Bacillus thuringiensis delta-endotoxin

Information

  • Patent Grant
  • 5593881
  • Patent Number
    5,593,881
  • Date Filed
    Friday, May 6, 1994
    32 years ago
  • Date Issued
    Tuesday, January 14, 1997
    29 years ago
Abstract
An improved Bacillus thuringiensis (B.t.) delta-endotoxin is created by the modification of the gene encoding the toxin. The toxicity of a B.t. toxin was improved by replacing the native protoxin segment with an alternate protoxin segment by constructing a chimeric toxin gene.
Description

BACKGROUND OF THE INVENTION
The soil microbe Bacillus thuringiensis (B.t.) is a Gram-positive, spore-forming bacterium characterized by parasporal crystalline protein inclusions. These inclusions often appear microscopically as distinctively shaped crystals. The proteins can be highly toxic to pests and specific in their toxic activity. Certain B.t. toxin genes have been isolated and sequenced, and recombinant DNA-based B.t. products have been produced and approved for use. In addition, with the use of genetic engineering techniques, new approaches for delivering these B.t. endotoxins to agricultural environments are under development, including the use of plants genetically engineered with endotoxin genes for insect resistance and the use of stabilized intact microbial cells as B.t. endotoxin delivery vehicles (Gaertner, F. H., L. Kim [1988] TIBTECH 6:S4-S7). Thus, isolated B.t. endotoxin genes are becoming commercially valuable.
Until the last ten years, commercial use of B.t. pesticides has been largely restricted to a narrow range of lepidopteran (caterpillar) pests. Preparations of the spores and crystals of B. thuringiensis subsp. kurstaki have been used for many years as commercial insecticides for lepidopteran pests. For example, B. thuringiensis var. kurstaki HD-1 produces a crystalline .delta.-endotoxin which is toxic to the larvae of a number of lepidopteran insects.
In recent years, however, investigators have discovered B.t. pesticides with specificities for a much broader range of pests. For example, other species of B.t., namely israelensis and tenebrionis (a.k.a.B.t. M-7, a.k.a.B.t. san diego), have been used commercially to control insects of the orders Diptera and Coleoptera, respectively (Gaertner, F. H. [1989] "Cellular Delivery Systems for Insecticidal Proteins: Living and Non-Living Microorganisms," in Controlled Delivery of Crop Protection Agents, R. M. Wilkins, ed., Taylor and Francis, New York and London, 1990, pp. 245-255). See also Couch, T. L. (1980) "Mosquito Pathogenicity of Bacillus thuringiensis var. israelensis," Developments in Industrial Microbiology 22:61-76; Beegle, C. C., (1978) "Use of Entomogenous Bacteria in Agroecosystems," Developments in Industrial Microbiology 20:97-104. Krieg, A., A. M. Huger, G. A. Langenbruch, W. Schnetter (1983) Z. ang. Ent. 96:500-508, describe Bacillus thuringiensis var. tenebdonis, which is reportedly active against two beetles in the order Coleoptera. These are the Colorado potato beetle, Leptinotarsa decemlineata, and Agelastica alni.
Recently, new subspecies of B.t. have been identified, and genes responsible for encoding active .delta.-endotoxin proteins have been isolated (H ofte, H., H. R. Whiteley [1989] Microbiological Reviews 52(2):242-255). H ofte and Whiteley classified B.t. crystal protein genes into 4 major classes. The classes were CryI (Lepidoptera-specific), CryII (Lepidoptera- and Diptera-specific), CryIII (Coleoptera-specific), and CryIV (Diptera-specific). The discovery of strains specifically toxic to other pests has been reported. (Feitelson, J. S., J. Payne, L. Kim [1992]Bio/Technology 10:271-275).
The cloning and expression of a B.t. crystal protein gene in Escherichia coli has been described in the published literature (Schnepf, H. E., H. R. Whiteley [1981] Proc. Natl. Acad. Sci. U.S.A. 78:2893-2897). U.S. Pat. No. 4,448,885 and U.S. Pat. No. 4,467,036 both disclose the expression of B.t. crystal protein in E. coli. Hybrid B.t. crystal proteins have been constructed that exhibit increased toxicity and display an expanded host range to a target pest. See U.S. Pat. Nos. 5,238,130 and 5,055,294. U.S. Pat. Nos. 4,797,276 and 4,853,331 disclose B. thuringiensis strain tenebrionis (a.k.a. M-7, a.k.a.B.t. san diego) which can be used to control coleopteran pests in various environments. U.S. Pat. No. 4,918,006 discloses B.t. toxins having activity against dipterans. U.S. Pat. No. 4,849,217 discloses B.t. isolates which have activity against the alfalfa weevil. U.S. Pat. No. 5,208,077 discloses coleopteran-active Bacillus thuringiensis isolates. U.S. Pat. No. 5,151,363 and U.S. Pat. No. 4,948,734 disclose certain isolates of B.t. which have activity against nematodes. As a result of extensive research and investment of resources, other patents have issued for new B.t. isolates and new uses of B.t. isolates. However, the discovery of new B.t. isolates and new uses of known B.t. isolates remains an empirical, unpredictable art.
A majority of Bacillus thuringiensis .delta.-endotoxin crystal protein molecules are composed of two functional segments. The protease-resistant core toxin is the first segment and corresponds to about the first haft of the protein molecule. The three-dimensional structure of a core segment of a crylIIA B.t. .delta.-endotoxin is known and it is proposed that all related toxins have that same overall structure (Li, J., J. Carroll, D. J. Ellar [1991] Nature 353:815-821). The second half of the molecule is the second segment. For purposes of this application, this second segment will be referred to herein as the "protoxin segment." The protoxin segment is believed to participate in toxin crystal formation (Arvidson, H., P. E. Dunn, S. Strand, A. I. Aronson [1989] Molecular Microbiology 3:1533-1534; Choma, C. T., W. K. Surewicz, P. R. Carey, M. Pozsgay, T. Raynor, H. Kaplan [1990] Eur. J. Biochem. 189:523-527). The full toxin molecule is rapidly processed to the resistant core segment by protease in the insect gut. The protoxin segment may thus convey a partial insect specificity for the toxin by limiting the accessibility of the core to the insect by reducing the protease processing of the toxin molecule (Haider, M. Z., B. H. Knowles, D. J. Ellar [1986] Eur. J. Biochem. 156:531-540) or by reducing toxin solubility (Aronson, A. I., E. S. Han, W. McGaughey, D. Johnson [1991] Appl. Environ. Microbiol. 57:981-986).
Chimeric proteins joined within the toxin domains have been reported between CrylC and CrylA(b) (Honee, G., D. Convents, J. Van Rie, S. Jansens, M. Perferoen, B. Visser [1991] Mol. Microbiol. 5:2799-2806); however, the activity of these chimeric proteins was either much less, or undetectable, when compared to CrylC on a relevant insect.
Honee et al. (Honee, G., W. Vriezen, B. Visser [1990] Appl. Environ. Microbiol. 56:823-825) also reported making a chimeric fusion protein by linking tandem toxin domains of CrylC and CrylA(b). The resulting protein had an increased spectrum of activity equivalent to the combined activities of the individual toxins; however, the activity of the chimeric was not increased toward any one of the target insects.
BRIEF SUMMARY OF THE INVENTION
The subject invention concerns the discovery that the activity of a Bacillus thuringiensis (B.t.) .delta.-endotoxin can be substantially improved by replacing native protoxin amino acids with an alternate protoxin sequence, yielding a chimeric toxin. In a specific embodiment of the subject invention, a chimeric toxin is assembled by substituting all or part of the crylA(b) protoxin segment for all or part of the native crylC protoxin segment. The crylC/crylA(b) chimeric toxin demonstrates an increased toxicity over the crylC/crylC toxin produced by the native gene.
One aspect of the subject invention pertains to genes which encode the advantageous chimeric toxins. Specifically exemplified is a gene comprising DNA encoding the crylC core N-terminal toxin portion of the chimeric toxin and the crylA(b) C-terminal protoxin portion of the toxin.
The subject invention further pertains to the use of the chimeric toxin, or microbes containing the gene encoding the chimeric toxin, in methods for controlling lepidopteran pests. The subject invention also includes use of the chimeric gene encoding the claimed toxin. The chimeric gene can be introduced into a wide variety of microbial or plant hosts. A transformed host expressing the chimeric gene can be used to produce the lepidopteran-active toxin of the subject invention. Transformed hosts can be used to produce the insecticidal toxin or, in the case of a plant cell transformed to produce the toxin, the plant will become resistant to insect attack.
Still further, the invention includes the treatment of substantially intact recombinant cells producing the chimeric toxin of the invention. The cells are treated to prolong the lepidopteran activity when the substantially intact cells are applied to the environment of a target pest. Such treatment can be by chemical or physical means, or a combination of chemical and physical means, so long as the chosen means do not deleteriously affect the properties of the pesticide, nor diminish the cell's capability of protecting the pesticide. The treated cell acts as a protective coating for the pesticidal toxin. The toxin becomes active upon ingestion by a target insect.





BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1--The BamHI site is removed from pMYC1050 by a fill-in reaction with Klenow polymeruse to give plasmid pMYC1050.DELTA.BamHI. To facilitate cloning, an NsiI DNA fragment that contains most of the toxin open reading frame is cloned into pGEM5. The resulting plasmid is called pGEMtox. C=ClaI, H=HindlII.
FIG. 2--BamHI or PvuI cloning sites were introduced into toxin DNA by the technique of Splice Overlap Extension (SOE). DNA fragments with the new sites are used to replace homologous DNA fragments in pGEMtox. The resulting plasmids are pGEMtox BamHI or pGEMtox PvuI. The letters A through G below the arrows correspond to oligonucleotide primers in the text. Letters above vertical lines correspond to restriction enzyme sites. B=BamHI, C=ClaI, H=HindlII, P=PvuI, S=SacI.
FIG. 3--The DNA fragment containing the BamHI mutation is used to replace the homologous fragment in pGEMtox PvuI. The resulting plasmid which contains both cloning sites is pGEMtox BamHI/PvuI. To construct an expression plasmid, the toxin-containing NsiI fragment is excised for cloning into the pTJS260 broad host-range vector. B=BamHI, C=ClaI, H=HindlII, P=PvuI.
FIG. 4--The NsiI toxin-containing fragment with the new restriction sites is ligated to the vector-containing DNA from pMYC1050.DELTA.BamHI to give pMYC2244. A BamHI-PvuI PCR-derived DNA fragment containing the crylC toxin is exchanged for the equivalent fragment in pMYC2244. The resulting chimera is called pMYC2238. B=BamHI, C=ClaI, H=HindlII, N=NsiI, P=PvuI.
FIG. 5--A restriction map of a plasmid carrying a chimeric gene of the subject invention.
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO. 1 is oligonucleotide primer "A"
SEQ ID NO. 2 is oligonucleotide primer "B"
SEQ ID NO. 3 is oligonucleotide primer "C"
SEQ ID NO. 4 is oligonucleotide primer "D"
SEQ ID NO. 5 is oligonucleotide primer "E"
SEQ ID NO. 6 is oligonucleotide primer "F"
SEQ ID NO. 7 is oligonucleotide primer "G"
SEQ ID NO. 8 is oligonucleotide primer "L"
SEQ ID NO. 9 is oligonucleotide primer "N"
SEQ ID NO. 10 is oligonucleotide primer "O"
SEQ ID NO. 11 shows an amino acid sequence for a chimeric toxin of the subject invention.
SEQ ID NO. 12 shows an alternate amino acid sequence for a chimeric toxin of the subject invention.
SEQ ID NO. 13 is a characteristic sequence of cryI toxins. This sequence ends at residue 616 of SEQ ID NO. 11.





DETAILED DISCLOSURE OF THE INVENTION
The subject invention concerns the discovery of highly active chimeric Bacillus thuringiensis toxins. These chimeric toxins are created by replacing all or part of the native protoxin segment of a full length B.t. toxin with an alternate protoxin segment. In a preferred embodiment, the chimeric toxin comprises a crylA(b) C-terminal protoxin portion and a crylC core N-terminal toxin portion. As used herein, reference to a "core" toxin portion refers to the portion of the full length B.t. toxin, other than the protoxin, which is responsible for the pesticidal activity of the toxin.
Bacillus thuringiensis strains and other bacteria harboring plasmids useful according to the subject invention are the following:
______________________________________Culture Repository No. U.S. Pat. No.______________________________________Bacillus thuringiensis NRRL B-18484 5,273,746strain PS81IEscherichia coli NRRL B-18500 5,126,133NM522 (pMYC 394)Pseudomonas fluorescens NRRL B-18332 5,055,294(pM3, 130-7)Pseudomonas fluorescens MR436 NRRL B-18292 5,128,130(pM2, 16-11, aka pMYC436)______________________________________
It should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
The flow charts of FIGS. 1-4 provide a general overview of vector construction that can be carried out according to the subject invention. BamHI and PvuI cloning sites were introduced into a crylA(c)/crylA(b) chimeric toxin gene by mutagenesis using the PCR technique of Splice Overlap Extension (SOE) (Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, L. R. Pease [1989]Gene 77:61-68) to give plasmid pMYC2224. A region of the crylC gene from a crylC-containing plasmid such as pMYC394 can be generated by PCR and substituted for the BamHI-PvuI crylA(c)/crylA(b) gene fragment of pMYC2224. A plasmid created in this manner, pMYC2238, consisted of a short segment of crylA(c) followed by crylC to the toxin/protoxin segment junction. The protoxin segment was crylA(b) from pMYC1050. Fragments of plasmid pMYC2238, plasmid pMYCl197, and a crylC portion of plasmid pMYC394 were ligated to construct a chimeric gene encoding the toxin of the subject invention. The chimeric gene encodes the claimed toxin comprising a crylC core N-terminal toxin portion and a crylA(b) C-terminal protoxin portion which has increased lepidopteran activity compared to a native crylC toxin.
The chimeric toxins of the subject invention comprise a full core N-terminal toxin portion of a B.t. toxin and, at some point past the end of the toxin portion, the protein has a transition to a heterologous protoxin sequence. The transition to the heterologous protoxin segment can occur at approximately the toxin/protoxin junction or, in the alternative, a portion of the native protoxin (extending past the toxin portion) can be retained with the transition to the heterologous protoxin occurring downstream. As an example, one chimeric toxin of the subject invention has the full toxin portion of crylC (amino acids 1-616), a portion of the native crylC protoxin (amino acids 617 to 655), and a heterologous portion of the protoxin (amino acids 656 to the C-terminus). In a preferred embodiment, the heterologous portion of the protoxin is derived from a cryIA(b) toxin.
A person skilled in this art will appreciate that B.t. toxins, even within a certain class such as cryIC, will vary to some extent in length and the precise location of the transition from toxin portion to protoxin portion. Typically, the cryIA(b) and cryIC toxins will be about 1150 to about 1200 amino acids in length. The transition from toxin portion to protoxin portion will typically occur at between about 50% to about 60% of the full length toxin. The chimeric toxin of the subject invention will include the full expanse of this core N-terminal toxin portion. Thus, the chimeric toxin will comprise at least about 50% of the full length B.t. toxin. This will typically be at least about 600 amino acids. With regard to the protoxin portion, the full expanse of the cryIA(b) protoxin portion extends from the end of the toxin portion to the C-terminus of the molecule. It is the last about 100 to 150 amino acids of this portion which are most critical to include in the chimeric toxin of the subject invention. In a chimeric toxin specifically exemplified herein, at least amino acids 1085 to the C-terminus of the cryIA(b) molecule are utilized. Thus, it is at least the last approximately 5 to 10% of the overall B.t. protein which should comprise heterologous DNA (compared to the cryIF core N-terminal toxin portion) included in the chimeric toxin of the subject invention. Thus, a preferred embodiment of the subject invention is a chimeric B.t. toxin of about 1150 to about 1200 amino acids in length, wherein the chimeric toxin comprises a crylC core N-terminal toxin portion of at least about 50 to 60% of a full cryIC molecule, but no more than about 90 to 95% of the full molecule. The chimeric toxin further comprises a crylA(b) protoxin C-terminal portion which comprises at least about 5 to 10% of the cryIA(b) molecule. The transition from cryIC to cryIA(b) sequence thus occurs within the protoxin segment (or at the junction of the toxin and protoxin segments) between about 50% and about 95% of the way through the molecule. In the specific example provided herein, the transition from the cryIC sequence to the cryIA(b) sequence occurs prior to amino acid 1085 of the chimeric toxin.
A specific embodiment of the subject invention is the chimeric toxin of SEQ ID NO. 11. Other constructs may be made and used by those skilled in this art having the benefit of the teachings provided herein. The core toxin segment of cryI proteins characteristically ends with the sequence: Val/Leu Tyr/Ile Ile Asp Arg/Lys Ile/Phe Glu Ile/Phe Ile/Leu/Val Pro/Leu Ala/Val Glu/Thr/Asp (SEQ ID NO. 13), which ends at residue 616 of SEQ ID NO. 11. Additionally, the protoxin segments of the cryI toxins (following residue 616 of SEQ ID NO. 11) bear more sequence similarity than the toxin segments. Because of this sequence similarity, the transition point in the protoxin segment for making a chimeric protein between the crylC sequence and the cryIA(b) sequence can be readily determined by one skilled in the art. From studies of data regarding the partial proteolysis of CryI genes, the heterogeneity and least-conserved amino acid regions are found after the conserved cryI protoxin sequence, positions 1077-1084 of SEQ ID NO. 12 (or 1050-1057 of SEQ ID NO. 11).
Therefore a chimeric toxin of the subject invention can comprise the full cryIC toxin and a portion of the cryIC protoxin, transitioning to the corresponding cryIA(b) sequence at any position between the end of the toxin segment (as defined above) and about position 1084. Preferably, the amino acids which correspond to positions 1085 through 1190 (SEQ ID NO. 12; 1058-1163 of SEQ ID NO. 11) comprise a cryIA(b) sequence or equivalent thereof.
CryIC toxins, and genes which encode these toxins, are well known in the art. CryIC genes and toxins have been described in, for example, U.S. Pat. No. 5,188,960 (gene designated 81IB2); Honee et al. (1988) Nucleic Acids Res. 16:6240; and Sanchis et al. (1988) Mol. Microbiol. 2:393. Also, various cryIA(b) toxins are well known in the art. CryIA(b) genes and toxins have been described in, for example, H ofte et al. (1986) Eur. J. Blochem. 161:273; Geiser et al. (1986) Gene 48:109; and Haider et al. (1988) Nucleic Acids Res. 16:10927. The skilled artisan having the benefit of the teachings contained herein could readily identify and use DNA which encodes the toxin N-terminal portion of a cryIC molecule and the C-terminal protoxin portion of the cryIA(b) toxins.
Positions where amino acid substitutions can be used in the toxins of the subject invention are shown in SEQ ID NO. 12. It is also well known in the art that various mutations can be made in a toxin sequence without changing the activity of a toxin. Furthermore, due to the degeneracy of the genetic code, a variety of DNA sequences can be used to encode a particular toxin. These alternative DNA and amino acid sequences can be used according to the subject invention by a person skilled in this art.
The protoxin substitution techniques of the subject invention can be used with other classes of B.t. endotoxins to enhance processing of the full-length toxin to obtain the active toxin portion which can have enhanced or expanded activity. The technique would be most applicable to other B.t. toxins which have the characteristic sequence shown in SEQ ID NO. 13.
The subject invention not only includes the novel chimeric toxins and the genes encoding these toxins but also includes uses of these novel toxins and genes. For example, the gene of the subject invention may be used to transform host cells. These host cells expressing the gene and producing the chimeric toxin may be used in insecticidal compositions or, in the case of a transformed plant cell, in conferring insect resistance to the transformed cell itself.
Genes and toxins. The genes and toxins useful according to the subject invention include not only the full length sequences disclosed but also fragments of these sequences, variants, and mutants which retain the characteristic pesticidal activity of the toxin specifically exemplified herein. As used herein, the terms "variants" or "variations" of genes refer to nucleotide sequences which encode the same toxins or which encode equivalent toxins having pesticidal activity. As used herein, the term "equivalent toxins" refers to toxins having the same or essentially the same biological activity against the target pests as the claimed toxins.
It should be apparent to a person skilled in this art that genes encoding active toxins can be identified and obtained through several means. The crylC and crylA(b) specific genes (or portions thereof which encode toxin or protoxin domains) useful according to the subject invention may be obtained from the recombinant isolates deposited at a culture depository as described above. These genes, or portions or variants thereof, may also be constructed synthetically, for example, by use of a gene synthesizer. Variations of genes may be readily constructed using standard techniques for making point mutations. Also, fragments of these genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as Bal31 can be used to systematically cut off nucleotides from the ends of these genes. Alternatively, site-directed mutagenesis can be used. Also, genes which encode active fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these toxins.
Fragments and equivalents which retain the pesticidal activity of the exemplified toxin would be within the scope of the subject invention. Also, as bote above, because of the redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequence disclosed herein. It is well within the skill of a person trained in the art to create these alternative DNA sequences encoding the same, or essentially the same, toxin. These variant DNA sequences are within the scope of the subject invention. As used herein, reference to "essentially the same" sequence refers to sequences which have amino acid substitutions, deletions, additions, or insertions which do not materially affect pesticidal activity. Fragments retaining pesticidal activity are also included in this definition.
A further method for identifying additional toxins and genes useful according to the subject invention is through the use of oligonucleotide probes. These probes are detectable nucleotide sequences. These sequences may be detectable by virtue of an appropriate label or may be made inherently fluorescent as described in International Application No. WO93/16094. As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong bond between the two molecules, it can be reasonably assumed that the probe and sample have substantial homology. Preferably, hybridization is conducted under stringent conditions by techniques well-known in the art, as described, for example, in Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton Press, New York, N.Y., pp. 169-170. Detection of the probe provides a means for determining in a known manner whether hybridization has occurred. Such a probe analysis provides a rapid method for identifying toxin-encoding genes useful according to the subject invention. Preferably, such genes would be crylC genes whose core toxin-encoding N-terminal portions can be used with a crylA(b) protoxin-encoding C-terminal portion to create a chimeric gene according to the subject invention. The nucleotide segments which are used as probes according to the invention can be synthesized using DNA synthesizer and standard procedures. These nucleotide sequences can also be used as PCR primers to amplify genes of the subject invention.
Certain chimeric toxins of the subject invention have been specifically exemplified herein. It should be readily apparent that the subject invention comprises variant or equivalent toxins (and nucleotide sequences encoding equivalent toxins) having the same or similar pesticidal activity of the exemplified toxin. Equivalent toxins will have amino acid homology with the exemplified toxin. This amino acid homology will typically be greater than 75%, preferably be greater than 90%, and most preferably be greater than 95%. The amino acid homology will be highest in critical regions of the toxin which account for biological activity or are involved in the determination of three-dimensional configuration which ultimately is responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions which are not critical to activity or are conservative amino acid substitutions which do not affect the three-dimensional configuration of the molecule. For example, amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same class fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound. Table 1 provides a listing of examples of amino acids belonging to each class.
TABLE 1______________________________________Class of Amino Acid Examples of Amino Acids______________________________________Nonpolar Ala, Val, Leu, Ile, Pro, Met, Phe, TrpUncharged Polar Gly, Ser, Thr, Cys, Tyr, Asn, GlnAcidic Asp, GluBasic Lys, Arg, His______________________________________
In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not significantly detract from the biological activity of the toxin.
Recombinant Hosts. A gene encoding the chimeric toxins of the subject invention can be introduced into a wide variety of microbial or plant hosts. Expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of the pesticidal chimeric toxin. With suitable microbial hosts, e.g., Pseudomonas, the microbes can be applied to the situs of the pest, where they will proliferate and be ingested. The result is control of the pest. Alternatively, the microbe hosting the toxin gene can be treated under conditions that prolong the activity of the toxin and stabilize the cell. The treated cell, which retains the toxic activity, then can be applied to the environment of the target pest.
Where the gene encoding the chimeric toxin is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.
A large number of microorganisms are known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacteriurn, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, and Azotobacter vinlandii; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffiuens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms.
A wide variety of ways are available for introducing a gene encoding a chimeric toxin into a microorganism host under conditions which allow for the stable maintenance and expression of the gene. These methods are well known to those skilled in the art and are described, for example, in U.S. Pat. No. 5,135,867, which is incorporated herein by reference.
Treatment of cells. As mentioned above, recombinant cells producing the chimeric toxin of the subject invention can be treated to prolong the toxic activity and stabilize the cell. The pesticide microcapsule that is formed comprises the B.t. toxin within a cellular structure that has been stabilized and will protect the toxin when the microcapsule is applied to the environment of the target pest. Suitable host cells may include either prokaryotes or eukaryotes, normally being limited to those cells which do not produce substances toxic to higher organisms, such as mammals. However, organisms which produce substances toxic to higher organisms could be used, where the toxic substances are unstable or the level of application sufficiently low as to avoid any possibility of toxicity to a mammalian host. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi.
The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form, although in some instances spores may be employed.
Treatment of the microbial cell, e.g., a microbe containing the gene encoding a chimeric toxin of the subject invention, can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously affect the properties of the toxin, nor diminish the cellular capability of protecting the toxin. Examples of chemical reagents are halogenating agents, particularly halogens of atomic no. 17-80. More particularly, iodine can be used under mild conditions and for sufficient time to achieve the desired results. Other suitable techniques include treatment with aldehydes, such as glutaraldehyde; anti-infectives, such as zephiran chloride and cetylpyridinium chloride; alcohols, such as isopropyl and ethanol; various histologic fixatives, such as Lugol iodine, Bouin's fixative, various acids and Hetty's fixative (See: Humason, Gretchen L., Animal Tissue Techniques, W. H. Freeman and Company, 1967); or a combination of physical (heat) and chemical agents that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host environment. Examples of physical means are short wavelength radiation such as gamma-radiation and X-radiation, freezing, UV irradiation, lyophilization, and the like. Methods for treatment of microbial cells are disclosed in U.S. Pat. Nos. 4,695,455 and 4,695,462, which are incorporated herein by reference.
The cells generally will have enhanced structural stability which will enhance resistance to environmental conditions. Since the pesticide is in a proform, the method of cell treatment should be selected so as not to inhibit processing of the proform to the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will crosslink proteins and could inhibit processing of the proform of a polypeptide pesticide. The method of treatment should retain at least a substantial portion of the bio-availability or bioactivity of the toxin.
Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the gene into the host, availability of expression systems, efficiency of expression, stability of the pesticide in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a pesticide microcapsule include protective qualities for the pesticide, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; survival in aqueous environments; lack of mammalian toxicity; attractiveness to pests for ingestion; ease of killing and fixing without damage to the toxin; and the like. Other considerations include ease of formulation and handling, economics, storage stability, and the like.
Growth of cells. The cellular host containing the gene encoding a chimeric toxin of the subject invention may be grown in any convenient nutrient medium, where the DNA construct provides a selective advantage, providing for a selective medium so that substantially all or all of the cells retain the recombinant gene. These cells may then be harvested in accordance with conventional methods. Alternatively, the cells can be treated prior to harvesting.
Formulations. Recombinant microbes comprising the gene encoding the chimeric toxin disclosed herein, can be formulated into bait granules and applied to the soil. Formulated product can also be applied as a seed-coating or root treatment or total plant treatment at later stages of the crop cycle. Plant and soil treatments may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be aqueous-based or non-aqueous and employed as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers.
As would be appreciated by a person skilled in the art, the pesticidal concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The pesticide will be present in at least 1% by weight and may be 100% by weight. The dry formulations will have from about 1-95% by weight of the pesticide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 10.sup.2 to about 10.sup.4 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare.
The formulations can be applied to the environment of the pest, e.g., soil and foliage, by spraying, dusting, sprinkling, or the like.
Materials and Methods
NACS (Bethesda Research Labs, Gaithersburg, Md.) column chromatography was used for purification of electroeluted DNA. Purification was performed according to manufacturer's instructions with the exception that binding buffers were modified to 0.5X TBE/0.2M NaCl and elution buffers were modified to 0.5X TBE/2.0M NaCl.
Random primer labeling of DNA with .sup.32 P was done with a kit (Boehringer-Mannhelm Biochemicals, Indianapolis, Ind.) according to manufacturer's instructions.
Gel purification refers to the sequential application of agarose-TBE gel electrophoresis, electroelution, and NACS column chromatography for the purification of selected DNA fragments, these methods are well known in the art.
Polymerase chain reaction (PCR) amplification of DNA was done for 25 cycles on a Perkin Elmer (Norwalk, Conn.) thermal cycler with the following cycle parameters: 94.degree. C. for 1 minute, 37.degree. C. for 2 minutes, 72.degree. C. for 3 minutes (each 72.degree. C. cycle has a 5 second extension time). PCR products were treated with proteinase K to improve cloning efficiency (Crowe, J. S., Cooper, H. J., Smith, M. A., Sims, M. J., Parker, D., Gewert, D. [1991] Nucl. Acids Res. 19:184).
Oligodeoxyribonucleotides (oligonucleotides) were synthesized on an Applied Biosystems (Foster City, Calif.) model 381A DNA synthesizer. Purification was done, when necessary, on Nensorb columns (New England Nuclear-Dupont, Wilmington, Del.), according to the manufacturer's instructions.
Following are examples which illustrate procedures, including the best mode, for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example 1--Expression Vector Modification by Splice Overlap Extension
A cloning vector can be constructed based upon pMYC1050, a broad host-range plasmid derived from RSF1010 (pTJS260 can be obtained from Dr. Donald Helinski, U.C. San Diego). An example of the system used in the vector construction may be found in EPO patent application 0 471 564. Plasmid DNA of pMYC1050 initially contained the chimeric toxin gene crylA(c)/crylA(b). The toxin encoded by this gene is described in U.S. Pat. No. 5,055,294. pMYC1050 was constructed by re-cloning the toxin gene and promoter of pM3,130-7 (disclosed in U.S. Pat. No. 5,055,294) into a pTJS260-based-vector such as pMYC467 (disclosed in U.S. Pat. No. 5,169,760) by methods well known in the art. In particular, the pM3,130-7 promoter and toxin gene can be obtained as a BamHI to NdeI fragment and placed into the pMYC467 plasmid, replacing a fragment bounded by the same sites (BamHI near base 12100 and NdeI near base 8000).
The improved vector ideally contains a unique BamHI cloning site. The plasmid BamHI site, located upstream from the tac promoter (ptac), can be removed by blunting with Klenow and re-ligating (FIG. 1). Absence of the site was confirmed by restriction digestion. A plasmid produced according to this procedure was called pMYC1050.DELTA.BamHI. The construct can now have of a BamHI site added to the plasmid by SOE mutagenesis. SOE mutagenesis can be facilitated by subcloning an NsiI toxin-containing DNA fragment from the plasmid into the smaller pGEM5 (Promega Corp., Madison, Wis.) vector which uses the bla gene as a selectable marker (FIG. 1). The fragment can be oriented by restriction digestion. A plasmid produced according to this procedure was called pGEMtox.
DNA in the toxin-encoding region was mutated by the PCR-mediated technique of SOE to introduce restriction enzyme cloning sites as shown in FIG. 2. Oligonucleotides used as primers are shown below: ##STR1##
Plasmid pMYC1050 DNA was used as the template for PCR amplification using primer sets A/B, C/D, E/D, and F/G. Amplified DNA fragments were named AB, CD, ED, and FG. Amplified DNAs were purified by agarose-TBE gel electrophoresis, electroelution, and NACS column chromatography. Purified template DNAs were used in a second set of PCR reactions. Fragments AB and CD were mixed and amplified with primers A and D. In a separate reaction, fragments ED and FG were mixed and amplified with primers E and G. Amplified DNA was resolved by agarose-TBE gel electrophoresis and the fragments with the corresponding increase in size were excised, electroeluted, and purified. Amplified DNA fragments are called AD or EG for reference.
DNA fragments AD or EG with the new restriction enzyme sites were incorporated into the toxin-containing DNA by several subcloning experiments (FIGS. 2 and 3). pGEMtox was digested with ClaI or HindlII. Vector toxin-containing DNA was gel-purified. Fragment AD was digested with ClaI and ligated to ClaI-digested pGEMtox vector DNA. Fragment EG was digested with HindlII and ligated to HindlII-digested pGEMtox vector DNA. E. coli strain NM522 was transformed with ligation mixes. Correctly assembled constructs were identified by restriction enzyme digestion of plasmid DNA from isolated colonies. The plasmid with the new BamHI site was called pGEMtox BamHI. The plasmid with the new PvuI site was called pGEMtox PvuI. The ClaI fragment containing the BamHI site from plasmid pGEMtox BamHI was ligated to the phosphatased ClaI vector-containing fragment from pGEMtox PvuI. E. coli strain NM522 was transformed with ligation mixes. Correctly assembled constructs were identified by PCR analysis with primer set C/D, and by restriction digestion. The plasmid with both new restriction enzyme sites was called pGEMtox BamHI/PvuI.
A completed expression vector was assembled with the insert from pGEMtox BamHI/PvuI and the vector from pMYC1050ABamHI (FIGS. 3 and 4). Gel-purified insert was prepared from pGEMtox BamHI/PvuI by NsiI digestion, and ScaI digestion (to remove contaminating vector). It was ligated to gel-purified NsiI-digested vector-containing pMYC1050.DELTA.BamHI DNA. E. coli strain NM522 was transformed with the ligation mixes, and transformation mixes were plated on LB agar containing tetracycline at 12 .mu.g/ml. Colonies containing the NsiI insert were identified by colony hybridization and autoradiography. Inserts were oriented by PCR, using primer set A/D, which bridges a NsiI cloning site, and agarose-TBE gel electrophoresis. The correctly assembled plasmid is called pMYC2224. A lactose-inducible P. fluorescens strain was electroporated with correctly assembled plasmid DNA. Transformation mixes were plated on LB agar containing tetracycline at 20 .mu.g/ml. Plasmid DNA was prepared from P. fluorescens for use in subsequent cloning experiments.
Example 2--Subcloning the crylC Hypervariable Region into pMYC2224
A DNA fragment containing the hypervariable region of the crylC gene is obtained by PCR using primers C and D (SEQ ID NOS. 3 and 4, respectively, from Bacillus thuringiensis DNA (e.g., PS81I) or a plasmid with cloned DNA (e.g., pMYC394) containing crylC. The resulting PCR fragment was digested with restriction enzymes BamHI and PvuI and purified following agarose gel electrophoresis. Since the tetAR gene contains multiple PvuI sites, it was necessary to isolate the vector-containing DNA on two separate fragments. To obtain the first fragment, pMYC2224 was digested with BamHI.times.BstEII, and the large DNA fragment containing the promoter-tetAR locus-rep functions was gel-purified. To obtain the second fragment, pMYC2224 was digested with BstEII.times.PvuI, and the DNA fragment containing the vector-protoxin module was gel-purified. A three-piece ligation was set up and used for E. coli strain NM522 transformation. Plasmids were recovered following transformation of E. coli containing the correct inserts, as judged by restriction enzyme digestion.
The correct plasmid is named pMYC 2238. The plasmid consists of crylA(c) at the amino-terminus, crylC up to the toxin/protoxin junction, and crylA(b) through the protoxin segment.
Example 3 --Construction of a Native crylC and a Chimeric cryIC/crylA(b) Protoxin Expression Plasmids
An expression plasmid containing the crylC gene can be constructed using a three-fragment ligation as follows: (1) digestion of pMYC394 (from NRRL B-18500) with HindlII with subsequent purification of a 26 4600 bp fragment containing the crylC gene; (2) digestion of pTJS260, from which the SacI (bp 214) to NotI (bp 1674) had been deleted (described in EP 0 471 564 A2) with EcoRI and HindlII with subsequent purification of the .apprxeq.6300 bp fragment containing the plasmid replication origin; (3) digestion of pMYCl197 (described in EP 0 471 564 A2) with EcoRI and SpeI followed by purification of an .apprxeq.4200 bp fragment containing the tetracycline resistance genes and ptac promoter. The three fragments are ligated together and transformed into a lactose-inducible P. fluorescens using electroporation. The resulting tetracycline-resistant colonies are screened for plasmids having the correct structure.
An expression plasmid containing the crylC/crylA(b) chimeric gene can be constructed by digesting pMYC2238 with BgllI and BstEII and purifying the .apprxeq.3200 bp fragment. A second fragment can be produced by digesting the crylC expression plasmid above with the same enzymes and subsequent purification of an .apprxeq.12000 bp fragment. The fragments are ligated together and transformed into a lactose-inducible P. fluorescens using electroporation. The resulting tetracycline-resistant colonies are screened for plasmids having the structure indicated in FIG. 5 by restriction enzyme digestion and agarose gel analysis.
U.S. Pat. No. 5,169,760 discloses means for making P. fluorescens capable of regulating .beta.-galactoside-inducible promoters. This patent and EP 0 471 564 A2 describe conditions for expression of these genes in P. fluorescens.
Example 4--Activity of the Chimeric Toxin Against Spodoptera exigua
Serial dilutions of recombinant Pseudomonas fluorescens stabilized by the methods disclosed in U.S. Pat. Nos. 4,695,455 and 4,695,462 were mixed with modified USDA soy flour insect diet (Technical Bulletin 1528, U.S. Department of Agriculture). This mixture was poured into plastic trays with compartmentalized 3-ml wells (Nutrend Container Corporation, Jacksonville, Fla.). Water served as a control as well as the vehicle to introduce the toxin protein into the diet. Second-instar Spodoptera exigua larvae were placed singly onto the diet mixture. Wells were then sealed with MYLAR sheeting (ClearLam Packaging, Ill.) using a tacking iron, and several pinholes were made in each well to provide gas exchange. Larvae were held with continuous light at 25.degree. C. or 29.degree. C. and mortality was recorded after six or four days, respectively. LC.sub.50 s were determined by standard log-probit analysis (POLO-PC, LeOra Software, 1987). CrylC and the crylC/crylA(b) chimeric were tested simultaneously and representative results are as follows:
TABLE 2______________________________________Toxin Designation LC50 (.mu.g toxin/ml diet)______________________________________cryIC 139cryIC/cryIA(b) 28______________________________________
Example 5--Insertion of the Gene Encoding the Chimeric Toxin Into Plants
One aspect of the subject invention is the transformation of plants with genes encoding the insecticidal toxin. The transformed plants are resistant to attack by the target pest.
The gene encoding the chimeric toxin, as disclosed herein, can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that permits selection of the transformed cells are available for preparation for the insertion of foreign genes into higher plants. The vectors comprise, for example, pBR322, pUC series, M13mp series, pACYC184, etc. Accordingly, the sequence encoding the B.t. toxin can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli. The E. coli cells are cultivated in a suitable nutrient medium, then harvested and lysed. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biological methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be cleaved and joined to the next DNA sequence. Each plasmid sequence can be cloned in the same or other plasmids. Depending on the method of inserting desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right border, but often the right and the left border of the Ti or Ri plasmid T-DNA, has to be joined as the flanking region of the genes to be inserted.
The use of T-DNA for the transformation of plant cells has been intensively researched and sufficiently described in EP 0 120 516; Hoekema (1985) In: The Binary Plant Vector System, Offset-durkkerij Kanters B. V., Alblasserdam, Chapter 5; Fraley et al., Crit. Rev. Plant Sci. 4:1-46; and An et al. (1985) EMBO J. 4:277-287.
Once the inserted DNA has been integrated in the genome, it is relatively stable there and, as a rule, does not come out again. It normally contains a selection marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G 418, bleomycin, hygromycin, or chloramphenicol, inter alia. The individually employed marker should accordingly permit the selection of transformed cells rather than cells that do not contain the inserted DNA.
A large number of techniques are available for inserting DNA into a plant host cell. Those techniques include transformation with T-DNA using Agrobacteriurn tumefaciens or Agrobacterium rhizogenes as transformation agent, fusion, injection, or electroporation as well as other possible methods. If agrobacteria are used for the transformation, the DNA to be inserted has to be cloned into special plasmids, namely either into an intermediate vector or into a binary vector. The intermediate vectors can be integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate themselves in agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors can replicate themselves both in E. coli and in agrobacteria. They comprise a selection marker gene and a linker or polylinker which are framed by the right and left T-DNA border regions. They can be transformed directly into agrobacteria (Holsters et al. [1978] Mol. Gen. Genet. 163:181-187). The agrobacterium used as host cell is to comprise a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be contained. The bacterium so transformed is used for the transformation of plant cells. Plant explants can advantageously be cultivated with Agrobactedum tumefaciens or Agrobactedum rhizogenes for the transfer of the DNA into the plant cell. Whole plants can then be regenerated from the infected plant material (for example, pieces of leaf, segments of stalk, roots, but also protoplasts or suspension-cultivated cells) in a suitable medium, which may contain antibiotics or biocides for selection. The plants so obtained can then be tested for the presence of the inserted DNA. No special demands are made of the plasmids in the case of injection and electroporation. It is possible to use ordinary plasmids, such as, for example, pUC derivatives.
The transformed cells grow inside the plants in the usual manner. They can form germ cells and transmit the transformed traits to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties.
In a preferred embodiment of the subject invention, plants will be transformed with genes wherein the codon usage has been optimized for plants. Also, advantageously, plants encoding a truncated toxin will be used. The truncated toxin typically will encode about 55% to about 80% of the full length toxin. Methods for creating synthetic genes for use in plants are known in the art.
Example 6--Cloning of the Gene Encoding the Chimeric Toxin Into Insect Viruses
A number of viruses are known to infect insects. These viruses include, for example, baculoviruses and entomopoxviruses. In one embodiment of the subject invention, genes encoding the insecticidal toxins, as described herein, can be placed within the genome of the insect virus, thus enhancing the pathogenicity of the virus. Methods for constructing insect viruses which comprise the chimeric toxin gene are well known and readily practiced by those skilled in the art. These procedures are described, for example, in Merryweather et al. (Merryweather, A. T., U. Weyer, M. P. G. Harris, M. Hirst, T. Booth, R. D. Possee (1990) J. Gen. Virol. 71:1535-1544) and Martens et al. (Martens, J. W. M., G. Honee, D. Zuidema, J. W. M. van Lent, B. Visser, J. M. Vlak (1990) Appl. Environmental Microbiol. 56(9):2764-2770).
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 13(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 39 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCATACTAGTAGGAGATTTCCATGGATAACAATCCGAAC39(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:GGATCCGCTTCCCAGTCT18(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:AGAGAGTGGGAAGCGGATCCTACTAATCC29(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:TGGATACTCGATCGATATGATAATCCGT28(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:TAATAAGAGCTCCTATGT18(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:TATCATATCGATCGAGTATCCAATTTAG28(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GTCACATAGCCAGCTGGT18(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:GAGTGGGAAGCAGATCTTAATAATGCACAATTAAGG36(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:TTAATCATCGGCTCGTA17(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (synthetic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:ACTCGATCGATATGATARTCCGT23(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1163 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:MetGluGluAsnAsnGlnAsnGlnCysIleProTyrAsnCysLeuSer151015AsnProGluGluValLeuLeuAspGlyGluArgIleSerThrGlyAsn202530SerSerIleAspIleSerLeuSerLeuValGlnPheLeuValSerAsn354045PheValProGlyGlyGlyPheLeuValGlyLeuIleAspPheValTrp505560GlyIleValGlyProSerGlnTrpAspAlaPheLeuValGlnIleGlu65707580GlnLeuIleAsnGluArgIleAlaGluPheAlaArgAsnAlaAlaIle859095AlaAsnLeuGluGlyLeuGlyAsnAsnPheAsnIleTyrValGluAla100105110PheLysGluTrpGluGluAspProAsnAsnProAlaThrArgThrArg115120125ValIleAspArgPheArgIleLeuAspGlyLeuLeuGluArgAspIle130135140ProSerPheArgIleSerGlyPheGluValProLeuLeuSerValTyr145150155160AlaGlnAlaAlaAsnLeuHisLeuAlaIleLeuArgAspSerValIle165170175PheGlyGluArgTrpGlyLeuThrThrIleAsnValAsnGluAsnTyr180185190AsnArgLeuIleArgHisIleAspGluTyrAlaAspHisCysAlaAsn195200205ThrTyrAsnArgGlyLeuAsnAsnLeuProLysSerThrTyrGlnAsp210215220TrpIleThrTyrAsnArgLeuArgArgAspLeuThrLeuThrValLeu225230235240AspIleAlaAlaPhePheProAsnTyrAspAsnArgArgTyrProIle245250255GlnProValGlyGlnLeuThrArgGluValTyrThrAspProLeuIle260265270AsnPheAsnProGlnLeuGlnSerValAlaGlnLeuProThrPheAsn275280285ValMetGluSerSerAlaIleArgAsnProHisLeuPheAspIleLeu290295300AsnAsnLeuThrIlePheThrAspTrpPheSerValGlyArgAsnPhe305310315320TyrTrpGlyGlyHisArgValIleSerSerLeuIleGlyGlyGlyAsn325330335IleThrSerProIleTyrGlyArgGluAlaAsnGlnGluProProArg340345350SerPheThrPheAsnGlyProValPheArgThrLeuSerAsnProThr355360365LeuArgLeuLeuGlnGlnProTrpProAlaProProPheAsnLeuArg370375380GlyValGluGlyValGluPheSerThrProThrAsnSerPheThrTyr385390395400ArgGlyArgGlyThrValAspSerLeuThrGluLeuProProGluAsp405410415AsnSerValProProArgGluGlyTyrSerHisArgLeuCysHisAla420425430ThrPheValGlnArgSerGlyThrProPheLeuThrThrGlyValVal435440445PheSerTrpThrHisArgSerAlaThrLeuThrAsnThrIleAspPro450455460GluArgIleAsnGlnIleProLeuValLysGlyPheArgValTrpGly465470475480GlyThrSerValIleThrGlyProGlyPheThrGlyGlyAspIleLeu485490495ArgArgAsnThrPheGlyAspPheValSerLeuGlnValAsnIleAsn500505510SerProIleThrGlnArgTyrArgLeuArgPheArgTyrAlaSerSer515520525ArgAspAlaArgValIleValLeuThrGlyAlaAlaSerThrGlyVal530535540GlyGlyGlnValSerValAsnMetProLeuGlnLysThrMetGluIle545550555560GlyGluAsnLeuThrSerArgThrPheArgTyrThrAspPheSerAsn565570575ProPheSerPheArgAlaAsnProAspIleIleGlyIleSerGluGln580585590ProLeuPheGlyAlaGlySerIleSerSerGlyGluLeuTyrIleAsp595600605LysIleGluIleIleLeuAlaAspAlaThrPheGluAlaGluSerAsp610615620LeuGluArgAlaGlnLysAlaValAsnAlaLeuPheThrSerSerAsn625630635640GlnIleGlyLeuLysThrAspValThrAspTyrHisIleAspArgVal645650655SerAsnLeuValGluCysLeuSerAspGluPheCysLeuAspGluLys660665670LysGluLeuSerGluLysValLysHisAlaLysArgLeuSerAspGlu675680685ArgAsnLeuLeuGlnAspProAsnPheArgGlyIleAsnArgGlnLeu690695700AspArgGlyTrpArgGlySerThrAspIleThrIleGlnGlyGlyAsp705710715720AspValPheLysGluAsnTyrValThrLeuLeuGlyThrPheAspGlu725730735CysTyrProThrTyrLeuTyrGlnLysIleAspGluSerLysLeuLys740745750AlaTyrThrArgTyrGlnLeuArgGlyTyrIleGluAspSerGlnAsp755760765LeuGluIleTyrLeuIleArgTyrAsnAlaLysHisGluThrValAsn770775780ValProGlyThrGlySerLeuTrpProLeuSerAlaProSerProIle785790795800GlyLysCysAlaHisHisSerHisHisPheSerLeuAspIleAspVal805810815GlyCysThrAspLeuAsnGluAspLeuGlyValTrpValIlePheLys820825830IleLysThrGlnAspGlyHisAlaArgLeuGlyAsnLeuGluPheLeu835840845GluGluLysProLeuValGlyGluAlaLeuAlaArgValLysArgAla850855860GluLysLysTrpArgAspLysArgGluLysLeuGluTrpGluThrAsn865870875880IleValTyrLysGluAlaLysGluSerValAspAlaLeuPheValAsn885890895SerGlnTyrAspArgLeuGlnAlaAspThrAsnIleAlaMetIleHis900905910AlaAlaAspLysArgValHisSerIleArgGluAlaTyrLeuProGlu915920925LeuSerValIleProGlyValAsnAlaAlaIlePheGluGluLeuGlu930935940GlyArgIlePheThrAlaPheSerLeuTyrAspAlaArgAsnValIle945950955960LysAsnGlyAspPheAsnAsnGlyLeuSerCysTrpAsnValLysGly965970975HisValAspValGluGluGlnAsnAsnHisArgSerValLeuValVal980985990ProGluTrpGluAlaGluValSerGlnGluValArgValCysProGly99510001005ArgGlyTyrIleLeuArgValThrAlaTyrLysGluGlyTyrGlyGlu101010151020GlyCysValThrIleHisGluIleGluAsnAsnThrAspGluLeuLys1025103010351040PheSerAsnCysValGluGluGluValTyrProAsnAsnThrValThr104510501055CysAsnAspTyrThrAlaThrGlnGluGluTyrGluGlyThrTyrThr106010651070SerArgAsnArgGlyTyrAspGlyAlaTyrGluSerAsnSerSerVal107510801085ProAlaAspTyrAlaSerAlaTyrGluGluLysAlaTyrThrAspGly109010951100ArgArgAspAsnProCysGluSerAsnArgGlyTyrGlyAspTyrThr1105111011151120ProLeuProAlaGlyTyrValThrLysGluLeuGluTyrPheProGlu112511301135ThrAspLysValTrpIleGluIleGlyGluThrGluGlyThrPheIle114011451150ValAspSerValGluLeuLeuLeuMetGluGlu11551160(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1190 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:MetGluGluAsnAsnGlnAsnGlnCysIleProTyrAsnCysLeuSer151015AsnProGluGluValLeuLeuAspGlyGluArgIleSerThrGlyAsn202530SerSerIleAspIleSerLeuSerLeuValGlnPheLeuValSerAsn354045PheValProGlyGlyGlyPheLeuValGlyLeuIleAspPheValTrp505560GlyIleValGlyProSerGlnTrpAspAlaPheLeuValGlnIleGlu65707580GlnLeuIleAsnGluArgIleAlaGluPheAlaArgAsnAlaAlaIle859095AlaAsnLeuGluGlyLeuGlyAsnAsnPheAsnIleTyrValGluAla100105110PheLysGluTrpGluGluAspProXaaAsnProXaaThrArgThrArg115120125ValIleAspArgPheArgIleLeuAspGlyLeuLeuGluArgAspIle130135140ProSerPheArgIleSerGlyPheGluValProLeuLeuSerValTyr145150155160AlaGlnAlaAlaAsnLeuHisLeuAlaIleLeuArgAspSerValIle165170175PheGlyGluArgTrpGlyLeuThrThrIleAsnValAsnGluAsnTyr180185190AsnArgLeuIleArgHisIleAspGluTyrAlaAspHisCysAlaAsn195200205ThrTyrAsnArgGlyLeuAsnAsnLeuProLysSerThrTyrGlnAsp210215220TrpIleThrTyrAsnArgLeuArgArgAspLeuThrLeuThrValLeu225230235240AspIleAlaAlaPhePheProAsnTyrAspAsnArgArgTyrProIle245250255GlnProValGlyGlnLeuThrArgGluValTyrThrAspProLeuIle260265270AsnPheAsnProGlnLeuGlnSerValAlaGlnLeuProThrPheAsn275280285ValMetGluSerSerXaaIleArgAsnProHisLeuPheAspIleLeu290295300AsnAsnLeuThrIlePheThrAspTrpPheSerValGlyArgAsnPhe305310315320TyrTrpGlyGlyHisArgValIleSerSerLeuIleGlyGlyGlyAsn325330335IleThrSerProIleTyrGlyArgGluAlaAsnGlnGluProProArg340345350SerPheThrPheAsnGlyProValPheArgThrLeuSerXaaProThr355360365LeuArgLeuLeuGlnGlnProXaaXaaXaaXaaXaaPheAsnLeuArg370375380GlyXaaGluGlyValGluPheSerThrProThrAsnSerPheThrTyr385390395400ArgGlyArgGlyXaaValAspSerLeuThrGluLeuProProGluAsp405410415AsnSerValProProArgGluGlyTyrSerHisArgLeuCysHisAla420425430ThrPheValGlnArgSerGlyThrProPheLeuThrThrGlyValVal435440445PheSerTrpThrXaaArgSerAlaThrLeuThrAsnThrIleAspPro450455460GluArgIleAsnGlnIleProLeuValLysGlyPheArgValTrpGly465470475480GlyThrSerValIleThrGlyProGlyPheThrGlyGlyAspIleLeu485490495ArgArgAsnThrPheGlyAspPheValSerLeuGlnValAsnIleAsn500505510SerProIleThrGlnArgTyrArgLeuArgPheArgTyrAlaSerSer515520525ArgAspAlaArgValIleValLeuThrGlyAlaAlaSerThrGlyVal530535540GlyGlyGlnValSerValAsnMetProLeuGlnLysThrMetGluIle545550555560GlyGluAsnLeuThrSerArgThrPheArgTyrThrAspPheSerAsn565570575ProPheSerPheArgAlaAsnProAspIleIleGlyIleSerGluGln580585590ProLeuPheGlyAlaGlySerIleSerSerGlyGluLeuTyrIleAsp595600605LysIleGluIleIleLeuAlaAspAlaThrPheGluAlaGluSerAsp610615620LeuGluArgAlaGlnLysAlaValAsnXaaLeuPheThrSerXaaAsn625630635640GlnIleGlyLeuLysThrAspValThrAspTyrHisIleAspGlnVal645650655SerAsnLeuValGluCysLeuSerAspGluPheCysLeuAspGluLys660665670XaaGluLeuSerGluLysValLysHisAlaXaaXaaLeuSerAspGlu675680685ArgAsnLeuLeuGlnAspProAsnPheArgGlyIleAsnArgGlnXaa690695700AspArgGlyTrpArgGlySerThrAspIleThrIleGlnGlyGlyAsp705710715720AspValPheLysGluAsnTyrValThrLeuXaaGlyThrPheAspGlu725730735CysTyrXaaThrTyrLeuTyrGlnLysIleAspGluSerLysLeuLys740745750AlaTyrThrArgTyrXaaLeuArgGlyTyrIleGluAspSerGlnAsp755760765LeuGluIleTyrLeuIleArgTyrAsnAlaLysHisGluThrValAsn770775780ValProGlyThrGlySerLeuTrpXaaLeuSerXaaXaaSerSerIle785790795800GlyXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa805810815XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaLysCysAlaHisHis820825830SerHisHisPheSerLeuAspIleAspValGlyCysXaaAspLeuAsn835840845GluAspLeuGlyValTrpValIlePheLysIleLysThrGlnAspGly850855860HisXaaArgLeuGlyXaaLeuGluPheLeuGluXaaXaaXaaProLeu865870875880ValGlyGluAlaLeuAlaArgValLysArgAlaGluLysLysTrpArg885890895AspLysArgGluLysLeuXaaXaaGluThrAsnIleValTyrLysGlu900905910AlaLysGluSerValAspAlaLeuPheValAsnSerGlnTyrAspXaa915920925LeuGlnAlaAspThrAsnIleAlaMetIleHisXaaAlaAspLysArg930935940ValHisXaaIleXaaGluAlaTyrLeuProGluLeuSerValIlePro945950955960GlyValAsnAlaXaaIlePheGluGluLeuGluGlyArgIlePheThr965970975AlaPheSerLeuTyrAspAlaArgAsnValIleLysAsnGlyAspPhe980985990AsnAsnGlyLeuSerCysTrpAsnValLysGlyHisValAspValGlu99510001005GluGlnAsnAsnXaaArgSerValLeuValValProGluTrpGluAla101010151020GluValSerGlnGluValArgValCysProGlyArgGlyTyrIleLeu1025103010351040ArgValThrAlaTyrLysGluGlyTyrGlyXaaGlyCysValThrIle104510501055HisGluIleGluAsnAsnThrAspGluLeuLysPheSerAsnXaaVal106010651070GluGluGluValTyrProAsnAsnThrValThrCysAsnAspTyrThr107510801085AlaXaaGlnGluGluTyrXaaGlyXaaTyrThrSerXaaAsnArgGly109010951100TyrAspXaaXaaTyrXaaSerAsnXaaSerValProAlaAspTyrAla1105111011151120SerXaaTyrGluGluLysAlaTyrThrAspGlyArgArgAspAsnPro112511301135CysGluSerAsnArgGlyTyrGlyAspTyrThrProLeuProAlaGly114011451150TyrValThrLysXaaLeuGluTyrPheProGluThrAspLysValTrp115511601165IleGluIleGlyGluThrGluGlyThrPheIleValAspSerValGlu117011751180LeuLeuLeuMetGluGlu11851190(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:XaaXaaIleAspXaaXaaGluXaaXaaXaaXaaXaa510__________________________________________________________________________
Claims
  • 1. An isolated DNA molecule comprising a nucleotide sequence encoding a chimeric Bacillus thuringiensis toxin of approximately 1150 to 1200 amino acids, wherein said toxin comprises a crylC core N-terminal toxin portion having a sequence of at least about 600 amino acids and no more than about 1100 amino acids, wherein the amino acid sequence from the end of said core N-terminal sequence to the C-terminus of the chimeric toxin is a crylA(b) C-terminal protoxin portion having a crylA(b) sequence.
  • 2. The isolated DNA molecule, according to claim 1, wherein said core toxin portion comprises the first about 616 amino acids of a crylC toxin and wherein said protoxin portion comprises the amino acids from about 1058 of SEQ ID NO. 11 to the C-terminus of the crylA(b) toxin.
  • 3. The isolated DNA molecule, according to claim 1, which is a toxin having an amino acid sequence as shown in SEQ ID NO. 12.
  • 4. The isolated DNA molecule, according to claim 1, wherein the transition from cryIC sequence to cryIA(b) occurs after the sequence shown in SEQ ID NO. 13 and before a sequence corresponding to positions 1050 to 1057 of SEQ ID NO. 11.
  • 5. A recombinant DNA transfer vector comprising a DNA molecule of claim 1.
  • 6. The isolated DNA molecule, according to claim 2, which encodes a toxin having the amino acid sequence shown in SEQ ID NO. 11.
  • 7. A recombinant host transformed to express a chimeric Bacillus thuringiensis toxin comprising a crylC core N-terminal toxin portion and a crylA(b) C-terminal protoxin portion.
US Referenced Citations (11)
Number Name Date Kind
4448885 Schnepf et al. May 1984
4467036 Schnepf et al. Aug 1984
4797276 Herrnstadt et al. Jan 1989
4849217 Soares et al. Jul 1989
4853331 Herrnstadt et al. Aug 1989
4918006 Ellar et al. Apr 1990
4948734 Edwards et al. Aug 1990
5055294 Gilroy Oct 1991
5128130 Gilroy et al. Jul 1992
5151363 Payne Sep 1992
5208077 Proctor et al. May 1993
Foreign Referenced Citations (1)
Number Date Country
9506730 Mar 1995 WOX
Non-Patent Literature Citations (18)
Entry
Nakamura,. et al. (1990) "Construction of Chimeric Insecticidal Proteins between the 130-kDa and 135-kDa Proteins of Bacillus thuringiensis subsp. aizawai for Analysis of Structure-Function Relationship" Agric. Biol. Chem. 54(3):715-724.
Raymond, K. C. et al. (1990) "Larvicidal activity of chimeric Bacillus thuringiensis protoxins" Molecular Microbiology 4(11);1967-1973.
Stiekema, W. et al. (1990) "Recombinant Baccillus thuringiensis Crystal Protein Genes and their Entomocidal Host Range" Journal of Cellular Biochemistry, UCLA Symposia on Molecular & Cellular Biology, Mar. 31-Apr. 22, 1990, p. 341, abstract no. R436.
Gaertner, F. H., L. Kim (1988) "Current Applied Recombinant DNA Projects" TIBTECH 6:S4-S7.
Gaertner, F. H. (1989) "Cellular delivery systems for insecticidal proteins: living and non-living microorganisms" in Controlled Deliver of Crop-Protection Agents, pp. 245-255.
Couch, T. L. (1980) "Mosquito Pathogenicity of Bacillus thuringiensis var. israelensis" Developments in Industrial Microbiology 22:61-76.
Beegle, C. C. (1978) "Use of Entomogenous Bacteria in AGroecosystems" in Developments in Industrial Microbiology 20:97-104.
Krieg, A. et al. (1983) "Bacillus thuringiensis var. tenebrionis: ein neuer, gegenuber Larven von Coleopteren Wirksamer Pathotyp" Z. ang. Ent. 96:500-508.
Hofte, H., H. R. Whiteley (1989) "Insecticidal Crystal Proteins of Bacillus thuringiensis" Microbiological Reviews 52(2):242-255.
Feitelson, J. S. et al. (1992) "Bacillus thuringiensis: Insects and Beyond" Bio/Technology 10:271-275.
Schnepf, H. E., H. R. Whiteley (1981) "Cloning and expression of the Bacillus thuringiensis crystal protein gene in Escherichia coli" Proc. Natl. Acad. Sci. USA 78(5):2893-2897.
Li, J., J. Carroll, D. J. Ellar (1991) "Crystal structure of insecticidal .delta.-endotoxin from Bacillus thuringiensis at 2.5 A resolution" Nature 353:815-821.
Arvidson, H. et al. (1989) "Specificity of Bacillus thuringiensis for lepidopteran larvae: factors involved in vivo and in the structure of a purified protoxin" Molecular Microbiology 3(11):1533-1543.
Choma, C. T. et al. (1990) "Unusual proteolysis of the protoxin and toxin from Bacillus thuringiensis" Eur. J. Biochem. 189:523-527.
Haider, M. Z., et al. (1986) "Specificity of Bacillus thuringiensis var. colmeri insecticidal .delta.-endotoxin is determined by differential proteolytic processing of the protoxin" Eur. J. Biochem. 156:531-540.
Aronson, A. I. et al. (1991) "The Solubility of Inclusion Proteins from Bacillus thuringiensis Is Dependent upon Protoxin Composition and Is a Factor in Toxicity to Insects" Appl. Environ. Microbiol. 57(4):981-986.
Honee, G. et al. (1991) "The C-terminal domain of the toxic fragment of a Bacillus thuringiensis crystal protein determines receptor binding" Molecular Microbiology 5(11):2799-2806.
Honee, G. et al. (1990) "A Translation Fusion Product of Two Different Insecticidal Crystal Protein Genes of Bacillus thuringiensis Exhibits an Enlarged Insecticidal Spectrum" Appl. Environ. Microbiol. 56(3):823-825.