Patent Application
20210024889
The present disclosure relates to modified B cells and methods for making the modified B cells. The B cells maintain allelic exclusion and produce heterologous antibodies when introduced to an individual.
Although a vaccine for HIV remains elusive, anti-HIV-1 broadly neutralizing-antibodies (bNAbs) have been identified and their protective activity has been demonstrated in animal models (Escolano et al., 2017; Kwong and Mascola, 2018; Nishimura and Martin, 2017; Sok and Burton, 2018). These antibodies are effective in suppressing viremia in humans and large-scale clinical trials to test their efficacy in prevention are currently under way (Bar et al., 2016; Caskey et al., 2015; Caskey et al., 2017; Ledgerwood et al., 2015; Lynch et al., 2015; Mendoza et al., 2018; Nishimura and Martin, 2017; Scheid et al., 2016; Schoofs et al., 2016). However, these antibodies typically have one or more unusual characteristics including high levels of somatic hypermutation (SHM), long or very short complementarity determining regions (CDRs) and self-reactivity that interfere with their elicitation by traditional immunization.
Consistent with their atypical structural features, antibodies that broadly neutralize HIV-1 have been elicited in camelids, cows and transgenic mice with unusual pre-existing antibody repertoires (Briney et al., 2016; Dosenovic et al., 2015; Escolano et al., 2016; McCoy et al., 2012; Sok et al., 2017; Tian et al., 2016). However, even in transgenic mice that carry super-physiologic frequencies of bNAb precursors, antibody maturation required multiple immunizations with a number of different sequential immunogens. Moreover, bNAbs only developed for one of the epitopes targeted (Briney et al., 2016; Escolano et al., 2016; Tian et al., 2016). Consequently, elicitation of bNAbs in primates or humans remains a significant challenge. There is accordingly and ongoing an unmet need for compositions and methods safe and effective for production of antibodies, including but not necessarily limited to antibodies with virus neutralizing activity. The present disclosure is pertinent to this need.
The present disclosure provides, in one embodiment, a method to produce transgenic antibodies in primary B cells using CRISPR-based systems. This new method involves short term culture in vitro, silencing of the endogenous Ig genes, and insertion of a bi-cistronic cDNA into the Igh locus. Mouse B cells edited to express an anti-HIV-1 bNAbs by this method can produce transgenic antibody levels that are protective in animal models (Mascola et al., 1999; Parren et al., 2001; Shibata et al., 1999; Shingai et al., 2014).
Mouse and human B lymphocytes typically express a single antibody despite having the potential to express 2 different heavy chains and 4 different light chains. Theoretically the combination could produce 8 different antibodies and a series of additional chimeras that could interfere with the efficiency of humoral immunity and lead to unwanted autoimmunity. Allelic exclusion prevents this from happening and would need to be maintained by any gene replacement strategy used to edit B lymphocytes. In addition, genetic editing is accompanied by safety concerns due to off-target double strand breaks and integrations. The currently provided approach lowers these risks by using non-viral gene editing with ssDNA templates, which limits random integrations and by keeping culture time short to prevent expansion of any such cell.
The present approach maintains allelic exclusion in part by ablating the Igkc gene. In the mouse data described below, 95% of B cells express Igkc. In the absence of Igkc expression these cells will die by apoptosis because they cannot survive unless they continue to express a B cell receptor (Kraus et al., 2004; Lam et al., 1997). Since the introduction of the transgene into the heavy chain locus disrupts endogenous Igh expression, editing maintains allelic exclusion in the majority of cells because only cells expressing the introduced antibody can survive. The presently provided strategy also interferes with the survival of cells that suffer off-target integration events, because the majority of such cells would be unable to express the B cell receptor and they too would die by apoptosis.
A potential issue is that there are two heavy chain alleles in every B cell and allelic exclusion would be disrupted if the transgene were only integrated in the non-productive Igh allele allowing for expression of the original productive Igh. However, our flow cytometry data discussed below indicates that this is a very rare event. Thus, either both alleles are targeted or the occasional remaining endogenous Igh gene is unable to pair with the transgenic Igk. A small number of B cells that have not deleted endogenous Igk might also integrate the transgene into the Igh locus. This could decrease the efficiency of knock-in antibody expression if the endogenous kappa pairs with the transgenic heavy chain. The use of a promoterless construct as described below increases surface BCR expression and improves safety. This construct relies on integration into an allele with in frame VDJ rearrangement. Furthermore, the absence of a promoter makes off target gene activation less likely thereby increasing the safety of this approach.
In contrast to the mouse, IGL is expressed by 45% of all B cells in humans. Therefore, this locus would either need to be ablated, or alternatively, cells expressing IGL could be removed from the transferred population by any one of a number of methods of negative selection. The disclosure includes each of these approaches.
Similar to antibody transgenes in mice, expression of the edited BCR varied between different antibodies. Some combinations of heavy and light chains were refractory to expression in mature B cells. In addition, although the level of B cell receptor expression was within the normal range, it was generally in the low end compared to polyclonal B cells. This is consistent with generally lower level expression of a similar transgene in knock-in mice (Jacobsen et al., 2018). Low BCR expression could also be due to the bi-cistronic design since expression was higher in knock-in mice that expressed the identical Ig from the native Igk and Igh loci (Dosenovic et al., 2018). Nevertheless, expression levels were adequate to drive antigen-induced antibody production in vivo.
bNAb mediated protection against infection with simian-human immunodeficiency viruses in macaques requires ICso neutralizing titers of 1:100 (Mascola et al., 1999; Parren et al., 2001; Shibata et al., 1999; Shingai et al., 2014). Thus, the titers achieved by CRISPR/Cas9 edited B cells in mice would be protective if they could be translated to macaques and by inference humans. Moreover, our neutralization measurements may be an underestimate since we excluded bNAbs produced as IgM or isotypes other than IgG.
Most protective vaccine responses depend on humoral immunity. Neutralizing antibody responses are readily elicited for most human pathogens, but in some cases, including HIV-1, it has not yet been possible to do so. The alternatives include passive antibody infusion, which has been an effective means of protection since it was discovered at the turn of the last century. However, in the present disclosure, it is shown that passive transfer of mouse B cells edited by CRISPR/Cas9 can also produce protective antibody levels in vivo. This demonstrates that humoral immune responses can be engineered by CRISPR/Cas9. The approach is not limited to HIV-1 and can be applied to any disease requiring a specific antibody response.
A non-limiting embodiment of the disclosure is illustrated by engineering mature B cells that express an anti-HIV-1 bNAb. Adoptive transfer of the engineered B cells and immunization with a single cognate antigen led to germinal center formation and antibody production at levels consistent with protection.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein. All time intervals, temperatures, reagents, culture conditions and media, described herein are included in this disclosure.
The disclosure includes all steps and compositions of matter described herein in the text and figures of this disclosure, including all such steps individually and in all combinations thereof, and includes all compositions of matter including but not necessarily limited to vectors, cloning intermediates, cells, cell cultures, progeny of the cells, and the like. The disclosure includes all polynucleotide sequences, their RNA or DNA equivalents, all complementary sequences, and all reverse complementary sequences. If reference to a database entry is made for a sequence, the sequence is incorporated herein by reference as it exists in the database as of the filing date of this application or patent. Sequences that are 80.0-99.9% identical, inclusive, and including all numbers to the first decimal point there between, to any nucleotide or amino acid sequence are encompassed by this disclosure. The disclosure includes the human homologues of every mouse nucleotide and amino acid sequence described herein.
All nucleotide sequences and amino acid sequences encoded by them are included in this disclosure. The disclosure includes contiguous segments of these sequences. The disclosure includes all sequences encoding leader, variable, and joining regions (VJ) encoding antibody light chains, and all the sequences encoding the variable, diversity, and joining regions (VDJ) of heavy chains, and all amino acid sequences encoded by those sequences. CDR sequences from these sequences can be recognized by those skilled in the art and are also included as distinct sequences. The disclosure includes all combinations of VJ and VDJ sequences, combinations of distinct antibodies that are differentiated from one another by said sequences, modified B cells that encode such antibodies, and combinations of modified B cells that produce distinct antibodies, as further described herein.
Throughout this application, unless stated differently, the singular form encompasses the plural and vice versa. All sections of this application, including any supplementary sections or figures, are fully a part of this application.
The term “treatment” as used herein refers to alleviation of one or more symptoms or features associated with the presence of the particular condition or suspected condition being treated. Treatment does not necessarily mean complete cure or remission, nor does it preclude recurrence or relapses. Treatment can be effected over a short term, over a medium term, or can be a long-term treatment, such as, within the context of a maintenance therapy. Treatment can be continuous or intermittent.
The term “therapeutically effective amount” as used herein refers to an amount of an agent sufficient to achieve, in a single or multiple doses, the intended purpose of treatment. The amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient specifics and the like. Appropriate effective amounts can be determined by one of ordinary skill in the art informed by the instant disclosure using routine experimentation. In embodiments, about 3×104-4×105 modified B cells/kg are administered, such as by intravenous administration.
This disclosure provides modified B cells, antibodies made by such B cells, vectors and cells comprising nucleic acids encoding the antibodies, compositions comprising any of the foregoing, methods of making any of the foregoing, and methods of using the modified B cells expressing the antibodies in the treatment and/or prophylaxis of a condition associated with the antigen to which the produced antibodies bind with specificity. This disclosure includes all nucleic acid and amino acid sequences described herein and all contiguous segments thereof including all integers and ranges of integers there between. In embodiments, each CDR amino acid sequence of each antibody of this disclosure is included as a distinct sequence.
In an embodiment, the disclosure provides a method for modifying one or more primary B cells to provide one or more modified primary B cells. The modified primary B cells maintain allelic exclusion and can participate in a humoral immune response when introduced into a mammal. The modified primary B cells can also form germinal centers in the individual into which they are introduced. The modified primary B cells produce heterologous antibodies that bind with specificity to a distinct epitope. “Heterologous” means the modified B cells produce antibodies that are encoded by the constructs described herein and which are introduced into the modified B cells. Thus, in embodiments, the antibodies are not encoded by the primary B cells before being modified as set forth in this disclosure. Primary B cells are B lymphocytes that are characterized by having developed in in vivo. In embodiments, primary mature naïve B cells derived from blood or spleen are used. In embodiments, the primary B cells may be memory B cells. In embodiments, the primary B cells used in the methods of this disclosure are IgM or IgD and do not detectably express activation markers at the time they are modified. Memory B cells can express IgM or IgD, or any of switched isotypes. In human samples, CD27 may be used to indicate memory B cells. In embodiments, the disclosure comprises obtaining B cells from an individual, modifying the B cells as described herein, and administering the B cells to the individual. As described further herein, production of the heterologous antibodies can be stimulated by vaccinating the individual with the epitope to which the heterologous antibodies bind with specificity.
In embodiments, the antibodies produced by modified B cells of this disclosure produce functional antibodies. “Functional antibodies” are antibodies that bind to their cognate epitope with specificity. Thus, modified B cells of this disclosure express the sequence encoding leader, variable, and joining regions (VJ) of the heterologous antibody light chain, and the sequence encoding the variable, diversity, and joining regions (VDJ) of the heterologous heavy antibody chain, to thereby form a functional antibody.
The antibodies produced by the modified B cells can contain any suitable framework and hypervariable regions. Any desired complementarity determining regions (CDRs) can be part of the antibodies produced by the modified B cells. Aspects of the disclosure are illustrated with modified B cells that produce IgG and/or IgM antibodies, but the method can be adapted, given the benefit of this specification, to produce any isotope (e.g., any of IgA, IgD, IgE, IgM, and IgG).
The epitope to which the antibodies produced by modified B cells bind is not particularly limited. In embodiments, the epitope (and thus the CDRs of the antibodies produced by the modified B cells confer specificity to the epitope) is present on any infectious agent, such as an infectious microorganism, or a virus. In embodiments, the infectious organism is any pathogenic bacteria, or an infectious pathogenic fungus. In embodiments, the epitope is present on the surface of a virus, or on a component of a virus that is exposed during replication or during cell entry.
In embodiments, the epitope is present on a virus that specifically infects humans, or specifically infects non-human animals, or avian animals. The disclosure thus includes human and veterinary approaches.
In embodiments, the modified B cells produce viral neutralizing antibodies. The term “neutralizing antibody” and its various grammatical forms refers to antibodies that inhibit, reduce or completely prevent viral infection. Whether neutralizing antibodies are produced can be determined by in vitro assays that are known in the art. Modified B cells of this disclosure can be used for prophylaxis and/or treatment of, for example, viral infections. In embodiments, the antibodies bind with specificity to an epitope comprised by any component of HIV, or any component of a coronavirus, or any component of a hepatitis virus.
In non-limiting embodiments, antibodies produced by modified B cells of this disclosure are specific for any epitope include anti-HIV antibodies PGT121, 3BNC60SI, 10-1074, and 3BNC117, and variants and derivatives thereof. In non-limiting embodiments, the antibodies produced by the modified B cells of this disclosure are any antibody, and variants and derivatives thereof, as described in PCT publication WO/2018/187799, published Apr. 9, 2018, the entire disclosure of which is incorporated herein by reference.
In embodiments, a CRISPR system is used to initially introduce a ssDNA homology directed repair template (HDRT) into primary B cells. Insertion of the HDRT may be heterozygous or homozygous for any particular allele.
The HDRT comprises or consists of at least the following elements:
In embodiments, the splice acceptor may comprise an AG nucleotide sequence, and may further comprise a branch sequence. In embodiments, nucleotides from constant mu (Cμ) exon 1 are from any suitable such exon sequence. In embodiments, the nucleotides are inserted such that they maintain the downstream reading frame of the remainder of the construct, and any number of nucleotides can be used. Since the first codon in the exon is split between the J and the constant region with the first nucleotide encoded by J and the other two nucleotides by the C region, the following equation applies for the number of nucleotides (nucleotides x 3)-1. The sequence of the constant mu (Cμ) exon 1 is known and can be accessed at, for example, NCBI Gene ID 3507, Ensemb1 ENSG00000211899.
The first amino acid linker is typically three amino acids long, and may be comprised of a GSG sequence. The first self-cleaving amino acid sequence is typically about 18-22 amino acids long. Any suitable sequence can be used, non-limiting examples of which include: T2A, comprising the amino acid sequence: EGRGSLLTCGDVEENPGP (SEQ ID NO:49); P2A, comprising the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO:50); E2A, comprising the amino acid sequence QCTNYALLKLAGDVESNPGP (SEQ ID NO:51); and F2A, comprising the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:52).
The kappa constant region is known, and can be accessed at, for example NCBI Gene ID 3514, Ensembl ENSG00000211592. Alternatively, a lambda constant region may be used, and its sequence is also know. The sequence of the protease-cleavage site is typically about 4 amino acids long. In a non-limiting embodiment, the sequence is RRKR. The sequence of the second amino acid linker sequence may be the same as the first amino acid linker. The intron splice donor site can be of variable length, typically about 40-60 nucleotides. In embodiments, the intron splice donor comprises a GU sequence.
The first and second homology arms are configured to be introduced into one or more desired chromosomal loci. In embodiments, the disclosure comprises combined endogenous Ig disruption with insertion of a transcription unit (the HDRT) that directs expression of the heavy and light chain into an endogenous heavy chain locus/loci. In embodiments, such loci comprise the IGKC exon, an IGHJ6 intron, an IgLC locus, or a combination thereof. The sequence of the IGKC exon can be accesed at, for example, NCBI Gene ID 3514, Ensembl ENSG00000211592). The sequence of IGHJ6 introns can be accessed at, for example, NCBI Gene ID 28475, Ensembl ENSG00000211900). There are five functional genes in the IgLC locus, and any can be used for the homology arm. The sequence of the five genes in the IgLC locus are IGLC1, IGLC2, IGLC3, IGLC6 IGLC7, and can be accessed at, for example, NCBI Gene ID 3537, 3538, 3539 3542, 28834, respectively, Ensemb1 ENSG00000211675, ENSG00000211677, ENSG00000211679, ENSG00000222037, ENSG00000211685, respectively. Thus, the sequences of the first and second homology arms may be identical to the chromosomal sequences into which they are introduced and/or replace. Non-limiting examples of HDRT sequences used in this disclosure are provided in Table 2 and
In addition to the HDRT, the disclosure comprises introducing into primary B cells a clustered regularly interspaced short palindromic repeats (CRISPR)-Cas (CRISPR-associated proteins) system. The disclosure is illustrated using a Cas9 enzyme, but it is expected that other CRISPR systems and Cas enzymes can be used. In embodiments, any type II CRISPR system/Cas enzyme is used. In embodiments, the type II system/Cas enzyme is type II-B enzyme. In embodiments, that Cas enzyme comprises Cpf1
In embodiments, the disclosure includes introducing the HDRT, the Cas enzyme, a trans-activating crRNA (tracrRNA), and one, two, or three guide RNAs. Suitable tracrRNAs are known in the art and can be adapted for use with the methods of this disclosure. The guide RNAs may be provided as crRNAs. The guide RNAs are programmed to target specific sites so that the first and second homology arms are integrated correctly, depending on the locus where the HDRT is inserted. In embodiments, two or three guide RNAs are used. In embodiments, the guide RNAs are targeted to a suitable sequence in the IGKC, IGHJ6, and/or IgLC loci.
Methods for designing suitable guide RNAs are known in the art such that guide RNAs having the proper sequences can be designed and used, when given the benefit of the present disclosure. Non-limiting examples of guide RNAs are provided in Table 1.
In embodiments, insertion of an HDRT described herein into a plurality of primary B cells results in more of the primary B being λ-B cell receptor positive primary B cells than κ-B cell receptor positive primary B cells. In embodiments, insertion of an HDRT as describe herein reduces or eliminates λ-B cell receptor positive primary B cells, and/or reduces or eliminates κ-B cell receptor positive primary B cells.
In embodiments, an HDRT of this disclosure comprises at least one of the following characteristics:
i) no promoter is included in the HDRT;
ii) the primary B cells are human B cells;
iii) only two nucleotides from the Cμ exon 1 are included in the HDRT;
iv) the first or second self-cleaving amino acid sequences comprise a T2A sequence or a P2A sequence;
v) the first or second amino acid linker sequences, or both, are GSG-linker sequences;
vi) the protease cleavage site is a furin-cleavage site;
vii) the CAS enzyme and the guide RNAs are introduced into the primary B cell as a ribonucleotide protein complex;
vii) production of the modified primary B cells is performed without using a viral delivery vector.
In embodiments, the disclosure comprises providing a treatment to an individual in need thereof by introducing a therapeutically effective amount of modified B cells as described herein to the individual, and vaccinating the individual with an antigen that is cognate to the antibodies produced by the modified B cells. Thus, the antigen used in the vaccination comprises an epitope that is specifically recognized by the antibodies produced by the modified B cells. One or more vaccinations can be used.
In embodiments, the disclosure includes modified B cells made according to a method of this disclosure. In embodiments, the modified B cells can be provided in a pharmaceutical formulation, and such formulations are included in the disclosure. A pharmaceutical formulation can be prepared by mixing the modified B cells with any suitable pharmaceutical additive, buffer, and the like. Examples of pharmaceutically acceptable carriers, excipients and stabilizers can be found, for example, in Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins, the disclosure of which is incorporated herein by reference.
In embodiments, the disclosure comprises a kit for use in making modified B cells. In embodiments, the kit can comprising one or more cloning vectors, the vectors comprising the elements discussed above for producing an HDRT, with the exception that the vector contains suitable restriction enzyme recognition sites for inserting a sequence encoding the VJ regions of the heterologous antibody light chain, and for inserting a sequence encoding the VDJ regions of the heterologous heavy antibody chain. Guide RNAs and a Cas enzyme may also be provided with the kit.
In embodiments, the disclosure comprises an isolated HDRT. Methods for producing ssDNA homology directed repair templates are known and can be adapted for use with the present disclosure. In a non-limiting embodiment, plasmids comprising the HDRT are digested with sequence-specific nickases, and ssDNA purification is performed using any suitable technique, such as by agarose gel electrophoresis.
In embodiments, the disclosure comprises isolating a sample from a mammal, identifying antibody coding sequences from the sample, and engineering B cells to express the identified antibody sequences. In embodiments, the individual produces virus neutralizing antibodies, and the engineered B cells make antibodies that neutralize the same virus, e.g., the produced antibodies comprise the same CDRs as the antibodies in the sample.
In embodiments, the disclosure comprises obtaining a sample comprising B cells from an individual, determining the sequence of the VJ regions of an antibody light chain, determining the sequence of the VDJ chain of the same antibody, and generating an HDRT comprising the sequences encoding the VJ and VDJ regions. The disclosure further includes using the HDRT to produce modified B cells that comprise the VJ and VDJ regions, and which produce the antibodies.
The following examples are meant to illustrate, and are not intended to be limiting. The disclosure includes all reagents and process steps that are described in these examples.
Expressing Antibodies in Primary Mature, Murine B Cells.
To edit mature B cells efficiently, the disclosure comprise activating and culturing the B cells in vitro. To determine whether such cells can participate in humoral immune responses in vivo we used Igha CD45.1 B cells carrying the B1-8hi heavy chain that are specific for the hapten 4-hydroxy-3-nitro-phenylacetyl (NP) (Shih et al., 2002). B1-8hi B cells were activated in vitro with anti-RP105 antibody for 1-2 days and subsequently transferred into congenically marked (Ighb CD45.2) C57BL/6J mice. Recipients immunized with NP-conjugated to ovalbumin (NP-OVA) developed germinal centers (GCs) containing large numbers of the antigen-specific, transferred B cells (
Despite having two alleles for each of the antibody chains, B cells express only one heavy and one light chain gene, a phenomenon referred to as allelic exclusion (Cebra et al., 1966; Nussenzweig et al., 1987; Pernis et al., 1965). In the absence of the present disclosure, introducing additional antibody genes would risk random combinations of heavy and light chains some of which could be self-reactive or incompatible. Thus, deletion of the endogenous chains would be desirable to prevent expression of chimeric B cell receptors (BCRs) composed of the transgene and the endogenous antibody genes. To do so, we combined endogenous Ig disruption with insertion of a transcription unit that directs expression of the heavy and light chain into the endogenous heavy chain locus.
CRISPR-RNAs (crRNAs) were designed to ablate the κ-light chain because 95% of all mouse B cells express Igk (
To insert a transgene into the heavy chain locus we designed crRNAs specific for the first Igh intron immediately 3′ of the endogenous VDJH gene segment, and 5′ of the Eμ enhancer. The Eu enhancer sequence is known in the art, and is located in the IGHJ6 intron, the sequence of which is described above. This position was selected to favor transgene expression and allow simultaneous disruption the endogenous heavy chain (see below and (Jacobsen et al., 2018, the disclosure of which is incorporated herein by reference)). We tested 7 crRNAs and selected a high-efficiency crRNA located 110 bp downstream of the JH4 intron producing 77% indels by the TIDE assay (
TGGAGTTTTCTGAGCATTGCAGACTAATCTTGGATATTTGTCCCTGAGGGAGCCGGC TGAGAGAAGTTGGGAAATAAACTGTCTAGGGATCTCAGAGCCTTTAGGACAGATTA TCTCCACATCTTTGAAAAACTAAGAATCTGTGTGATGGTGTTGGTGGAGTCCCTGGA TGATGGGATAGGGACTTTGGAG (SEQ ID NO:41). In
The homology-directed repair template is described above. In an embodiment, it is composed of a splice acceptor (SA) stop cassette to terminate transcription of upstream rearranged VDJH, and a VH-gene promoter followed by cDNAs encoding Igk, a P2A self-cleaving sequence, and IgVH with a JH1 splice donor (SD) site (
A number of methods for producing ssDNA homology directed repair templates (HDRTs) were compared. The most reproducible and least cytotoxic involved digestion of plasmids with sequence-specific nickases, and ssDNA purification by agarose gel electrophoresis (
Co-transfection of the ssDNA template with pre-assembled Cas9 ribonucleoproteins (RNPs) containing the crRNAs resulted in expression of the encoded anti-HIV antibody in 0.1-0.4% of mouse B cells by antigen-specific flow cytometry using antigens TM4 core (McGuire et al., 2014; McGuire et al., 2016) or 10mut (Steichen et al., 2016) (
To determine whether edited cells are allelically excluded at the heavy chain locus we transfected Igha/b B cells with 3BNC60SI, a chimeric antibody composed of the mature heavy chain and germline light chain of the anti-HIV bNAb 3BNC60 (
Promoter containing expression cassettes have the potential to cause unwanted ectopic gene expression or allelic inclusion since they can be expressed from either the rearranged or germline IgH locus. To address these potential problems we designed a smaller, promoterless antibody expression cassette that depends on integration into a rearranged IgH allele for expression (
Without intending to be bound by any particular theory, we conclude that mature mouse B cells can be edited in vitro to produce anti-HIV-1 bNAbs from the Igh locus.
Antibody Gene Editing in Human B Cells
To determine whether this method could be adapted to edit human B cells we isolated them from peripheral blood of healthy volunteers and activated them using an anti-human RP105 antibody (Miura et al., 1998). Analogous crRNAs were selected for targeting the human IGKC and the first intron 3′ of IGHJ6 (
To target bNAbs into the human JH6 intron we adapted the ssDNA HDRT and replaced mouse with human homology arms, the human Cμ splice acceptor, the human IGHV1-69 promoter, a codon-modified human IGKC constant region to avoid targeting by crRNAs and the human JH4 splice donor (
Without intending to be bound by any particular theory, we conclude that primary human B cells can be edited by CRISPR/Cas9 to express anti-HIV bNAbs, and that this is significantly more efficient than in mouse B cells.
Adoptive Transfer of Antibody-Edited B Cells
To determine whether edited B cells can participate in immune responses, we adoptively transferred mouse 3BNC60SI-edited Ighb B cells, into congenically-marked Igha wild type mice and immunized with the high-affinity, cognate antigen TM4 core in Ribi adjuvant (
To determine whether the transferred cells retained the ability to produce neutralizing antibodies we used B cells that were edited to produce 10-1074, a potent bNAb, or 3BNC60SI a chimeric antibody with limited neutralizing activity (Dosenovic et al., 2018; Mouquet et al., 2012). 4×107 transfected B cells were transferred into wild type Igha mice that were subsequently immunized with the appropriate cognate antigen 10mut (Steichen et al., 2016) or TM4 core (Dosenovic et al., 2018; Dosenovic et al., 2015; McGuire et al., 2014; McGuire et al., 2016). IgG was purified from the serum of 3 mice that received an estimated ˜103 edited B cells expressing 10-1074 or 3BNC60SI. The purified serum antibodies were tested for neutralizing activity in the TZM-b1 assay (Montefiori, 2005). Two of the 3 mice that received 10-1074 edited cells showed IC50s of 21.59 μg/mL and a third reached 49% neutralization at 118 μg/mL (corresponding to approximately 1:500 and 1:100 dilution of serum,
Without intending to be bound by theory, we conclude that edited B cells can be recruited into immune responses and produce sufficient antibody to confer potentially protective levels of humoral immunity (Shingai et al., 2014).
This Example provides a description of the materials and methods used to produce the foregoing results.
crRNA Design
crRNAs were designed with the MIT guide design tool (crispr.mit.edu), CHOPCHOP (chopchop.cbu.uib.no) and the IDT crRNA design tool (www.idtdna.com). Designs were synthesized by IDT as Alt-R CRISPR-Cas9 crRNAs. crRNA sequences are listed in Table 1 as DNA sequences, these sequences include sequences with substitution of U for T.
ssDNA HDRT Preparation
HDRT sequences, listed in Table 2, were synthesized as gBlocks (IDT) and cloned using NheI and XhoI (NEB) into vector pLSODN-4D from the long ssDNA preparation kit (BioDynamics Laboratories, Cat. #DS620). ssDNA was prepared following the manufacturer's instructions with the following modifications: In brief, 2.4 mg sequence verified vector was digested at 2 μg/μL in NEB 3.1 buffer with 1200 U Nt.BspQI for 1 h at 50° C. followed by addition of 2400 U XhoI (NEB) and incubation for 1 hat 37° C. Digests were desalted by ethanol precipitation and resuspended in water at <1 μg/μL. An equal volume of formamide gel-loading buffer (95% de-ionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 0.025 SDS, 18 mM EDTA) was added and heated to 70° C. for 5 min to denature dsDNA. Denatured samples were immediately loaded into dye-free 1% agarose gels in TAE and run at 100 V for 3 h. Correctly sized bands were identified by partial post-stain with GelRed (Biotium), then excised and column purified (Machery Nagel Cat. #740610.20 or 740609.250) according to the manufacturer's instructions. Eluate was ethanol precipitated, resuspended in water, adjusted to 2.5 μg/μL and stored at −20° C.
Murine Cell Culture
Mature, resting B cells were obtained from mouse spleens by forcing tissue through a 70 μm mesh into PBS containing 2% heat-inactivated fetal bovine serum (FBS). After ACK lysis for 3 min, untouched B cells were enriched using anti-CD43 magnetic beads (MACS) according to manufacturer's protocol (Miltenyi Biotec) obtaining >95% purity. 3.2×107 cells/10 cm dish (Gibco) were cultured at 37° C. 5% CO2 in 10 mL mouse B cell medium consisting of RPMI-1640, supplemented with 10% heat-inactivated FBS, 10 mM HEPES, antibiotic-antimycotic (1×), 1 mM sodium pyruvate, 2 mM L-glutamine and 53 μM 2-mercaptoethanol (all from Gibco) and activated with 2 μg/mL anti-mouse RP105 clone RP/14 (produced in house or BD Pharmingen Cat. #562191).
NB-21 feeder cells (Kuraoka et al., 2016) were maintained in DMEM supplemented with 10% heat-inactivated FBS and antibiotic-antimycotic (1×). For co-culture, feeder cells were irradiated with 80 Gy and seeded simultaneously with B cells, 24 h after transfection, into B cell culture medium supplemented with 1 ng/mL recombinant mouse IL-4 (PeproTech Ca. #214-14) and 2 μg/mL anti-mouse RP105 clone RP/14.
Human Cell Culture
Leukapheresis samples of healthy human individuals were collected after signed informed consent in accordance with protocol TSC-0910 approved by the Rockefeller University Institutional Review Board (IRB). PBMCs were prepared, stored in liquid nitrogen, then thawed in a 37° C. water bath and resuspended in human B cell medium composed of RPMI-1640, supplemented with 10% heat-inactivated FBS or human serum, 10 mM HEPES, antibiotic-antimycotic (1×), 1 mM sodium pyruvate, 2 mM L-glutamine and 53 μM 2-mercaptoethanol (all from Gibco). B cells were isolated using EasySep human naïve B cell Enrichment Kit (Stemcell Cat. #19254) according to the manufacturer's instructions and cultured in the above medium supplemented with 2 μg/mL anti-human RP105 antibody clone MHR73-11 (BioLegend Cat. #312907).
RNP Preparation and Transfection
Per 100 μL transfection, 1 μL of 200 μM crRNA and 1 μL 200 μM tracrRNA in duplex buffer (all IDT) were mixed, denatured at 95° C. for 5 min, re-natured for 5 min at room temperature. 5.6 μL PBS and 2.4 μL 61 μM Cas9 V3 (IDT, Cat. #1081059) were added and incubated for 15-30 min. If required RNPs were mixed at the following ratios: 50% crIgH, 25% crIgK1 and 25% crIgK2 (mouse) or 50% crhIgH3 and 50% crhIgK3 (human). 4 μI, 100 μM electroporation enhancer in duplex buffer or 4 μL HDRT at 2.5 μg/μL were added to 10 μL mixed RNP and incubated for a further 1-2 min.
24 h after stimulation, activated mouse or human B cells were harvested, washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer's instructions (Lonza) at a concentration of 4-5×106 cells/86 μL. 86 μL cells were added to the RNP/HPRT mix, gently mixed by pipetting and transferred into nucleofection cuvettes and electroporated using an Amaxa IIb machine setting Z-001 (murine B cells) or Amaxa 4D machine setting EH-140 (human B cells). Cells were immediately transferred into 6-well dishes containing 5 mL prewarmed mouse or human B cell medium supplemented with the relevant anti-RP105 antibody at 2 μg/mL and incubated at 37° C. 5% CO2 for 24 h before further processing.
TIDE Assay
Genomic DNA was extracted from 0.5-5×105 cells by standard phenol/chloroform extraction 24-42 h after transfection. PCRs to amplify human or mouse Ig loci targeted by CRISPR-Cas9 were performed using Phusion Green Hot Start II High-Fidelity polymerase (Thermo Fisher Cat. #F-537L) and primers listed in Table 3. Thermocycler was set to 40 cycles, annealing at 65° C. for 30 s and extending at 72° C. for 30 s. PCR product size was verified by gel electrophoresis, bands gel-extracted and sent for Sanger sequencing (Genewiz) using the relevant PCR primers. ab1 files were analyzed using the TIDE web tool (tide.nki.nl) using samples receiving scramble or irrelevant HPRT-targeting crRNA as reference (Brinkman et al., 2014).
Flow Cytometry
Mouse spleens were forced through a 70 μm mesh into FACS buffer (PBS containing 2% heat-inactivated FBS and 2 mM EDTA) and red blood cells were lysed in ACK lysing buffer (Gibco) for 3 min. Cultured cells were harvested by centrifugation. Then cells were washed and Fc-receptors blocked for 15 min on ice. Cells were stained for 20 min on ice with antibodies or reagents listed in Table 4 and depending on the stain, washed again and secondary stained for another 20 min on ice before acquisition on a BD LSRFortessa. Anti-idiotype 3BNC60SI (iv8) produced as human IgG1/κ was detected with anti-human Igκ-BV421 on edited mouse B cells. GC B cells were gated as single/live, B220+, CD38−FAS+, GL7+, IgD−. Allotypic markers CD45.1 and CD45.2 were used to track adoptively transferred B cells.
Mice
C57BL/6J and B6.Igha (B6.Cg-Gpi1a Thy1a Igha/J) and B6.SJL were obtained from the Jackson Laboratory. Igha/b mice were obtained by intercrossing B6.Igha and B6.SJL mice. B1-8hi (Shih et al., 2002), 3BNC60SI (Dosenovic et al., 2018) and PGT121 (Escolano et al., 2016; Steichen et al., 2016) strains were generated and maintained in our laboratory on a C57BL/6J background. All experiments used age and sex-matched animals, littermates when possible. All experiments were performed with authorization from the Institutional Review Board and the Rockefeller University IACUC.
Cell Transfers and Immunizations
After culture, mouse B cells were harvested at the indicated time points and resuspended in mouse B cell medium without anti-RP105 antibody and rested for 2-3 h at 37° C., 5% CO2. Then cells were washed once in PBS and resuspended in 200 μL PBS/mouse containing the indicated number of initially transfected cells. 200 μL cell suspension/mouse were injected intravenously via the retroorbital sinus. Number of transferred, edited B cells was estimated as follows: Number of cells transfected×20% survival×0.15-0.4% transfection efficiency×50% handling/proliferation×5% transfer efficiency (Dosenovic et al., 2018). Mice were immunized intraperitoneally within 24 h after cell transfer with 200 μL containing 10 μg TM4 core (McGuire et al., 2014) or 10mut (Steichen et al., 2016) in PBS with 50% Ribi (Sigma Adjuvant system, Sigma Aldrich) prepared to the manufacturer's instructions. Mice were bled at the indicated time points from the submandibular vein. Blood was allowed to clot and then serum was separated by centrifugation for 10 min at 20817 g. Serum was stored at −20° C.
Anti-Idiotypic Antibody
IgG producing hybridomas were isolated from mice immunized with iGL-VRC01 at the Frederick Hutchinson Cancer Research Center Antibody Technology Resource. Hybridoma supernatants were screened against a matrix of inferred germline (iGL) VRCO1 class antibodies as well as irrelevant iGL-antibodies using a high throughput bead-based assay. One anti-idiotypic antibody, clone iv8, bound to additional VRC01 class antibodies, but it also bound to a chimeric antibody with an iGL-VRC01 class light chain paired with the 8ANC131 heavy chain (which is derived from VH1-46), and to 3BNC60SI.
ELISAs
For determination of 3BNC60SI levels, Corning 3690 half-well 96-well plates were coated overnight at 4° C. with 25 μL/well of 2 μg/mL human anti-3BNC60SI (clone iv8) IgG in PBS, then blocked with 150 μL/well PBS 5% skimmed milk for 2 h at room temperature (RT). Sera were diluted to 1:50 with PBS and 7 subsequent 3-fold dilutions. Recombinant 3BNC60SI (produced in house as mouse IgG1,κ) was diluted to 10 μg/mL in PBS followed by six 5-fold dilutions. Blocked plates were washed 4-times with PBS 0.05% Tween 20 and incubated with 25 μL diluted sera or antibody for 2 h at RT. Binding was revealed by either anti-mouse IgG-horseradish peroxidase (HRP) (Jackson ImmunoResearch, Cat. #115-035-071) or anti-mouse IgG1a-biotin (BD Pharmingen Cat. #553500) or anti-mouse IgG1b-biotin (BD Pharmingen Cat. #553533), all diluted 1:5000 in PBS, 25 μL/well and incubation for 1 h at RT. Biotinylated antibodies were subsequently incubated with Streptavidin-HRP (BD Pharmingen Cat. #554066), diluted 1:1000 in PBS, 25 μL/well for 30 min at RT. Plates were washed 4-times with PBS 0.05% Tween 20 in between steps and 6 times before addition of substrate using a Tecan Hydrospeed microplate washer. HRP activity was determined using TMB as substrate (Thermo Scientific Cat. #34021), adding 50 μL/well. Reactions were stopped with 50 μL/well 2 M H2SO4 and read at 450 and 570 nm on a FLUOstar Omega microplate reader (BMG Labtech). Data were analyzed with Microsoft Excel and GraphPad Prism 6.0. Absolute 3BNC60SI titers were interpolated from sigmoidal fits of recombinant 3BNC60SI standard curves.
For determination of NP-binding antibodies the following modifications applied. Plates were coated with 10 μg/mL NP31-bovine serum albumin (BSA, Biosearch Technologies) and blocked with PBS 3% BSA. Sera, antibodies and secondary reagents were diluted in PBS 1% BSA 0.05% Tween20.
Neutralization Assays
Collected mouse serum was pooled and IgG purified using protein G Ab SpinTraps (GE Healthcare Cat. #28-4083-47) then concentrated and buffer-exchanged into PBS using Amicon Ultra 30K centrifugal filter units (Merck Millipore Cat. #UFC503024) according to the manufacturers' instructions.
TZM-b1 assays were performed as previously described (Montefiori, 2005). Neutralizing activity was calculated as a function of the reduction in Tat-inducible luciferase expression in the TZM-b1 reporter cell line in a single round of virus infection.
Additional Information:
References—This reference listing is not an indication that any particular reference is material to patentability:
Bar, K. J., M. C. Sneller, L. J. Harrison, J. S. Justement, E. T. Overton, M. E. Petrone, D. B. Salantes, C. A. Seamon, B. Scheinfeld, R. W. Kwan, G. H. Learn, M. A. Proschan, E. F. Kreider, J. Blazkova, M. Bardsley, E. W. Refsland, M. Messer, K. E. Clarridge, N. B. Tustin, P. J. Madden, K. Oden, S. J. O'Dell, B. Jarocki, A. R. Shiakolas, R. L. Tressler, N. A. Doria-Rose, R. T. Bailer, J. E. Ledgerwood, E. V. Capparelli, R. M. Lynch, B. S. Graham, S. Moir, R. A. Koup, J. R. Mascola, J. A. Hoxie, A. S. Fauci, P. Tebas, and T. W. Chun. 2016. Effect of HIV Antibody VRC01 on Viral Rebound after Treatment Interruption. N Engl J Med 375:2037-2050.
Briney, B., D. Sok, J. G. Jardine, D. W. Kulp, P. Skog, S. Menis, R. Jacak, O. Kalyuzhniy, N. de Val, F. Sesterhenn, K. M. Le, A. Ramos, M. Jones, K. L. Saye-Francisco, T. R. Blane, S. Spencer, E. Georgeson, X. Hu, G. Ozorowski, Y. Adachi, M. Kubitz, A. Sarkar, I. A. Wilson, A. B. Ward, D. Nemazee, D. R. Burton, and W. R. Schief. 2016. Tailored Immunogens Direct Affinity Maturation toward HIV Neutralizing Antibodies. Cell 166:1459-1470.e1411.
Brinkman, E. K., T. Chen, M. Amendola, and B. van Steensel. 2014. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42:e168. Caskey, M., F. Klein, J. C. Lorenzi, M. S. Seaman, A. P. West, N. Buckley, G. Kremer, L. Nogueira, M. Braunschweig, J. F. Scheid, J. A. Horwitz, I. Shimeliovich, S. Ben-Avraham, M. Witmer-Pack, M. Platten, C. Lehmann, L. A. Burke, T. Hawthorne, R. J. Gorelick, B. D. Walker, T. Keler, R. M. Gulick, G. Fakenheuer, S. J. Schlesinger, and M. C. Nussenzweig. 2015. Viraemia suppressed in HIV-1-infected humans by broadly neutralizing antibody 3BNC117. Nature 522:487-491.
Caskey, M., T. Schoofs, H. Gruell, A. Settler, T. Karagounis, E. F. Kreider, B. Murrell, N. Pfeifer, L. Nogueira, T. Y. Oliveira, G. H. Learn, Y. Z. Cohen, C. Lehmann, D. Gillor, I. Shimeliovich, C. Unson-O'Brien, D. Weiland, A. Robles, T. Kummerle, C. Wyen, R. Levin, M. Witmer-Pack, K. Eren, C. Ignacio, S. Kiss, A. P. West, H. Mouquet, B. S. Zingman, R. M. Gulick, T. Keler, P. J. Bjorkman, M. S. Seaman, B. H. Hahn, G. Fakenheuer, S. J. Schlesinger, M. C. Nussenzweig, and F. Klein. 2017. Antibody 10-1074 suppresses viremia in HIV-1-infected individuals. Nat Med 23:185-191.
Cebra, J. J., J. E. Colberg, and S. Dray. 1966. Rabbit lymphoid cells differentiated with respect to alpha-, gamma-, and mu-heavy polypeptide chains and to allotypic markers Aa1 and Aa2. J Exp Med 123:547-558.
Dosenovic, P., E. E. Kara, A. K. Pettersson, A. T. McGuire, M. Gray, H. Hartweger, E. S. Thientosapol, L. Stamatatos, and M. C. Nussenzweig. 2018. Anti-HIV-1 B cell responses are dependent on B cell precursor frequency and antigen-binding affinity. Proc Natl Acad Sci USA 115:4743-4748.
Dosenovic, P., L. von Boehmer, A. Escolano, J. Jardine, N. T. Freund, A. D. Gitlin, A. T. McGuire, D. W. Kulp, T. Oliveira, L. Scharf, J. Pietzsch, M. D. Gray, A. Cupo, M. J. van Gils, K. H. Yao, C. Liu, A. Gazumyan, M. S. Seaman, P. J. Bjorkman, R. W. Sanders, J. P. Moore, L. Stamatatos, W. R. Schief, and M. C. Nussenzweig. 2015. Immunization for HIV-1 Broadly Neutralizing Antibodies in Human Ig Knockin Mice. Cell 161:1505-1515.
Escolano, A., P. Dosenovic, and M. C. Nussenzweig. 2017. Progress toward active or passive HIV-1 vaccination. J Exp Med 214:3-16.
Escolano, A., J. M. Steichen, P. Dosenovic, D. W. Kulp, J. Golijanin, D. Sok, N. T. Freund, A. D. Gitlin, T. Oliveira, T. Araki, S. Lowe, S. T. Chen, J. Heinemann, K. H. Yao, E. Georgeson, K. L. Saye-Francisco, A. Gazumyan, Y. Adachi, M. Kubitz, D. R. Burton, W. R. Schief, and M. C. Nussenzweig. 2016. Sequential Immunization Elicits Broadly Neutralizing Anti-HIV-1 Antibodies in Ig Knockin Mice. Cell 166:1445-1458.e1412.
Eyquem, J., J. Mansilla-Soto, T. Giavridis, S. J. van der Stegen, M. Hamieh, K. M. Cunanan, A. Odak, M. Gillen, and M. Sadelain. 2017. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature 543:113-117.
Freitag, J., S. Heink, E. Roth, J. Wittmann, H. M. Jäck, and T. Kamradt. 2014. Towards the generation of B-cell receptor retrogenic mice. PLoS One 9:e109199.
Jacobsen, J. T., L. Mesin, S. Markoulaki, A. Schiepers, C. B. Cavazzoni, D. Bousbaine, R. Jaenisch, and G. D. Victora. 2018. One-step generation of monoclonal B cell receptor mice capable of isotype switching and somatic hypermutation. J Exp Med 215:2686-2695.
Kraus, M., M. B. Alimzhanov, N. Raj ewsky, and K. Raj ewsky. 2004. Survival of resting mature B lymphocytes depends on BCR signaling via the Igalpha/beta heterodimer. Cell 117:787-800.
Kuraoka, M., A. G. Schmidt, T. Nojima, F. Feng, A. Watanabe, D. Kitamura, S. C. Harrison, T. B. Kepler, and G. Kelsoe. 2016. Complex Antigens Drive Permissive Clonal Selection in Germinal Centers. Immunity 44:542-552.
Kwong, P. D., and J. R. Mascola. 2018. HIV-1 Vaccines Based on Antibody Identification, B Cell Ontogeny, and Epitope Structure. Immunity 48:855-871.
Lam, K. P., R. Kuhn, and K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073-1083.
Ledgerwood, J. E., E. E. Coates, G. Yamshchikov, J. G. Saunders, L. Holman, M. E. Enama, A. DeZure, R. M. Lynch, I. Gordon, S. Plummer, C. S. Hendel, A. Pegu, M. Conan-Cibotti, S. Sitar, R. T. Bailer, S. Narpala, A. McDermott, M. Louder, S. O'Dell, S. Mohan, J. P. Pandey, R. M. Schwartz, Z. Hu, R. A. Koup, E. Capparelli, J. R. Mascola, B. S. Graham, and V. S. Team. 2015. Safety, pharmacokinetics and neutralization of the broadly neutralizing HIV-1 human monoclonal antibody VRC01 in healthy adults. Clin Exp Immunol 182:289-301. Lim, W. A., and C. H. June. 2017. The Principles of Engineering Immune Cells to Treat Cancer. Cell 168:724-740.
Lynch, R. M., E. Boritz, E. E. Coates, A. DeZure, P. Madden, P. Costner, M. E. Enama, S. Plummer, L. Holman, C. S. Hendel, I. Gordon, J. Casazza, M. Conan-Cibotti, S. A. Migueles, R. Tressler, R. T. Bailer, A. McDermott, S. Narpala, S. O'Dell, G. Wolf, J. D. Lifson, B. A. Freemire, R. J. Gorelick, J. P. Pandey, S. Mohan, N. Chomont, R. Fromentin, T. W. Chun, A. S. Fauci, R. M. Schwartz, R. A. Koup, D. C. Douek, Z. Hu, E. Capparelli, B. S. Graham, J. R. Mascola, J. E. Ledgerwood, and V. S. Team. 2015. Virologic effects of broadly neutralizing antibody VRC01 administration during chronic HIV-1 infection. Sci Transl Med 7:319ra206.
Mascola, J. R., M. G. Lewis, G. Stiegler, D. Harris, T. C. VanCott, D. Hayes, M. K. Louder, C. R. Brown, C. V. Sapan, S. S. Frankel, Y. Lu, M. L. Robb, H. Katinger, and D. L. Birx. 1999. Protection of Macaques against pathogenic simian/human immunodeficiency virus 89.6PD by passive transfer of neutralizing antibodies. J Virol 73:4009-4018.
McCoy, L. E., A. F. Quigley, N. M. Strokappe, B. Bulmer-Thomas, M. S. Seaman, D. Mortier, L. Rutten, N. Chander, C. J. Edwards, R. Ketteler, D. Davis, T. Verrips, and R. A. Weiss. 2012. Potent and broad neutralization of HIV-1 by a llama antibody elicited by immunization. J Exp Med 209:1091-1103.
McGuire, A. T., A. M. Dreyer, S. Carbonetti, A. Lippy, J. Glenn, J. F. Scheid, H. Mouquet, and L. Stamatatos. 2014. HIV antibodies. Antigen modification regulates competition of broad and narrow neutralizing HIV antibodies. Science 346:1380-1383.
McGuire, A. T., M. D. Gray, P. Dosenovic, A. D. Gitlin, N. T. Freund, J. Petersen, C. Correnti, W. Johnsen, R. Kegel, A. B. Stuart, J. Glenn, M. S. Seaman, W. R. Schief, R. K. Strong, M. C. Nussenzweig, and L. Stamatatos. 2016. Specifically modified Env immunogens activate B-cell precursors of broadly neutralizing HIV-1 antibodies in transgenic mice. Nat Commun 7:10618.
Mendoza, P., H. Gruell, L. Nogueira, J. A. Pai, A. L. Butler, K. Millard, C. Lehmann, I. Suárez, T. Y. Oliveira, J. C. C. Lorenzi, Y. Z. Cohen, C. Wyen, T. Kümmerle, T. Karagounis, C. L. Lu, L. Handl, C. Unson-O'Brien, R. Patel, C. Ruping, M. Schlotz, M. Witmer-Pack, I. Shimeliovich, G. Kremer, E. Thomas, K. E. Seaton, J. Horowitz, A. P. West, P. J. Bjorkman, G. D. Tomaras, R. M. Gulick, N. Pfeifer, G. Fätkenheuer, M. S. Seaman, F. Klein, M. Caskey, and M. C. Nussenzweig. 2018. Combination therapy with anti-HIV-1 antibodies maintains viral suppression. Nature 561:479-484.
Miura, Y., R. Shimazu, K. Miyake, S. Akashi, H. Ogata, Y. Yamashita, Y. Narisawa, and M. Kimoto. 1998. RP105 is associated with MD-1 and transmits an activation signal in human B cells. Blood 92:2815-2822.
Montefiori, D. C. 2005. Evaluating neutralizing antibodies against HIV, SIV, and SHIV in luciferase reporter gene assays. Curr Protoc Immunol Chapter 12:Unit 12.11.
Mouquet, H., L. Scharf, Z. Euler, Y. Liu, C. Eden, J. F. Scheid, A. Halper-Stromberg, P. N. Gnanapragasam, D. I. Spencer, M. S. Seaman, H. Schuitemaker, T. Feizi, M. C. Nussenzweig, and P. J. Bjorkman. 2012. Complex-type N-glycan recognition by potent broadly neutralizing HIV antibodies. Proc Natl Acad Sci USA 109:E3268-3277.
Nishimura, Y., and M. A. Martin. 2017. Of Mice, Macaques, and Men: Broadly Neutralizing Antibody Immunotherapy for HIV-1. Cell Host Microbe 22:207-216. Nussenzweig, M. C., A. C. Shaw, E. Sinn, D. B. Danner, K. L. Holmes, H. C. Morse, and P. Leder. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin mu. Science 236:816-819.
Parren, P. W., P. A. Marx, A. J. Hessell, A. Luckay, J. Harouse, C. Cheng-Mayer, J. P. Moore, and D. R. Burton. 2001. Antibody protects macaques against vaginal challenge with a pathogenic R5 simian/human immunodeficiency virus at serum levels giving complete neutralization in vitro. J Virol 75:8340-8347.
Pernis, B., G. Chiappino, A. S. Kelus, and P. G. Gell. 1965. Cellular localization of immunoglobulins with different allotypic specificities in rabbit lymphoid tissues. J Exp Med 122:853-876.
Roth, T. L., C. Puig-Saus, R. Yu, E. Shifrut, J. Carnevale, P. J. Li, J. Hiatt, J. Saco, P. Krystofinski, H. Li, V. Tobin, D. N. Nguyen, M. R. Lee, A. L. Putnam, A. L. Ferris, J. W. Chen, J. N. Schickel, L. Pellerin, D. Carmody, G. Alkorta-Aranburu, D. Del Gaudio, H. Matsumoto, M. Morell, Y. Mao, M. Cho, R. M. Quadros, C. B. Gurumurthy, B. Smith, M. Haugwitz, S. H. Hughes, J. S. Weissman, K. Schumann, J. H. Esensten, A. P. May, A. Ashworth, G. M. Kupfer, S. A. W. Greeley, R. Bacchetta, E. Meffre, M. G. Roncarolo, N. Romberg, K. C. Herold, A. Ribas, M. D. Leonetti, and A. Marson. 2018. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 559:405-409.
Sadelain, M., I. Rivière, and S. Riddell. 2017. Therapeutic T cell engineering. Nature 545:423-431.
Scheid, J. F., J. A. Horwitz, Y. Bar-On, E. F. Kreider, C. L. Lu, J. C. Lorenzi, A. Feldmann, M. Braunschweig, L. Nogueira, T. Oliveira, I. Shimeliovich, R. Patel, L. Burke, Y. Z. Cohen, S. Hadrigan, A. Settler, M. Witmer-Pack, A. P. West, B. Juelg, T. Keler, T. Hawthorne, B. Zingman, R. M. Gulick, N. Pfeifer, G. H. Learn, M. S. Seaman, P. J. Bjorkman, F. Klein, S. J. Schlesinger, B. D. Walker, B. H. Hahn, M. C. Nussenzweig, and M. Caskey. 2016. HIV-1 antibody 3BNC117 suppresses viral rebound in humans during treatment interruption. Nature 535:556-560.
Schoofs, T., F. Klein, M. Braunschweig, E. F. Kreider, A. Feldmann, L. Nogueira, T. Oliveira, J. C. Lorenzi, E. H. Parrish, G. H. Learn, A. P. West, P. J. Bjorkman, S. J. Schlesinger, M. S. Seaman, J. Czartoski, M. J. McElrath, N. Pfeifer, B. H. Hahn, M. Caskey, and M. C. Nussenzweig. 2016. HIV-1 therapy with monoclonal antibody 3BNC117 elicits host immune responses against HIV-1. Science 352:997-1001.
Shibata, R., T. Igarashi, N. Haigwood, A. Buckler-White, R. Ogert, W. Ross, R. Willey, M. W. Cho, and M. A. Martin. 1999. Neutralizing antibody directed against the HIV-1 envelope glycoprotein can completely block HIV-1/SIV chimeric virus infections of macaque monkeys. Nat Med 5:204-210.
Shih, T. A., M. Roederer, and M. C. Nussenzweig. 2002. Role of antigen receptor affinity in T cell-independent antibody responses in vivo. Nat Immunol 3:399-406.
Shingai, M., O. K. Donau, R. J. Plishka, A. Buckler-White, J. R. Mascola, G. J. Nabel, M. C. Nason, D. Montefiori, B. Moldt, P. Poignard, R. Diskin, P. J. Bjorkman, M. A. Eckhaus, F. Klein, H. Mouquet, J. C. Cetrulo Lorenzi, A. Gazumyan, D. R. Burton, M. C. Nussenzweig, M. A. Martin, and Y. Nishimura. 2014. Passive transfer of modest titers of potent and broadly neutralizing anti-HIV monoclonal antibodies block SHIV infection in macaques. J Exp Med 211:2061-2074. Sok, D., and D. R. Burton. 2018. Recent progress in broadly neutralizing antibodies to HIV. Nat Immunol 19:1179-1188.
Sok, D., K. M. Le, M. Vadnais, K. L. Saye-Francisco, J. G. Jardine, J. L. Torres, Z. T. Berndsen, L. Kong, R. Stanfield, J. Ruiz, A. Ramos, C. H. Liang, P. L. Chen, M. F. Criscitiello, W. Mwangi, I. A. Wilson, A. B. Ward, V. V. Smider, and D. R. Burton. 2017. Rapid elicitation of broadly neutralizing antibodies to HIV by immunization in cows. Nature 548:108-111. Steichen, J. M., D. W. Kulp, T. Tokatlian, A. Escolano, P. Dosenovic, R. L. Stanfield, L. E. McCoy, G. Ozorowski, X. Hu, O. Kalyuzhniy, B. Briney, T. Schiffner, F. Garces, N. T. Freund, A. D. Gitlin, S. Menis, E. Georgeson, M. Kubitz, Y. Adachi, M. Jones, A. A. Mutafyan, D. S. Yun, C. T. Mayer, A. B. Ward, D. R. Burton, I. A. Wilson, D. J. Irvine, M. C. Nussenzweig, and W. R. Schief. 2016. HIV Vaccine Design to Target Germline Precursors of Glycan-Dependent Broadly Neutralizing Antibodies. Immunity 45:483-496.
Tian, M., C. Cheng, X. Chen, H. Duan, H. L. Cheng, M. Dao, Z. Sheng, M. Kimble, L. Wang, S. Lin, S. D. Schmidt, Z. Du, M. G. Joyce, Y. Chen, B. J. DeKosky, E. Normandin, E. Cantor, R. E. Chen, N. A. Doria-Rose, Y. Zhang, W. Shi, W. P. Kong, M. Choe, A. R. Henry, F. Laboune, I. S. Georgiev, P. Y. Huang, S. Jain, A. T. McGuire, E. Georgeson, S. Menis, D. C. Douek, W. R. Schief, L. Stamatatos, P. D. Kwong, L. Shapiro, B. F. Haynes, J. R. Mascola, and F. W. Alt. 2016. Induction of HIV Neutralizing Antibody Lineages in Mice with Diverse Precursor Repertoires. Cell 166:1471-1484.e1418.
Voss, J. E., A. Gonzalez-Martin, R. Andrabi, R. P. Fuller, B. Murrell, L. E. McCoy, K. Porter, D. Huang, W. Li, D. Sok, K. Le, B. Briney, M. Chateau, G. Rogers, L. Hangartner, A. J. Feeney, D. Nemazee, P. Cannon, and D. Burton. 2019. Reprogramming the antigen specificity of B cells using genome-editing technologies. Elife 8:
Yoshimi, K., Y. Kunihiro, T. Kaneko, H. Nagahora, B. Voigt, and T. Mashimo. 2016. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun 7:10431.
Although the subject matter of this disclosure has been described above in terms of certain embodiments/examples, other embodiments/examples, including embodiments/examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.
This application claims priority to U.S. provisional patent application No. 62/877,982, filed Jul. 24, 2019, the entire disclosure of which is incorporated herein by reference.
This invention was made with government support under grant nos. 1UM1AI100663 and R01AI-129795 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62877982 | Jul 2019 | US |
