy (VH) and light (VL) regions or chains of immunoglobulins connected with a shorter linker peptide of from about ten to about 25 amino acids. These two genes can be engineered to express NAMPT-targeted therapy and any cell-targeted therapy. ScFv1 has an exemplary nucleotide sequence identified as SEQ ID NO 1, and scFv1 has an exemplary amino acid sequence identified as SEQ ID NO 2. ScFv2 has an exemplary nucleotide sequence identified as SEQ ID NO 3, and scFv2 has an exemplary amino acid sequence identified as SEQ ID NO 4.
The disclosure also concerns cDNA clones of anti-NAMPT antibody genes. The clones encode monobodies or monomers including the variable regions from the VH chain of immunoglobulin linked with the variable regions from the VL chain of immunoglobulin connected by a linker. Thus, one cDNA clone of an anti-NAMPT antibody gene encodes a monomer scFv1 having linked variable regions from the VH and VL chains. Another cDNA clone of an anti-NAMPT antibody gene encodes a monomer scFv2 having linked variable regions from the VH and VL chains.
The disclosure further concerns cDNA clones of anti-NAMPT antibody genes encoding dibodies or dimers including two monomers, each monomer including the variable regions from the VH chain of immunoglobulin linked with the variable regions from the VL chain of immunoglobulin, the monomers being connected by a linker.
The disclosure further concerns cDNA clones of anti-NAMPT antibody genes encoding dimers formed of a scFv1 connected with a scFv1 by a linker.
The disclosure further concerns cDNA clones of anti-NAMPT genes encoding dimers formed of a scFv1 connected with a scFv2 by a linker. In one non-limiting example, a dimer of the present disclosure has a nucleotide sequence identified as SEQ ID NO 5, and an amino acid sequence identified as SEQ ID NO 6.
Another non-limiting example of a dimer of the present disclosure provides cDNA clones of anti-NAMPT genes encoding dimers formed of a scFv2 connected with another scFv2 by a linker.
In a further aspect of the present disclosure, cDNA clones of anti-NAMPT genes encoding tribodies or trimers including three monomers are provided, each monomer including the variable regions from the VH chain of immunoglobulin linked with the variable regions from the VL chain of immunoglobulin, the monomers being connected by linkers.
Non-limiting examples of a tribodies or trimers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding trimers formed of three linked scFv1 monomers, or three linked scFV2 monomers, where the monomers are each connected by linkers, which may be the same linker or each linker may be distinct.
Additional non-limiting examples of a tribodies or trimers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding trimers formed of two scFv1 monomers and one scFv2 monomer, where the monomers are each connected by linkers, which may be the same linker or each linker may be distinct.
Additional non-limiting examples of a tribodies or trimers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding trimers formed of one scFv1 monomer and two scFv2 monomers, where the monomers are each connected by linkers, which may be the same linker or each linker may be distinct.
Another aspect of the present disclosure concerns cDNA clones of anti-NAMPT genes encoding tetrabodies or tetramers including four monomers, each monomer including the variable regions from the VH chain of immunoglobulin linked with the variable regions from the VL chain of immunoglobulin, the monomers being connected by linkers. Further aspects of the present disclosure can include five monomers linked together by linkers, six monomers, seven monomers, eight monomers, nine monomers, or ten monomers, where each monomer is connected to at least one other monomer by a linker, where the linker may be the same linker or each linker may be distinct.
Non-limiting examples of tetrabodies or tetramers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding tetramers formed of four scFv1 monomers, the monomers connected by linkers, where the monomers may be connected by the same linker or each linker may be distinct.
In another non-limiting examples of tetrabodies or tetramers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding tetramers formed of four scFv2 monomers, the monomers connected by linkers, where the monomers may be connected by the same linker or each linker may be distinct.
Further non-limiting examples of tetrabodies or tetramers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding tetramers formed of three scFv1 monomers, and one scFv2 monomer, with each monomer being connected to at least one other monomer by a linker, where the monomers may be connected by the same linker or each linker may be distinct.
Additional non-limiting examples of tetrabodies or tetramers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding tetramers formed of two scFv1 monomers, and two scFv2 monomers, the monomers being connected by linkers, where the monomers may be connected by the same linker or each linker may be distinct. In one embodiment, such a tetrabody or tetramer may be formed by two dimers, where each dimer has a nucleotide sequence identified as SEQ ID NO 7, and an amino acid sequence identified as SEQ ID NO 8. In such an embodiment, the dimers would be connected by a linker.
Further non-limiting examples of tetrabodies or tetramers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding tetramers formed of one scFv1 monomer, and three scFv2 monomers, the monomers connected by linkers where the monomers may be connected by the same linker or each linker may be distinct.
Another aspect of the present disclosure concerns the variable regions of the heavy (VH) and light (VL) chains of immunoglobulins connected with a shorter linker peptide to form the fusion protein that comprises the scFv1 and scFv2 monomers. As previously described, each scFv1 or scFv2 monomer includes a VH chain and a VL chain. A scFv1 VH chain may be substituted for a scFv2 VH chain, and a scFv1 VL chain may be substituted for a scFv2 VL chain. These heavy (VH) and light (VL) chains may be substituted in any monomer described herein, including those monomers that are part of dimers, trimmers, tetramers, and the like.
Non-limiting examples of monomers of the present disclosure include cDNA clones of anti-NAMPT antibody genes encoding monomers formed of a scFv1 VH chain and a scFv2 VL chain, the chains connected by a linker. Such a monomer may be part of a dimer, trimer, or tetramer as described herein.
A non-limiting example of a monomer having variable light and/or heavy chain regions includes cDNA clones of anti-NAMPT antibody genes containing monomers formed of a scFv2 VH chain and a scFv1 VL chain, the chains connected by a linker.
A further non-limiting example of a monomer having variable light and/or heavy chain regions includes cDNA clones of anti-NAMPT antibody genes containing monomers formed of a scFv1 VH chain and a scFv2 VL chain, the chains connected by a linker.
In another aspect of the disclosure, each monomer includes 6 Complementarity Determining Regions (CDR) per scFv antibody, identified as CDR1, CDR2, CDR3, CDR4, CDR5, and CDR6. These CDRs confer the ability to recognize and bind to a unique antigen, in this case NAMPT.
In another aspect of the disclosure as illustrated in Tables 1 and 2 below, an exemplary scFv1 CDR1 has a nucleotide sequence identified as SEQ ID NO 9 and an exemplary amino acid sequence identified as SEQ ID NO 10. An exemplary scFv2 CDR1 has a nucleotide sequence identical to scFv1 CDR1 and identified as SEQ ID NO 9, and an exemplary scFv2 CDR1 has an amino acid sequence identical to scFv1 CDR1 and identified as SEQ ID NO 10. An exemplary scFv1 CDR 2 has a nucleotide sequence identified as SEQ ID NO 11 and an exemplary amino acid sequence identified as SEQ ID NO 12. An exemplary scFv2 CDR 2 has a nucleotide sequence identified as SEQ ID NO 13 and an exemplary amino acid sequence identified as SEQ ID NO 14. An exemplary scFv1 CDR3 has a nucleotide sequence identified as SEQ ID NO 15 and an exemplary amino acid sequence identified as SEQ ID NO 16. An exemplary scFv2 CDR3 has a nucleotide sequence identified as SEQ ID NO 17 and an exemplary amino acid sequence identified as SEQ ID NO 18. An exemplary scFv1 CDR4 has a nucleotide sequence identified as SEQ ID NO 19 and an exemplary amino acid sequence identified as SEQ ID NO 20. An exemplary scFv2 CDR4 has a nucleotide sequence that is identical to scFv1 CDR4 and identified as SEQ ID NO 19. The amino acid sequence of scFv2 CDR 4 is identical to scFv1 CDR4 and identified as SEQ ID NO 20. An exemplary scFv1 CDR5 has a nucleotide sequence identified as SEQ ID NO 21 and an exemplary amino acid sequence identified as SEQ ID NO 22. An exemplary scFv2 CDR5 has a nucleotide sequence identified as SEQ ID NO 23 and an exemplary amino acid sequence identified as SEQ ID NO 24. An exemplary scFv1 CDR6 has a nucleotide sequence identified as SEQ ID NO 25 and an exemplary amino acid sequence identified as SEQ ID NO 26. An exemplary scFv2 CDR6 has a nucleotide sequence identified as SEQ ID NO 27 and an exemplary amino acid sequence identified as SEQ ID NO 28.
The disclosure further provides that, within monomers, the scFv1 Complimentary Determining Regions and scFv2 Complimentary Determining Regions may be substituted for each other, where a CDR1 would be substituted for a CDR1, a CDR2 would be substituted for a CDR2, and so on. As previously discussed, scFv1 CDR1 and scFv2 CDR1, each having a nucleotide sequence identified as SEQ ID NO 9 and an amino acid sequence identified as SEQ ID 10, are identical; scFv1 CDR4 and scFv2 CDR4, each having a nucleotide sequence identified as SEQ ID NO 19 and an amino acid sequence identified as SEQ ID 20, are identical. Thus, scFv1 CDR 2 nucleotide SEQ ID NO 11 and scFv2 CDR2 nucleotide SEQ ID NO 13 may be substituted for each other. ScFv1 CDR 2 amino acid SEQ ID NO 12 and scFv2 CDR2 amino acid SEQ ID NO 14 may also be substituted for each other. ScFv1 CDR3 nucleotide SEQ ID NO 15 and scFv2 CDR3 nucleotide SEQ ID NO 17 may be substituted for each other. ScFv1 CDR3 amino acid SEQ ID NO 16 and scFv2 CDR3 amino acid SEQ ID NO 18 may also be substituted for each other. ScFv1 CDR5 nucleotide SEQ ID NO 21 and scFv2 CDR5 nucleotide SEQ ID NO 23 may be substituted for each other. ScFv1 CDR5 amino acid SEQ ID NO 22 and scFv2 CDR5 amino acid SEQ ID NO 24 may also be substituted for each other. ScFv1 CDR6 nucleotide SEQ ID NO 25 and scFv2 CDR6 nucleotide SEQ ID NO 27 may be substituted for each other. ScFv1 CDR6 amino acid SEQ ID NO 26 and scFv2 CDR6 amino acid SEQ ID NO 28 may also be substituted for each other. These CDR regions may be substituted in any monomer of the present disclosure, where the monomer may be part of a dimer, trimer, tetramer, and the like, as described herein. Therefore, one of skill in the art can appreciate the multitude of combinations possible for purposes of the present disclosure.
The disclosure further provides that, in any of the potential monomer, dimer, trimer and tetramer combinations previously described, within any monomer, one or more of the Complimentary Determining Regions within the VH and VL regions can be substituted between scFv1 and scFv2 as described above. This is in addition to the possibility of substituting the VH and VL regions within each monomer, where the monomer may be part of a dimer, trimer or tetramer, as described herein.
The disclosure further provides, as a non-limiting example, that in a scFv1 monomer, Complimentary Determining Region CDR2 may have nucleotide SEQ ID NO 13 and amino acid sequence SEQ ID NO 14 from the scFv2 fragment. Similarly, in another non-limiting example, a scFv2 monomer, CDR2 may have nucleotide SEQ ID NO 11 and amino acid SEQ ID NO 12 from scFv1. In a further non-limiting example, a scFv1 monomer, CDR3 may have nucleotide SEQ ID NO 17 and amino acid sequence SEQ ID NO 18 from scFv2. In yet a further non-limiting example, a scFv2 monomer, CDR3 may have nucleotide SEQ ID NO 15 and amino acid SEQ ID NO 16 from scFv1. In a further non-limiting example, a scFv1 monomer, CDR5 may have nucleotide SEQ ID NO 23 and amino acid sequence SEQ ID NO 24 from scFv2. Similarly, in another non-limiting example a scFv2 monomer, CDR5 may have nucleotide SEQ ID NO 21 and amino acid SEQ ID NO 22 from scFv1. In a scFv1 monomer, CDR6 may have nucleotide SEQ ID NO 27 and amino acid sequence SEQ ID NO 28 from scFv2. Similarly, in a scFv2 monomer, CDR6 may have nucleotide SEQ ID NO 25 and amino acid SEQ ID NO 26 from scFv1. Within any monomer, one or more of the foregoing substitutions can be made. For example, in an scFv1 monomer, CDR2 may have nucleotide SEQ ID NO 13 and amino acid sequence SEQ ID NO 14 from the scFv2 fragment, and CDR5 may have nucleotide SEQ ID NO 23 and amino acid sequence SEQ ID NO 24 from the scFv2 fragment.
In one embodiment, the present disclosure provides a dimer formed of an scFv1 connected with an scFv2 by a linker, as a non-limiting example, in the scFv1 monomer, CDR2 may have a nucleotides sequence SEQ ID NO 13 and amino acid sequence SEQ ID NO 14 from the scFv2 fragment, and CDR5 may have nucleotide SEQ ID NO 23 and amino acid sequence SEQ ID NO 24 from the scFv2 fragment; and in the scFv2 monomer, CDR2 may have nucleotide SEQ ID NO 11 and amino acid sequence SEQ ID NO 12 from the scFv1 fragment, and CDR5 may have nucleotide SEQ ID NO 21 and amino acid sequence SEQ ID NO 22 from the scFv1 fragment.
In another embodiment, the present disclosure provides a trimer formed of two scFv1 monomers and one scFv2 monomers, the monomers connected by linkers. As a non-limiting example, in one scFv1 monomer, CDR2 may have nucleotide SEQ ID NO 13 and amino acid sequence SEQ ID NO 14 from the scFv2 fragment, and CDR5 may have nucleotide SEQ ID NO 23 and amino acid sequence SEQ ID NO 24 from the scFv2 fragment; and in the scFv2 monomer, CDR2 may have nucleotide SEQ ID NO 11 and amino acid sequence SEQ ID NO 12 from the scFv1 fragment, and CDR5 may have nucleotide SEQ ID NO 21 and amino acid sequence SEQ ID NO 22 from the scFv1 fragment.
In a further embodiment, the present disclosure provides a tetramer formed of two scFv1 monomers and two scFv2 monomers, the monomers connected by linkers, as a non-limiting example, in each of the scFv1 monomers, CDR2 may have nucleotide SEQ ID NO 13 and amino acid sequence SEQ ID NO 14 from the scFv2 fragment, and CDR5 may have nucleotide SEQ ID NO 23 and amino acid sequence SEQ ID NO 24 from the scFv2 fragment; and in each of the scFv2 monomers, CDR2 may have nucleotide SEQ ID NO 11 and amino acid sequence SEQ ID NO 12 from the scFv1 fragment, and CDR5 may have nucleotide SEQ ID NO 21 and amino acid sequence SEQ ID NO 22 from the scFv1 fragment.
Another aspect of the present disclosure concerns use of peptide linker sequences of various lengths to connect individual scFv from the VH chain of immunoglobulin to individual scFv1 and sFv2 from the VL chain of immunoglobulin to form monomers, and to connect various scFv1 and scFv2 monomers to form dimers, tribodies and tetrabodies. Such peptide linkers may be used in any of the embodiments described above that utilize a linker.
Another aspect concerns the use of peptide linker sequences having different amino acid compositions to connect individual scFv1 and or individual scFv1 to form dimers, trimers and tetramers. Such peptide linkers may be used in any of the embodiments described above that utilize a linker.
In a further aspect, the present disclosure provides antibodies expressed by the cDNA clones of anti-NAMPT genes. Such antibodies are the proteins expressed by the cDNA clones described herein, where such cDNA clones may provide monomers, dimers, trimmers, or tetramers, having variable VH and VL regions and/or variable CDR regions as described herein.
In yet another aspect, the present disclosure provides the use of such antibodies, as described above, to inhibit NAMPT. In one embodiment, the use of such antibody clones to inhibit NAMPT is limited to specific neutrophil populations, where such neutrophil populations may be associated with a cancer, disease, disorder, or other illness.
In some embodiments of the present disclosure, the use of anti-NAMPT genes are preferably used to drive the anti-NAMPT antibody genes specifically expressed in neutrophils.
A further aspect of the present disclosure provides the therapeutic use of such antibodies to inhibit NAMPT-mediated cell proliferation, induce cell death and decrease NAD synthesis. In such an embodiment, the use of the antibodies, as described herein may be used to inhibit NAMPT in specific neutrophil, fibroblast, or macrophage populations, where such populations may be associated with a cancer, disease, disorder, or other illness.
The present disclosure additionally provides for a method of using the antibodies of the present disclosure for anti-NAMPT-targeted therapy for diseases whose pathogenesis involves an augmented expression of the NAMPT gene to drive the NAD inflammatory pathway. In one such an embodiment, the anti-NAMPT therapy is targeted to specific fibroblast, neutrophil, or macrophage populations associated with a particular disease state.
The method of the present disclosure for using the antibodies of the present disclosure for anti-NAMPT-targeted therapy, are preferably directed towards, but not limited to use in acute lung injury (ALI), acute respiratory distress syndrome (ARDS), juvenile idiopathic arthritis (JIA), rheumatoid arthritis (RA), cancer, and Inflammatory Bowel Diseases (IBD) including ulcerative colitis and Crohn's disease as well as other diseases in which an upregulation of NAMPT gene is a phenotype.
The present disclosure also provides for the therapeutic use of knockdown of neutrophil-specific NAMPT gene expression to treat LPS-, mechanical ventilation-, or LPS+mechanical ventilation-induced lung injury.
The present disclosure also provides for the therapeutic use of macrophage-specific knockdown of NAMPT gene expression to treat LPS-, mechanical ventilation-, or LPS+mechanical ventilation-induced lung injury.
The present disclosure additionally provides for the therapeutic use of fibroblast-specific knockdown of NAMPT gene expression to treat RA, JIA, osteoarthritis and osteoporosis.
The present disclosure also concerns NAMPT involvement in regulating expression of SP-B in the lung epithelial cells in vitro and in vivo. LPS or TNF-α stimulation increased NAMPT expression in both of H441 cells and A549 cells. Down regulation of NAMPT increased the expression of SP-B, as well as rescued the TNF-α induced inhibition of SP-B, while overexpression of NAMPT inhibited SP-B expression. NAMPT-induced inhibition of SP-B expression was mainly due to intracellular NAMPT nonenzymatic function via the JNK pathway, and partly due to enzymatic function. Mice harboring club cell specific deletion of NAMPT exhibited attenuated ALI and increased SP-B expression than wild type mice. Moreover, in epithelial cells, specific knockdown of NAMPT via recombinant virus may provide therapeutic potential to attenuate inflammation associated with ALI.
The present disclosure also concerns NAMPT mediated TNF-α induced inhibition of SP-B in H441 cells and A549 cells. NAMPT involves a lot of inflammatory processes. TNF-α augments NAMPT expression in A549 cells. The present disclosure confirmed the same role of NAMPT in H441 cells.
The present disclosure also concerns NAMPT regulation of SP-B expression via its NAMPT activity.
The present disclosure also concerns JNK pathway involvement in the NAMPT-inhibited SP-B in H441 cells.
The present disclosure also concerns epithelial cell specific knockdown of NAMPT and its effect on acute lung injury.
The present disclosure also concerns the generation of a heterozygous NAMPT L+/− mouse line with targeted deletion of a single NAMPT allele in epithelial cells, in order to examine the NAMPT function in vivo.
The present disclosure also concerns the therapeutic effect of the Ad-SPC-NAMPT antibody gene upon ALI.
The present disclosure also concerns a constructed adenovirus that expresses a NAMPT scFV antibody (Ad-SPC-NAMPT-scFv) driven by the lung epithelium specific human SPC promoter utilizing the Adeno-X™ Adenoviral System 3.
Various objects, features and advantages of this disclosure will become apparent from the following detailed description, which, taken in conjunction with the accompanying drawings, which depict, by way of illustration and example, certain embodiments of these anti-NAMPT antibody genes.
The drawings constitute a part of this specification, include exemplary embodiments of the anti-NAMPT antibody genes, and illustrate various objects and features thereof.
Production and manipulation of the cDNA clones for the single-chain variable fragment scFv1 and scFv2 anti-NAMPT antibodies described herein are within the skill in the art and can be carried out according to recombinant techniques described, among other places, in Maniatis, et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, cold Spring Harbor, N.Y.; Ausubel, et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates & Wiley Interscience, NY; Sambrook, et al. 1989, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Innis et al. (Eds.), 1995, PCR Strategies, Academic Press, Inc., San Diego; and Erlich (ed), 1992, PCR Technology, Oxford University Press, New York, all of which are incorporated herein by reference.
In preparing the cDNA clones, any expression vector appropriate for the intended recipient may be employed. Examples of appropriate expression vectors include but are not limited to: bacteria, yeasts, virus derivatives such as plasmids, bacteriophages, animal viruses, retroviruses, baculoviruses, and combinations thereof.
As used herein, the term “linker” refers to any peptide of from about 10 to about 25 amino acids or any other peptide known to work with these types of cDNA sequences. A non-limiting example of such linkers include the 18 mer linker, HIV1 p24 linker, 15-mer (G4S)3 linker.
The present disclosure provides two unique anti-NAMPT antibody genes scFv1 and scFv2 that were identified by screening a HuScL-2™ Phage Display Naïve Human scFv Library against purified recombinant NAMPT protein. The scFv1 and scFv2 clones contain complementary determining regions having unique nucleotide and amino acid sequences.
The scFv1 and scFv2 clones vary in the heavy chain VH and light chain VL chain regions and in the six Complementarity Determining Regions CDR1-CDR6, that is to say SEQ ID NOs 10-28. Preferably, the fragments of the present disclosure are from about 96% to about 97% identical.
In a preferred embodiment, the cDNA clones of the present disclosure have at least 96% sequence homology to either the nucleotide sequences SEQ ID No. 1 or SEQ ID No. 3, where sequences homology values of at least 97%, at least 98%, at least 99%, and 100% sequence homology are envisioned. In a preferred embodiment, the cDNA clones of the present disclosure have at least 96% sequence homology to either the amino acid e sequences SEQ ID No. 2 or SEQ ID No. 4, where sequences homology values of at least 97%, at least 98%, at least 99%, and 100% sequence homology are envisioned. Further, it is understood that codon optimization may be performed and that the sequence homology comparison be performed on the encoded amino acid sequences.
In cell culture experiments, the scFv1 and scFv2 clones were found to inhibit cell proliferation and induce cell death. In one embodiment of the present disclosure, as best shown in
As shown in
The technology described herein is relevant for any physiological process or disease involving the NAD inflammatory pathway, including cancer, infections, autoimmune diseases and other genetic disorders, acute respiratory distress syndrome, arthritis, cancer, coronary artery disease, and diabetes. It may be employed to target selected populations of neutrophils associated with any injury, illness, or disease state associated with neutrophil proliferation.
In therapeutic uses, such cDNA clones can be expressed into a cell using a lentiviral or adenoviral system and then injected into the body of an animal or a human to deliver the purified antibody protein to the body for treatment of an inflammatory disease. In another aspect, the cDNA clones may also be injected directly into the body. In another aspect, the cDNA clones may be introduced to the body orally or sublingually. Targeted cells may include neutrophils, macrophages, fibroblasts, endothelials, or other cells where a cell specific promoter may drive the cell specific expression of anti-NAMPT gene.
In another aspect, NAMPT is used to mediate TNF-α induced inhibition of SP-B in epithelial cells. Knockdown of NAMPT increases SP-B expression, and NAMPT mediates TNF-α induced inhibition of SP-B in H441 cells and A549 cells, both of which are epithelial cells.
In another aspect, NAMPT is used to inhibit SP-B expression mainly via its nonenzymatic activity and partly via its enzymatic activity.
In another aspect of the present disclosure, the JNK pathway is used to regulate NAMPT-inhibition of SP-B in epithelial cells.
In another aspect of the present disclosure, cell specific knockdown of NAMPT in epithelial cells is used to attenuate acute lung injury in mice.
In another aspect, the Ad-SPC-NAMPT antibody gene is used to achieve a therapeutic effect on ALI.
In another aspect, a lung epithelial cell specific NAMPT knockdown is used as a new therapeutic modality in ALI.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 1, wherein said clone has a complementary determining region 2 selected from the group consisting of SEQ ID No. 11 and SEQ ID No. 13.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 2, wherein said clone has a complementary determining region 2 selected from the group consisting of SEQ ID No. 12 and SEQ ID No. 14.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 3, wherein said clone has a complementary determining region 2 selected from the group consisting of SEQ ID No. 11 and SEQ ID No. 13.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 4, wherein said clone has a complementary determining region 2 selected from the group consisting of SEQ ID No. 12 and SEQ ID No. 14.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 1, wherein said clone has a complementary determining region 3 selected from the group consisting of SEQ ID No. 15 and SEQ ID No. 17.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 2, wherein said clone has a complementary determining region 3 selected from the group consisting of SEQ ID No. 16 and SEQ ID No. 18.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 3, wherein said clone has a complementary determining region 3 selected from the group consisting of SEQ ID No. 15 and SEQ ID No. 17.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 4, wherein said clone has a complementary determining region 3 selected from the group consisting of SEQ ID No. 16 and SEQ ID No. 18.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 1, wherein said clone has a complementary determining region 5 selected from the group consisting of SEQ ID No. 21 and SEQ ID No. 23.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 2, wherein said clone has a complementary determining region 5 selected from the group consisting of SEQ ID No. 22 and SEQ ID No. 24.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 3, wherein said clone has a complementary determining region 5 selected from the group consisting of SEQ ID No. 21 and SEQ ID No. 23.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 4, wherein said clone has a complementary determining region 5 selected from the group consisting of SEQ ID No. 22 and SEQ ID No. 24.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 1, wherein said clone has a complementary determining region 6 selected from the group consisting of SEQ ID No. 25 and SEQ ID No. 27.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 2, wherein said clone has a complementary determining region 6 selected from the group consisting of SEQ ID No. 26 and SEQ ID No. 28.
The present disclosure provides for an anti-NAMPT cDNA clone having a sequence at least 96% homologous to nucleotide sequence SEQ ID No. 3, wherein said clone has a complementary determining region 6 selected from the group consisting of SEQ ID No. 25 and SEQ ID No. 27.
The present disclosure provides for an anti-NAMPT cDNA clone encoding a sequence at least 96% homologous to amino acid sequence SEQ ID No. 4, wherein said clone has a complementary determining region 6 selected from the group consisting of SEQ ID No. 26 and SEQ ID No. 28.
The present disclosure provides for a dimer comprising any two anti-NAMPT cDNA clones individually and respectively selected from the clones described herein.
The present disclosure provides for a trimer comprising any three of the anti-NAMPT cDNA clones individually and respectively selected from the clones described herein.
The present disclosure provides for a tetramer comprising any four of the anti-NAMPT cDNA clones individually and respectively selected from the clones described herein.
The present disclosure provides for a cDNA clone as described herein, wherein the heavy chain of SEQ ID No. 1 is replaced by the heavy chain of SEQ ID No. 3.
The present disclosure provides for a cDNA clone as described herein, wherein the light chain of SEQ ID No. 1 is replaced by the light chain of SEQ ID No. 3.
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes having the nucleotide sequence of SEQ ID No. 1.
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes encoding the amino acid sequence of SEQ ID No. 2
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes having the nucleotide sequence of SEQ ID No. 3.
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes encoding the amino acid sequence of SEQ ID No. 4
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes having the nucleotide sequence of SEQ ID No. 5.
The present disclosure provides for a cDNA clone of anti-NAMPT antibody genes encoding the amino acid sequence of SEQ ID No. 6.
The present disclosure provides for a method of inhibiting the NAMPT pathway, wherein said method comprises administration of any one of the cDNA clones described herein.
The present disclosure provides for a method of targeting neutrophil populations, wherein said method comprises administration of any one of the cDNA clones described herein.
The present disclosure provides for a method for treating LPS-induced lung injury, wherein said method comprises administration of any one of the cDNA clones described herein
Examples I-III are directed to neutrophil chemotaxis, activation and apoptosis between NAMPT+/+ and NAMPT N−/− mice in basal and challenged conditions.
Activation and transmigration of neutrophils is a hallmark event in the progression of ALI and ARDS. Since it has an antiapoptotic role, NAMPT functions to prolong neutrophil presence at the site of inflammation, and hence results in hyperinflammatory tissue damage because of the neutrophil's capacity for the production of toxic mediators. Knockdown of NAMPT in neutrophils would serve to enhance neutrophil apoptosis, shorten the life of neutrophils, which could ameliorate long lasting neutrophil-related inflammatory change.
Neutrophils from bone marrows of either NAMPTOE or NAMPT+/− or NAMPT+/+ mice are isolated using The Neutrophil Isolation Kit (cat. No. 130-097-658, Miltenyi Biotec Inc., San Diego, Calif.). Isolated neutrophils with the purity >95% as determined by flow cytometry using CD11b and Gr-1 staining and the viability >98% as determined by PI exclusion are used. Three different donor NAMPTOE or NAMPT+/− or NAMPT+/+ neutrophils (5×106 cells each) plus a control (0.2 ml PBS) are adoptively transferred into four recipient groups of NAMPT+/+ mice by an injection in the retro-orbital sinus according to the protocol of Boari et al. 48 h later, those four recipient groups of mice are subject to LPS+MV as carried out in our preliminary experiments (
Conclusion: An adoptive transfer of neutrophils from NAMPT overexpression (NAMPTOE) mice or NAMPT heterozygous knockdown (NAMPT+/−) mice into wild type (NAMPT+/+) mice aggravates or attenuates the pathogenesis of ALI when challenged with LPS+mechanical ventilation (MV), further substantiating the role of a neutrophil specific NAMPT expression in the pathogenesis of ALI.
Neutrophils are the first line response of the innate immune system to injury, releasing cytotoxic mediators and reactive oxygen species (ROS). However, if neutrophils persist, they can result in host tissue damage. Therefore, the factors that control the recruitment, function, lifespan, and removal of these cells are important for host defense and resolution of inflammation.
Neutrophils isolated from bone marrows of either NAMPTN+/− or NAMPT+/+ mice are examined as described in Experiment I. Preliminary data have indicated that the purity of isolated neutrophils using the above-referenced kit reaches more than 97% Gr-1 and CD11b positive (
Chemotaxis of those neutrophils isolated from bone marrows of either NAMPTN+/− or NAMPT+/+ mice in basal or LPS+MV challenged conditions towards known chemoattractants (e.g. fMLP) is carried out using the CHEMICON® QCM™ Chemotaxis 3 μm 24-well Migration Assay in a Migration Chamber, based on the Boyden chamber principle (Cat. No. ECM505, EMD Milliport). Migrating cells are lysed and detected by the CyQUANT® GR dye (Molecular Probes).
Results: A chemotactic migration of NAMPTN+/− neutrophils towards fMLP in baseline is significantly decreased compared to wild type counterparts though it is assayed in a limited number of mice (
Neutrophil activation status of those neutrophils isolated from bone marrows of either NAMPTN+/− or NAMPT+/+ mice in basal or LPS+MV challenged conditions are assessed by measurement of neutrophil shape change and by CD62-L/CD11b expression levels using RT-PCR. Superoxide anion production is assessed by dihydrorhodamine fluorescence. Neutrophil TNFα and IL1-(3 level is measured by ELISA.
Apoptosis of those neutrophils isolated from bone marrows of either NAMPTN+/− or NAMPT+/+ mice in basal or LPS+ventilation challenged conditions are assessed by flow cytometric analysis for Annexin-V/propidium iodide staining and by analysis of cleaved caspase-3 by western blot and ELISA.
Phagocytic index of those neutrophils isolated from bone marrows of either NAMPTN+/− or NAMPT+/+ mice in basal or LPS+MV challenged conditions are measured using a kit with pHrodo Green S. aureus BioParticle conjugates for phagocytosis (Cat. No. P35367, Thermo Fisher Scientific Inc.) to allow quantification of phagocytosis by flow cytometry and fluorescence microscopy. Our study using this assay did not find a significant difference in phagocytosis between wild type and NAMPTN+/− neutrophils in baseline (
To evaluate differences in these variables between NAMPT+/− and NAMPT+/+ neutrophils groups, parametric statistical analyses are performed using Sigmaplot analysis software (ver 13, Systat Software, Inc. San Jose, Calif. with an unpaired t-test (two groups) or ANOVA (multiple groups) followed by the Tueky-Kramer Multiple Comparisons posttest. Results are represented as mean±DS. Two-tailed P values<0.05 are considered significant.
The same principles of these statistical analyses are applied to all examples for data analysis.
Conclusion:
Neutrophils with the NAMPT gene knockdown may decrease their chemotactic migration and activation and apoptosis without compromising their ability in innate immunity compared to those wild type neutrophils
RNA-seq is a technology that uses next-generation sequencing to determine the identity and abundance of all RNA sequences in biological samples. RNA-seq profiling of neutrophil transcriptomes from both NAMPT+/+ mice and NAMPTN+/− mice without or with LPS+MV challenge provides us with rich information on new molecular targets, new components in canonical pathways, and new pathways of gene expression, which may lead us to elucidate new and novel molecular mechanisms underlying the therapeutic effect of neutrophil specific knockdown of NAMPT on ALI/ARDS as well as neutrophil dependent and general pathogenesis of ALI.
Illumina's HiSeq1500 instrument is used to characterize the neutrophil transcriptomes from both NAMPT+/+ mice and NAMPTN+/− mice without or with LPS+MV challenge, using our established protocol and data analysis pipeline. Each type of RNA samples includes at least three biological replicates. Total RNA (1 μg) of each sample is converted into a paired-end cDNA library using the Illumina's TruSeq Stranded Total Library Preparation kit (Cat. No. RS-122-2201) before sequencing following Illumina's protocol. Sequence quality analyses, alignments to reference genome, differential transcript calling are carried out according to our established pipeline except the transcript assembly which is done using String Tie, a new software using a genome-guided transcriptome assembly approach along with concepts from de novo genome assembly with the capacity to increase new transcript calls by 20 to 53%. Significantly differentially expressed transcripts (FDR, q<0.05) with >2 fold magnitude between NAMPTN+/− and NAMPT+/+ neutrophils groups are subjected to pathway analysis of either QIAGEN'S Ingenuity Pathway Analysis (found on the web at “ingenuity.com/products/ipa”) or The Database for Annotation, Visualization and Integrated Discovery (DAVID, found on the web at “david.abcc.ncifcrf.gov”). Selected candidates are validated by RT-PCR before subjecting to further experimentation to gain insights into molecular mechanisms, therapeutic utility as new drug targets in ALI.
Conclusion:
A neutrophil specific knockdown of NAMPT gene can significantly attenuate acute lung injury, and neutrophils with NAMPT knockdown can decrease their chemotactic migration and activation and apoptosis without compromising their ability in innate immunity. RNA-seq provides information on new molecular targets, new components in canonical pathways, and new pathways of gene expression, which may lead to elucidation of new and novel molecular mechanisms underlying the therapeutic effect of a neutrophil specific knockdown of NAMPT gene on ALI/ARDS as well as neutrophil-dependent and general pathogenesis of ALI.
Examples 4-6 investigate the role of a neutrophil specific NAMPT knockdown in three different mouse models of ALI (LPS+MV, sepsis and pneumonia). LPS- or MV-induced animal models of ALI are the most widely used animal models of ALI. It is thought that the “two hits” such as LPS+MV synergize to lead to more detrimental effects on the lung, which is more closely mimicked to the pathogenesis of human ALI. Sepsis is one of the main risk factors for ARDS. Pulmonary infections are the main risk factor of ALI/ARDS in 46-51% patients. Sepsis and pneumonia are the most common causes of death among ALI/ARDS patients. Because of these, a sepsis induced ALI model, was selected in which cecal ligation and puncture (CLP) induced peritonitis is followed by sepsis and lung injury, and a pneumonia induced ALI model, in which local administration of bacteria into the lungs is achieved by an intratracheal catheter, to evaluate the broad therapeutic utility of neutrophil specific NAMPT knockdown on ALI/ARDS. The CLP procedure was used to induce sepsis because it is the most frequently used polymicrobial infection model and it closely resembles the progression and characteristics of human sepsis.
Age- and gender-matched C57BL/6 mice between 8 and 12 weeks old, n=6/per group, are used in this study. The sample size (n=6/per group) is based on the power calculation given at Experiment I. Mice are divided into four groups at each time point: NAMPT+/+ experiment (NAMPT+/+-E), NAMPT+/+ control (NAMPT+/+-C), NAMPT+/− experiment (NAMPT+/−-E), NAMPT+/− control (NAMPT+/−-C). Experimental groups are subjected to the LPS+MV treatment and control groups to the room air +PBS as described in Experiment I. After the experimentation, mouse BAL and Lung tissues from day 1 and 2 (exudative stage), day 3 and 5 (proliferative stage), day 7 and 10 (fibrotic stage) are harvested. Various assays in BAL (protein, total and differential cell counts, cytokines TNFα and IL1β) and lung tissues (wet/dry ratio, MPO, cytokines TNFα and IL1β, histological haematoxylin and eosin staining for visualizing alveolar structure, and Masson's Trichrome Staining for Collagen Fibers) are carried out as described by Patel et al and in our preliminary study (
Age- and gender-matched C57BL/6 mice between 8 and 12 weeks old, n=6/per group, are used in this study. The sample size (n=8/per group) is based on the power calculation from our preliminary data (
Age- and gender-matched C57BL/6 mice between 8 and 12 weeks old, n=6/per group, are used in this study. The sample size (n=6/per group) is extrapolated on the power calculation from our preliminary data (
We witness a beneficial protective effect of neutrophil specific NAMPT knockdown on all three stages of ALI. Neutrophil specific NAMPT knockdown also protects against lung injury in either sepsis- or pneumonia-induced mouse model of ALI.
EXAMPLES 7-9 evaluate the therapeutic efficacy of neutrophil NAMPT targeted small chemical inhibitors, antibodies and shRNAs in ALI/ARDS. Small chemical inhibitors have been demonstrated as potential drugs for inflammatory diseases. Here we improve the structure of the small chemical inhibitor to NAMPT, MC4-PPEA, to evaluate the therapeutic efficacy on LPS+MV induced mouse model of ALI by a neutrophil targeted delivery of MC4-PPEA or its derivatives. scFv (Single-Chain Fragment Variable) antibodies have been successfully applied as diagnostic reagents and therapeutic gene deliveries. We improve the scFv antibody to NAMPT to generate neutrophil specific expression of anti-NAMPT gene as a new therapy to ALI. siRNA or shRNA-based therapeutics have demonstrated the capability to silence therapeutically relevant genes in various in vivo models of cancer, infections, autoimmune diseases, and other genetic disorders including ALI. We improve the forms of NAMPT shRNA to develop powerful and neutrophil specific NAMPT knockdown as a viable therapeutic strategy to ALI.
We previously modified FK866, an inhibitor of NAMPT, by replacing its benzoylpiperidine moiety with a meta-carborane to yield a more potent and less toxic NAMPT inhibitor, MC4-PPEA (
We develop a neutrophil-specific NAMPT inhibitor by covalently linking the optimized hydroxymethyl MC4 compound (similar to hm-MC4 azide,
Twenty four wild type C56BL/6 mice with age, gender matched are arranged into 3 groups of 8 mice each. These three groups are intravenously injected with 0.5 mg MC4-PPEA-peptide, 0.5 mg control peptide, and saline according to the method of Newton-Northup et al. Two hours later, they are subjected to LPS+MV procedure as described in our preliminary study (
We expressed and purified recombinant mouse NAMPT protein and obtained two human against mouse NAMPT antibody gene clones, termed NAMPT-scFv1 (Ab1) and -scFv2 (Ab2), by screening a HuScL-2™ Phage Display Naïve Human scFv Library (www.creative-biolabs.com/). We cloned the cDNAs for each scFv, including a histidine-tag on the 3′ end, into the pCAGGS expression vector. The VH and VL fragments for each scFv are separated by a (G4S)3 linker and encode proteins of 247 and 249 amino acids, respectively for NAMPT-scFv1 and -scFv2. To test the anti-NAMPT ability of each construct, we performed MTS assays in transfected 3T3-L1 (ATCC® CL-173™) and RAW 264.7 (ATCC® TIB-71™) cells. Our preliminary result shows that tested anti-mouse antibody clones, Ab1 and Ab2, can inhibit proliferation of mouse 3T3 (
To test in vivo therapeutic effect, eighteen wild type C56BL/6 mice with age, gender matched are arranged into 2 groups of 8 mice each. These 2 groups are intravenously injected with NAMPT-scFv1 or its antisense control plasmid. 24 hours later, they are subjected to LPS+MV procedure as described in our preliminary study (
We have constructed tissue specific adenoviral expression vectors utilizing the Adeno-X™ Adenoviral System 3 (Cat #632264) with In-Fusion HD cloning technology and Stellar Competent E. coli cells (Clontech® Laboratories, Inc.). We have generated a NAMPT shRNA (NAMPT: 971: 5′ TGAAGACCTGAGACATCTGATA 3′) expression vector using truncated hMRP8 promoters according to the strategy of Giering et al., to optimize shRNA expression using tissue specific pol II promoters (
To test in vivo therapeutic effect, thirty-two wild type C56BL/6 mice with age, gender matched are arranged into 4 groups of 8 mice each. These 4 groups are intravenously injected with NAMPT-shRNA, NAMPT-scramble RNA, NAMPT-cDNA, and NAMPT-antisense cDNA, respectively. 24 hours later, they are subjected to LPS+MV procedure as described in our preliminary study (
EXAMPLES X-XIV will investigate the molecular mechanisms underlying the attenuation of CIA in NAMPT knockdown mice.
Neutrophils are the first line of response of the innate immune system to injury, releasing cytotoxic mediators and reactive oxygen species. However, if neutrophils persist, they can induce tissue damage. Therefore, the factors that control the recruitment, function, lifespan and removal of these cells are important for host defense and resolution of inflammation. In RA, macrophages overexpress proinflammatory cytokines, growth factors, histocompatibility complex class II molecules and matrix-degrading enzymes, all leading to increased inflammation, matrix destruction, and angiogenesis. In turn, infiltrating neutrophils and macrophages stimulate SF to proliferate and produce cytokines, chemokines and matrix-degrading enzymes, which ultimately leads to the thickening and progressive destruction of joint membrane, cartilage and bone.
Otero et al., first reported that patients with rheumatoid arthritis had higher plasma levels of NAMPT than healthy controls. The authors proposed that NAMPT could coordinate the inflammatory process in RA, and at the very least could serve as a biomarker for the disease. These findings were confirmed by Nowell et al., Bretano et al., and Matsui et al., Nowell and colleagues detected elevated levels of NAMPT in synovial fluid from RA patients when compared with osteoarthritis (OA) patients. NAMPT expression was immunolocalized within the synovial lymphoid aggregates, which consisted of B cells, T cells, dendritic cells, plasma cells, endothelial cells, macrophage-like synoviocytes, and SF. Bretano et al. demonstrated that NAMPT expression was elevated in the joints of RA patients, especially in the SF localized at the points of invasion into the synovial lining and cartilage. Matsui et al., detected elevated NAMPT mRNA expression in synovial tissue, peripheral blood mononuclear cells, and peripheral blood granulocytes isolated from RA patients compared to healthy controls. Meier et al. demonstrated that recombinant, extracellular NAMPT increased SF motility and cytokine synthesis. The correlation of elevated expression of NAMPT with inflammation and tissue destruction identified NAMPT as an important mediator of the innate immune response and a potential target for RA therapy. These findings suggest that SF play important roles in the initiation and the perpetuation of RA, but the underlying molecular mechanisms are not understood fully. Therefore, to provide a systems approach to uncover the transcriptional regulation in SF we profiled human normal control and RA SF transcriptomes by RNA-seq. We identified 277 genes, 595 known isoforms and 1081 novel isoforms that were differentially expressed in RASF compared to controls, representing key networks and pathways that may contribute to the pathogenesis of RA. In total, these findings prompted us to utilize our NAMPT mouse lines to investigate further the role of NAMPT in the pathogenesis of arthritis. We have generated a congenic DBA/1J NAMPT+/− (N>10) and incipient congenic DBA/1J NAMPTOE mice (currently N=5) by backcrossing to DBA/1J mice. We initiated transferring C57BL/6J NAMPTN−/− mice to the DBA/1J background, since neutrophil specific gene knockdown of Syk is sufficient to block the initiation of arthritis in the K/B×N serum transfer model. Our preliminary results demonstrated clearly that mice expressing lower levels of NAMPT (NAMPT+/−) present with a decreased auto-immune response and are protected against bone erosion compared to their wild-type littermate controls (NAMPT+/+) after arthritic induction by collagen injection (
We examine CIA in NAMPT+/+, NAMPT+/−, NAMPTOE (
We test the hypothesis that differential expression of NAMPT alters the signal transduction cascades regulating the production of proinflammatory cytokines and matrix degrading enzymes of SF. To elucidate further the NAMPT mediated signal transduction cascades, we utilize SF isolated from the NAMPT+/+, NAMPT+/−, and NAMPTOE mice in either the normal or arthritic state for in vitro cell assays. Pure cultures of SF (N=4 per mouse line) are isolated from hind ankle joints according to the method of Armaka et al. The cells are used between P3-P7. To extend their utility, primary SF is immortalized by nucleofection (4D-Nucleofector™ System, Lonza) with pBABE-puro-hTERT (Addgene #1771). To date, we have immortalized NAMPT+/+ and NAMPT+/− mouse SF. A panel of primary and immortalized SF with NAMPT+/+, NAMPT+/−, and NAMPTOE genotypes afford the ability to perform gain- and loss-of-function experiments without transfection. However, as needed we nucleofect (P2 solution, program EN-150) SF with NAMPT overexpression and knockdown vectors (
This experiment tests the hypothesis that differential expression of NAMPT in macrophages alters their ability to differentiate into osteoclasts. We examine the differentiation of bone marrow derived macrophage isolated from NAMPT+/+, NAMPT+/−, NAMPTOE mice in either the normal or arthritic state (N=4 per mouse line, condition). To extend their utility, primary macrophages are immortalized by as described in EXAMPLE X1. Transfected RAW 264.7 (ATCC® TIB-71™) cells are used as an experimental control. Bone marrow derived macrophages are isolated, cultured, and differentiated as described in Mukai et al., and Ueki et al.
This experiment tests the hypothesis that differential expression of NAMPT in neutrophils alters their chemotactic migration, activation and apoptosis. We examine the following functions using bone marrow derived neutrophils isolated from NAMPT+/+, NAMPT+/−, NAMPTOE, NAMPTN−/ mice in either the normal or arthritic state (N=4 per mouse line, condition).
Chemotaxis of neutrophils towards known chemoattractants (e.g. FMLP, NAMPT) is be carried out using The CHEMICON® QCM™ Chemotaxis 3 μm 24-well Migration Assay in a Migration Chamber, based on the Boyden chamber principle (Cat. No. ECM505, EMD Millipore). Migrating cells will be lysed and detected by the CyQUANT® GR dye (Molecular Probes).
Activation of neutrophils is assessed by measurement of neutrophil shape change and by CD62-L/CD11b expression levels by qPCR. Superoxide anion production is assessed by dihydrorhodamine fluorescence. Neutrophil TNFα and IL1-β levels are measured by ELISA.
Apoptosis is assessed by flow cytometric analysis for Annexin-V/propidium iodide staining and by analysis of cleaved caspase-3 by western blot and ELISA.
Phagocytosis is measured with pHrodo® Red S. aureus Bioparticles® Conjugate for Phagocytosis (Cat. No., A10010, Thermo Fisher Scientific Inc.) by flow cytometry and fluorescence microscopy.
This experiment tests the hypothesis that the interplay of SF with macrophages and neutrophils exacerbate the progression and severity of arthritis. We examine the following interactions between SF, macrophages and neutrophils isolated from NAMPT+/+, NAMPT+/−, NAMPTOE, NAMPTN−/− mice in either the normal or arthritic state (N=4 per mouse line, condition). We test all possible cell to cell combinations (e.g. NAMPTN−/− neutrophil vs. NAMPTOE SF).
Chemotaxis of neutrophils or macrophages towards SF conditioned media is carried out using The CHEMICON® QCM™ Chemotaxis 3 μm 24-well Migration Assay in a Migration Chamber as described in Experiment XIII
Synovial fibroblast motility is measured by electric cell-substrate Impedance sensing (ECIS® Zθ; Applied Biophysics, Troy, N.Y.) to quantify cell behavior. We measure SF motility upon exposure to either conditioned media or direct cell to cell contact with neutrophils and macrophages using both wound healing and electric fence procedures. We test all genotypic combinations of the cells in both normoxic and hypoxic conditions.
Signal transduction is detected by changes of resistance (ECIS® Zθ) when the SF are exposed to either conditioned media or directly to neutrophils and macrophages. We also test the effect of increasing doses of TNFα±IL-1β on changes in resistance (signal transduction) in SF. We test all genotypic combinations of the cells in both normoxic and hypoxic conditions.
Gene expression in cultured SF exposed to conditioned media from cultures of neutrophils or macrophages is measured by qPCR and western analyses. The supernatant (media) is collected and cytokine expression is detected by ELISA and/or Lumenix assays. Media alone (no exposure to SF) will serve as the control.
Statistical analyses. To evaluate differences in the variables between NAMPT+/+, NAMPT+/−, NAMPTOE, NAMPTN−/− groups, parametric statistical analyses are performed using Sigmaplot analysis software with an unpaired t-test (two groups) or ANOVA (multiple groups) followed by the Tukey-Kramer Multiple Comparisons posttest. Results are represented as mean±SD. Two-tailed P values <0.05 are considered significant.
Examples XV-XVII evaluate the efficacy of anti-NAMPT therapies in CIA.
Treatment of RA is problematic because individual RA patients differ in both their genetic background and the progression of the disease. However, the genetic component of the disease provides a significant opportunity for the identification of new biological factors, like NAMPT, that can be targeted for therapeutic intervention. We determine the ability of three novel therapies to inhibit NAMPT activity and/or expression in vivo and to attenuate CIA. We developed the NAMPT inhibitor, MC4-PPEA (
The dysregulation of NAMPT activity in RA makes it an attractive target for therapeutic intervention. NAMPT has been demonstrated to be a key player in inflammatory arthritis. CIA is accompanied by increased expression of NAMPT in both serum and the arthritic paw. Administration of FK866, a competitive inhibitor of NAMPT, has been shown to effectively reduce the severity and progression of arthritis, while a liposome-packaged NAMPT siRNA delivered by tail vein injection has been shown to attenuate the immune response in mice by lowering the number of circulating monocytes and decreasing serum levels of inflammatory cytokines. Inhibition by FK866 in CIA mice has provided strong evidence that NAMPT is a promising therapeutic target. However, screening for additional inhibitory molecules is needed, as thrombocytopenia is a potential side effect of FK866 treatment in humans. Therefore, we replace the benzoylpiperidine moiety of FK866 with a carborane moiety. This supercharged FK866 molecule, termed MC4-PPEA exhibits a 100-fold increase in NAMPT inhibition compared to FK866. Furthermore, the half-maximal inhibitory concentrations (IC50) are about 10 fold lower than FK866 in several cell lines tested. MC4-PPEA is more effective than FK866 in preventing the TNFα induced nuclear translocation of NF-kβ and trans-endothelial resistance (
To determine the therapeutic efficacy of MC4-PPEA in attenuating arthritis, we first optimize the structure in terms of the placement of the carborane moiety (
To determine the therapeutic efficacy of NAMPT-4CshRNA expression vectors in attenuating arthritis, we first transfer the 4 copy shRNA constructs (
We expressed and purified recombinant mouse NAMPT protein and obtained two human against mouse NAMPT antibody gene clones, termed NAMPT-scFv1 and -scFv2, by screening a HuScL-2™ Phage Display Naïve Human scFv Library. We cloned the cDNAs for each scFv, including a histidine-tag on the 3′ end, into the pCAGGS expression vector. The VH and VL fragments for each scFv are separated by a (G4S)3 linker and encode proteins of 247 and 249 amino acids, respectively for NAMPT-scFv1 and -scFv2 (
Parametric statistical analyses is performed using Sigmaplot analysis software as described in Experiment X.
These experiments demonstrate the efficacy of attenuating arthritis with novel anti-NAMPT reagents, including MC4-PPEA, 4CshRNA, and scFv, in a CIA mouse model.
EXAMPLES XVIII-XXI characterize functionally the human NAMPT gene promoter.
These experiments test the hypothesis that SNPs within the NAMPT promoter exert differential allelic effects on expression, which underlies susceptibility to arthritis. Our preliminary data indicate that SNPs within the NAMPT promoter, and their corresponding haplotype combinations, are associated with JIA. To determine the functional consequences of each promoter haplotype Luciferase reporter assays in SW982 (ATCC® HTB-93™) human synovial fibroblasts are used to determine both allele and haplotype effects of the four promoter SNPs on NAMPT expression. We validate the luciferase assays by CRISPR/Cas9 genome editing of the NAMPT promoter in SW982 cells to generate the key haplotypes followed by measurement of NAMPT mRNA and protein expression. EMSA is performed to assess initially whether transcription factors (TFs) bind the SNP alleles differentially. A modified (B1H) is used to isolate potential TFs. As needed, we also employ traditional affinity chromatography, supershift assays, and ChIP qPCR methods to identify and isolate TFs. Finally, we utilize the CRISPR/Cas9 system to humanize the regulation of the mouse NAMPT gene by replacing the mouse NAMPT promoter with a panel of protective and susceptible human NAMPT promoters. A humanized NAMPT promoter mouse model allows a systems approach to elucidate the regulation of NAMPT in multiple tissues and cell types upon induction of arthritis. We characterize the role of the protective and susceptible haplotypes, and their corresponding TFs, in the regulation of NAMPT transcription in arthritis
During our previous investigation of NAMPT in acute respiratory distress syndrome, we published the identity of 11 SNPs in the NAMPT gene promoter. Our study was followed by several genetic association studies linking these SNPs with disease. Since no one has analyzed the NAMPT promoter SNPs in JIA, we collaborated to genotype 4 SNPs (G-1535A, A-1001C, C-948A, T-423C) in a cohort of JIA patients. The minor alleles for 3 SNPs (−1001, −948, −423) are protective compared to the controls (P<0.05; (OR=0.6, 0.2, 0.77, respectively). Haplotypes were estimated with H-Plus. GACT is associated slightly with susceptibility in JIA patients compared with controls: OR=1.23 (1.05-1.45) p=0.01, GCAC is a significantly protective haplotype OR=0.51(0.30-0.87) p=0.01. We found the GCCC haplotype associated with severity (p=0.026, OR=6.2; 1.25-30.7)). These results suggest that NAMPT SNP alleles and their haplotypes are associated with the susceptibility to JIA. We hypothesize that the susceptible and protective haplotypes are associated with an increase and decrease in NAMPT expression, respectively.
This experiment was designed to test the hypothesis that SNPs within the NAMPT promoter exert differential allelic effects on expression, which underlies susceptibility to arthritis by performing Dual-Glo® luciferase gene reporter assays (Promega, Madison, Wis.). To correlate the SNPs with the transcriptional activity (strength) of the NAMPT promoter, we have generated 16 plasmids containing the 16 possible haplotype combinations for the 4 SNPS (24) within the 1974 bp full length NAMPT promoter cloned into the pGL3-Basic firefly reporter (Promega) (
This example is designed to establish that there are differential allelic effects of the 4 SNPs on binding affinities of potential TFs in synovial fibroblasts. This is partly based on in silco prediction (
This example is designed to test the hypothesis that each SNP exerts differential allelic effects on NAMPT expression by altering its binding affinity of potential TFs by isolating and identify those TFs. We employ Scot Wolfe's B1H system, which provides a robust method to characterize protein-DNA interactions, as a complementary approach to clone and identify the TFs that bind each SNP region (
This example is designed to test the hypothesis that a humanized NAMPT promoter mouse model will allow a systems approach to elucidate the regulation of NAMPT in the context of multiple tissues and cell types upon induction of arthritis. We interchange the mouse promoter with selected human promoters to generate humanized NAMPT promoter mice. We use a service provider (Creative Animodel, Shirley, N.Y.) since the UMKC-LARC does not possess transgenic mouse facilities. We utilize these new mouse models to study CIA as previously described.
Parametric statistical analyses are performed using Sigmaplot analysis software as described in EXAMPLE X.
We characterize the ability of the promoter SNPs, and their haplotypes, to alter NAMPT expression and to disrupt TF binding. We isolate at least four TFs that bind to the corresponding SNP binding sites. In addition, we developed humanized mice possessing selected haplotypes of the human NAMPT promoter. These experiments substantiate our hypothesis that each SNP exerts differential allelic effects on NAMPT expression by altering its binding affinity of potential transcription factors, which underlie their functional association with arthritis. We further identify and characterize TFs that regulate NAMPT expression.
This example determines that NAMPT mediates TNF-α induced inhibition of SP-B in H441 cells and A549 cells. In order to confirm the role of NAMPT in H441 cells, the cells were first treated with different doses of either LPS or TNF-α. The results demonstrated that LPS (
This example determined that NAMPT inhibits SP-B expression mainly via its nonenzymatic activity and partly via its enzymatic activity. NAMPT is a multiple function protein that is not only involved in the mammalian salvage pathway of NAD synthesis via its enzymatic activity, but is also involved in the regulation of inflammatory cytokine expression in pulmonary epithelial cells via its nonenzymatic and AP-1 dependent mechanism. To examine whether NAMPT regulates SP-B expression via its NAMPT activity, H441 cells were transfected with either wild-type pCAGGS-hPBEF or pCAGGS-hPBEF (H247E, HE) which are the human NAMPT mutants that have very low NAMPT activities. The results (
This example demonstrates that the JNK pathway is involved in the NAMPT-inhibition of SP-B in H441 cells. NAMPT increases AP-1 binding to the IL-8 promoter to activate transcription in epithelial cells via the p38 MAPK pathway and the JNK pathway. Activated AP-1 inhibits SP-B expression. To determine the relationship, H441 cells were pretreated in the absence or presence of either a p38 pathway inhibitor, SB203580, or a JNK pathway inhibitor, SP600125, for 6 hours, then transfected with either wild-type pCAGGS-hPBEF or mutant type pCAGGS-H247E. The results (
This example demonstrates that cell specific knockdown of NAMPT in epithelial cells exhibited attenuated acute lung injury in mice. Knockdown of NAMPT increases SP-B expression and rescues the TNF-α induced inhibition of SP-B in vitro. A heterozygous NAMPT L+/− mouse line with a targeted deletion of a single NAMPT allele in epithelial cells was generated in order to examine the NAMPT function in vivo. NAMPT L+/− mice were injected with tamoxifen prior to the experiment to induce NAMPT knockdown in epithelial cells. Lung specific NAMPT gene deletion was confirmed by PCR of genotyping of mouse lung tissue and organs from NAMPT L+/− mice (
This example demonstrates that the Ad-SPC-NAMPT antibody gene has a therapeutic effect on ALI. The findings support that lung epithelial cell specific NAMPT knockdown attenuated lung injury, which demonstrated a need for the development of a lung epithelial cell specific NAMPT knockdown as a new therapeutic modality in ALI. An adenovirus expressing a NAMPT scFV antibody (Ad-SPC-NAMPT-scFv) driven by the lung epithelium specific human SPC promoter utilizing the Adeno-X™ Adenoviral System 3 was generated. An in vitro tissue culture model using H441 cells to test the anti-nampt potential of our Ad-SPC-NAMPT-scFv viral was established. Fluorescence images of H441 cells and A549 cells infected with Ad-SPC-NAMPT-scFv viral indicated the high efficiency of adenovirus infection in epithelial cells. Western blot showed that NAMPT expression was decreased, while SP-B expression was increased in Ad-SPC-NAMPT-scFv treated H441 cells. In vivo assays were then performed using Ad-SPC-NAMPT-scFv (1×109 IFU) or the appropriate controls Ad-control insert (1×109 IFU). Ad constructs were injected into individual wild type mice intratracheally, 3 days later the adenovirus treated mice were challenged with LPS or PBS. The mice were then sacrificed for tissue isolation to determine the therapeutic effect of the viral constructs. The results showed that BAL protein concentration, total BAL cell counts, total BAL neutrophils, lung tissue histology and lung injury scores from Ad-SPC NAMPT antibody (
Reagents used in these examples include: RPMI 1640 (Cat#: 11875), DMEM (Cat#: 11965), FBS (Cat#: 14190), and penicillin-streptomycin (Cat#: 15140) were purchased from ThermoFisher, life technologies, NY. Escherichia coli 0111:B4 endotoxin (LPS, Cat# L4391), p38 inhibitor SB239063, JNK inhibitor SP600125 was purchased from Sigma-Aldrich (St. Louis, Mo.). TNF-α ELISA kit (Cat# MTA00B) was obtained from R&D system (Minneapolis, Minn.). NAMPT antibody was purchased, SP-B antibody was obtained from Santa Cruz, FK866.
Cell cultures used in these examples include: A549 cell (Cat. No. CCL-185™), H441 cell (Cat. No. HTB-174™) and HL-60 cell (Cat. No. CCL-240™), were obtained from ATCC (Manassas, Va., USA). A549 cells were maintained in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, penicillin/streptomycin. H441 cells and HL-60 cells were maintained in RPMI supplemented with 10% fetal bovine serum, 2 mM glutamine, penicillin/streptomycin. All cells were cultured at 37° C. in a humidified atmosphere of 5% CO2, 95% air. Cells from each primary flask were detached with 0.25% trypsin, resuspended in fresh culture media, and seeded into 6-well plates for Western blotting or RT-PCR analysis, or seeded into the 48-well plates for ELISA or HL-60 adhesion assay.
Isolation of RNA and RT-PCR analysis. Total RNA was isolated from A549 cells with TRIZOL solution (Cat. No. 15596-018, Invitrogen, Carlsbad, Calif., USA) according to the supplier's instructions. RT-PCR was performed using Invitrogen RNA PCR kit (Superscript III, 18080-044). PCR products were separated on a 1.5% agarose gel and stained by Ethidium Bromide (0.5 μg/ml). The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software (Alpha Innotech Corp., San leandro, CA, USA).
LPS-induced ALI animal mode. Mice were anesthetized with PS (100 mg/kg and 5 mg/kg ip), intubated with a 20-g catheter, and administered intratracheally PBS or LPS (2 mg/kg per mice, diluted in phosphate-buffered saline (PBS), Sigma, St. Louis Mo.), after recovery, the mice returned to their cages. After 24 hours, the mice were anesthetized and intubated again.
Construction of recombinant adenovirus vectors. The plasmid pAdX-PRLS-ZsGreen1 was constructed previously. The SPC-NAMPT-scFv antibody, and their control SPC-NAMPT-reverse scFv antibody cassette were inserted into pAdX-PRLS-ZsGreen1 individually. The plasmid was then transfected into the Adeno-X 293 Cell Line. The recombinant adenoviruses were isolated and purified by Maxi purification kit. The viral titers were determined by Adeno-X™ Rapid Titer Kit.
In vivo adenovirus transduction. 8-10 week mice were anesthetized with PS, intubated with a 20-g catheter and administered intratracheally with 100 μl of either Ad-SPC-NAMPT-scFv or Ad-control-insert virus solution (1×109 ifu). After recovery, the mice returned to their cages. 72 hours later the mice were anesthetized and intubated for challenge with either PBS or LPS. 24 hours later, the mice were sacrificed.
Statistics. Statistical analyses were performed using the Sigma Stat (ver 13.0, Systat Software, Inc., San Jose, Calif.). Results are expressed as means±S.D. of more than three samples for each group from at least two independent experiments. Two group comparisons were done by unpaired t-test. Three or more group comparisons were carried out using ANOVA followed by a Holm-Sidak test, p<0.05 was considered statistically significant.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US16/50444 | 9/6/2016 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62213957 | Sep 2015 | US |