Patent Application
20240026461
A Sequence Listing is provided herewith as an xml file, “2339852.xml” created on Jun. 2, 2023, and having a size of 12,694 bytes. The content of the xml file is incorporated by reference herein in its entirety.
Activated B-cell diffuse large B-cell lymphomas (ABC DLBCLs) are among the most aggressive lymphomas. ABC DLBCLs typically include frequent mutations of immune signaling pathways that culminate in activation of the CARD11-BCL10-MALT1 (CBM) complex signal amplification complex. The CARD11/BCL10/MALT1 complex plays a role in integrating signaling pathways involved in immunity and inflammation in a broad repertoire of cell types. In B-cells and T-cells, the CBM complex is activated downstream of B-cell receptor (BCR) or T-cell receptor (TCR) signaling and serves to amplify such signals leading to powerful phenotype responses conferred by critical downstream mediates.
As described herein BCL10 gain-of-function mutations have been identified in subjects with diffuse large B-cell lymphomas (DLBCLs) and in activated B-cell-DLBCLs. Through biochemical, structural and functional dissection of these mutations, two distinct classes of BCL10 mutations were identified: missense mutations in the caspase activation and recruitment domain (CARD) and truncation mutations in the C-terminal region of BCL10. Treatment with MALT1 inhibitors of subjects having such mutations is particularly beneficial, and more effective than treatment with BTK inhibitors or commonly used chemotherapy regimens for advanced DLBCL. For example, when a sample from a subject indicates that the subject has a BCL10 mutation that subject is more effectively treated with MALT1 inhibitors, and in some cases not treated with BTK inhibitors. MALT1 inhibitors are particularly useful for treatment of subjects with C-terminal deletions or C-terminal truncations of at least one BCL10 allele. However, subjects having mutations in the BCL10 CARD domain can also benefit from treatment with MALT1 inhibitors.
A method is described herein that can involve administering at least one MALT1 inhibitor to a subject having a mutation in at least one BCL10 allele.
Also described herein are methods of identifying subjects who can benefit from treatment with at least one MALT1 inhibitor, the method involving screening the subjects to identify which subjects, if any, have at least one mutation in at least one BCL10 allele.
The BCL10 mutation(s) can be missense mutations, deletions, or insertions in the BCL10 coding region of at least one BCL10 allele. In some cases, the mutation is in a BCL10 CARD domain. In some cases, the mutation is a BCL10 C-terminal truncation or BCL10 C-terminal deletion in the BCL10 coding region. Subjects with at least mutation in a coding region of at least one BCL10 allele can be treated with one or more MALT1 inhibitors.
In some cases, the mutation is in the BCL10 CARD domain is a mutation at an amino acid position equivalent to position 58 of SEQ ID NO:1, or is a mutation that includes an amino acid position equivalent to position 58. In some cases, the C-terminal truncation or C-terminal deletion in a coding region of at least one BCL10 allele is within amino acid positions equivalent to position 135-174 of SEQ ID NO:1.
Subjects can be evaluated for treatment with one or more MALT1 inhibitors by a variety of methods such as genomic sequencing, polymerase chain reaction (PCR) analysis, restriction fragment length polymorphism (RFLP) analysis, mRNA size analysis, protein sequencing, antibody detection of BCL10 mutant proteins, use of primers/probes specific for truncation mutant BCL10 proteins, and the like.
A method is also described herein that can involve administering at least one MALT1 inhibitor to a subject having one or more genomic mutations in a coding region of at least one BCL10 allele, where the one or more genomic mutations can be within:
As described herein, subjects having lymphomas who also have BCL10 mutations can be treated more effectively with MALT1 inhibitors than other types of treatments. In some cases, the subjects are resistant to BTK inhibitors. Treatment with MALT1 inhibitors can therefore be significantly more effective than other types of treatments. Genome sequencing studies identified BCL10 gain-of-function mutations in diffuse large B-cell lymphomas (DLBCLs), and mostly within the ABC-DLBCLs. Through biochemical, structural and functional dissection of these mutations, two distinct classes of BCL10 mutations were identified: a missense (CARD) mutation and C-terminal truncations of BCL10.
A method is described herein that can involve administering at least one MALT1 inhibitor to a subject having a mutation in at least one BCL10 allele.
Also described herein are methods of identifying subjects who can benefit from treatment with at least one MALT1 inhibitor, the method involving screening the subjects to identify which subjects, if any, have at least one mutation in at least one BCL10 allele.
The BCL10 mutation(s) can be missense mutations, deletions, or insertions in the BCL10 coding region of at least one BCL10 allele. In some cases, the mutation is in a BCL10 CARD domain. In some cases, the mutation is a BCL10 C-terminal truncation or BCL10 C-terminal deletion in the BCL10 coding region. Subjects with at least mutation in a coding region of at least one BCL10 allele can be treated with one or more MALT1 inhibitors.
In some cases, at least one of the mutations is in the BCL10 CARD domain such as at an amino acid position equivalent to position 58 of SEQ ID NO:1, or the mutation includes an amino acid position equivalent to position 58. In some cases, the C-terminal truncation or C-terminal deletion in a coding region of at least one BCL10 allele is within amino acid positions equivalent to position 135-174 of SEQ ID NO:1. The BCL10 mutations can be at positions 58 and 140 et seq.
Subjects can be evaluated for treatment with one or more MALT1 inhibitors by a variety of methods such as genomic sequencing, polymerase chain reaction (PCR) analysis, restriction fragment length polymorphism (RFLP) analysis, mRNA size analysis, protein sequencing, antibody detection of BCL10 mutant proteins, use of primers/probes specific for truncation mutant BCL10 proteins, and the like.
BCL10 is composed of an N-terminal caspase activation and recruitment domain (CARD) domain, and a long C-terminal unstructured region containing a distal Ser and Thr rich region. Structure guided studies have shown that the BCL10 filament polymerizes in a unidirectional manner through CARD-CARD interactions, providing a surface for cooperative binding of MALT1 through its N-terminal Death Domain. Upon BCL10 filament binding, MALT1 immediately dimerizes and incorporates TRAF6 to form a higher ordered assembly leading to all-or-none activation of downstream pathways including NF-κB and JNK. Binding to BCL10 also activates MALT1 paracaspase activity and cleavage of substrate proteins. BCL10 filament formation is dynamic in activated T lymphocytes and precisely regulated by disassembly and degradation through BCL10 K63 polyubiquitination and p62-dependent selective autophagy-lysosomal proteolysis system. Hence dynamic BCL10 filament turnover is needed to precisely tune its effect on downstream signaling pathways such as NF-κB.
Chronic active NF-κB signaling is a hallmark of highly aggressive activated B cell-like diffuse large B-cell lymphomas (ABC-DLBCLs), due to somatic mutations of B-cell receptors (BCRs) and Toll-like receptor (TLR) subunits such as CD79b and MYD88 (Young et al. SeminHematol 52:77-85 (2015); Davis et al. Nature 463:88-92 (2010); Ngo et al., Nature 470:115-119 (2011)), as well as activating mutations of CARD11 and amplifications of MALT1 (Lenz et al., Science 319:1676-1679 (2008); Sanchez-Izquierdo et al., Blood 101:4539-4546 (2003); Vicente-Duenas et al., Proc Natl Acad Sci USA 109:10534-10539 (2012)). Collectively these mutations induce chronic activation of the CARD11-BCL10-MALT1 (CBM) complex to maintain robust and sustained NF-κB and other downstream pathway activation. The involvement of these signaling pathways in highly aggressive tumors has inspired development of targeted therapies disrupting oncogenic BCR/TLR activity.
However, the position where mutations happen in the BCR pathway may be important for assigning potential precision therapy to patients. For example, mutations in the most upstream BCR proteins like CD79B confer sensitivity to BTK inhibitors, whereas downstream mutations like PLCγ2 and CARD11 confer resistance (Wilson et al. Nat Med 21:922-926 (2015); Hendricks et al., Nat Rev Cancer 14:219-232 (2014); Woyach et al., N Engl J Med 370:2286-2294 (2014); Caeser et al., JCO Precis Oncol 5:145-152 (2021)). Hence mechanistic study of oncogenic mutations is beneficial to guide targeted therapy in B cell lymphomas.
Aberrant CBM function has been shown to play roles in diseases such as B-cell lymphoma and auto-immunity. Upon antigen receptor engagement, the CARD11 subunit is phosphorylated by protein kinase C (PKC), which activates its function by reducing interaction of its auto-inhibitory coiled coil domain to its CARD domain. The activated form CARD11 then can interact with BCL10 and facilitate formation of large macromolecular filaments, providing a large scaffold for binding and activation of MALT1, which is the enzymatic paracaspase subunit of the CBM complex that results in further downstream activation of a variety of effector molecules. Like other supramolecular organizing center (SMOC) mediated signaling transduction, such as toll-like receptor (TLR) triggering Myddosome, RIG-1 like receptor sensing intracellular viral RNA and activating mitochondrial antiviral signaling protein (MAVS) filament formation, the BCL10 filament formation is also important for BCR/TCR signaling amplification and robust downstream NF-κB activation.
The human BCL10 gene is located on chromosome 1 (location 1p22.3; NC_000001.11 (85265776 . . . 85276632, complement; NC_060925.1 (85106896 . . . 85117748, complement).
A sequence for isoform 1 of human BCL10 is shown below (NCBI NP_003912.1; SEQ ID NO:1).
STTPFFSTNS SLNL
PVLEVG RTENTIFSST TLPRPGDPGA
A cDNA encoding human BCL10 protein is shown below as SEQ ID NO:2.
Another cDNA encoding this human BCL10 protein is shown below as SEQ ID NO:3.
Other isoforms of human BCL10 exist and have sequences with NCBI accession numbers NP_001307644.1 (GI: 1002639417), XP-011540699.1 (GI: 767906661), XP_011540700.1 (GI: 767906663), XP_011540701.1 (GI: 767906666).
Hence, various isoforms and variants of the human BCL10 proteins and nucleic acids can be present in populations of subjects. Any such isoforms and variants can also be detected and subjects with such isoforms can be treated using the methods described herein. Such isoforms and variants of the human BCL10 proteins and nucleic acids can have sequences with between 55-100% sequence identity to a reference sequence, for example to any of the human BCL10 sequences described herein. For example, the isoforms and variants of the human BCL10 protein and nucleic acids can have at least 55% sequence identity, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97% sequence, at least 98%, at least 99% identity to any of the sequences described herein. The sequence comparisons can be over a specified comparison window. Optimal alignment may be ascertained or conducted, for example, using the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443-53 (1970).
However, as described herein, mutations at position 58 and truncation at or beyond position 135 of the BCL10 protein (e.g., positions 135-174, highlighted in SEQ ID NO:1) are correlated with aggressive forms of diffuse large B-cell lymphomas (DLBCLs), and such lymphomas can benefit more from treatment with MALT1 inhibitors than some other types of treatment. Accordingly subjects with mutations of their BCL10 protein at amino acid position equivalent to position 58 and/or a truncation at or beyond an amino acid position equivalent to position 135 of SEQ ID NO:1 can be diagnosed and treated even when those subjects have any BCL10 isoform or variant. In some cases the C-terminal BCL10 truncation can be with positions equivalent to amino acid positions 135 to 174 of SEQ ID NO:1.
BCL10 mutations can be detected in the genomes or mRNA samples from subjects by a variety of methods. Examples of methods that can be used include genomic sequencing, cDNA sequencing, mRNA sequencing, RFLP analysis, SNP analysis, PCR amplification, Northern blot analysis, Southern blot analysis, probe hybridization, or a combination thereof. Mutant BCL10 proteins can be detected in samples from subjects by a variety of methods, including antibody detection, PAGE analysis, Western blot analysis, BCL10 filament formation (or missing/aberrant filament formation), or combinations thereof.
Antibodies that specifically bind to BCL10 protein, and/or probes/primers that bind specifically to BCL10 DNA or BCL10 mRNA can be used to detect BCL10 mutations. Antibodies that bind to BCL10 protein are available, for example from Abcam, CellSignal, OriGene, Rockland, and ThermoFisher Scientific. Probes and primers that bind specifically to BCL10 mRNA can include segments of about 15-100 nucleotides that have at least 90% sequence identity or complementarity to a BCL10 coding region (e.g., to a BCL10 cDNA with the SEQ ID NO:2 sequence).
A variety of MALT1 inhibitors can be used for treatment of subjects having BCL10 mutations at amino acid positions equivalent to position 58 of SEQ ID NO:1, and/or truncations of BCL10 at positions equivalent to 140 and beyond in the BCL10 C-terminus. The subjects can have diagnosed lymphoma and/or symptoms of lymphoma such as enlarged lymph nodes, night sweats, unusual weight loss, loss of appetite, tiredness/fatigue, fever, itchiness, or a combination thereof.
Examples of MALT1 inhibitors that can be used include MLT-748, JNJ-67690246, MI-2, Mepazine, MLT-943, JNJ-67856633, MLT-985, (R)-MALT1-IN-7, MLT-231, Z-VRPR-FMK (TFA), MLT-747, (S)-MALT1-IN-5, (R)-MALT I-IN-3, MALT1-IN-7, or combinations thereof. Such inhibitors can reduce tumor weight or tumor volume by at least 10%, or 20% or 30%, or 40%, or 50%, or 60%, or 75%, or 100% compared to an untreated control. In some cases, inhibitors can reduce tumor weight or tumor volume by at least 1.2-fold, or 1.5-fold, or 2-fold, or 3-fold, or 5-fold, or 7-fold, or 10-fold compared to an untreated control. Such a control can be a subject with untreated lymphoma.
MLT-748 is a reversible allosteric compound that binds MALT1 Trp580 side chain to lock the protease into an inactive form (Quancard et al., Nat Chem Biol 15:304-313 (2019)). A structure for MLT-748 is shown below.
JNJ-67690246 is an allosteric MALT1 inhibitor, having the structure shown below.
MI-2 is an irreversible MALT1 inhibitor with the structure shown below.
Mepazine (Pecazine) is a potent and selective MALT1 protease inhibitor with the structure shown below.
MLT-943 is a potent, selective and orally active MALT1 protease inhibitor with the structure shown below.
JNJ-67856633 is an orally active, first-in-class, potent, selective and allosteric MALT1 protease inhibitor with the structure shown below.
MLT-985 is a highly selective allosteric MALT1 inhibitor with the structure shown below.
(R)-MALT1-IN-7 (compound 142a) is a potent MALT1 protease inhibitor with the structure shown below.
(R)-MLT-985 (compound 11) is a potent MALT1 protease inhibitor with the structure shown below.
(R)-MALT1-IN-7 (compound 142a) is a potent MALT1 protease inhibitor with the structure shown below.
(R)-MLT-985 (compound 11) is a potent MALT1 protease inhibitor with the structure shown below.
MLT-231 is a potent, highly selective allosteric MALT1 Inhibitor with the structure shown below.
Z-VRPR-FMK (TFA) (VRPR), a tetrapeptide, is a selective and irreversible MALT1 with the structure shown below.
MLT-747 is a potent, selective, allosteric inhibitor of MALT1, binds MALT1 in the allosteric Trp580 pocket, with the structure shown below.
(S)-MALT1-IN-5 is a potent inhibitor of MALT1 protease, with the structure shown below.
(R)-MALT1-IN-3 (compound 121) is a potent MALT1 protease inhibitor with the structure shown below.
MALT1-IN-7 (compound 142b) is a potent MALT1 protease inhibitor with the structure shown below.
BTK is member of the Tec family that is important for the growth, differentiation and activation of myeloid-, mast- and B-cells. BTK is initially activated by membrane localization which is stimulated by the generation of PIP3. As illustrated herein, subjects having BCL10 mutations at amino acid positions equivalent to position 58 of SEQ ID NO:1, and/or truncations of BCL10 at positions equivalent to 140 and beyond in the BCL10 C-terminus can benefit from treatment with a variety of MALT1 inhibitors. The subjects can have diagnosed lymphoma and/or symptoms of lymphoma such as enlarged lymph nodes, night sweats, unusual weight loss, loss of appetite, tiredness/fatigue, fever, itchiness, or a combination thereof.
However, some lymphoma patients may already have received one or more BTK inhibitors, and in some cases those patients are subjects who may be resistant to BTK inhibitors. Such subjects may be treated more effectively with MALT1 inhibitors.
Examples of BTK inhibitors that may have been used for various subjects include Ibrutinib, Zanubrutinib, Acalabrutinib, CGI 1746, LCB 03-0110, LFM-A13, PCI 29732, PF 06465469, (−)-Terreic acid, DD 03-171, or a combination thereof.
Ibrutinib is a potent and selective BTK inhibitor with the following structure:
Zanubrutinib is classified as a BTK) inhibitor with the following structure.
Acalabrutinib, sold under the brand name Calquence, is a BTK inhibitor with the following structure:
CGI 1746 is a potent, reversible inhibitor of BTK with the following structure:
LCB 03-0110 salts are potent c-Src kinase inhibitors, as well as potent inhibitors of BTK. LCB 03-0110 has the following structure:
LFM-A13 is a potent and selective inhibitor of BTK, and has the following structure:
PCI 29732 is a potent BTK inhibitor with the following structure:
PF 06465469 is a potent inhibitor of interleukin-2 inducible T cell kinase (ITK) (IC50=2 nM), and also exhibits inhibitory activity against BTK. PF 06465469 with the following structure:
(−)-Terreic acid is a selective inhibitor of BTK with the following structure:
DD 03-171 is a potent and selective BTK Degrader (PROTAC®) with the following structure:
MALT1 inhibitors may be administered neat or, preferably, as pharmaceutical compositions. Pharmaceutical compositions of the invention include an appropriate amount of the MALT1 inhibitors in combination with an appropriate carrier as well as other useful ingredients.
MALT1 inhibitors can include the compounds described herein, and wherein applicable, acceptable salts thereof. Acceptable salts include, but are not limited to, those prepared from the following acids: alkyl, alkenyl, aryl, alkylaryl and alkenylaryl mono-, di- and tricarboxylic acids of 1 to 20 carbon atoms, optionally substituted by 1 to 4 hydroxyls; alkyl, alkenyl, aryl, alkylaryl and alkenylaryl mono-, di- and trisulfonic acids of 1 to 20 carbon atoms, optionally substituted by 1 to 4 hydroxyls; and mineral acids. Examples include hydrochloric: hydrobromic; sulphuric; nitric; phosphoric; maleic; acetic; salicyclic; p-toluenesulfonic; tartaric; citric; methanesulphonic; formic; malonic; succinic; naphthalene-2-sulphonic; and benzenesulphonic acid. Also, pharmaceutically-acceptable salts may be prepared as amine salts, ammonium salts, or alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. These are formed from alkaline metal or alkaline earth metal bases or from amine compounds. In addition, analogs of the foregoing compounds that act as functional equivalents also are intended to be embraced as equivalents and within the scope of the invention.
Pharmaceutical compositions of MALT1 suitable for oral administration may be in the form of (1) discrete units such as capsules, cachets, tablets or lozenges each containing a predetermined amount of the MALT1; (2) a powder or granules; (3) a bolus, electuary or paste; (4) a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or (4) an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. Thus, compositions suitable for topical administration in the mouth, for example buccally or sublingually, include lozenges. Compositions suitable for parenteral administration include aqueous and non-aqueous sterile suspensions or injection solutions. Compositions suitable for rectal administration may be presented as a suppository.
Thus, pharmaceutical compositions of MALT1 inhibitors may be formulated using a solid or liquid carrier. The solid or liquid carrier would be compatible with the other ingredients of the formulation and not deleterious to the recipient. If the pharmaceutical composition is in tablet form, then MALT1 inhibitor(s) are mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired. If the composition is in powder form, the carrier is a finely divided solid in admixture with the finely divided active ingredient. The powders and tablets may contain up to 99% of the active ingredient. Suitable solid carriers include, for example, calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, methyl cellulose, sodium carboxymethyl cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins. A solid carrier may include one or more substances that may act as flavoring agents, lubricants, solubilizers, suspending agents, fillers, glidants, compression aids, binders or tablet-disintegrating agents. A suitable carrier may also be an encapsulating material.
If the composition is a solution, suspension, emulsion, syrup, elixirs or pressurized compositions, then liquid carriers may be used. In this case, the MALT1 inhibitors are dissolved or suspended in a pharmaceutically acceptable liquid carrier. Suitable examples of liquid carriers for oral and parenteral administration include (1) water, (2) alcohols, e.g. monohydric alcohols and polyhydric alcohols such as glycols, and their derivatives, and (3) oils, e.g. fractionated coconut oil and arachis oil. For parenteral administration, the carrier may also be an oily ester such as ethyl oleate and isopropyl myristate. Liquid carriers for pressurized compositions include halogenated hydrocarbon or other pharmaceutically acceptable propellent. The liquid carrier may contain other suitable pharmaceutical additives such as solubilizers; emulsifiers; buffers; preservatives; sweeteners; flavoring agents; suspending agents; thickening agents; colors; viscosity regulators; stabilizers; osmo-regulators; cellulose derivatives such as sodium carboxymethyl cellulose; anti-oxidants; and bacteriostats. Other carriers include those used for formulating lozenges such as sucrose, acacia, tragacanth, gelatin and glycerin as well as those used in formulating suppositories such as cocoa butter or polyethylene glycol.
If the composition is to be administered intravenously or intraperitoneally by infusion or injection, solutions of the MALT1 inhibitors may be prepared in a solvent (e.g. water), optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in water, glycerol, liquid polyethylene glycols, triacetin, oils, and mixtures thereof. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The composition suitable for injection or infusion may include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium as described above. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the MALT1 inhibitors in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying techniques, which yield a powder of the MALT1 inhibitors, plus any additional desired ingredient present in the previously sterile-filtered solutions.
Pharmaceutical compositions of the invention may be in unit-dose or multi-dose form or in a form that allows for slow or controlled release of the MALT1 inhibitors. Each unit-dose may be in the form of a tablet, capsule or packaged composition such as, for example, a packeted powder, vial, ampoule, prefilled syringe or sachet containing liquids. The unit-dose form also may be the appropriate number of any such compositions in package form. Pharmaceutical compositions in multi-dose form may be in packaged in containers such as sealed ampoules and vials. In this case, the MALT1 inhibitors may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier immediately prior to use. In addition, extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
In general, dosage forms of the invention comprise an amount of at least one of the MALT1 inhibitors effective to treat or prevent the clinical symptoms of a disease (e.g. a lymphoma). Any statistically significant attenuation of one or more symptoms of a lymphoma is considered to be a treatment thereof.
The absolute weight of a given MALT1, or other therapeutic agent that is included in a unit dose can vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one MALT1, or other therapeutic agent can be administered. Alternatively, the unit dosage can vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.
Daily doses of a MALT1, or other therapeutic agent(s) can vary as well. Such daily doses can range, for example, from about 0.1 g/day to about 50 g/day, from about 0.1 g/day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.
The term “about” as used herein when referring to a measurable value such as an amount, a length, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value.
As used herein, a “cell” refers to any type of cell isolated from a prokaryotic, eukaryotic, or archaeon organism, including bacteria, archaea, fungi, protists, plants, and animals, including cells from tissues, organs, and biopsies, as well as recombinant cells, cells from cell lines cultured in vitro, and cellular fragments, cell components, or organelles comprising nucleic acids. The term also encompasses artificial cells, such as nanoparticles, liposomes, polymersomes, or microcapsules encapsulating nucleic acids. The methods described herein can be performed, for example, on a sample comprising a single cell or a population of cells. The term also includes genetically modified cells.
A “coding region” or a sequence which “encodes” a selected polypeptide or a selected RNA, is a nucleic acid molecule which is transcribed (in the case of DNA templates) into RNA and/or translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or “control elements”). The boundaries of the coding sequence can be determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxy) terminus. A coding sequence can include, but is not limited to, ncRNAs, tracrRNAs, ncRNAs modified to include heterologous sequences, cDNA from viral, prokaryotic or eukaryotic ncRNA, mRNA, viral or prokaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3′ to the coding sequence.
Typical “control elements,” include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3′ to the translation stop codon), sequences for optimization of initiation of translation (located 5′ to the coding sequence), and translation termination sequences.
“Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding region is capable of effecting the expression of the encoded sequence when the proper polymerases are present. The promoter need not be contiguous with the coding region, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding region and the promoter sequence can still be considered “operably linked” to the coding region.
“Encoded by” refers to a nucleic acid sequence that codes for a polypeptide or RNA. For example, a polypeptide sequence or a portion thereof is encoded by the nucleic acid sequence. The RNA sequence or a portion thereof contains a nucleotide sequence that is encoded by a DNA (or other nucleic acid) sequence.
The terms “isolated,” “purified,” or “biologically pure” refer to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation. A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein, DNA, or RNA or cause other adverse consequences. That is, a nucleic acid or peptide can be purified if it is substantially free of cellular material, viral material, or culture medium when obtained from nature or when produced by recombinant DNA techniques, or free from chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
“Substantially purified” generally refers to isolation of a substance (nucleic acid, compound, polynucleotide, protein, polypeptide, peptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically, in a sample, a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are available and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
A “vector” is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, “vector construct,” “expression vector,” and “gene transfer vector,” mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.
“Expression” refers to detectable production of a gene product by a cell. The gene product may be a transcription product (i.e., RNA), which may be referred to as “gene expression”, or the gene product may be a translation product of the transcription product (i.e., a protein), depending on the context.
“Mammalian cell” refers to any cell derived from a mammalian subject. The mammalian cells can in some cases be suitable for transfection with vector systems. The cell may be xenogeneic, autologous, or allogeneic. The cell can be a primary cell obtained directly from a mammalian subject. The cell may also be a cell derived from the culture and expansion of a cell obtained from a mammalian subject. Immortalized cells are also included within this definition. In some embodiments, the cell has been genetically engineered to express a recombinant protein and/or nucleic acid.
The term “subject” includes animals, including both vertebrates and invertebrates, including, without limitation, invertebrates such as arthropods, mollusks, annelids, and cnidarians; and vertebrates such as amphibians, including frogs, salamanders, and caecillians; reptiles, including lizards, snakes, turtles, crocodiles, and alligators; fish; mammals, including human and non-human mammals such as non-human primates, including chimpanzees and other apes and monkey species; laboratory animals such as mice, rats, rabbits, hamsters, guinea pigs, and chinchillas; domestic animals such as dogs and cats: farm animals such as sheep, goats, pigs, horses and cows; and birds such as domestic, wild and game birds, including chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. In some cases, the disclosed methods find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; primates, and transgenic animals. In some cases, the subject is a human.
“Gene transfer” or “gene delivery” refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells. Gene delivery expression vectors include, but are not limited to, vectors derived from bacterial plasmid vectors, viral vectors, non-viral vectors, alphaviruses, pox viruses and vaccinia viruses.
The term “derived from” is used herein to identify the original source of a molecule but is not meant to limit the method by which the molecule is made which can be, for example, by chemical synthesis or recombinant means.
A polynucleotide or nucleic acid “derived from” a designated sequence refers to a polynucleotide or nucleic acid that includes a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence. The derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
The terms “hybridize” and “hybridization” refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing.
The term “homologous region” refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a “homologous region” is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term “homologous, region,” as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule can have two homologous regions which are capable of hybridizing to each other. Thus, the term “homologous region” includes nucleic acid segments with complementary sequences. Homologous regions may vary in length but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).
As used herein, the terms “complementary” or “complementarity” refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. “Complementarity” may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be “complementary” and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are “perfectly complementary” or “100% complementary” if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered “perfectly complementary” or “100% complementary” even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other. “Less than perfect” complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.
The term “donor polynucleotide” or “donor DNA” refers to a nucleic acid or polynucleotide that provides a nucleotide sequence of an intended edit to be integrated into the genome at a target locus by HDR or recombineering.
“Administering” a nucleic acid, such as an expression cassette, comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, etc., i.e., any means by which a nucleic acid can be transported across a cell membrane.
The subject matter disclosed herein is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosed subject matter.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed subject matter belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the disclosed subject matter, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the nucleic acid” includes reference to one or more nucleic acids and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of any features or elements described herein, which includes use of a “negative” limitation.
The invention will be further described by the following non-limiting examples.
This Example describes some of the materials and methods used in the development of the invention.
Raji, HBL1, TMD8 and RIVA were cultured in RPMI supplemented with 10% FBS, 2 mM L-glutamine and 10 mM HEPES. OCI-Ly10 was cultured in Iscove's medium supplemented with 20% FBS, 2 mM L-glutamine. 293T was cultured in Dulbecco's Modified Eagle Medium with 10% FBS. All cell lines were authenticated by University of Arizona Genetic Core, grown in presence of 1% penicillin G and streptomycin and at 37° C. in a humidified atmosphere of 5% CO2. HBL1 and RIVA was obtained from Jose A. Martinez-Climent (Universidad de Navarra, Pamplona, Spain); TMD8 was obtained from Louis M. Staudt (National Cancer Institute, Bethesda, Maryland, USA); OCI-Ly10 cell lines were obtained from the Ontario Cancer Institute (OCI).
Lentiviruses were produced in 293T cells by co-transfecting shRNA or overexpression vectors with packaging vectors psPax2 (Addgene #12260, RRID: Addgene_12260) and psMD2.g (Addgene #12259, RRID: Addgene_12259) at the 4:3:1 ratio in serum free media. The sequences of the short hairpin sequences used were:
The supernatant containing virus particles were harvested 48 h and 72 h after transfection, filtered through 0.45 μm filter and then concentrated with PEG-it according to manufacturer's instructions (LV825A-1, System Biosciences). Virus was resuspended with PBS containing 25 μM HEPES and added to cells for overnight infection. Cells were selected 24 h post transfection by adding puromycin (Sigma), blasticidin (Invivogen) or G418 (Life Technologies) for at least 48 h.
All mice experiments were approved by Institutional Animal Care & Use Committee (IACUC) at Weill Cornell Medicine and were performed following the IACUC guidelines. Eight to ten weeks of female NOD.Cg-prkdcscid Il2rgtm1Wj1/SzJ (NSG, RRID: IMSR_JAX: 005557) mice were obtained from The Research Animal Resource Center (RARC) at Weill Cornell Medicine. 5×106 HBL1 or 107 million OCI-Ly10 and their derived engineered cells were resuspended with PBS/Matrigel (1:1) and subcutaneously injected to the right flank of mice. Treatments were started when tumor volume reached an average of 100 mm3. Ibrutinib was prepared in corn oil with 10% (v/v) DMSO or 0.5% methylcellulose in water and administrated p.o. with 25 or 37.5 mg/kg once per day. JNJ-67690246 was prepared in PEG400 with 10% (w/v) PVPVA64 and administrated p.o. with 100 mg/kg twice per day. Tumor volume was monitored 2˜3 times/week with digital caliper and calculated using the following formula. smallest diameter2×largest diameter×0.5.
DLBCL cell lines were cultured in exponential condition and the cell growth was determined by CellTiter Glo (Promega). 3000-5000 cells were seeded and cultured in each well of 384 well plate for 96 h and treated with compounds every 48 h. Luminescence was read at the endpoint with the Synergy NEO microplate reader (BioTek). The value of compound treated cells was normalized to their vehicle treated controls and then used to calculate IC50 in GraphPad Prism (RRID:SCR_002798).
For NF-κB reporter assay in 293T, the plasmids expressing different BCL10 mutations were transiently transfected into 293T cells using Lipofectamine (Invitrogen). Renilla luciferase plasmid was co-transfected as an internal control. 24 h after transfection, cells were collected and luciferase activities were measured in Synergy NEO microplate reader (BioTek) with the Dual Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions and normalized to Renilla luciferase activity. To generate stable NF-κB reporter cells, the lentivirus expressing 3×NF-κB response element followed by a luciferase firefly was made and infect the parental cells. Puromycin was then added for antibiotic selection 24 h after infection. Reporter cells were further validated by BTK inhibitor and MALT1 protease inhibitor treatment and PMA/IO stimulation. NF-κB reporter cells expressing BCL10 were generated by infecting reporter cells with different lentiviral BCL10 isoforms (co-expressing GFP), followed by sorting out GFP+ cells. Stable NF-κB reporter cells were harvested at the indicated conditions and lysed with 1× passive lysis buffer at room temperature for 20 min. The lysate was briefly centrifuged and the supernatant was collected for luciferase activity. All the assays were presented as mean±SEM of three independent experiments.
The generation of Raji MALT1 GloSensor reporter cell has been previously described44. All other GloSensor reporter cells were generated by infecting parental cells with lentiviral MALT1-GloSensor (pLex306 backbone), followed by antibiotic (blasticidin) selection. All derived GloSensor cells were further validated by MALT1 protease inhibitor treatment and PMA/IO stimulation.
Lymphoma cells (108) were collected, washed with cold PBS and resuspended with lysis buffer (1% NP40, 10% glycerol, 150 mM NaCl, 20 mM Tris-HCL pH 7.5, and freshly added protease inhibitors). The lysates were centrifuged at 15,000 g, 4° C. for 15 min and the supernatant was then collected and incubated with 50 μL equilibrated anti-Flag magnetic beads (Sigma-Aldrich Cat #M8823, RRID:AB_2637089) at 4° C. for 3 h. The beads were washed 3 times with lysis buffer and followed by 3 times washing with the lysis buffer without NP40. SDS loading buffer without non-reducing reagent was added and boiled at 95° C. for 5 min. The elution was added for 0-mercaptoethanol (final 10%), and ready to run western blot after boiling at 95° C. for 5 min.
Whole cell lysates extracted with RIPA buffer or IP elution were separated by SDS-PAGE gels and followed by transferring to PVDF membranes. Membranes were incubated with indicated primary antibodies: anti-Flag (Sigma-Aldrich Cat #F3165, RRID:AB_259529), anti-MALT1 (Santa Cruz Biotechnology Cat #sc-46677, RRID:AB_627909), anti-CARD11 (Abcam Cat #ab113409, RRID:AB_10861854), anti-O-Actin (AC-15, Sigma-Aldrich), and then mouse/rabbit peroxidase-conjugated secondary antibodies (Cell Signaling Technology). Protein intensity was detected with enhanced chemiluminescence using ChemiDoc imaging system (Bio Rad).
The Driver mutation analysis is performed using Fishhook (see website at github.com/mskilab/fishHook) on a total of 243 ABC-DLBCL cases from NCI cohort. Fishhook is a model built with mutational calls, a set of hypothesis intervals, eligible genomic ranges and a set of genomic covariates that identifies the depletion and enrichment of genomic interval statistically. The model used a gamma-Poisson regression to implement the maximum likelihood approximation with consideration of user assigned covariates and expected mutation density to the hypothesis. With this approach, the model helps us to identify enriched mutations with consideration like chromatin features, sequence context composition and gene expression.
Eligible region is defined using genecode v19 and fractional coverage of hg19 positions provided by Agilent exome coverage. The model was also fed covariates that defines B cell specific transcriptional states and chromatin state information for the model. The covariates of ABC specific transcriptional states are generated by number of the overlap between the TSS site of genes TPM >2 in the half the ABC-DLBCL cases from the same NCI cohort within 10 kb the eligible regions. The covariates of B-cell specific chromatin states are generated by number of the overlap between H3K27Ac Peaks that previously reported in the B cell within 100 kb of the eligible regions and the ATAC peaks of the B cells within 10 kb of the eligible. A total of 3 covariates was fed to the fishhook model. Here we noted genes of FDR <0.05 and BCL10 have an FDR of 1.4e−10. QQ-plot is plotted by pairing observed −log 10 transformed quantiles of observed P values (y-axis) with their corresponding −log 10 transformed quantiles from the uniform distribution (x-axis).
MALT1 protease activity was assessed in vitro using full-length MALT1 protein (Strep-MALT1(1-824)-His) purified from baculovirus-infected insect cells. The tetrapeptide LRSR is coupled to 7-amino-4-methylcoumarin (AMC) and provides a quenched, fluorescent substrate for the MALT1 protease (SM Biochemicals). Cleavage of AMC from the arginine residue results in an increase in coumarin fluorescence measured at 460 nm (excitation 355 nm). Diluted compounds were pre-incubated with MALT1 enzyme for 50 minutes at room temperature (RT). Substrate was added and the reaction was then incubated for 4 h at RT, after which fluorescence was measured.
Secretion of the IL-6 and IL-10 cytokines by OCI-Ly3 ABC-DLBCL cells was measured using a Mesoscale assay (MSD). MALT1 inhibition results in a decrease of IL-6/10 secretion. OCI-Ly3 cells were treated with diluted compounds for 24 h at 37° C. and 5% CO2. After 24 h of incubation, 50 μL of the supernatant was transferred to an MSD plate (V-Plex Proinflammation Panel 1 [human] kit) and incubated for 2 h at RT followed by a 2 h incubation with IL-6/10 antibody solution. Plates were read on a SECTOR imager.
all Constructs of BCL10, MALT1 are from Human Sequences. Full-Length WT and mutant BCL10 constructs with N-terminal MBP tag were generated in vector pDB-His-MBP with a 3C protease site between MBP and BCL10. Full length His-tagged MALT1 cloned into pET29b was purchased from Addgene (RRID:Addgene_48968) and was expressed in E. coli.
All proteins were purified by either Ni-NTA resin (Qiagen) or Amylose resin followed by gel filtration chromatography (Superdex 200 10/300 GL, GE Healthcare). BCL10 FL and mutant filaments were purified by MBP affinity column in binding buffer containing 25 mM Tris at pH 7.5, 300 mM NaCl, 1 mM TCEP, followed by Superdex 200 gel filtration chromatography in buffer containing 20 mM Tris at pH 7.5, 150 mM NaCl and 1 mM TCEP, resulted in isolation of a monomeric fraction of BCL10. Then monomeric MBP-BCL10 was cleaved by 3C protease and incubated at RT for 2 hours in order to allow filaments formation. This step was followed by another Superdex 200 gel filtration chromatography and BCL10 filaments were isolated at the void peak for structure determination and thermostability assay. Isolation of BCL10 (1-140)-MALT1 complex was performed in a similar way in which BCL10 and MALT1 were purified separately. BCL10 pre-formed filaments after 3C cleavage were added mixed together with FL MALT1 to form a complex.
Copper grids coated with layers of plastic and thin carbon film were glow-charged before 5 μl of purified complexes were applied. Samples were left on the grids for 1 minute followed by negative staining with 1% uranyl formate for 30 seconds and air dried. In vitro BCL10 WT and mutants, BCL10/MALT1 and CBM were imaged with JEOL 1200EX or Tecnai G2 Spirit BioTWIN at Harvard Medical School EM facility operating at 80 keV.
Cryo grids for BCL10 R58Q and BCL10 E140X/MALT1 filaments were prepared by applying 3 μl of protein sample on a c-flat (1.2/1.3) 300 mesh grids. Grids were plunged by using vitrobot (FEI) at 4° c. with 3 sec blotting and force 4. For BCL10 R58Q data collection, 3439 movies were collected at super resolution mode with using Arctica microscope at UMASS facility, operated at 200 kv facility with k2 camera. The movies were collected automatically using SerialEM data collection at a nominal magnification of 36,000 and a pixel size of 0.435 Å, with a total dose of 38 e/A2 which was fractionated into 40 movie frames, with defocus range of −1-2.5 μm. For BCL10 E140X-MALT1 collection, 700 movies were collected at super resolution mode with using 300 kV FEI Titan Krios microscope equipped with FEI Falcon II detector at PNCC cryo-EM facility, operated at 300 kv with Falcon3 camera. The movies were collected automatically using SerialEM data collection at a nominal magnification of 47,000 and a pixel size of 0.4 Å, with a total dose of 55 e/Å2 which was fractionated into movie frames.
For helical reconstruction of BCL10 R58Q and BCL10 E140X/MALT1, Motioncor2 was used for drift correction and Micrographs were CTF corrected by using CTFFIND4. Data was processed with using Relion (3.1). The resolutions of the reconstruction were determined by FSC to 4.6 Å and 4.3 Å, respectively. Model building was performed in program Coot36. Refinement was performed against the using Phenix refine50 Structural presentations were generated using Pymol (DeLano Scientific) and Chimera (Pettersen et al. J Comput Chem 25:1605-1612 (2004).
Time lapsed movies of full length labeled Alexa488-BCL10 FL, BCL10 R58Q and BCL10 E140X were recorded with using Nikon spinning disk confocal microscope at Harvard Micron facility for periods of 30 min-1 hr with 1 minute interval, with using ×100 objective. 3C was added at a sub-molar ratio to allow MBP cleavage to occur within 2-3 minutes in order to provide ample time for setting up the microscope and starting the recording.
For concentration determination, labeled Alexa488-BCL10 FL, R58Q and E140X filaments were formed at increasing concentrations ranging between 0.1 μM-1 μM. 4 h after cleavage with 3C and incubation at RT, samples were placed on a 35 mm bottom glass dish and imaged with using spinning disk confocal microscope with using ×100 objective.
Purified full length MBP-BCL10, BCL10 R58Q and BCL10 E140X were mixed with 5-fold molar excess of Alexa-488-C5-maleimide (Invitrogen) and incubated at 4° C. temperature for O/N. Gel filtration chromatography (Superdex 200, GE Healthcare) was used to remove free dyes. Fluorescence polarization assay was performed at 18° C. in buffer containing 20 mM Tris at pH 7.5, 150 mM NaCl, and 0.5 mM TCEP and in 20 p0 volume. 3 μM of labeled MBP-BCL10 were cleaved with 3C in the presence of increasing amount of MALT1. The fluorescence quenching was measured right after 3C addition for 2 h by using NEO plate reader (Biotek) using excitation/emission wavelengths of 495 nm/519 nm.
Purified BCL10 FL, R58Q and E140X filaments purified from the void peak of Superdex200 were mixed with 1-fold protein thermal shift dye (Thermo Fisher Scientific). Thermal scanning (25 to 95° C. at 1° C./min) was performed and melting curves were recorded on a StepOne RT-PCR machine. Data analysis was done by Protein Thermal Shift™ Software (Thermo Fisher Scientific).
HBL1 cells cultured in fresh media were mixed in 1:1 ratio with cytospin. Cells were spined at 800×g for 5 min. Cell pellets were resuspended with cytospin and plated on CELLview 4-compartment dishes (Greiner Bio-One). Cells were left at RT overnight and were fixed with 100% cold methanol for 5 minutes at −20° C., followed by cell permeabilization with 0.1% Triton X-100 in PBS-Tween (PBST) for 10 minutes. Cells were incubated with blocking buffer containing 3% BSA for 3 h, in order to minimize non-specific binding. After blocking, Cells were incubated overnight at 4° C. with FLAG primary antibody (Sigma-Aldrich Cat #F1804, RRID:AB_262044). After incubation, cells were washed with PBST 3 times and incubated with AlexaFluor488-conjugated anti-mouse IgG (Abcam Cat #ab1l50113, RRID:AB_2576208) for 1 h at room temperature. After incubation, cells were washed with PBS and then stained with Hoechst for 10 minutes (1:500, Immunochemistry Technologies, Cat #639). Cells were imaged using spinning disk confocal microscope with using ×100 objective.
Formalin-fixed paraffin-embedded (FFPE) tissue sections of 4 μm thickness were cut from a tissue microarray composed of duplicate 0.6 mm cores from 298 cases of de novo DLBCL. Slides were processed using standard immunohistochemistry protocols and stained with an antibody against NF-κB p65 (Cell Signaling Technology Cat #8242, RRID:AB_10859369, 1:500 dilution). Appropriate staining was verified in sections of benign tonsil, heart and liver. Stained slides were assessed by an expert hematopathologist for nuclear expression of p65 in DLBCL tumor cells, scored as a percentage of tumor cell nuclei.
As a first approach to explore structure-function of BCL10 mutations, the inventors merged and evaluated DLBCL sequencing databases (Chapuy et al. Nat Med 24:679-690 (2018); Schmitz et al., N Engl J Med 378:1396-1407 (2018); Lacy et al., Blood 135: 1759-1771 (2020); Karube et al., Leukemia 32:675-684 (2018); Morin et al. Blood 122:1256-1265 (2013) (n=2255). Seventy-five (75) BCL10 mutant patients were identified.
BCL10 contains a structured caspase activation and recruitment domain (CARD) at its N-terminal half that mediates interaction with other CARD proteins and polymerization of BCL10 into fibrils. The C-terminal region of BCL10 is unstructured and contains serine and threonine residues targeted for post-translational modifications (Qiao et al., Mol Cell 51:766-779 (2013); Thys et al. Front Oncol 8:498 (2018)). BCL10 mutations affected both regions. Although mutations in the CARD were all missense mutations with a prominent hotspot at Arginine 58, in contrast a majority of those in the C-terminal region were truncating (nonsense or frameshift) mutations with a number of hotspot residues observed (
The BCL10 mutations in a cohort of patients were examined with rigorous cell of origin and genetic cluster information (Schmitz et al. N Engl J Med 378:1396-1407 (2018); Alizadeh et al., Nature 403.503-511 (2000)). The inventors discovered that 51% of the mutations occurred in ABC-DLBCLs, 31% of the mutations were unclassifiable cases, and 18% of mutations occurred in GCB-DLBCLs (
To determine whether BCL10 somatic mutations were likely to be robust genetic drivers of ABC-DLBCLs, we performed a rigorous genomic co-variate “Fish-hook” analysis36 controlling for gene size, as well as GC B-cell gene expression profiles, activating promoter histone marks, chromatin accessibility profiles and others. This analysis captured BCL10 as one of the top 10 driver mutations in ABC-DLBCL, along with genes such as MYD88, CD79B, PIM1 and TP53 (FDR<0.01,
To survey whether the different classes of BCL10 mutations had a functional impact on NF-κB signaling, a panel of CARD and C-terminal mutants were expressed, as well as wild-type BCL10, together with an NF-κB luciferase reporter in 293T cells. The wild type BCL10 was able to induce NF-κB activity (
To determine if such findings could be validated in primary human DLBCLs, immunohistochemistry staining of p65 was performed in a set of tissue microarrays containing biopsies from 298 genetically annotated DLBCL patients. We found that BCL10 mutant DLBCLs manifested significantly increased p65 nuclear staining scores compared to BCL10 WT cases (Mann-Whitney p<0.0001,
To determine the mechanism through which BCL10 mutants might confer a biochemical gain of function, purified full-length BCL10WT, BCL10E140X and BCL10R58Q proteins were fused to a 3C protease-cleavable maltose binding protein (MBP) at the N-terminus were expressed to keep the proteins in a monomeric state (
Judging from the images obtained (some shown in
The kinetics of filament formation by these proteins was further evaluated at 1 μM concentrations, which are above the concentration of polymerization for WT and these mutant BCL10 proteins, using time lapse confocal fluorescence microscopy. As illustrated in
Activated CARD11-BCL10-MALT1 (CBM) complexes manifest as puncta when visualized through confocal microscopy of living cells (Lenz et al., Science 319:1676-1679 (2008); Rossman et al., Mol Biol Cell 17:2166-2176 (2006); Traver et al., Methods Mol Biol 1584:101-127 (2017)). Therefore, ABC-DLBCL cells (HBL1) were imaged that had been engineered for constitutive expression of FLAG-tagged BCL10WT, BCL10E140X and BCL10R58Q, respectively. These experiments revealed large, striking aggregates of BCL10140X, in comparison with the much smaller puncta of BCL10E140X or BCL10R58Q (
To better visualize these filaments, BCL10WT, BCL10R58Q and BCL10E140X filaments were treated with 3C protease and purified by collecting the void fraction (i.e. polymerized BCL10) from a Superose 6 gel filtration column. The polymerized BCL10 filaments were then imaged using scanning electron microscopy (EM) (
To determine if the BCL10R5RQ filaments are structurally different from BCL10 or BCL10E140X filaments and how the bundling occurs, cryo-EM data were collected using an Arctica microscope operating at 200 keV and a K2 electron counting direct detection camera. Thin and thick filaments were manually selected from the cryo-EM micrographs. As illustrated in
Using 3D reconstruction, the cryo-EM structure of the BCL10R58Q filament was determined at 4.6 Å resolution as assessed by gold-standard Fourier shell correlation (FSC). The overall structure was similar to that of the BCL10WT filament with only the CARD domain ordered (
To further demonstrate the potential role of the hydrogen bonding network in BCL10 filament assembly within the R58Q mutant, an R58E mutant was generated that does not have the NE2 atom (e.g. Q58 side chain) for hydrogen bond formation. The biochemical and biophysical properties of the R58E mutant were then characterized. However, there was no enhancement of filament formation for R58E and the concentration for R58E polymerization was about 1 μM, which was even higher than WT BCL10. These results confirm that the hydrogen bond formed by Q58 is important for its filament formation.
These Q58-mediated interactions prompted further experiments designed to determine whether there might be a difference in the stability of the BCL10R58Q filament in comparison to BCL10WT and BCL10E140X filaments. To assess this possibility, thermal melt assays were performed on purified BCL10WT, BCL10R58Q and BCL10E140X filaments. As shown in
To investigate how the truncation mutants might affect CBM complex formation, Flag-tagged wild type and mutant forms of BCL10 were expressed in Raji cells, which lack constitutive B-cell receptor (BCR) signaling. Anti-Flag co-immunoprecipitations were performed on cell lysates. As illustrated in
The observed weaker recruitment of MALT1 by BCL10 truncation mutants (
MALT1 has multiple domains (
The inventors designed experiments to determine whether there were additional MALT1-binding sites on BCL10 at its largely unstructured C-terminus. The C-terminal region was divided into two halves and MALT1 pull-down studies were performed. As shown in
This new MALT1 binding domain is deleted from BCL10E140X. The inventors next explored whether there was any impairment in MALT1 recruitment to BCL10 filaments, by generating BCL10WT and BCL10E140X filaments in vitro and incubating them with purified, full length MALT1 followed by negative staining electron microscopy (EM). These experiments showed equivalent patterns of MALT1 decorating the surface of WT and BCL10E140X filaments, suggesting that MALT1 recruitment was intact in each case (
The cryo-EM structure of the BCL10E140X filament with MALT1 was highly similar to that of the BCL10WT filament with MALT1 at 4.9 Å resolution, in which the death domains of MALT1 bind the CARD of BCL10 and decorate the outside of the core CARD filament (
To further investigate these associations, gel filtration analysis was performed from lysates of ABC-DLBCL cells expressing FLAG-tagged BCL10WT, BCL10R58Q or BCL10E140X. Cell fractionation of these lysates revealed a relatively small proportion of BCL10WT or BCL10R58Q in high molecular weight fractions corresponding to filaments, along with a small fraction of MALT1, whereas most BCL10 and MALT1 proteins were in low molecular weight fractions (
The association between enhanced polymerization and lack of MALT1 monomeric interaction of BCL10E140X prompted the inventors to hypothesize that MALT1 binding to the C-terminal region of BCL10 might inhibit BCL10 polymerization. To investigate whether this was the case Alexa488-labeled, MBP-fused BCL10WT, BCL10R58Q or BCL10E140X were incubated with increasing concentrations of purified MALT1. These reaction mixtures were then treated with C3 protease to remove the MBP moiety, and the BCL10 polymerization kinetics were monitored using fluorescence quenching.
As shown in
Because MALT1 dimerization on BCL10 filaments activates its proteolytic function, the inventors designed experiments to determine whether skewing of MALT1 cellular pools towards the BCL10 polymer bound state in the BCL10E140X setting might lead to higher cellular levels of MALT1 activity.
The effect of BCL10 mutants on MALT1 activity was examined within cells in the absence of basal BCR signaling. To do this, MALT1 enzymatic reporter assays were performed, using a GloSensor protein construct engineered with a specific MALT1 cleavage site (Fontan et al., J Clin Invest 128:4397-4412 (2018)) stably transduced into Raji cells expressing BCL10WT, BCL10E140X or BCL10R58Q).
As shown in
Similar MALT1 protease reporter assays were performed in ABC-DLBCL cell lines expressing BCL10WT, BCL10E140X or BCL10R58Q, where there is constitutive activation of signaling to the CBM complex. Again BCL10E140X generally yielded the strongest MALT1 activation (
Collectively, these data indicate that both BCL10R58Q and especially BCL10E140X, through distinct mechanisms, lead to aberrantly increased MALT1 activity.
Normally, active CARD11 is required to nucleate the formation of BCL10 filaments (Qiao et al., Mol Cell 51:766-779 (2013); David et al., Proc Natl Acad Sci USA 115:1499-1504 (2018)). However, the inventors hypothesized that the requirement for CARD11 could be diminished in ABC-DLBCL cells expressing BCL10E140X, given its greater tendency to polymerize and loss of MALT1 inhibitory interactions.
To test this hypothesis, CARD11 shRNA knockdown experiments were performed in isogenic ABC-DLBCL cells expressing BCL10WT, BCL10R58Q and BCL10E140X. CARD11 depletion can cause proliferation arrest of ABC-DLBCL cells (Lenz et al., Science 319:1676-1679 (2008)) As shown in
To determine how the effects of these mutant BCL10 proteins relate to CBM complex function, the impact of CARD11 knockdown on MALT1 activity was evaluated using GloSensor reporter assays. MALT1 activity was highly impaired after CARD11 knockdown in the presence of wild type BCL10, but this effect was completely rescued in BCL10E140X cells and partially rescued by BCL10R58Q(
As illustrated in the foregoing Example, BCL10E140X activates MALT1, which may be linked to its reduced requirement for CARD11 to induce filament formation. These results are consistent with the data described herein showing markedly greater BCL10E140X activity in unstimulated B-cells. The BCL10R58Q mutant, which does not polymerize as readily as BCL10E140X and is still inhibited by MALT1 monomers, retained a greater degree of CARD11 dependency.
Bruton's tyrosine kinase (BTK) inhibitors have emerged as a precision therapy modality for ABC-DLBCLs (Wilson et al., Nat Med 21:922-926 (2015); Aalipour & Advani, Ther Adv Hematol 5:121-133 (2014)). However, lymphoma cells with inherent or acquired mutations in activating proteins downstream of BTK (e.g. those CARD11 mutations that induce potent MALT1 activation) can be resistant to such treatments (Wilson et al., Nat Med 21:922-926 (2015); Caeser et al., JCO Precis Oncol 5:145-152 (2021)).
Given the distinct functional profiles, CARD11 dependencies, and MALT1 activation effects of the BCL10 CARD and truncation mutants, the inventors designed experiments to evaluate whether, and to what extent, these mutant BCL10 proteins might confer BTK inhibitor resistance. Isogenic ABC-DLBCL cells expressing BCL10WT, BCL10R58Q and BCL10E140X proteins were treated with escalating doses of three chemically distinct covalent BTK inhibitors: ibrutinib, acalabrutinib, or zanubrutinib. The cellular proliferation rates of the treated cells were measured using an ATP fluorescence assay after 96 hours of drug exposure.
As shown in
As illustrated in
When the further downstream impact of the BTK inhibitors was measured on NF-κB reporter activity, significantly blunted NF-κB reporter activity was observed in cells expressing BCL10R58Q and BCL10E140X.
Ibrutinib (37mpk, oral gavage, Q.D.) was administered to mice bearing BCL10WT, BCL10R58Q and BCLE140X expressing ABC-DLBCL xenografts and the tumor volumes in the different mice were measured. As shown in
The fact that BCL10 mutants drive potent MALT1 activation even in the absence of CARD11 and that these BCL10 mutants confer reduced responses to ibrutinib led the inventors to hypothesize that cells expressing BCL10 mutants might be especially dependent on MALT1 and hence highly responsive to MALT1 inhibitors.
To evaluate this hypothesis, the impact of three chemically and mechanistically distinct MALT1 inhibitors was tested against the inventors' set of isogenic ABC-DLBCL cells. The MALT1 inhibitors tested included:
C3, a potent and specific compound that covalently inactivates the MALT1 catalytic pocket (Fontan et al., J Clin Invest 128:4397-4412 (2018));
MLT-748, a reversible allosteric compound that binds MALT1 Trp580 side chain thus to lock protease inactive (Quancard et al., Nat Chem Biol 15:304-313 (2019)); and
JNJ-67690246, an allosteric MALT1 inhibitor, having the structure shown below.
JNJ-67690246 potently inhibits MALT1 enzymatic activity (IC50=15 nM) in biochemical assays and cytokine secretion of IL6/10 (IC50=60 nM) in OCI-Ly3 cellular assays, as shown by the IC50 values in the table below.
Isogenic BCL10WT, BCL10R58Q and BCL10E140X ABC-DLBCLs were exposed to increasing concentrations of each of these compounds for 96 hours.
As shown in
Both WT cells and BCL10R58Q cells were generally sensitive to the allosteric inhibitors (MLT-748 and JNJ-67690246), but BCL10R58Q cells were less sensitive than wild type to C3 (
Analysis of NF-κB reporter activity showed significantly greater impairment in MALT1 inhibitor treated BCL10E140X cells as compared to either BCL10WT or BCL10R58Q. Cells expressing BCL10R58Q exhibited even less impairment of the NF-κB activity than in wild type cells. These results indicate that some other pathway may be maintaining NF-κB and hence conferring less dependency on MALT1 than in BCL10E140X cells.
Mice having BCL10WT, BCL10R58Q and BCL10E140X ABC-DLBCL xenografts were treated in vivo with JNJ-67690246, using the OCI-Ly10 cell line, which is generally less sensitive to MALT1 inhibition (
BCL10, one of the most frequently mutated genes in DLBCL, is a bona fide genetic driver of lymphomagenesis. Importantly, structure-function studies described herein reveal that specific mutations occur in at least two biochemically distinct classes within DLBCL patients: missense mutations of the CARD domain and truncation mutations of the C-terminal tail. These classes of mutations seem to affect distinct aspects of BCL10 functionality and lead to biologically distinct outcomes as indicated by their differential downstream effects on MALT1 and NF-κB signaling as well as vulnerability to targeted therapies. Many of the BCL10 truncating mutations cluster between amino acid positions 135 to 174, and representatives of these mutations manifested the most powerful activation of NF-κB activity. BCL10 truncation mutants such as BCL10E140X manifested a striking increase in its ability to polymerize into its filamentous form, accompanied by potent activation of MALT1 protease activity. This tendency to polymerize, indicated for example by its lower concentration threshold may help to explain the reduced CARD11 dependency of lymphoma cells expressing BCL10E140X. Although CARD11 serves to nucleate BCL10 polymerization, CARD11 association with BCL10 filaments can be further stabilized by nascent helical BCL10 polymers, which is consistent with results showing increased association of BCL10 and CARD11 in lymphoma cells expressing BCL10E140X in view of this mutant's greater tendency to polymerize, while at the same time being consistent with its reduced requirement for CARD11 to induce filament formation and reduced biological dependency on CARD11 in BCL10E140X expressing DLBCL cells.
Binding of the MALT1 death domain to BCL10 was unperturbed in filaments composed of BCL10E140X. This MAL T1-BCL10 molecular association is mediated through the BCL10 CARD domain and proximal regions that are not affected by C-terminal truncation mutations. However, co-immunoprecipitation experiments paradoxically indicated reduced interaction between BCL10 and MALT1. This prompted the inventors to examine other modes of BCL10-MALT1 association, leading to the identification of a novel direct interaction site between MALT1 Ig1-Ig2 region and BCL10 amino acid positions 165 to 208, a region that is lost in a majority of truncation mutants except for a cluster deleting the extreme C-terminal Ser/Thr rich tail. Importantly, the results described herein show that MALT1 impairs BCL10 polymerization through this interaction surface, thus constituting a novel CBM negative regulatory mechanism preventing spurious polymerization of BCL10. This explains the dramatically increased filament formation observed for BCL10E140X in vitro, and greatly enhanced ability of the BCL10E140X mutant to recruit MALT1 into the polymerized CBM complex, given that loss of monomeric BCL10 and MALT1 binding would increase the pool of MALT1 to associate with filaments. The events that occur due to the presence of BCL10E140X thus appear to constitute a positive feedback loop that ultimately causes potent MALT1 protease activation and biological dependency on MALT1 catalytic function.
The more distal set of C-terminal truncating mutations such as Q208X, L209X and L225X retain the MALT1 Ig1-Ig2 interacting region and hence would not be expected to escape from this MALT1 inhibitory binding. Accordingly, when expressed in cells, they did not induce greater NF-κB activity than wild type BCL10, suggesting that there may be additional ways in which BCL10 function could be perturbed, perhaps due to specific loss of certain as of yet undiscovered post-translational modifications. Interestingly, a BCL10-L225X mutant produces a truncated form of BCL10 similar to the MALT1 protease dependent cleavage form of BCL10 R228X observed in activated T-cells as well as in ABC-DLBCL cells with chronic active BCR signaling and showed similar functional effects to wild type BCL10 overexpression in NF-κB reporter assays, perhaps due to retaining both intact MALT1 biding sites.
In contrast, missense mutations of the BCL10 CARD domain seem to have distinct functional effects. Many of the BCL10 residues affected by mutations (e.g. R58, K63) are localized within the core of BCL10 helical structures where they make important intrastrand (Type III) and interstrand (Type I) interactions that needed for filament formation. An R53Q mutation, affecting type III interactions, might be predicted to disrupt intrastrand interactions and caused a severe defect in BCL10 CARD domain polymerization. This was however proven to be incorrect, and the sole CARD domain hotspot mutant residue Q58 engages in a novel form of type III interaction resulting in apparent formation of a hydrogen bonded glutamine network. The consequence is a shift in BCL10 polymerization kinetics, favoring the polymerized state but without dramatically altering binding to CARD11 or MALT1 and yielding a more modest gain of function phenotype. Missense mutations such as K63Q might functionally resemble R58Q since they also locate at the central core of the BCL10 CARD filament, and have positively charged residues switched to glutamine to potentially enhance, rather than disrupt, interactions.
These biochemical features of the BCL10R58Q mutant result in a hypomorphic phenotype compared to truncation mutant where they induced less potent MALT1 and NF-κB activation than BCL10E140X. However, the results shown herein also indicate that BCL10R58Q may engage in additional gain of function effects. Cells expressing BCL10R58Q seemed relatively resistant to loss of NF-κB activity upon exposure to MALT1 inhibitors as compared to that on BCL10-WT or BCL10E140X, whereas in contrast, reduction in NF-κB activity in response to the upstream BTK inhibitors was similar between BCL10R58Q and BCL10E140X. These data prompt us to hypothesize that other functions may derive from the stability or bundling of R58Q filament. For example, more stable BCL10 filaments might enhance MALT1 recruitment and activation of TRAF6, which could partially support NF-κB independently from the MALT1 proteolytic function, or activate NF-κB through other alternative means such as linear ubiquitylation (LUBAC) associated mechanisms. Engagement of these or other MALT1 paracaspase independent biochemical effects would be consistent with BCL10R58Q DLBCL cells retaining greater dependency on CARD11 and hence upstream signaling and responsiveness to BTK inhibitors.
Overall, the data provided herein illustrate the complexities involved in developing precision therapies for DLBCLs and other tumors. The identification of chronic active BCR signaling as a characteristic of ABC-DLBCLs has led to intense efforts to integrate BTK inhibitors (BTKi) into multi-modality regimens. However to date, it is clear that many patients still do not benefit from the addition of such compounds. The results provided herein point to biochemical mechanisms that might help to explain this, as exemplified most clearly by the BTKi resistance conferred by BCL10 truncation mutants, indicating that such patients should not be treated with BTKi containing regimens. Instead, patients with BCL10 truncation mutations would likely best be served by incorporating MALT1 inhibitors. Several MALT1 inhibitors are already in clinical trials and can be used for this purpose. Similar considerations may apply to other (but not all) mutations downstream of BTK, as exemplified by the case of CARD11 coiled-coil domain mutants, which induce resistance to BTK inhibitors but not to MALT1 inhibitors. However, the fact that BCL10 CARD domain mutations may still retain BTK inhibitor responsiveness further underlines the need for rigorous study of signaling pathway mutations such as those described herein.
Example 10 ABC-DLBCLs have unfavorable outcomes and chronic activation of CBM signal amplification complexes that form due to polymerization of BCL10 subunits, which is affected by recurrent somatic mutations in ABC-DLBCLs. Herein, it is shown that BCL10 mutants fall into at least two functionally distinct classes: missense mutations of the BCL10 CARD domain and truncation of its C-terminal tail. Truncating mutation abrogated a novel motif through which MALT1 inhibits BCL10 polymerization, trapping MALT1 in its activated filament-bound state. CARD missense mutation enhanced BCL10 filament formation; forming glutamine network structures that stabilize BCL10 filaments. Mutant forms of BCL10 were less dependent on upstream CARD activation and thus manifested resistance to BTK inhibitors, whereas BCL10 truncating but not CARD mutants were hypersensitive to MALT1 inhibitors. Therefore, BCL10 mutations are potential biomarkers for BTK inhibitor resistance in ABC-DLBCL and further precision can be achieved by selecting therapy based on specific biochemical effects of distinct mutation classes.
ABC-DLBCLs feature frequent mutations of signaling mediators that converge on the CARD11-BCL10-MALT1 (CBM) complex. Herein structure-function approaches were used to reveal that BCL10 mutations fall into at least two distinct biochemical classes. Importantly both classes confer resistance to BTK inhibitors, whereas BCL10 truncating mutants confer hyper-responsiveness to MALT1 inhibitors, providing a roadmap for precision therapies for ABC-DLBCLs.
The CARD11/BCL10/MALT1 complex plays a role integrating signaling pathways involved in immunity and inflammation in a broad repertoire of cell types. In B-cells and T-cells, the CBM complex is activated downstream of B-cell receptor (BCR) or T-cell receptor (TCR) signaling and serves to amplify such signals leading to powerful phenotype responses conferred by downstream mediators. Accordingly, aberrant CBM function has been shown to play roles in diseases such as B-cell lymphoma and auto-immunity. Upon antigen receptor engagement, the CARD11 subunit is phosphorylated by protein kinase C (PKC), which activates its function by reducing interaction of its auto-inhibitory coiled coil domain to its CARD domain. The activated form CARD11 then can interact with BCL10 and facilitate its forming of large macromolecular filaments, providing a large scaffold for binding and activation of MALT1, which is the enzymatic paracaspase subunit of the CBM complex that results in further downstream activation of a variety of effector molecules.
Like other supramolecular organizing center (SMOC) mediated signaling transduction, such as toll-like receptor (TLR) triggering Myddosome, RIG-I like receptor sensing intracellular viral RNA and activating mitochondrial antiviral signaling protein (MAVS) filament formation, the BCL10 filament formation is also important for BCR/TCR signaling amplification and robust downstream NF-xB activation. BCL10 is composed of an N-terminal CARD domain, and a long C-terminal unstructured region containing a distal Ser and Thr rich region. Structure guided studies showed that BCL10 filament polymerizes in a unidirectional manner through CARD-CARD interactions, providing a surface for cooperative binding of MALT1 through its N-terminal Death Domain. Upon BCL10 filament binding, MALT1 is immediately dimerized and incorporates TRAF6 to form higher ordered assembly leading to all-or-none activation of downstream pathways including NF-xB and JNK. Binding to BCL10 also activates MALT1 paracaspase activity and cleavage of substrate proteins. BCL10 filament formation is dynamic in activated T lymphocytes and precisely regulated by disassembly and degradation through BCL10 K63 polyubiquitination and p62 dependent selective autophagy-lysosomal proteolysis system. Hence dynamic BCL10 filament turnover might be important to precisely tune its effect on downstream signaling pathways such as NF-xB.
Chronic active NF-xB signaling is a hallmark of the highly aggressive activated B cell-like diffuse large B-cell lymphomas (ABC-DLBCLs), due to somatic mutations of BCR and Toll-like receptors (TLR) subunits such as CD79b and MYD88, as well as activating mutations of CARD11 and amplifications of MALT1. Collectively these mutations induce chronic activation of the CBM complex to maintain robust and sustained NF-xB and other downstream pathway activation. The involvement of these signaling pathways in highly aggressive tumors has inspired development of targeted therapies disrupting oncogenic BCR/TLR activity. However, the position where mutations happen in the BCR pathway may be important for assigning potential precision therapy to patients. For example, mutations in the most upstream BCR proteins like CD79B confer sensitivity to BTK inhibitors, whereas downstream mutations like PLCγ2 and CARD11 confer resistance. Hence mechanistic study of oncogenic mutations is beneficial to guide targeted therapy in B cell lymphomas. Recent genomic sequencing studies in DLBCLs and other lymphomas have revealed recurrent and widely spread somatic mutations of BCL10, However, the functionality and mechanism of BCL10 mutations in DLBCL have not been studied. Whereas it is evident how mutations causing constitutive activation of CARD11 or increased abundance of MALT1 might result in enhanced CBM function, it is not immediately clear how these BCL10 mutations might function. Therefore, the structure and function of BCL10 mutations in DLBCL were explored by identifying distinct classes of mutant proteins with different biochemical effects and distinct impact on response to targeted therapies. These studies have implications for selecting targeted therapy agents for lymphoma precision therapy.
As a first approach to explore structure-function of BCL10 mutations DLBCL sequencing databases were merged (n=2255) and BCL10 mutant patients identified. BCL10 contains a structured CARD domain at its N-terminal half that mediates interaction with CARD11 and polymerization of BCL10 into fibrils. The C-terminal region is unstructured and contains serine and threonine residues targeted by post-translational modifications. BCL10 mutations affected both regions. Although mutations in the CARD were all missense mutations with a prominent hotspot at Arginine 58, in contrast a majority of those in the C-terminal region were truncating (nonsense or frameshift) mutations with a number of hotspot residues observed (
Examining BCL10 mutations in a cohort of patients with rigorous cell of origin and genetic cluster information, it was observed that 51% occurred in ABC-DLBCLs, 31% in unclassifiable cases, and 18% in GCB-DLBCLs (
To determine whether BCL10 somatic mutations were likely to be robust genetic drivers of ABC-DLBCLs, a rigorous genomic co-variate “Fish-hook” analysis controlling for gene size, as well as GC B-cell gene expression profiles, activating promoter histone marks, chromatin accessibility profiles and others were performed. This analysis captured BCL10 as one of the top 10 driver mutations in ABC-DLBCL, along with genes such as MYD88, CD79B, PIM1 and TP53 (FDR<0.01,
Next, to survey whether the different classes of BCL10 mutations had a functional impact on NF-xB signaling, a panel of CARD and C-terminal mutants were expressed, as well as wild-type BCL10 together with an NF-xB luciferase reporter in 293T cells. As expected, WT BCL10 was able to induce NF-xB activity (
Focusing the studies on representative CARD and C-terminal mutations, this markedly increased NF-κB reporter induction even occurred in ABC-DLBCL cells that already have chronic BCR activation including both MCD (HBL1) and BN2-DLBCL cells (RIVA) (
To determine the mechanism through which BCL10 mutants might confer a biochemical gain of function, full-length BCL10WT, BCL10E140X and BCL10R58Q fused to a 3C protease-cleavable maltose binding protein (MBP) at the N-terminus to keep the proteins in a monomeric state were expressed and purified (
Activated C8M complexes manifest as puncta when visualized through confocal microscopy of living cells. ABC-DLBCL cells (HBL1) engineered for constitutive expression of FLAG-tagged BCL10WT, BCL10E140X and BCL10R58Q, respectively, were imaged. These experiments revealed large, striking aggregates of BCL10E140X, in comparison with the much smaller puncta of BCL10WT or BCL10R58Q (
The R58Q mutant forms filaments with a glutamine ladder, enhanced stability and tendency to bundle. To better visualize these filaments, 3C protease-treatment induced filaments of BCL10w, BCL10R58Q and BCL10E140X were purified by collecting the void fraction (i.e., polymerized BCL10) from a Superose 6 gel filtration column, and imaged using scanning electron microscopy (EM) (
To determine if the BCL10R58Q filaments are structurally different from BCL10WT or BCL10E140X filaments and how the bundling occurs, cryo-EM data was collected using an Arctica microscope operating at 200 keV and a K2 electron counting direct detection camera (
Using 3D reconstruction, the cryo-EM structure of the BCL10R58Q filament at 4.6 Å resolution was determined, assessed by gold-standard Fourier shell correlation (FSC) (
These Q58-mediated interactions prompted us to ask whether there might be a difference in the stability of the BCL10R58Q filament in comparison to BCL10WT and BCL10E140X filaments. To assess this possibility, thermal melt assays were performed on purified BCL10WT, BCL10R58Q and BCL10E140X filaments, which revealed that BCL10R58Q, and to a lesser degree BCL10E140X, yielded more stable filaments, with thermal melting temperatures of 80.8° C. and 78.8° C. respectively, in comparison with 76.6° C. for the BCL10WT (
Loss of basal MALT1 binding promotes spontaneous polymerization of BCL10E140X. To investigate how the truncation mutants might affect CBM complex formation, Flag-tagged WT and mutant forms of BCL10 were expressed in Raji cells, which lack constitutive BCR signaling. Performing anti-Flag co-immunoprecipitations, equivalent enrichment for MALT1 in WT and BCL10R58Q as well as in another CARD missense mutant BCL10R58Q was observed. In contrast, there was less binding of MALT1 to BCL10E140X, as well as the similar BCL10K146Nfs*2 truncation mutant (
MALT1 has multiple domains (
Given that this new MALT1 binding domain is deleted from BCL10E140X we next explored whether there was any impairment in MALT1 recruitment to BCL10 filaments, by generating BCL10WT and BCL10E140X filaments in vitro and incubating them with purified, full length MALT1 followed by negative staining EM. These experiments showed equivalent patterns of MALT1 decorating the surface of WT and BCL10E140X filaments, suggesting that MALT1 recruitment was intact in each case (
To further investigate these associations, gel filtration analysis was performed from lysates of ABC-DLBCL cells expressing FLAG-tagged BCL10WT, BCL10R58Q and BCL10E140X, respectively (
The association between enhanced polymerization and lack of MALT1 monomeric interaction of BCL10E140X prompted the hypothesis that MALT1 binding to the C-terminal region of BCL10 might inhibit BCL10 polymerization. To investigate whether this was the case Alexa488-labeled, MBP-fused BCL10WT, BCL10R58Q or BCL10E140X were incubated with increasing concentrations of purified MALT1, treated the reactions with C3 protease to remove the MBP moiety, and monitored polymerization kinetics using fluorescence quenching (
Differential activation of MALT1 by BCL10E140X vs BCL10R58Q. Because MALT1 dimerization on BCL10 filaments activates its proteolytic function, it was wondered whether skewing of MALT1 cellular pools towards the BCL10 polymer bound state in the BCL10E140X setting might lead to higher cellular levels of MALT1 activity. The effect of BCL10 mutants on MALT1 activity within cells in the absence of basal BCR signaling was investigated. For this, MALT1 enzymatic reporter assays were performed using a GloSensor protein construct engineered with a specific MALT1 cleavage site stably transduced in Raji cells expressing BCL10WT, BCL10E140X or BCL10R58Q(
BCL10E140X confers reduced dependency on CARD11 for CBM activation. Normally, active CARD11 is required to nucleate the formation of BCL10 filaments. However, it was wondered whether the requirement for CARD11 might be diminished in ABC-DLBCL cells expressing BCL10E140X, given its greater tendency to polymerize and loss of MALT1 inhibitory interactions. CARD11 shRNA knockdown experiments were performed in isogenic ABC-DLBCL cells expressing BCL10WT, BCL10R58Q and BCL10E140X CARD11 depletion is known to cause proliferation arrest of ABC-DLBCL cells and accordingly it was observed significant growth suppression induced by CARD11 knockdown in the presence of wild type BCL10 (
BCL10R58Q and BCL10E140X confer distinct levels of resistance to ibrutinib BTK inhibitors have emerged as a precision therapy modality for ABC-DLBCLs. However, lymphoma cells with inherent or acquired mutations in activating proteins downstream of BTK (e.g., CARD11 mutations that induce potent MALT1 activation) are often resistant to such treatments. Given the distinct functional profiles, CARD11 dependencies, and MALT1 activation effects of BCL10 CARD and truncation mutants, it was wondered whether and to what extent they might confer BTK inhibitor resistance. The isogenic ABC-DLBCL cells expressing BCL10WT, BCL10R58Q and BCL10E140X proteins were treated with escalating doses of three chemically distinct covalent BTK inhibitors: ibrutinib, acalabrutinib or zanubrutinib, and tested their proliferation rates using an ATP fluorescence assay after 96 hours of drug exposure. BCL10R59Q conferred at least a modest and often significant reduction in response to these drugs (
All three BTK inhibitors yielded potent and dose dependent suppression of MALT1 activity in BCL10WT ABC-DLBCL cells (
BCL10 Truncating Mutant Lymphomas are Hypersensitive to MALT1 Protease inhibitor.
The fact that BCL10 mutants drive potent MALT1 activation even in the absence of CARD11 and confer reduced response to ibrutinib led to the hypothesis that these cells might be especially dependent on MALT1 and hence highly responsive to MALT1 inhibitors. To explore this question, the impact of three chemically and mechanistically distinct MALT1 inhibitors were tested against the set of isogenic ABC-DLBCL cells. These included: C3, a potent and specific compound that covalently inactivates the MALT1 catalytic pocket; MLT-748, a reversible allosteric compound that binds MALT1 Trp580 side chain thus to lock protease inactive and JNJ-67690246, an allosteric MALT1 inhibitor (
Isogenic BCL10WT, BCL10R58Q and BCL10E140X ABC-DLBCLs were exposed to increasing concentrations of each of these compounds for 96 h, revealing striking differences in the response profiles of BCL10E140X vs BCL10WT and BCL10R58Q (
Herein, it is shown that BCL10, one of the most frequently mutated genes in DLBCL, is a bona fide genetic driver of lymphomagenesis. Importantly, the structure-function studies reveal that these mutations occur in at least two biochemically distinct classes: missense mutations of the CARD domain and truncation mutations of the C-terminal tail. These classes of mutations seem to affect distinct aspects of BCL10 functionality and lead to biologically distinct outcomes as indicated by their differential downstream effects on MALT1 and NF-xB signaling as well as vulnerability to targeted therapies. Many of the BCL10 truncating mutations cluster between AA 135 to 174, and representatives of these mutations manifested the most powerful activation of NF-xB activity. BCL10 truncation mutants such as BCL10E140X manifested a striking increase in its ability to polymerize into its filamentous form, accompanied by potent activation of MALT1 protease activity. This tendency to polymerize, indicated for example by its lower concentration threshold may help to explain the reduced CARD11 dependency of lymphoma cells expressing BCL10E140X, and is consistent with previous studies showing that BCL10 CARD domain alone can undergo spontaneous polymerization in vitro. Although it is generally understood that CARD11 serves to nucleate BCL10 polymerization, it has been suggested that CARD11 association with BCL10 filaments is further stabilized by nascent helical BCL10 polymers. This may explain why increased association of BCL10 and CARD11 in lymphoma cells expressing BCL10E140X was observed given its greater tendency to polymerize, while at the same time being consistent with its reduced requirement for CARD11 to induce filament formation and reduced biological dependency on CARD11 in BCL10E140X expressing DLBCL cells.
Binding of the MALT1 death domain to BCL10 was unperturbed in filaments composed of BCL10E140X which is not surprising since this molecular association is mediated through the BCL10 CARD domain and proximal regions that are not affected by truncation mutation. Yet Co-IP experiments paradoxically indicated reduced interaction between BCL10 and MALT1. This prompted us to examine other modes of BCL10-MALT1 association, leading to the identification of a novel direct interaction site between MALT1 Ig1-Ig2 region and BCL10 AAs 165 to 208, a region that is lost in a majority of truncation mutants except for a cluster deleting the extreme C-terminal Ser/Thr rich tail. Importantly, MALT1 impairs BCL10 polymerization through this interaction surface, thus constituting a novel CBM negative regulatory mechanism preventing spurious polymerization of BCL10. This in turn likely explains the dramatically increased filament formation by BCL10E140X in vitro, and its greatly enhanced ability to recruit MALT1 into the polymerized CBM complex, given that loss of monomeric BCL10 and MALT1 binding would increase the pool of MALT1 to associate with filaments. These events occur due to the presence of BCL10E140X thus appear to constitute a positive feedback loop that ultimately causes potent MALT1 protease activation and biological dependency on MALT1 catalytic function. The more distal set of C-terminal truncating mutations such as Q208X, L209X and L225X retain the MALT1 Ig1-Ig2 interacting region and hence would not be expected to escape from this MALT1 inhibitory binding. Accordingly, when expressed in cells, they did not induce greater NF-xB activity than WT BCL10, suggesting that there may be additional ways in which BCL10 function could be perturbed, perhaps due to specific loss of certain as of yet undiscovered post-translational modifications. Interestingly, L225X produces a truncated form of BCL10 similar to the MALT1 protease dependent cleavage form of BCL10 R228X observed in activated T-cells as well as in ABC-DLBCL cells with chronic active BCR signaling and showed similar functional effects to WT BCL10 overexpression in NF-xB reporter assays, perhaps due to retaining both intact MALT1 biding sites. Notably, the cleaved BCL10 R228X form was shown to mediate migratory function in T-cells. BCL10 truncating mutations, translocation and amplification were also shown to occur in marginal zone lymphomas including MALT lymphomas.
In contrast, missense mutations of the BCL10 CARD domain seem to have distinct functional effects. Many of the BCL10 residues affected by mutations (e.g., R58, K63) are localized within the core of BCL10 helical structures where they make important intrastrand (Type III) and interstrand (Type I) interactions that are involved in filament formation. Along these lines an R53Q mutation affecting type III interactions might be predicted to disrupt intrastrand interactions and caused a severe defect in BCL10 CARD domain polymerization. This was however proven to be incorrect, and the sole CARD domain hotspot mutant residue Q58 engages in a novel form of type III interaction resulting in apparent formation of a hydrogen bonded glutamine network. The consequence is a shift in BCL10 polymerization kinetics, favoring the polymerized state but without dramatically altering binding to CARD11 or MALT1 and yielding a more modest gain of function phenotype. Missense mutations such as K63Q might functionally resemble R58Q since they also locate at the central core of the BCL10 CARD filament, and have positively charged residues switched to glutamine to potentially enhance, rather than disrupt, interactions.
These biochemical features of the BCL10R58Q mutant result in a hypomorphic phenotype compared to truncation mutant where they induced less potent MALT1 and NF-κB activation than BCL10E140X. However, the results also suggest that BCL10R58Q may engage in additional gain of function effects. This is suggested by the fact that cells expressing BCL10R58Q seemed relatively resistant to loss of NF-κB activity upon exposure to MALT1 inhibitors as compared to that on BCL10-WT or BCL10E140X, whereas in contrast, reduction in NF-κB activity in response to the upstream BTK inhibitors was similar between BCL10R58Q and BCL10E140X. These data prompt us to hypothesize that other functions may derive from the stability or bundling of R58Q filament. For example, more stable BCL10 filaments might enhance MALT1 recruitment and activation of TRAF6, which could partially support NF-κB independently from the MALT1 proteolytic function, or activate NF-κB through other alternative means such as linear ubiquitylation (LUBAC) associated mechanisms. Engagement of these or other MALT1 paracaspase independent biochemical effects would be consistent with BCL10R58Q DLBCL cells retaining greater dependency on CARD11 and hence upstream signaling and responsiveness to BTKi.
Overall, our data spotlight the complexities involved in developing precision therapies for DLBCLs and other tumors. The identification of chronic active BCR signaling as a characteristic of ABC-DLBCLs has led to intense efforts to integrate BTKi into multi-modality regimens. However, to date, it is clear that many patients still do not benefit from the addition of such compounds. The data point to biochemical mechanisms that might help to explain this, as exemplified most clearly by the BTKi resistance conferred by BCL10 truncation mutants and this suggests that such patients should not be treated with BTKi containing regimens.
Instead, patients with BCL10 truncation mutations would likely best be served by incorporating MALT1 inhibitors. This concept is feasible since several MALT1 inhibitors are already in clinical trials. Although these findings could also be relevant to acquired BTK inhibitor resistance, as of yet BCL10 mutations have not been identified in this setting. Similar considerations may apply to other (but not all) mutations downstream of BTK, as exemplified by the case of CARD11 coiled-coil domain mutants, which induce resistance to BTKi but not MALT1i. However, the fact that BCL10 CARD domain mutations may still retain BTKi responsiveness further underlines the need for rigorous study of signaling pathway mutations such as these, and perhaps eventually the need for targeted sequencing studies to provide a precision therapy “map” of these tumors allowing selection (or even combination) of the targeted therapies (e.g., BTKi vs MALT1 i) appropriate to their specific signaling scenarios.
Raji, HBL1, TMD8 and RIVA were cultured in RPMI supplemented with 10% FBS, 2 mM L-glutamine and 10 mM HEPES. OCI-Ly10 was cultured in Iscove's medium supplemented with 20% FBS, 2 mM L-glutamine. 293T was cultured in Dulbecco's Modified Eagle Medium with 10% FBS. All cell lines were authenticated by University of Arizona Genetic Core, grown in presence of 1% penicillin G and streptomycin and at 37° C. in a humidified atmosphere of 5% CO2. HBL1 and RIVA was obtained from Jose A. Martinez-Climent (Universidad de Navarra, Pamplona, Spain); TMD8 was obtained from Louis M. Staudt (National Cancer Institute, Bethesda, Maryland, USA); OCI-Ly1 O cell lines were obtained from the Ontario Cancer Institute (OCI).
Lentiviruses were produced in 293T cells by co-transfecting shRNA (short hairpin sequences are: shNonTargeting: CAACAAGATGAAGAGCACCAA (SEQ ID NO:7); shCARD11#1: GGACGACAACTACAACTTAGC (SEQ ID NO:8); shCARD11#3: TGGTCAAGAAGCTGACGATTC (SEQ ID NO:9)) or overexpression vectors with packaging vectors psPax2 (Addgene #12260, RRID: Addgene_12260) and psMD2.g (Addgene #12259, RRID: Addgene_12259) at the 4:3:1 ratio in serum free media. The supernatant containing virus particles were harvested 48 h and 72 h after transfection, filtered through 0.45 μm filter and then concentrated with PEG-it according to manufacturer's instructions (LV825 Å-1, System Biosciences). Virus was resuspended with PBS containing 25 μM HEPES and added to cells for overnight infection. Cells were selected 24 h post transfection by adding puromycin (Sigma), blasticidin (Invivogen) or G418 (Life Technologies) for at least 48 h.
All mice experiments were approved by Institutional Animal Care & Use Committee (IACUC) at Weill Cornell Medicine and were performed following the IACUC guidelines. Eight to ten weeks of female NOD.Cg-prkdcscid Il2rgtm1Wj1/SzJ (NSG, RRID: IMSR_JAX: 005557) mice were obtained from The Research Animal Resource Center (RARC) at Weill Cornell Medicine. 5×106 HBL1 or 107 million OCI-Ly and their derived engineered cells were resuspended with PBS/Matrigel (1:1) and subcutaneously injected to the right flank of mice. Treatments were started when tumor volume reached an average of 100 mm3. Ibrutinib was prepared in corn oil with 10% (v/v) DMSO or 0.5% methylcellulose in water and administrated p.o. with 25 or 37.5 mg/kg once per day. JNJ-67690246 was prepared in PEG400 with 10% (w/v) PVPVA64 and administrated p.o. with 100 mg/kg twice per day. Tumor volume was monitored 2-3 times/week with digital caliper and calculated using the following formula: smallest diameter2× largest diameter×0.5.
DLBCL cell lines were cultured in exponential condition and the cell growth was determined by CellTiter Glo (Promega). 3000-5000 cells were seeded and cultured in each well of 384 well plate for 96 h and treated with compounds every 48 h. Luminescence was read at the endpoint with the Synergy NEO microplate reader (BioTek). The value of compound treated cells was normalized to their vehicle treated controls and then used to calculate IC50 in GraphPad Prism (RRID:SCR_002798).
For NF-κB reporter assay in 293T, the plasmids expressing different BCL10 mutations were transiently transfected into 293T cells using Lipofectamine (Invitrogen). Renilla luciferase plasmid was co-transfected as an internal control. 24 h after transfection, cells were collected and luciferase activities were measured in Synergy NEO microplate reader (BioTek) with the Dual Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions and normalized to Renilla luciferase activity.
To generate stable NF-κB reporter cells, the lentivirus expressing 3×NF-κB response element followed by a luciferase firefly was made and infect the parental cells. Puromycin was then added for antibiotic selection 24 h after infection. Reporter cells were further validated by BTK inhibitor and MALT1 protease inhibitor treatment and PMA/1O stimulation. NF-κB reporter cells expressing BCL10 were generated by infecting reporter cells with different lentiviral BCL10 isoforms (co-expressing GFP), followed by sorting out GFP+ cells. Stable NF-κB reporter cells were harvested at the indicated conditions and lysed with 1× passive lysis buffer at room temperature for 20 min. The lysate was briefly centrifuged and the supernatant was collected for luciferase activity. All the assays were presented as mean±SEM of three independent experiments.
The generation of Raji MALT1 GloSensor reporter cell has been described All other GloSensor reporter cells were generated by infecting parental cells with lentiviral MALT1-GloSensor (pLex306 backbone), followed by antibiotic (blasticidin) selection. All derived GloSensor cells were further validated by MALT1 protease inhibitor treatment and PMA/IO stimulation.
108 lymphoma cells were collected, washed with cold PBS and resuspended with lysis buffer (1% NP40, 10% glycerol, 150 mM NaCl, 20 mM Tris-HCL pH 7.5, and freshly added protease inhibitors). The lysates were centrifuged at 15,000 g, 4° C. for 15 min and the supernatant was then collected and incubated with 50 μL equilibrated anti-Flag magnetic beads (Sigma-Aldrich Cat #M8823, RRID:AB_2637089) at 4° C. for 3 h. The beads were washed 3 times with lysis buffer and followed by 3 times washing with the lysis buffer without NP40. SDS loading buffer without non-reducing reagent was added and boiled at 95° C. for 5 min. The elution was added for 0-mercaptoethanol (final 10%), and ready to run western blot after boiling at 95° C. for 5 min.
Whole cell lysates extracted with RIPA buffer or IP elution were separated by SDS-PAGE gels and followed by transferring to PVDF membranes. Membranes were incubated with indicated primary antibodies: anti-Flag (Sigma-Aldrich Cat #F3165, RRID:AB_259529), anti-MALT1 (Santa Cruz Biotechnology Cat #sc-46677, RRID:AB_627909), anti-CARD11 (Abcam Cat #ab113409, RRID:AB_10861854), anti-O-Actin (AC-15, Sigma-Aldrich), and then mouse/rabbit peroxidase-conjugated secondary antibodies (Cell Signaling Technology). Protein intensity was detected with enhanced chemiluminescence using ChemiDoc imaging system (Bio Rad).
The Driver mutation analysis is performed using Fishhook (https.//github.com/mskilab/fishHook) on a total of 243 ABC-DLBCL cases from NCI cohort. Fishhook is a model built with mutational calls, a set of hypothesis intervals, eligible genomic ranges and a set of genomic covariates that identifies the depletion and enrichment of genomic interval statistically. The model used a gamma-Poisson regression to implement the maximum likelihood approximation with consideration of user assigned covariates and expected mutation density to the hypothesis. With this approach, the model helps us to identify enriched mutations with consideration like chromatin features, sequence context composition and gene expression.
Eligible region is defined using genecode v19 and fractional coverage of hg19 positions provided by Agilent exome coverage. We also fed the model covariates that defines B cell specific transcriptional states and chromatin state information for the model. The covariates of ABC specific transcriptional states are generated by number of the overlap between the TSS site of genes TPM >2 in the half the ABC-DLBCL cases from the same NCI cohort within 10 kb the eligible regions. The covariates of B-cell specific chromatin states are generated by number of the overlap between H3K27Ac Peaks that previously reported in the B cell within 100 kb of the eligible regions and the ATAC peaks of the B cells within 10 kb of the eligible. A total of 3 covariates was fed to the fishhook model. Here we noted genes of FDR<0.05 and BCL10 have an FDR of 1.4e−10. QQ-plot is plotted by pairing observed −log 10 transformed quantiles of observed P values (y-axis) with their corresponding −log 10 transformed quantiles from the uniform distribution (x-axis).
MALT1 protease activity was assessed in vitro using full-length MALT1 protein (Strep-MALT1 (1-824)-His) purified from baculovirus-infected insect cells. The tetrapeptide LRSR is coupled to 7-amino-4-methylcoumarin (AMC) and provides a quenched, fluorescent substrate for the MALT1 protease (SM Biochemicals). Cleavage of AMC from the arginine residue results in an increase in coumarin fluorescence measured at 460 nm (excitation 355 nm). Diluted compounds were pre-incubated with MALT1 enzyme for 50 minutes at room temperature (RT). Substrate was subsequently added and the reaction was then incubated for 4 h at RT, after which fluorescence was measured.
Secretion of the IL-6 and IL-10 cytokines by OCI-Ly3 ABC-DLBCL cells was measured using a Mesoscale assay (MSD). MALT1 inhibition results in a decrease of IL-6/10 secretion. OCI-Ly3 cells were treated with diluted compounds for 24 h at 37° C. and 5% CO2. After 24 h of incubation, 50 μL of the supernatant was transferred to an MSD plate (V-Plex Proinflammation Panel 1 [human] kit) and incubated for 2 h at RT followed by a 2 h incubation with IL-6/10 antibody solution. Plates were read on a SECTOR imager.
All constructs of BCL10, MALT1 are from human sequences. Full-length WT and mutant BCL10 constructs with N-terminal MBP tag were generated in vector pDB-His-MBP with a 3C protease site between MBP and BCL10. Full length His-tagged MALT1 cloned into pET29b was purchased from Addgene (RRID:Addgene_48968) and was expressed in E. coli.
All proteins were purified by either Ni-NTA resin (Qiagen) or Amylase resin followed by gel filtration chromatography (Superdex 200 10/300 GL, GE Healthcare). BCL10 FL and mutant filaments were purified by MBP affinity column in binding buffer containing 25 mM Tris at pH 7.5, 300 mM NaCl, 1 mM TCEP, followed by Superdex 200 gel filtration chromatography in buffer containing 20 mM Tris at pH 7.5, 150 mM NaCl and 1 mM TCEP, resulted in isolation of a monomeric fraction of BCL10. Then monomeric MBP-BCL10 was cleaved by 3C protease and incubated at RT for 2 hours in order to allow filaments formation. This step was followed by another Superdex 200 gel filtration chromatography and BCL10 filaments were isolated at the void peak for structure determination and thermostability assay. Isolation of BCL10 (1-140)-MALT1 complex was performed in a similar way in which BCL10 and MALT1 were purified separately. BCL10 pre-formed filaments after 3C cleavage were added mixed together with FL MALT1 to form a complex.
Copper grids coated with layers of plastic and thin carbon film were glow-charged before 5 μI of purified complexes were applied. Samples were left on the grids for 1 minute followed by negative staining with 1% uranyl formate for 30 seconds and air dried. In vitro BCL10WT and mutants, BCL10/MALT1 and CBM were imaged with JEOL 1200EX or Tecnai G2 Spirit BioTWIN at Harvard Medical School EM facility operating at 80 keV.
Cryo grids for BCL10 R58Q and BCL10 E140X/MALT1 filaments were prepared by applying 3 μl of protein sample on a c-flat (1.2/1.3) 300 mesh grids. Grids were plunged by using vitrobot (FEI) at 4° c. with 3 sec blotting and force 4. For BCL10R58Q data collection, 3439 movies were collected at super resolution mode with using Arctica microscope at UMASS facility, operated at 200 kv facility with k2 camera. The movies were collected automatically using SerialEM data collection at a nominal magnification of 36,000 and a pixel size of 0.435 Å, with a total dose of 38 e/Å2 which was fractionated into 40 movie frames, with defocus range of −1-2.5 μm. For BCL10 E140X-MALT1 collection, 700 movies were collected at super resolution mode with using 300 kV FEI Titan Krios microscope equipped with FEI Falcon II detector at PNCC cryo-EM facility, operated at 300 kv with Falcon3 camera. The movies were collected automatically using SerialEM data collection at a nominal magnification of 47,000 and a pixel size of 0.4 Å, with a total dose of 55 e/Å2 which was fractionated into 40 movie frames.
For helical reconstruction of BCL10 R58Q and BCL10 E140X/MALT1, Motioncor2 was used for drift correction and Micrographs were CTF corrected by using CTFFIND4. Data was processed with using Relion (3.1). The resolutions of the reconstruction were determined by FSC to 4.6 Å and 4.3 Å, respectively. Model building was performed in program Coot36. Refinement was performed against the using Phenix refine50. Structural presentations were generated using Pymol (Delano Scientific) and Chimera.
Time lapsed movies of full length labeled Alexa488-BCL10 FL, BCL10 R58Q and BCL10 E140X were recorded with using Nikon spinning disk confocal microscope at Harvard Micron facility for periods of 30 min-1 hr with 1 minute interval, with using ×100 objective. 3C was added at a sub-molar ratio to allow MBP cleavage to occur within 2-3 minutes in order to provide ample time for setting up the microscope and starting the recording.
For concentration determination, labeled Alexa488-BCL10 FL, R58Q and E140X filaments were formed at increasing concentrations ranging between 0.1 M-1 M. 4 h after cleavage with 3C and incubation at RT, samples were placed on a 35 mm bottom glass dish and imaged with using spinning disk confocal microscope with using ×100 objective.
Purified full length MBP-BCL10, BCL10 R58Q and BCL10 E140X were mixed with 5-fold molar excess of Alexa-488-C5-maleimide (Invitrogen) and incubated at 4° C. temperature for O/N. Gel filtration chromatography (Superdex 200, GE Healthcare) was used to remove free dyes. Fluorescence polarization assay was performed at 18° C. in buffer containing 20 mM Tris at pH 7.5, 150 mM NaCl, and 0.5 mM TCEP and in 20 μI volume. 3 μM of labeled MBP-BCL10 were cleaved with 3C in the presence of increasing amount of MALT1. The fluorescence quenching was measured right after 3C addition for 2 h by using NEO plate reader (Biotek) using excitation/emission wavelengths of 495 nm/519 nm.
Purified BCL10 FL, R58Q and E140X filaments purified from the void peak of Superdex200 were mixed with 1-fold protein thermal shift dye (Thermo Fisher Scientific). Thermal scanning (25 to 95° C. at 1° C./min) was performed and melting curves were recorded on a StepOne RT-PCR machine. Data analysis was done by Protein Thermal Shift™ Software (Thermo Fisher Scientific).
HBL1 cells cultured in fresh media were mixed in 1:1 ratio with cytospin. Cells were spined at 800×g for 5 min. Cell pellets were resuspended with cytospin and plated on CELLview 4-compartment dishes (Greiner Bio-One). Cells were left at RT o/n and were fixed with 100% cold methanol for 5 minutes at −20° C., followed by cell permeabilization with 0.1% Triton X-100 in PBS-Tween (PSST) for 10 minutes. Cells were incubated with blocking buffer containing 3% BSA for 3 h, in order to minimize non-specific binding. After blocking. Cells were incubated overnight at 4° C. with FLAG primary antibody (Sigma-Aldrich Cat #F1804, RRID:AB_262044). After incubation, cells were washed with PBST 3 times and incubated with AlexaFluor488-conjugated anti-mouse IgG (Abcam Cat #ab150113, RRID:AB_2576208) 5 for 1 h at room temperature. After incubation, cells were washed with PBS and then stained with Hoechst for 10 minutes (1:500, Immunochemistry Technologies, Cat #639). Cells were imaged using spinning disk confocal microscope with using ×100 objective.
IHC staining of p65
Formalin-fixed paraffin-embedded (FFPE) tissue sections of 4 μm thickness were cut from a tissue microarray composed of duplicate 0.6 mm cores from 298 cases of de nova DLBCL. Slides were processed using standard immunohistochemistry protocols and stained with an antibody against NF-xB p65 (Cell Signaling Technology Cat #8242, RRID:AB_10859369, 1:500 dilution). Appropriate staining was verified in sections of benign tonsil, heart and liver. Stained slides were assessed by an expert hematopathologist for nuclear expression of p65 in DLBCL tumor cells, scored as a percentage of tumor cell nuclei.
All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.
The following Statements summarize aspects and features of the invention.
The specific methods and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims.
As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to “a nucleic acid” or “a protein” or “a cell” includes a plurality of such nucleic acids, proteins, or cells (for example, a solution or dried preparation of nucleic acids or expression cassettes, a solution of proteins, or a population of cells), and so forth. In this document, the term “or” is used to refer to a nonexclusive or, such that “A or B” includes “A but not B,” “B but not A,” and “A and B,” unless otherwise indicated.
Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.
The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention.
The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
This application claims the benefit of the filing date of U.S. application No. 63/349,459, filed on Jun. 6, 2022, the disclosure of which is incorporated by reference herein.
This invention was made with government support under CA220499 and CA249843 awarded by National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63349459 | Jun 2022 | US |
