Patent Application
20200399714
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jan. 29, 2016, is named Sequence_Listing_030258-069537-C and is 5,407 bytes in size.
The present invention relates to the fields of biomarker analysis, diagnosis, prognosis, patient monitoring, therapy selection, risk assessment, and novel therapeutic agents for human or other animal subjects, particularly the profiling of biological materials from a microvesicle fraction of a biological sample, and novel therapies related to microvesicles.
Increasing knowledge of the genetic and epigenetic changes occurring in cancer cells provides an opportunity to detect, characterize, and monitor tumors by analysing tumor-related nucleic acid sequences and profiles. Cancer-related changes include specific mutations in gene sequences (Cortez and Calin, 2009; Diehl et al., 2008; Network, 2008; Parsons et al., 2008), up- and down-regulation of mRNA and miRNA expression (Cortez and Calin, 2009; Itadani et al., 2008; Novakova et al., 2009), mRNA splicing variations, changes in DNA methylation patterns (Cadieux et al., 2006; Kristensen and Hansen, 2009), amplification and deletion of genomic regions (Cowell and Lo, 2009), and aberrant expression of repeated DNA sequences (Ting et al., 2011). Various molecular diagnostic tests such as mutational analysis, methylation status of genomic DNA, and gene expression analysis may detect these changes.
Research uncovering the molecular mechanisms underlying cancer improves our understanding of how to select and design optimal treatment regimes for a patient's disease based on the molecular makeup of his or her particular cancer. Over the past few years, this has led to a significant increase in the development of therapies specifically targeting gene mutations involved in disease progression. In parallel, the use of molecular diagnostic testing for cancer diagnosis, prognosis and treatment selection has expanded, driven by the need for more cost efficient applications of expensive therapies. Current molecular diagnostics has so far almost exclusively relied on assaying cancer cells from tissue biopsy by needle aspiration or surgical resection.
However, the ability to perform these tests using a blood sample is sometimes more desirable than using a tissue sample from a cancer patient because, frequently, fresh tissue samples are difficult or impossible to obtain, and archival tissue samples are often less relevant to the current status of the patient's disease. A less invasive approach using a more easily accessible biological sample, e.g., a blood sample, has wide ranging implications in terms of patient welfare, the ability to conduct longitudinal disease monitoring, and the ability to obtain expression profiles even when tissue cells are not easily accessible, e.g., in ovarian or brain cancer patients.
Currently, gene expression profiling of blood samples involves the analysis of RNA extracted from peripheral blood mononuclear cells (PBMC) (Hakonarson et al., 2005) or circulating tumor cells (CTC) (Cristofanilli and Mendelsohn, 2006).
Many types of cancer cells release an abundance of small membrane-bound vesicles, which have been observed on their surface in culture (Skog et al., 2008). These microvesicles are generated and released through several processes and vary in size (from about 30 nm to about 1 μm in diameter) and content (Simons and Raposo, 2009). Microvesicles can bud/bleb off the plasma membrane of cells, much like retrovirus particles (Booth et al., 2006), be released by fusion of endosomal-derived multivesicular bodies with the plasma membrane (Lakkaraju and Rodriguez-Boulan, 2008), or be formed as apoptotic bodies during programmed cell death (Halicka et al., 2000). In addition, defective (i.e., non-infectious without helper-virus) retrovirus particles derived from human endogenous retroviral (HERV) elements may be found within microvesicle populations (Voisset et al., 2008).
Microvesicles from various cell sources have been studied with respect to protein and lipid content (Iero et al., 2008; Thery et al., 2002; Wieckowski and Whiteside, 2006). They have also been observed to contain cellular RNAs and mitochondria DNA (Baj-Krzyworzeka et al., 2006; Guescini et al.; Skog et al., 2008; Valadi et al., 2007) and may facilitate the transfer of genetic information between cells and/or act as a “release hatch” for DNA, RNA, and/or proteins that the cell is trying to eliminate. Both mRNA and miRNA in microvesicles are observed to be functional following uptake by recipient cells (Burghoff et al., 2008; Deregibus et al., 2007; Ratajczak et al., 2006; Skog et al., 2008; Valadi et al., 2007; Yuan et al., 2009) and it has also been shown that apoptotic bodies can mediate horizontal gene transfer between cells (Bergsmedh et al., 2001).
Knowing the expression profile, mutational profile, or both expression and mutational profiles of individual cancer is helpful for personalized medicine as many drugs target specific pathways affected by the genetic status of the tumors. Detection of genetic biomarkers in blood samples from tumor patients is challenging due to the need for high sensitivity against a background of normal cellular nucleic acids found circulating in blood. Microvesicles released by tumor cells into the circulation can provide a window into the genetic status of individual tumors (Skog et al., 2008).
The present invention is directed to microvesicular nucleic acid profiles of microvesicle fractions obtained from a biological sample from a subject, methods for aiding in diagnosis, prognosis, patient monitoring, treatment selection, and risk assessment based on detecting the presence or absence of a genetic aberration in a nucleic acid profile, or changes in a polypeptide profile of a microvesicle fraction obtained from a biological sample from a patient, and therapeutic agents and methods of cancer treatment or prevention.
The present invention is based on the discovery of various types of cancer-related biological materials within microvesicles. The biological materials within microvesicles from a biological sample may be characterized and measured, and the results this analysis may be used to aid in biomarker discovery, as well as in diagnosis, prognosis, monitoring, treatment selection, or risk assessment for a disease or other medical condition.
In one aspect, the biological materials are nucleic acids and the invention is a method for assaying a biological sample comprising the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject; b) extracting nucleic acid from the fraction; and c) detecting the presence or absence of a biomarker in the extracted nucleic acid. In a method for aiding in the diagnosis, prognosis or monitoring of a subject, the biomarker is a genetic aberration that is associated with the diagnosis, prognosis, or determination of the status or stage of a disease or other medical condition in the subject. In a method for aiding in treatment selection for a subject in need of or potentially in need of therapeutic treatment, the biomarker is a genetic aberration that is associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition in the subject. In a method for aiding in a determination of a subject's risk of developing a disease or other medical condition, the biomarker is a genetic aberration that is associated with the subject's risk of developing a disease or other medical condition.
In some embodiments of the above methods, the genetic aberration is in or corresponds to a c-myc gene, a transposable element, a retrotransposon element, a satellite correlated gene, a repeated DNA element, a non-coding RNA other than miRNA, or a fragment of any of the foregoing.
In other embodiments of the above methods, the genetic aberration is in or corresponds to a transposable element listed in Table 4 or Table 5, or a fragment thereof. For one example, the genetic aberration is in or corresponds to retrotransposon elements including LINE, SINE or HERV, or a fragment thereof. For another example, the genetic aberration is in or corresponds to a retrotransposon element that is Line1 (L1), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.
In further embodiments of the above methods, the genetic aberration is in or corresponds to a satellite-correlated gene listed in Table 6, or a fragment thereof, a repeated DNA element listed in Table 8, or a fragment thereof; or a non-coding RNA listed in Table 9 (other than miRNA) or a fragment thereof. The non-coding RNA, for example, can be 7SL RNA.
In yet further embodiments of the above methods, the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof.
In another aspect, the biological material is protein or polypeptide and the invention is a method for assaying a biological sample from a subject comprising the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject b) measuring a protein or polypeptide activity in the fraction; and c) determining whether the protein or polypeptide activity is higher or lower than a normal or average activity for the same protein or polypeptide. In a method for aiding in the diagnosis, prognosis or monitoring of a subject, an elevated or lowered activity is associated with a diagnosis, prognosis, status or stage of a disease or other medical condition in the subject. In a method for aiding in directing treatment of a subject, an elevated or lowered activity is associated with a disease or other medical condition or with the subject's responsiveness to a specific therapy for the disease or other medical condition. In a method in aid of a determination of a subject's risk of developing a disease or other medical condition, an elevated or lowered activity is associated with the subject's risk of developing a disease or other medical condition. In some embodiments of the foregoing methods, the polypeptide is an enzyme. For example, the polypeptide can be a reverse transcriptase and the method is to determine whether the reverse transcriptase activity is higher than a normal or average activity for reverse transcriptase.
In the present invention, the methods may further comprise a step of enriching the microvesicle fraction for microvesicles originating from a specific cell type. The enrichment may be achieved, for example, by affinity purification with antibody-coated magnetic beads.
In the present invention, the biological sample from a subject can be a bodily fluid, e.g., blood, serum, plasma, or urine. The subject can be a human subject. When the subject is a human, the disease or other medical condition may be brain cancer such as medulloblastoma and glioblastoma, or melanoma.
In the present invention, the presence or absence of a biomarker in the extracted nucleic acid can be determined by various techniques, e.g., microarray analysis, PCR, quantitative PCR, Digital Gene Expression, or direct sequencing.
In yet another aspect, the present invention is a kit for genetic analysis of a microvesicle fraction obtained from a body fluid sample from a subject, comprising, in a suitable container, one or more reagents capable of hybridizing to or amplifying a nucleic acid corresponding to one or more of the genetic aberrations referenced above.
In yet another aspect, the present invention is an oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the oligonucleotides on the array are designed to hybridize to one or more nucleic acids corresponding to one or more of the genetic aberrations referenced above.
In yet another aspect, the present invention is a profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject. The profile may be a genetic aberration in or corresponding to: a) cancer gene listed in Table 2 or 3, or a fragment thereof; b) a transposable element from the subject's genome, preferably an element listed in Table 4 or 5, or a fragment of any of the foregoing; c) a retrotransposon element from the subject's genome, preferably LINE, SINE or HERV, more preferably LINE1 (L1), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment of any of the foregoing; d) a satellite correlated gene from the subject's genome, preferably a satellite correlated gene listed in Table 6, or a fragment of any of the foregoing; e) an element of repeated DNA from the subject's genome, preferably an element listed in Table 8, or a fragment of any of the foregoing; or f) a non-coding RNA other than miRNA, preferably a species listed in Table 9, or a fragment of any of the foregoing. In one embodiment, the profile is a genetic aberration in the cancer gene c-myc. In another embodiment, the profile is a genetic aberration in the non-coding 7SL RNA.
In all of the foregoing nucleic acid-related embodiments of the invention, the genetic aberration can be a species of nucleic acid, the level of expression of a nucleic acid, a nucleic acid variant; or a combination of any of the foregoing. For example, the genetic aberration may be an RNA expression profile. For another example, the genetic aberration may be a fragment of a nucleic acid, and in some instances, the fragment contains more than 10 nucleotides.
In yet another aspect, the present invention is a method of identifying a potential new nucleic acid biomarker associated with a disease or other medical condition, status or stage of disease or other medical condition, a subject's risk of developing a disease or other medical condition, or a subject's responsiveness to a specific therapy for a disease or other medical condition. The method comprises the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject; b) extracting nucleic acid from the fraction; c) preparing a profile according to any of the above-described profiles; and d) comparing the profile of step c) to a control or reference profile and selecting one or more potential new biomarkers based on one or more differences between the profile of step c) and the control or reference profile.
In yet anther aspect, the present invention is a method of treating a subject having a form of cancer in which cancer cells secrete microvesicles. The method comprises administering to the subject a therapeutically effective amount of a composition including an inhibitor of microvesicle secretion; an inhibitor of a reverse transcriptase; a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles; or any combination of the forgoing. In some embodiments, the inhibitor of microvesicle secretion is an inhibitor of RAB GTPase which may be Rab 27a, Rab 27b or Rab 35. In other embodiments, the inhibitor of a reverse transcriptase is a nucleoside analog selected from the group comprising 3′-azido2′,3′-dideoxythymidine (AZT); 2′,3′-dideoxyinosine (ddI), 2′,3′-didehyro-3′-deoxythymidine (d4T); nevirapine and efavirenz. In further embodiments, the inhibitor of a reverse transcriptase is RNAi targeting the reverse transcriptase gene. In still further embodiments, the microvesicle neutralizer is a biological agent that binds microvesicles and destroys the integrity of the microvesicles.
In yet another aspect, the present invention is a pharmaceutical composition comprising, in a suitable pharmaceutical carrier: a) an inhibitor of microvesicle secretion, particularly an inhibitor of RAB GTPase, and more particularly Rab 27a, Rab 27b or Rab 35); b) an inhibitor of reverse transcriptase, particularly a nucleoside analog, more particularly 3′-azido2′,3′-dideoxythymidine (AZT); 2′,3′-dideoxyinosine (ddI), 2′,3′-didehyro-3′-deoxythymidine (d4T); nevirapine, or efavirenz, or an RNAi targeting the reverse transcriptase gene; c) a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles, particularly a biological agent that binds microvesicles and destroys the integrity of the microvesicles; or d) a combination of any of the foregoing.
As described above, cell-derived vesicles are heterogeneous in size with diameters ranging from about 10 nm to about 1 μm. For example, “exosomes” have diameters of approximately 30 to 100 nm, with shedding microvesicles and apoptotic bodies often described as larger (Orozco and Lewis, 2010). Exosomes, shedding microvesicles, microparticles, nanovesicles, apoptotic bodies, nanoparticles and membrane vesicles co-isolate using various techniques and will, therefore, collectively be referred to throughout this specification as “microvesicles” unless otherwise expressly denoted.
The present invention is based on the discovery that cancer-related biological materials such as transposable elements, oncogenes, and reverse transcriptase (RT) can be detected in microvesicles.
The biological materials in microvesicles can be genetic materials, protein materials, lipid materials, or any combination of genetic, protein and lipid materials.
Genetic materials include nucleic acids, which can be DNA and its variations, e.g., double-stranded DNA (“dsDNA”), single-stranded DNA (“ssDNA”), genomic DNA, cDNA; RNA and its variations, e.g., mRNA, rRNA, tRNA, microRNA, siRNA, piwi-RNA, coding RNA, non-coding RNA, transposons, satellite repeats, minisatellite repeats, microsatellite repeats, Interspersed repeats such as short interspersed nuclear elements (SINES), e.g. but not limited to Alus, and long interspersed nuclear elements (LINES), e.g. but not limited to LINE-1, human endogenous retroviruses (HERVs), e.g. but not limited to HERV-K; or any combination of any of the above DNA and RNA species.
Protein materials can be any polypeptides and polypeptide variants recognized in the art. For convenience, “polypeptide” as disclosed in this application refers to both a polypeptide without modifications and a polypeptide variant with modifications. Polypeptides are composed of a chain of amino acids encoded by genetic materials as is well known in the art. For example, a reverse transcriptase is a polypeptide that can function as an enzyme to transcribe RNA into DNA. Polypeptide variants can include, e.g. polypeptides modified by acylation, ubiquitination, SUMOYlation, alkylation, amidation, glycosylation, hydroxylation, carboxylation, phosphorylations, oxidation, sulfation, selenoylation, nitrosylation, or glutathionylation.
Lipid materials include fats, waxes, sterols, fat-soluble vitamins (such as vitamins A, D, E and K), monoglycerides, diglycerides, phospholipids, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids, and polyketides.
Microvesicles may be isolated from tissue, cells or other biological samples from a subject. For example, the biological sample may be a bodily fluid from the subject, preferably collected from a peripheral location. Bodily fluids include but are not limited to blood, plasma, serum, urine, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid and combinations thereof. In some embodiments, the preferred bodily fluid for use as the biological sample is urine. In other embodiments, the preferred bodily fluid is serum.
The term “subject” is intended to include all animals shown to or expected to harbor nucleic acid-containing microvesicles. In particular embodiments, the subject is a mammal, e.g., a human or nonhuman primate, a dog, cat, horse, cow, other farm animal, or rodent (e.g. a mouse, rat, guinea pig, etc.). In one embodiment, the subject is an avian, amphibian or fish. The terms “subject,” “individual” and “patient” are used interchangeably herein.
Methods for isolating microvesicles from a biological sample and extracting biological materials from the isolated microvesicles are described in this application as well as in scientific publications and patent applications, e.g. (Chen et al., 2010; Miranda et al., 2010; Skog et al., 2008). See also WO 2009/100029, WO 2011/009104, WO 2011/031892 and WO 2011/031877. These publications are incorporated herein by reference for their disclosure pertaining to isolation and extraction methods and techniques.
A profile, as used herein, refers to a set of data or a collection of characteristics or features, which can be determined through the quantitative or qualitative analysis of one or more biological materials, particularly biological materials contained in microvesicles isolated from a subject. The biological materials, extraction of the biological materials, and various types of analysis of the biological materials are described herein. A control or reference profile is a profile obtained from the literature, from an independent subject or subjects, or from the same subject at a different time point.
In one aspect, the present invention includes a profile of one or more nucleic acids extracted from microvesicles. The nucleic acids include both RNA and DNA. A nucleic acid profile may be an RNA profile, a DNA profile, or may include profiles of both RNA and DNA. In other aspects, the present invention includes a profile of one or more protein or polypeptide species extracted from microvesicles, particularly, a level of protein activity.
In all of the various aspects of the invention described herein in relation to RNA, the RNA can be coding RNA, e.g., messenger RNA. The RNA can also be non-coding RNA (ncRNA), e.g., ribosomal RNA (rRNA), transfer RNA (tRNA), microRNA, and other non-coding transcripts that may originate from genomic DNA. See Table 9 for more examples of non-coding RNA. Non-coding RNA transcripts may include transcripts from satellite repeats or from transposons, which may be Class I retrotransposons or Class II DNA transposons.
In all of the various aspects of the invention described herein in relation to DNA, the DNA can be single-stranded DNA, e.g., cDNA, which is reverse transcribed from RNA. Reverse transcription is usually mediated by reverse transcriptase encoded by a reverse transcriptase gene in a cell. The DNA can also be single stranded DNA generated during DNA replication. Genomic DNA replicates in the nucleus while the cell is dividing. Some of the replicated DNA may come off its template, be exported out of the nucleus, and packaged into microvesicles. The DNA can further be fragments of double-stranded DNA.
In addition, the DNA can be non-coding DNA (ncDNA). The human genome contains only about 20,000 protein-coding genes, representing less than 2% of the genome. The ratio of non-coding to protein-coding DNA sequences increases as a function of developmental complexity (Mattick, 2004). Prokaryotes have less than 25% ncDNA, simple eukaryotes have between 25-50%, more complex multicellular organisms like plants and animals have more than 50% ncDNA, with humans having about 98.5% ncDNA (Mattick, 2004)
Some of the ncDNA from the genome is transcribed into ncRNA. NcRNAs have been implicated in many important processes in the cell, e.g., enzymes (ribozymes), binding specifically to proteins (aptamers), and regulating gene activity at both the transcriptional and post-transcriptional levels. Examples of ncRNA classes and examples of their functions are shown in Table 9.
Many of the ncRNA species have multiple functions. For example, Ribonuclease P (RNase P) is a ribozyme which is involved in maturation of tRNA by cleaving the precursor tRNA, and nuclear RNaseP can also act as a transcription factor (Jarrous and Reiner, 2007). In addition, bifunctional RNAs have also been described that function both as mRNA and as regulatory ncRNAs (Dinger et al., 2008) or have two different ncRNA functions (Ender et al., 2008).
One example of the many long ncRNAs is the X-inactive specific transcript (Xist) expressed by the inactive X-chromosome, which is used to silence the extra X-chromosome in females (Ng et al., 2007). This RNA transcript binds to and inactivates the same X chromosome from which it is produced.
Another example is the HOX antisense intergenic RNA (HOTAIR) (Rinn et al., 2007). This RNA is expressed from chromosome 12, but controls gene expression on chromosome 2, affecting the skin phenotype on different parts of the body surface (Rinn et al., 2007) and also being involved in cancer metastasis (Gupta et al., 2010).
Yet another example of ncRNA is PCA3, a biomarker for prostate cancer (Day et al., 2011). PCA3 can be readily measured in the RNA from urine microvesicles which can be extracted using a rapid filtration concentrator method (Miranda et al., 2010; Nilsson et al., 2009). Another biomarker for prostate cancer is PCGEM1, which is an ncRNA transcript over-expressed in prostate cancer (Srikantan et al., 2000).
Yet another example of ncRNA is NEAT2/MALAT1, which has been found to be upregulated during metastasis of non-small cell lung cancer, and was correlated with poor patient survival (Ji et al., 2003).
Microvesicles contain a substantial array of the cellular gene expression profile from the cells from which they originate (their parent cells) at any given time. That is, substantially all the RNAs expressed in the parent cell are present within the microvesicle, although the quantitative levels of these RNAs may differ in the microvesicle compared to the parent cell. Substantially all the genes from the parent cell can, therefore, be tracked in the microvesicle fraction. In addition, microvesicles contain DNA from the parent cell, which corresponds to diagnostically relevant aspects of the subject's genome. Therefore, a nucleic acid profile from microvesicles may be associated with a disease or other medical condition.
In one embodiment, the disease is a neurological disease or other medical condition, e.g., Alzheimer's disease. The nucleic acid profile for Alzheimer's disease may be a profile of early-onset familial Alzheimer's disease, associated genes including, but not limited to, amyloid beta (A4) precursor protein gene, presenilin 1 and presenilin 2.
In another embodiment, the disease is a cancer. The microvesicular nucleic acid profile for cancer may, e.g., include nucleic acids of one or more cancer-related genes (e.g., known or suspected oncogenes or tumor suppressor genes; or genes whose expression levels correlate with the expression levels of nearby satellites). The determination of a cancer nucleic acid profile, including such cancer related genes, can aid in understanding the status of the cancer cells. In one embodiment, the oncogenes or tumor suppressor genes are one or more of those listed in Tables 2 and 3. In another embodiment, the cancer-related genes are one or more of those genes whose expression levels correlate with the expression levels of nearby satellites, such as but not limited to the satellite correlated genes listed in Table 6.
In some instances, the cancer-related gene is c-myc. The copy number of c-myc oncogene is usually increased in tumor cells, e.g., medullablastoma cells. The detection of increased c-myc gene copy number in microvesicles indicates an increased c-myc copy number in tumor cells that secret the microvesicles.
In other instances, the cancer-related gene is one or more members in the signaling pathways depicted in
For one example, the member is from the RAS/RAF/MEK/MAPK pathway related to melanoma, brain and lung cancers. The MAP kinase is a convergence point for diverse receptor-initiated signaling events at the plasma membrane. The RAS/RAF/MEK/MAPK pathway regulates cell proliferation, differentiation, migration and invasion (Hanahan and Weinberg, 2000). In addition, extracellular signal-regulated kinases (ERKs) become activated upon integrin ligation and, thereby, regulate cell migration (Klemke et al., 1997).
For another sample, the member is from the PI3K/PTEN/AKT pathway related to prostate, bladder and kidney cancers. The PI3K/PTEN/AKT pathway is responsible for regulating cell survival (Cheng et al., 2008). Genetic variations in AKT1, AKY2, PIK3CA, PTEN, and FRAP1 are associated with clinical outcomes in patients who receive chemoradiotherapy (Hildebrandt et al., 2009). Therefore, the determination of genetic variations in members of the pathway may help evaluating cancer treatment efficacy.
The microvesicular nucleic acid profile of the present invention may also reflect the nucleic acid profile of DNA repeats and/or transposable elements in cells from which the microvesicles originate.
DNA repeats include one or more repeated DNA elements that are composed of arrays of tandemly repeated DNA with the repeat unit being a simple or moderately complex sequence. The array of tandemly repeated DNA can be of varying size, thereby giving rise to categories of megasatellite, satellite, minisatellite and microsatellite repeats. See Table 7. Repeated DNA of this type is not transcribed and accounts for the bulk of the heterochromatic regions of the genome, being notably found in the vicinity of the centromeres (i.e., pericentromeric heterochromatin). The base composition, and therefore density, of such DNA regions is dictated by the base composition of constituent short repeat units and may diverge from the overall base composition of other cellular DNA. The nucleic acid profiles of the present invention comprising satellite repeats may include profiles of satellite repeat DNA and/or profiles of transcripts that are transcribed from satellite repeats.
DNA repeats may serve as biomarkers of cancer cells. For example, some satellite repeats like HSATII are over-expressed in many types of cancers including pancreatic, lung, kidney, ovarian and prostate cancers (Ting et al., 2011). The RNA expression level of such satellite repeats correlates with cancer disease status. DNA repeats encompassed within the scope of the present invention can be one or more of those recited in Table 8. In some embodiments, the DNA repeats may be HSATII, ALR, (CATTC)n, or a combination of the HSATII, ALR, and (CATTC)n.
Transposable elements encompassed within the scope of the present invention may be one or more DNA transposons and/or retrotransposons. The retrotransposon can be one or more of those recited in Tables 3 and 4. In other embodiments, the retrotransposon can be one or more LINEs, Alus, HERVs or a combination of the LINEs, Alus and HERVs.
Transposable elements can serve as biomarkers of cancer cells. These repetitive elements constitute almost 50% of the human genome and include: half a million LINE-1 (L1) elements, of which about 100 are transcriptionally active and encode proteins involved in retrotransposition, including reverse transcriptase (RT) and integrase; a million Alu elements, which depend on L1 functions for integration; and thousands of provirus HERV sequences, some of which contain near-to-full length coding sequences (Goodier and Kazazian, 2008; Voisset et al., 2008). Without being bound by theory, increased expression of retrotransposon elements in cancer appears to result in part from overall hypomethylation of the genome, which is also associated with genomic instability (Daskalos et al., 2009; Estecio et al., 2007) and tumor progression (Cho et al., 2007; Roman-Gomez et al., 2008).
Increased transcription of retrotransposon elements in the human genome has been noted in a number of cancer cell types. For example, increased expression of L1 and HERV, as well as formation of retrovirus-like particles, has been reported in tumor tissue from breast cancer, melanoma, germ cell carcinoma and prostate cancer. See U.S. Pat. No. 7,776,523 and Bratthauer et al., 1994; Golan et al., 2008; Ruprecht et al., 2008. Retrotransposon RNA and proteins, as well as antibodies against HERV proteins and virus-like particles, have also been found in blood of some cancer patients (Contreras-Galindo et al., 2008; Kleiman et al., 2004; Ruprecht et al., 2008; Wang-Johanning et al., 2008).
High level expression of retrotransposon genes and/or endogenous reverse transcriptase are sometimes associated with cancer. For example, human LINE-1 p40 protein is often expressed at a higher level in breast cancer than in normal mammary gland (Asch et al., 1996). Thus, the microvesicular nucleic acid profiles of retrotransposable elements are suitable for use in aiding the diagnosis, prognosis, and/or monitoring of medical conditions such as cancer, as well as for use in aiding in treatment selection for therapies whose efficacy is affected by the subject's genetic make-up.
In one embodiment of the present invention, the microvesicular profile(s) of retrotransposable element(s) are determined by analyzing the content of microvesicles originating from brain cancer, e.g., medullablastoma, glioblastoma, lymphoma, and breast cancer cells. In one instance, the profile comprises one or more RNA expression levels of L1, Alu and HERV elements. In another instance, the profile comprises one or more DNA levels of L1 and HERV elements.
In one embodiment, the profile comprises a profile of the HERV-K element. For example, the profile may comprise the expression of the HERV-K element in microvesicles isolated from plasma from a subject. The expression of the HERV-K element may be assessed by determining the expression of any gene that the HERV-K element may encode, e.g., the group-specific antigen gene (gag), the protease gene (prt), the polymerase gene (pol), and the envelope gene (env) (Lower et al., 1996).
In one instance, the present invention may comprise a profile of the expression of the gag gene in microvesicles. The gag gene is from the HERV-K element and the profile of gag expression reflects the profile of HERV-K expression. The expression of the gag gene can be measured by methods known in the art, e.g., quantitative reverse transcription PCR analysis.
In another instance, the present invention may comprise a profile of the expression of the env gene in microvesicles. The env gene is from the HERV-K element and the profile of env expression reflects the profile of HERV-K expression. The expression of env gene can be measured by methods known in the art, e.g., quantitative reverse transcription PCR analysis.
In addition to the mRNA expression levels of one or more nucleic acids, the nucleic acid profiles of the present invention may also comprise the copy number of one or more nucleic acids, the fusion of several nucleic acids, the mutations of one or more nucleic acids, the alternative splicing of one or more nucleic acids, the methylation of one or more nucleic acids, and the single nucleotide polymorphism of one or more nucleic acids. The nucleic acids may correspond to genes, repeats, transposable elements, or other non-coding parts of the genomes of various organisms, including human beings.
The present invention encompasses all forms of cancer and pre-cancerous conditions. For example, without limitation, the present invention encompasses cancer and pre-cancer cells in brain, esophagus, lung, liver, stomach, ovary, testicle, kidney, skin, colon, blood, prostate, breast, uterus, and spleen.
The profile of nucleic acids can be obtained through analyzing nucleic acids obtained from isolated microvesicles according to standard protocols in the art.
In one embodiment, the nucleic acid is DNA. The analysis of the DNA may be performed by one or more various methods known in the art, including microarray analysis for determining the nucleic acid species in the extract, Quantitative PCR for measuring the expression levels of genes, DNA sequencing for detecting mutations in genes, and bisulfite methylation assays for detecting methylation patterns of genes.
In some embodiments of the present invention, data analysis may be performed by any of a variety of methods know in the art, e.g., Clustering Analysis, Principle Component Analysis, Linear Discriminant Analysis, Receiver Operating Characteristic Curve Analysis, Binary Analysis, Cox Proportional Hazards Analysis, Support Vector Machines and Recursive Feature Elimination (SVM-RFE), Classification to Nearest Centroid, Evidence-based Analysis, or a combination thereof.
In another embodiment, the nucleic acid extracted and analyzed from the microvesicles is RNA. In some instance, the RNA may be subject to Digital Gene Expression (DGE) analysis (Lipson et al., 2009). In this method, the RNA may be digested and converted into single stranded cDNA which may then be subject to sequencing analysis on a DNA sequencing machine, e.g., the HeliScope™ Single Molecule Sequencer from Helicos BioSciences as described in a publication by Ting et al. (Ting et al., 2011).
In other instances, the RNA is preferably reverse-transcribed into complementary DNA (cDNA) before further amplification. Such reverse transcription may be performed alone or in combination with an amplification step. One example of a method combining reverse transcription and amplification steps is reverse transcription polymerase chain reaction (RT-PCR), which may be further modified to be quantitative, e.g., quantitative RT-PCR as described in U.S. Pat. No. 5,639,606, which is incorporated herein by reference for this teaching. Another example of the method comprises two separate steps: a first step of reverse transcription to convert RNA into cDNA and a second step of quantifying the amount of cDNA using quantitative PCR.
Nucleic acid amplification methods include, without limitation, polymerase chain reaction (PCR) (U.S. Pat. No. 5,219,727) and its variants such as in situ polymerase chain reaction (U.S. Pat. No. 5,538,871), quantitative polymerase chain reaction (U.S. Pat. No. 5,219,727), nested polymerase chain reaction (U.S. Pat. No. 5,556,773), self-sustained sequence replication and its variants (Guatelli et al., 1990), transcriptional amplification system and its variants (Kwoh et al., 1989), Qb Replicase and its variants (Miele et al., 1983), cold-PCR (Li et al., 2008), BEAMing (Li et al., 2006) or any other nucleic acid amplification methods, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. Especially useful are those detection schemes designed for the detection of nucleic acid molecules if such molecules are present in very low numbers. The foregoing references are incorporated herein for their teachings of these methods. In other embodiment, the step of nucleic acid amplification is not performed. Instead, the extracted nucleic acids are analyzed directly, e.g., through next-generation sequencing.
The analysis of nucleic acids present in the isolated microvesicles can be quantitative, qualitative, or both quantitative and qualitative. For quantitative analysis, the amounts (expression levels), either relative or absolute, of specific nucleic acids of interest within the isolated microvesicles are measured with methods known in the art (some of which are described below). For qualitative analysis, the species of specific nucleic acids of interest within the isolated particles, whether wild type or variants, are identified with methods known in the art.
The present invention further encompasses methods of creating and using the microvesicular nucleic acid profiles described herein. In one embodiment of a method for creating a microvesicular profile, the method comprises the steps of isolating microvesicles from a biological sample (e.g., from a body fluid) obtained from a subject or obtaining a microvesicle fraction isolated from a biological sample obtained from a subject, extracting nucleic acids from the isolated microvesicles or microvesicle fraction (or obtaining such as extraction), and determining the profile of the nucleic acids in the extract.
The microvesicular profiles of the present invention may be used in methods of aiding diagnosis, prognosis, monitoring, therapy selection, or risk assessment of a disease or other medical condition for a subject as described herein and in the claims.
In some embodiments of the present invention, the one or more nucleic acid(s) may be one or more genes listed in Table 2 (cancer genes), Table 3 (cancer-related somatic mutations) and Table 6 (satellite-correlated genes). In one embodiment, the one or more nucleic acid(s) may be a fragment of a c-myc gene, for example, a fragment of c-myc gene containing more than 10 nucleotides. The fragment may contain incrementally longer sequences of 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides, up to the full length of the gene.
In other embodiments, the one or more nucleic acids may be one or more sequences listed in Table 4 (GBM transposable elements), Table 5 (human transposable elements) and Table 8 (repeated DNA). In one embodiment, the one or more nucleic acids may be L1, Alu, HERV, fragments thereof, or any combination of any of the foregoing. The fragment may contain incrementally longer sequences of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides up to the full length of each gene sequence.
In one embodiment, the invention comprises microvesicular profiles and methods based on microvesicular polypeptide species, polypeptide activities, or both the species and activities of polypeptides. The polypeptide may be any polypeptide in microvesicles. In some embodiments, the polypeptide is a reverse transcriptase. The activity of the reverse transcriptase (RT) can be measured by standard protocols known in the art. For example, the RT activity can be measured by the EnzChek RT Assay Kit (Invitrogen).
The human endogenous retrovirus K (HERV-K) reverse transcriptase may serve as a breast cancer prognostic marker (Golan et al., 2008). As such, one particular embodiment of the present invention encompasses profiles and related methods based on detecting the activity of HERV-K reverse transcriptase in microvesicles.
The present invention also includes a kit for genetic analysis of a microvesicle preparation from a biological sample (e.g., a bodily fluid sample) from a subject. The kit in a suitable container may include one or more reagents capable of hybridizing to or amplifying one or more nucleic acids extracted from microvesicles. In some embodiments, the nucleic acids correspond to one or more of those genes listed in Tables 2, 3, 4, 5, 6 and/or 8. In some further embodiments, the nucleic acids correspond to one or more RNA transcripts of one or more genes listed in Tables 2, 3, 4, 5, 6 and/or 8. In other further embodiments, the nucleic acid is DNA corresponding to one or more of the genes listed in Tables 2, 3, 4, 5, 6 and/or 8.
The present invention further includes an oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the various oligonucleotides on the array are designed to hybridize exclusively to nucleic acids corresponding to one or more genes listed in Tables 2, 3, 4, 5, 6 and/or 8. The arrays can be made by standard methods known in the art. For example, SurePrint Technology (Agilent Technologies Corp.) may be used to make as many as 8 arrays on a single slide.
The present invention also includes a method of aiding the discovery of one or more biomarkers for a disease or other medical condition. The method may comprise, e.g., the steps of isolating microvesicles from subjects having a disease or other medical condition of interest and also from subjects who do not have the disease or other medical condition of interest; measuring the level of one or more target biological materials extracted from the isolated microvesicles from each of the subjects; comparing the measured levels of the one or more target biological materials from each of the subjects; and determining whether there is a statistically significant difference in the measured levels. The step of determination of a statistically significant difference in the measured levels identifies the one or more target biological materials as potential biomarkers for the disease or other medical condition. As an alternative to isolating microvesicles, the method may be carried out with pre-isolated microvesicle fractions.
The one or more biomarkers and nucleic acids in each of the various embodiments of the invention described herein can be one or a collection of genetic aberrations. The term “genetic aberration” is used herein to refer to the nucleic acid amounts as well as nucleic acid variants within the nucleic acid-containing particles. Specifically, genetic aberrations include, without limitation, over-expression of a gene (e.g., an oncogene) or a panel of genes, under-expression of a gene (e.g., a tumor suppressor gene such as p53 or RB) or a panel of genes, alternative production of splice variants of a gene or a panel of genes, gene copy number variants (CNV) (e.g., DNA double minutes) (Hahn, 1993), nucleic acid modifications (e.g., methylation, acetylation and phosphorylations), single nucleotide polymorphisms (SNPs) (e.g., polymorphisms in Alu elements), chromosomal rearrangements (e.g., inversions, deletions and duplications), and mutations (insertions, deletions, duplications, missense, nonsense, synonymous or any other nucleotide changes) of a gene or a panel of genes, which mutations, in many cases, ultimately affect the activity and function of the gene products, lead to alternative transcriptional splice variants and/or changes of gene expression level, or combinations of any of the foregoing.
Genetic aberrations can be found in many types of nucleic acids. The determination of such genetic aberrations can be performed by a variety of techniques known to the skilled practitioner. For example, expression levels of nucleic acids, alternative splicing variants, chromosome rearrangement and gene copy numbers can be determined by microarray analysis (see, e.g., U.S. Pat. Nos. 6,913,879, 7,364,848, 7,378,245, 6,893,837 and 6,004,755) and quantitative PCR. Particularly, copy number changes may be detected with the Illumina Infinium II whole genome genotyping assay or Agilent Human Genome CGH Microarray (Steemers et al., 2006).
Nucleic acid modifications can be assayed by methods described in, e.g., U.S. Pat. No. 7,186,512 and patent publication WO/2003/023065. Particularly, methylation profiles may be determined by Illumina DNA Methylation OMA003 Cancer Panel.
SNPs and mutations can be detected by hybridization with allele-specific probes, enzymatic mutation detection, chemical cleavage of mismatched heteroduplex (Cotton et al., 1988), ribonuclease cleavage of mismatched bases (Myers et al., 1985), mass spectrometry (U.S. Pat. Nos. 6,994,960, 7,074,563, and 7,198,893), single strand conformation polymorphism (SSCP) (Orita et al., 1989), denaturing gradient gel electrophoresis (DGGE)(Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), temperature gradient gel electrophoresis (TGGE) (Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), restriction fragment length polymorphisms (RFLP) (Kan and Dozy, 1978a; Kan and Dozy, 1978b), oligonucleotide ligation assay (OLA), allele-specific PCR (ASPCR) (U.S. Pat. No. 5,639,611), ligation chain reaction (LCR) and its variants (Abravaya et al., 1995; Landegren et al., 1988; Nakazawa et al., 1994), flow-cytometric heteroduplex analysis (WO/2006/113590), nucleic acid sequencing, and combinations/modifications thereof.
Nucleic acid sequencing is to determine the base pair sequences of nucleic acids. Two traditional techniques for sequencing DNA are the Sanger dideoxy termination method (Sanger et al., 1977) and the Maxam-Gilbert chemical degradation method (Maxam and Gilbert, 1977). Both methods deliver four samples with each sample containing a family of DNA strands in which all strands terminate in the same nucleotide. Gel electrophoresis, or more recently capillary array electrophoresis is used to resolve the different length strands and to determine the nucleotide sequence, either by differentially tagging the strands of each sample before electrophoresis to indicate the terminal nucleotide, or by running the samples in different lanes of the gel or in different capillaries. Related methods using dyes or fluorescent labels associated with the terminal nucleotide have been developed, where sequence determination is also made by gel electrophoresis and automated fluorescent detectors. For example, the Sanger-extension method has recently been modified for use in an automated micro-sequencing system which requires only sub-microliter volumes of reagents and dye-labelled dideoxyribonucleotide triphosphates. U.S. Pat. No. 5,846,727.
More recently, high throughput DNA sequencing methods of various types have been developed and used to delineate nuclei acis sequences. These new methods are applied in sequencing machines including the 454 GenomeSequencer FLX instrument (Roche Applied Science), the Illumina (Solexa) Genome Analyzer, the Applied Biosystems ABI SOLiD system, the Helicos single-molecule sequencing device (HeliScope), and the Ion semiconductor sequencing by Ion Torrent Systems Inc. See also US patent application publications No. 20110111401 and No. 20110098193. It is understood that as the sequencing technology evolves, the analysis of nucleic acids obtained in the invention may be performed using any new sequencing method as one skilled in the art sees appropriate.
Gene expression levels may be determined by the serial analysis of gene expression (SAGE) technique (Velculescu et al., 1995), quantitative PCR, quantitative reverse transcription PCR, microarray analysis, and next generation DNA sequencing as known in the art.
In general, the methods for analyzing genetic aberrations are reported in numerous publications, not limited to those cited herein, and are available to skilled practitioners. The appropriate method of analysis will depend upon the specific goals of the analysis, the condition/history of the patient, and the specific cancer(s), diseases or other medical conditions to be detected, monitored or treated. The forgoing references are incorporated herein for their teaching of these methods.
Many biomarkers may be associated with the presence or absence of a disease or other medical condition in a subject. Therefore, detection of the presence or absence of such biomarkers in nucleic acids extracted from isolated microvesicles, according to the methods disclosed herein, may aid diagnosis of the disease or other medical condition in the subject.
For example, as described in WO 2009/100029, detection of the presence or absence of the EGFRvIII mutation in nucleic acids extracted from microvesicles isolated from a patient serum sample aided in the diagnosis and/or monitoring of glioblastoma in the patient. This is so because the expression of the EGFRvIII mutation is specific to some tumors and defines a clinically distinct subtype of glioma (Pelloski et al., 2007).
For another example, as described in WO 2009/100029, detection of the presence or absence of the TMPRSS2-ERG fusion gene, PCA-3, or both TMPRSS2-ERG and PCA-3 in nucleic acids extracted from microvesicles isolated from a patient's urine sample may aid in the diagnosis of prostate cancer in the patient.
Further, many biomarkers may be associated with disease or medical status monitoring in a subject. Therefore, the detection of the presence or absence of such biomarkers in a nucleic acid extraction from isolated microvesicles, according to the methods disclosed herein, may aid in monitoring the progress or reoccurrence of a disease or other medical condition in a subject.
For example, as described in WO 2009/100029, the determination of matrix metalloproteinase (MMP) levels in nucleic acids extracted from microvesicles isolated from an organ transplantation patient may be used to monitor the post-transplantation condition, as a significant increase in the expression level of MMP-2 after kidney transplantation may indicate the onset and/or deterioration of post-transplantation complications. Similarly, a significantly elevated level of MMP-9 after lung transplantation, suggests the onset and/or deterioration of bronchiolitis obliterans syndrome.
Many biomarkers have also been found to influence the effectiveness of treatment in a particular patient. Therefore, the detection of the presence or absence of such biomarkers in a nucleic acid extraction from isolated microvesicles, according to the methods disclosed herein, may aid in evaluating the efficacy of a given treatment in a given patient. For example, as disclosed in Table 1 in the publication by Furnari et al. (Furnari et al., 2007), biomarkers, e.g., mutations in a variety of genes, affect the effectiveness of specific medicines used in chemotherapy for treating brain tumors. The identification of these and other biomarkers in nucleic acids extracted from isolated particles from a biological sample from a patient can guide the skilled practitioner in the selection of treatment for the patient.
Without limitation, all of the methods mentioned above may further comprise the step of enriching the isolated microvesicles for microvesicles originating from a specific cell type. For example, the cell can be a cancer or pre-cancer cell.
Another aspect of the present invention is a method of treating a subject suffering from a form of cancer in which the cancer cells secret microvesicles. The method comprises administering to the subject a therapeutically effective amount of a composition comprising: an inhibitor of microvesicle secretion; an inhibitor of a reverse transcriptase; another microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles; or any combination of the inhibitors/neutralizers.
In one embodiment, the inhibitor of microvesicle secretion is an inhibitor of the Rab GTPase pathway (Ostrowski et al.).
In some instances, the Rab GTPases are Rab 27a and Rab 27b. The inhibition of the Rab 27a and Rab 27b can be effectuated by silencing the Slp4 gene (also known as SYTL4, synaptotagmin-like 4) and the Slac2b gene (also known as EXPH5, exophilin5), respectively. Gene silencing techniques are well known in the art. One example of such a gene silencing technique is an RNA interference technique that selectively silences genes by delivering shRNA with viral vectors (Sliva and Schnierle).
In other instances, the Rab GTPase is Rab35. The inactivation of Rab35 decreases microvesicle secretion. Therefore, silencing Rab35 may decrease the secretion of microvesicles by cells. Inactivation of Rab35 may be achieved by administering TBC1D10B (TBC1 domain family, member 10B) polypeptide (Sliva and Schnierle).
In another embodiment, instead of, or in addition to, inhibiting microvesicle secretion, the reverse transcriptase activity is inhibited by administration of an RT inhibitor. RT inhibitors may be any one of 3′-azido2′,3′-dideoxythymidine (AZT), 2′,3′-dideoxyinosine (ddI), 2′,3′-didehyro-3′-deoxythymidine (d4T), nevirapine and efavirenz.
Further, a microvesicle neutralizer may be used to block the effects of microvesicles. For example, such neutralizer may bind to microvesicles and destroy the integrity of microvesicles so that the biological materials in microvesicles are not transferred to other intact cells.
It should be understood that this invention is not limited to the particular methodologies, protocols and reagents, described herein, which may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
The contents of earlier filed provisional applications U.S. Ser. No. 61/378,860, filed Aug. 31, 2010, U.S. Ser. No. 61/421,421, filed Dec. 9, 2010, U.S. Ser. No. 61/437,547, filed Jan. 28, 2011, U.S. Ser. No. 61/438,199, filed Jan. 31, 2011, and 61/493,261 filed Jun. 3, 2011 are herein incorporated by reference in their entirety.
All patents, patent applications, and publications cited herein are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies and techniques described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
The present invention may be as defined in any one of the following numbered paragraphs.
The invention is further illustrated by the following examples, which should not be construed as further limiting. Examples of the disclosed subject matter are set forth below. Other features, objects, and advantages of the disclosed subject matter will be apparent from the detailed description, figures, examples and claims. Methods and materials substantially similar or equivalent to those described herein can be used in the practice or testing of the presently disclosed subject matter. Exemplary methods and materials are now described as follows.
We found that cultured tumor cells as well as normal cells release microvesicles. Here, we analyzed microvesicles produced by tumor cells from glioblastoma (GBM), a common and malignant brain tumor in adults; medulloblastoma, a common and malignant tumor in children with frequent amplification of c-Myc (Bigner et al., 1990); atypical teratoid rhabdoid tumor (AT/RT), a high-grade malignant tumor in children (Tez et al., 2008); and malignant melanoma, a peripheral tumor which can metastasize to the brain (Jemal et al., 2008). We analyzed microvesicles produced by epidermoid carcinoma cells as a control for the study. Increased expression of EGFR, but not c-Myc gene, was found in epidermoid carcinoma cells (Giard et al., 1973).
We cultured glioblastoma, medulloblastoma, melanoma and normal human fibroblast cells and monitored the release of microvesicles from each cell type. Specifically, primary GBM cell lines 20/3 and 11/5 were generated in our laboratory from tumor specimens kindly provided by Dr. Bob Carter (Massachusetts General Hospital), and diagnosed as GBM by a neuropathologist at Massachusetts General Hospital (Skog et al., 2008). Glioblastoma cells were cultured in Dulbecco modified essential medium (DMEM; Invitrogen, Carlsbad, Calif.) containing 10% fetal bovine serum (FBS; JRH Biosciences, Carlsbad, Calif.), and penicillin and streptomycin (10 IU/ml and 10 μg/ml, respectively; Cellgro, Herndon, Va.).
Primary medulloblastoma cell lines D458, D384 and D425, as well as rhabdoid AT/RT tumor cell line, NS224, were provided by Drs. Y.-J. Cho and S. L. Pomeroy (Children's Hospital, Boston, Mass.). All medulloblastoma cell lines were cultured in suspension in DMEM containing 10% FBS, 1×GutaMAX (Invitrogen) and penicillin/streptomycin. Rhabdoid tumor cell line NS224 was cultured in suspension in DMEM/F12 containing B27 supplement, 20 ng/ml EGF, 20 ng/ml FGF and penicillin/streptomycin.
Melanoma cell line, Yumel 0106, was kindly provided by Dr. R. Halaban (Yale New Haven Hospital, New Haven, Conn.) and cultured in OptiMEM (Invitrogen) containing 10% FBS and penicillin/streptomycin. Epidermoid carcinoma cell line, A431 (ATCC) was kindly provided by Huilin Shao (Massachusetts General Hospital) and cultured in DMEM containing 10% FBS and penicillin/streptomycin.
Normal human fibroblast lines, HF19 and HF27 were derived from human skin biopsies in the Breakefield laboratory; L2131 was derived in Dr. Christine Klein's laboratory (Univ. Lubeck, Lubeck, Germany) and cultured in DMEM supplemented with 10% FBS, 10 mM HEPES (Invitrogen) and penicillin/streptomycin. All cells were grown in media with 5% exosome-depleted fetal bovine serum (dFBS) (Skog et al., 2008). All cell lines were used over a few passages, as microvesicle yield tended to change over extended passages.
To characterize the size distribution and amount of microvesicles released from tumor cells and normal fibroblasts in culture using Nanosight LM10 nanoparticle tracking analysis (NTA), we isolated microvesicles from the culture media of three medulloblastoma cell lines (D384, D425 and D458), one melanoma (Yumel 0106), two GBMs (20/3 and 11/5) and two normal fibroblasts (HF19 and HF27). The media was first spun at 500×g for 10 min. The supernatant was removed and spun again at 16,500×g, filtered through a 0.22 μm filter and used for Nanosight analysis. The nanosight LM10 nanoparticle characterization system (NanoSight Ltd, UK) equipped with a blue laser (405 nm) illumination was used for real-time characterization of the vesicles. The result is presented as the average±SEM of three independent experiments.
We found that medulloblastoma cells released more microvesicles/cell than the other cells types analyzed. The amount of microvesicles released by each cell type was: 13,400-25,300/cell/48 hrs for medulloblastomas (
To measure the amount of RNA in the microvesicles released in the culture media from these cells, we collected each conditioned medium after culturing for 48 hr and isolated microvesicles by differential centrifugation and filtration through a 0.22 μm filter followed by ultracentrifugation at 110,000×g as detailed in WO 2009/100029.
For purposes of RNA extraction from microvesicles, microvesicle pellets generated from 39 ml conditioned medium produced from 0.5×106-3.5×106 cells over 48 hours were resuspended in 50 μL PBS and incubated at 37° C. for 30 min with DNAse I (DNA-Free™ kit, Ambion) and Exonuclease III (Fermentas, Glen Burnie, Md.), according to the manufacturer's instructions. After treatment, the enzymes were inactivated (using the kit's inactivation reagent and heat inactivation, respectively) and samples processed for RNA extraction.
Microvesicles were lysed in 300 μl MirVana lysis buffer (Ambion, Austin, Tex.) followed by extraction with an equal amount of acid-phenol:chloroform. After centrifugation at 10,000×g for 5 min, the upper aqueous phase was removed and further processed to extract RNA using the mirVana RNA isolation kit (Ambion), according to the manufacturer's instructions. RNA extracts were then treated with DNAse (DNA-free kit, Ambion) to exclude DNA carryover. RNA was quantified using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, Mass.) and the quantity and size ranges were evaluated using a 2100 Bioanalyzer (Agilent, Santa Clara, Calif.).
ExoRNA in microvesicles was measured using a 2100 Bioanalyzer (Agilent) with RNA 6000 Pico Chip for RNA. The Bioanalyzer RNA 6000 Pico Chip kit detects mainly single strand nucleic acids, but can also detect double strand DNA when present in large amounts. As shown in
To characterize the RNA and DNA in microvesicles, we isolated microvesicles from culture media of medulloblastoma cell line D384, glioblastoma cell line 11/5 and fibroblast cell line H19 as detailed in Example 1. Isolated microvesicles were treated extensively with DNase prior to nucleic acid extraction to reduce the chance of external DNA contamination. Isolated microvesicles may also be treated with RNase prior to nucleic acid extraction although such treatment did not affect the RNA yield from microvesicles probably due to the absence of any significant amounts of external RNA.
ExoRNA was extracted from isolated microvesicles as detailed in Example 1.
For exoDNA extraction, microvesicle pellets generated from 39 ml conditioned medium produced from 0.5×106-3.5×106 cells over 48 hr were resuspended in 50 μL PBS and incubated at 37° C. for 30 min with DNAse I (DNA-Free™ kit, Ambion) and Exonuclease III (Fermentas, Glen Burnie, Md.), according to manufacturer's instructions. After treatment, the enzymes were inactivated (using the kit's inactivation reagent and heat inactivation, respectively) and samples processed for DNA extraction.
Microvesicles were lysed in 300 μl MirVana lysis buffer (Ambion, Austin, Tex.) followed by extraction with an equal amount of acid-phenol:chloroform. After centrifugation at 10,000×g for 5 min, the upper aqueous phase was removed and further processed to extract DNA using the Qiagen PCR purification kit according to manufacturer's instructions. DNA extracts were then treated with RNase (e.g., RNase A, Fermentas, Glen Burnie, Md.) to exclude RNA carryover. DNA were quantified using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, Mass.) and the quantity and size ranges were evaluated using a 2100 Bioanalyzer (Agilent, Santa Clara, Calif.). ExoDNA in microvesicles was measured using a 2100 Bioanalyzer (Agilent) with RNA 6000 Pico Chip and/or DNA 7500 LabChip kits. The Bioanalyzer RNA 6000 Pico Chip kit detects mainly single stranded (“ss”) nucleic acids, but can also detect double-stranded DNA (dsDNA) when present in large amounts, while the DNA 7500 LabChip kit only detects dsDNA. S1 nuclease (200 U/ml; Fermentas) was also used to digest single stranded nucleic acid at 37° C. for 30 min. Genomic cell DNA was isolated from cells with the Flexigene DNA kit (Qiagen, Valencia, Calif.), according to manufacturers' recommendation.
As shown in
The DNA profile also varied among cell types. ExoDNA was much more abundant in microvesicles secreted by glioblastoma tumor cells (
We also found that exoDNA was primarily single stranded. When exoDNA from medulloblastoma tumor cells (D384) was analyzed using a dsDNA detection chip, no DNA was detected (
That exoDNA was primarily single stranded DNA was also supported by our S1 exonuclease assays and PicoGreen assays. In the S1 exonuclease assays, we isolated exoDNA from three medulloblastoma cell lines (D435, D384, D556) and gDNA from one normal human fibroblast cell line (L2132). Samples were incubated with S nuclease (200 U/ml) at 37° C. for 30 minutes or MOCK treated. PCR for the house-keeping gene GAPDH was then performed on treated and MOCK treated samples. S1 exonuclease specifically digests single stranded nucleic acids. As shown in
Further, quantitative analysis of exoDNA using PicoGreen® (Thermo Scientific, Waltham, Mass.), which is a sensitive dsDNA binding fluorescent dye, showed an 18-fold lower amount of nucleic acids in comparison with the amount detected using the Bioanalyzer RNA chip. Since the Bioanalyzer RNA chip detection method can detect only single stranded nucleic acids, the exoDNA extract contained mainly single stranded nucleic acids.
We detected c-Myc oncogene amplification using either exoRNA or exoDNA from medulloblastoma tumor cells. To measure the amount of c-Myc amplification, we extracted exoRNA and exoDNA, from culture media of three medulloblastoma cell lines (D458, D425 and D384), one atypical teratoid/rhabdoid (AT/RT) tumor cell line NS224, one glioblastoma cell line (11/5), and one normal fibroblast cell line H19 using the same method as detailed in Example 1, respectively. The genomic DNA from each of the same cell lines was extracted according to standard protocols in the art, which can be found in books such as Molecular Cloning: A Laboratory Manual (3-Volume Set) Ed. Joseph Sambrook, David W. Russel, and Joe Sambrook, Cold Spring Harbor Laboratory, 3rd edition (Jan. 15, 2001), ISBN: 0879695773. The extracted nucleic acids were then used in PCR analysis to measure the level of amplifications.
For PCR analysis of exoRNA, total exoRNA (50 ng) was converted into cDNA with the Sensiscript RT Kit (Qiagen) using random primers, according to the manufacturer's instructions, and a 1:20 fraction (corresponding to 2.5 ng reverse transcribed RNA) was used for quantitative PCR (qPCR). For PCR analysis of the gDNA and exoDNA, qPCR was carried out using 10 ng DNA as a template. All reactions were performed in a 25 μl reaction using Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, Calif.) and 160 nM of each primer. Amplification conditions consisted of: (1) 1 cycle of 50° C., 2 min; (2) 1 cycle of 95° C., 10 min; (3) 40 cycles of 95° C., 15 sec; and 60° C., 1 min, and (4) a dissociation stage consisting of 1 cycle of 95° C., 15 sec; 60° C., 20 sec; and 95° C., 15 sec on the 7000 ABI Prism PCR system (Applied Biosystems). Cycle threshold (“Ct”) values were analyzed in auto mode and manually inspected for accuracy. The Ct values of both RNA and DNA levels were normalized to the housekeeping gene GAPDH in each sample. Primer dimers were excluded by evaluation of dissociation curve and agarose gel electrophoresis.
Sequences of the primers used were as follows n-Myc primers: 1) Forward TCTACCCGGACGAAGATGAC (SEQ ID NO: 1), Reverse AGCTCGTTCTCAAGCAGCAT (SEQ ID NO: 2) (primers within exon 2); c-Myc primer: Forward TCAAGAGGCGAACACACAAC (SEQ ID NO: 3), Reverse TAACTACCTTGGGGGCCTTT (SEQ ID NO: 4) (both primers in exon 3); c-Myc primer: Forward CCTACCCTCTCAACGACAGC (SEQ ID NO: 5), Reverse CTCTGACCTTTTGCCAGGAG (SEQ ID NO: 6) (spanning intron 2). c-Myc human specific primers: Forward CAACCCTTGCCGCATCCAC (SEQ ID NO: 7), Reverse AGTCGCGTCCTTGCTCGG (SEQ ID NO: 8) (both primers in exon 1). POU5F1B primers: Forward ATCCTGGGGGTTCTATTTGG (SEQ ID NO: 9), Reverse CTCCAGGTTGCCTCTCACTC (SEQ ID NO: 10); and GAPDH primers: Forward CTCTGCTCCTCCTGTTCGAC (SEQ ID NO: 11) (exon 8), Reverse ACGACCAAATCCGTTGACTC (SEQ ID NO: 12) (exon 9).
Levels of c-Myc amplification were measured at the genomic level (gDNA) by qPCR (
Furthermore, to establish that this genomic fragment of c-Myc in microvesicles was derived from a genomic amplicon, we verified the presence of elevated levels of a flanking gene, POU5F1B gene (Storlazzi et al., 2006) at levels matching those of c-Myc (
Levels of n-Myc sequences in cellular genomic DNA (gDNA) or exoRNA were also measured by qPCR and qRT-PCR and none of the other tumor types showed genomic amplification of n-Myc sequences or elevated levels of n-Myc exoRNA (
The levels of c-Myc DNA quantitated for gDNA and exoDNA/RNA in these medulloblastoma lines were also compared to levels estimated by 250K single nucleotide polymorphism (SNP) analysis. For gene copy number estimation by the SNP array analysis, genomic DNA was extracted from medulloblastoma cell pellets using the Puregene DNA Extraction Kit (Gentra Systems, Minneapolis, Minn.), according to the manufacturer's instructions. To obtain signal intensities and genotype calls, genomic DNA samples were digested, labeled and hybridized to Affymetrix 250K StyI SNP arrays, according to the manufacturer's protocol (Affymetrix, Santa Clara, Calif.). Signal intensities were normalized using rank invariant set normalization, and copy numbers for altered genomic regions were inferred using the GLAD (Gain and Loss of DNA) algorithm available in the Genepattern software package (www.genepattern.org). C-Myc and n-Myc copy numbers were inferred by analyzing the smoothed copy number data at genomic regions ch8q24.12 and ch2p24, respectively.
The results are shown in Table 1 and in
a2.5 ng reverse transcribed exoRNA and 10 ng of exoDNA were used as template for qPCR. All values were normalized to GAPDH mRNA.
bFISH = Fluorescence in situ hybridization of metaphase chromosome spread.63
cSee representative heat map shown in FIG. 30.
To assess the potential diagnostic utility of using exoRNA to detect c-Myc amplification in tumors, human medulloblastoma cells (c-Myc amplified) and epidermoid carcinoma tumor cells (non-amplified) were grown as xenograft tumors in nude mice. In the xenograft experiments, two groups of five adult immunodeficient mice (nu/nu NCI) were each injected subcutaneously in both flanks with 5×106 medulloblastoma cells (line D425) or epidermoid carcinoma cells (line A431). Tumors were allowed to grow for three weeks; the mice were then sacrificed and blood was drawn by cardiac puncture. Approximately 1 ml of blood was obtained from each mouse and allowed to clot at room temperature for 15 min and then centrifuged at 1300×g for 10 min. The serum was then filtered through a 0.22 μm filter and stored at −80° C. Samples were thawed and centrifuged for 1 hr at 100,000×g to obtain microvesicles for RNA extraction, as described above.
As shown in
We analyzed the RNA species in cellular RNA and exoRNA preparations from a low passage GBM line by microarray analysis using a whole genome array (Agilent Technologies). Briefly, RNA was extracted from microvesicles, as described above. RNA (0.5 μg) was used for linear T7-based amplification and Cy-3/Cy-5 labeling (Agilent Low RNA Input Linear Amp Kit, Agilent Technologies) following the manufacturer's protocol. The microarray experiments were performed by Miltenyi Biotec (Auburn, Calif.) using the Agilent whole human genome microarray, 4×44K (44,000 probes), two-color array. The array was performed on two different RNA preparations from primary GBM cells and their microvesicles.
The microarray results have been deposited with a Geo accession number GSE13470. The results indicate the presence of higher transcription levels of a number of retrotransposon sequences in exoRNA extracts as compared to cellular RNA extracts.
From the two-color Agilent array data, we generated MA plots as previously described (Storey and Tibshirani, 2003). The intensities of the expression levels for each transcript were obtained from the array data for both exoRNA extracts from microvesicles and cellular RNA extracts from cells. The intensity of exoRNA is here designated “Microvesicle.” The intensity of cellular RNA is here designated “Cell”. The log ratio of the intensities of microvesicle/cell is plotted on the Y-axis (M=log2Microvesicle−log2Cell) and the mean log expression of the two on the X-axis (A=0.5×(log2Microvesicle+log2Cell)).
As shown in
As shown in
Since only a selected subset of transposon/retrotransposon probes are represented on the Agilent arrays, other retrotransposons that are not represented on the Agilent arrays may be enriched in microvesicles from tumor cells as well.
Since L1 and HERV-K retrotransposons, as well as Alu elements (Goodier and Kazazian, 2008), have been implicated in tumor progression, we further assayed their levels in cellular RNA and exoRNA from tumor and normal cells by qRT-PCR (again with the caveat that the primers used only detect a subset of these sequences). See
We found that the expression profiles of the non-coding 7SL RNA in microvesicles from plasma may serve as biomarkers for glioblastoma. We obtained de-identified blood samples from a GBM patient and healthy control from the biobank at Massachusetts General Hospital. We took the serum for each blood sample and isolated microvesicles from the serum using the method as described in Example 1. RNA was extracted from the isolated microvesicles for further analysis. The expression levels of the 7SL RNA, EGFR and GAPDH were determined using qRT-PCR following a procedure as detailed in Example 3. The primers used for the qRT-PCR are as follows: 7SL-RNA: Forward primer 5′ CAAAACTCCCGTGCTGATCA 3′ (SEQ IDNO: 13), Reverse primer 5′ GGCTGGAGTGCAGTGGCTAT 3′ (SEQ ID NO: 14), Probe (FAM labeled MGB probe), 5′ TGGGATCGCGCCTGT 3′ (SEQ ID NO: 15); EGFR: Forward primer 5′ TATGTCCTCATTGCCCTCAACA 3′ (SEQ IDNO: 16), Reverse primer 5′ CTGATGATCTGCAGGTTTTCCA 3′ (SEQ ID NO: 17), Probe (FAM labeled MGB probe), 5′ AAGGAATTCGCTCCACTG 3′ (SEQ ID NO: 18); GAPDH, huGAPDH ID 4326317E from the vendor Applied Biosystems Inc.
The results show that the expression profile of the 7SL RNA in microvesicles correlates with the disease status of the subject from which the microvesicles were isolated (
As such, one aspect of the present invention is directed to the profile of 7SL RNA in microvesicles isolated from a subject, e.g., a human being. The profile of 7SL RNA may be the expression profile of the 7SL RNA. The profile of 7SL RNA may be correlated with the medical condition of the subject wherefrom the microvesicles are isolated.
Another aspect of the present invention is directed to a method of aiding the diagnosis, prognosis or selection of treatment therapy of a medical condition by determining the profile of the 7SL RNA. The determination of the profile of 7SL RNA may be the determination of the expression profile of the 7SL RNA. Since the profile of 7SL RNA may be correlated with the medical condition of the subject wherefrom the microvesicles are isolated, the determination of the profile in microvesicles may therefore aid the diagnosis, prognosis or selection of treatment therapy for the subject.
To determine whether microvesicles could transfer HERV-K RNA to normal cells, human umbilical vein endothelial cells (HUVEC) were exposed to microvesicles from medulloblastoma cells and levels of HERV-K RNA were measured in HUVEC cells over time. Human umbilical vein endothelial cells (HUVEC) cells, kindly provided by Dr. Jonathan Song (Massachusetts General Hospital), were cultured in gelatin—coated flasks in endothelial basal medium (Lonza, Walkersville, Md.) supplemented with hEGF, hydrocortisone, GA-1000 and FBS (Singlequots from Lonza). All cell lines were used over a few passages, as microvesicle yield tended to change over extended passages.
Specifically, HUVEC cells were seeded in 12-well plates at a density of 1.5×105 cells/well. Microvesicles were isolated from 1.2×107 D384 cells over a 48 hour period and added to each well in a total volume of 400 μl DMEM. Mock treated cells were incubated in 400 μl exosome-free DMEM. The cells were incubated for 2 hrs at 37° C. and were then replenished with 1.5 ml DMEM (with 5% dFBS). Cells were collected at different time points after the microvesicle exposure and cell RNA was extracted for qRT-PCR analysis. The result is presented as the average±SEM of three independent experiments.
As shown in
ExoDNA was also analyzed at the retrotransposon level with qPCR. ExoDNAs were extracted from microvesicles as detailed in Example 2. gDNA were extracted from cells as detailed in Example 3. The primers used for qPCR are as follows: GAPDH primers: Forward CTCTGCTCCTCCTGTTCGAC (SEQ ID NO: 19) (exon 8), Reverse ACGACCAAATCCGTTGACTC (SEQ ID NO: 20) (exon 9); L1 primers: Forward TAAGGGCAGCCAGAGAGAAA (SEQ ID NO: 21), Reverse GCCTGGTGGTGACAAAATCT (SEQ ID NO: 22); HERV-K6 primers: Forward GGAGAGAAGCTGTCCTGTGG (SEQ ID NO: 23), Reverse TGACTGGACTTGCACGTAGG (SEQ ID NO: 24); Alu primers: Forward CATGTGGGTTAGCCTGGTCT (SEQ ID NO: 25), Reverse TTCCCACATTGCGTCATTTA (SEQ ID NO: 26).
The exoDNA levels were compared to nuclear gDNA isolated from the cells in MA plots. The levels of exoDNA in microvesicles and gDNA in corresponding cells were normalized to levels of GAPDH. The exoDNA (presumably originating from the cytoplasmic compartment) and gDNA (isolated from the nuclear compartment of the cells) showed clearly different patterns (M≠0). L1 was slightly enriched in all medulloblastomas (
We further found that the enrichment of the transposable elements at the exoDNA level in the medulloblastoma cell lines corresponded to high levels of endogenous Reverse Transcription (RT) activity in exosomes. To measure RT activities, microvesicles were lysed in RIPA buffer [50 mM Tris-HCl (pH 8); 150 mM NaCl, 2.5% sodium dodecyl sulfate, 2.5% deoxycholic acid, 2.5% Nonidet P-40] for 20 min at 4° C. Exosomal debris was removed by centrifugation at 14,000×g for 15 min. Proteins were quantified by Bradford assay and diluted 1:6 for each RT reaction. The RT assay was performed using the EnzCheck RT assay kit (Invitrogen) on a 25 μL reaction, as described by the manufacturer. Fluorescence signal of the samples was measured before and after the RT incubation. The difference between the two values indicates newly synthesized DNA. Serial dilutions of SuperScript™ III First Strand (Invitrogen) were used as standards. The result is presented as the average±SEM of three independent experiments.
As shown in
In addition, we found that exoDNA might also include fragments of genomic DNA. We used L-mimosine to inhibit DNA replication and examined whether the inhibition affected the yield of exoDNA. If the exoDNA yield is decreased after inhibition, it is very likely that exoDNA may contain fragments of genomic DNA.
Specifically, D384 cells were plated on 6-well plates (2×106 cells/well) and treated with increasing amounts (200, 400 and 600 μM) of L-mimosine (Sigma-Aldrich, St. Louis, Mo.) which is an inhibitor of DNA replication. The drug was added at one time point and 48 hrs after, the media was collected and processed for the isolation of microvesicles. Cell viability was assessed by cell count using the Countess Automated Cell Counter (Invitogen). SsDNA yields are normalized to one.
As shown in
While the present invention has been disclosed with reference to certain embodiments, numerous modifications, alterations, and changes to the described embodiments are possible without departing from the sphere and scope of the present invention, as defined in the appended claims. Accordingly, it is intended that the present invention not be limited to the described embodiments, but that it has the full scope defined by the language of the following claims, and equivalents thereof.
‡D (large deletion) covers the abnormalities that result in allele loss/loss of heterozygosity at many recessive cancer genes.
∥O (other) in the ‘mutation type’ column refers primarily to small in-frame deletions/insertions as found in KIT/PDGFRA, and larger duplications/insertions as found in FLT3 and EGFR.
Homo sapiens transposon-derived Buster1
Homo sapiens Cas-Br-M (murine) ecotropic
Homo sapiens endogenous retroviral sequence K,
Homo sapiens endogenous retroviral family W,
Homo sapiens Cas-Br-M (murine) ecotropic
Homo sapiens mRNA containing human
Homo sapiens cDNA FLJ11804 fis, clone
Homo sapiens cDNA clone IMAGE:
Homo sapiens cDNA clone IMAGE:
Homo sapiens LINE-1 type transposase domain
Homo sapiens retrotransposon gag domain
Homo sapiens transposon-derived Buster3
Homo sapiens retrotransposon gag domain
Homo sapiens SET domain and mariner
Homo sapiens tigger transposable element derived
Homo sapiens tigger transposable element derived
Homo sapiens pogo transposable element with
Homo sapiens pogo transposable element with
Homo sapiens tigger transposable element derived
Homo sapiens piggyBac transposable element
This application is a Divisional Application of U.S. application Ser. No. 15/012,111 filed Feb. 1, 2016, which is a Continuation Application of U.S. application Ser. No. 13/819,539 filed Oct. 17, 2013 which is a 35 U.S.C. § 371 National Phase Entry Application of International Application No. PCT/US2011/050041 filed Aug. 31, 2011, which designates the U.S., and which claims the benefit of 35 U.S.C. § 119(e) to U.S. Provisional Application Ser. No. 61/378,860 filed Aug. 31, 2010; 61/421,421 filed Dec. 9, 2010; 61/437,547 filed Jan. 28, 2011; 61-438,199 filed Jan. 31, 2011; and 61/493,261 filed Jun. 3, 2011, the contents of each of which are incorporated herein by reference in their entirety.
This invention was made with Government support under grants CA86355, CA69246, CA141226, and CA141150 awarded by National Cancer Institute. The Government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61493261 | Jun 2011 | US | |
| 61438199 | Jan 2011 | US | |
| 61437547 | Jan 2011 | US | |
| 61421421 | Dec 2010 | US | |
| 61378860 | Aug 2010 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15012111 | Feb 2016 | US |
| Child | 17014540 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 13819539 | Oct 2013 | US |
| Child | 15012111 | US |
