Patent Application
20230220102
The present application includes a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 18, 2021, is named RBYC_022.01US_SeqList_ST25.txt and is 521,445 bytes in size.
The CD25 protein is the alpha chain of interleukin-2 (IL-2) receptor and is a transmembrane protein present on regulatory T cells, and activated T cells. In a normal state, regulatory T cells constitutively express CD25 and act to suppress the expansion of effector cells. Regulatory T cells maintain the healthy state and inhibit effector T cells from reacting against self antigens or over-reacting to foreign antigens. In a normal, protective immune response, effector T cells multiply after contact with foreign antigen and overcome inhibition by regulatory T cells. In case of proliferative diseases, however cancer cells disable the healthy immune response by increasing the amount of regulatory T cells and thereby limiting the generation of effector T cells against them. Additional molecular tools to alter the proliferation of CD25-expressing regulatory T cells are needed, for example to dampen the immune system for use in cancer therapies or to upregulate the immune system for use in autoimmune diseases; provided herein are such tools.
Provided herein are antibodies that specifically bind to CD25 (anti-CD25 antibodies, interchangeably referred to herein as CD25 antibodies). The antibodies may be human, chimeric or humanized. Also provided herein are methods of use and methods of making the antibodies described. For example, the CD25 antibodies may be used therapeutically to treat cancer, comprising administering to a subject in need thereof an antibody or a pharmaceutical composition thereof. Also provided are methods of producing the CD25 antibodies described herein.
In one aspect, provided herein is a monoclonal CD25 antibody which binds to human CD25, and possesses at least one, at least two, at least three, at least four, at least five, or at lease six of the following characteristics:
a. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds;
b. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor;
c. the antibody disrupts the binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the IL-2 receptor, and binds to a different epitope than to which daclizumab or baciliximab bind;
d. the antibody exhibits a higher affinity of binding to CD25 at pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4;
e. the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or
f. the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or
g. the VH of the antibody comprises any one of the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, and 6 or contained in the sequences presented in
h. the VL of the CD25 antibody comprises any one of the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B and 7, or contained in the sequences presented in
i. the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6 and the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
In some embodiments, the VH of the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 combinations as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, or 6 or contained in the sequences presented in
In some embodiments, the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 combinations as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B, or 7 or contained in the sequences presented in
In some embodiments, the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.
In some embodiments, the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
In some embodiments the antibody is a human antibody. In some embodiments the antibody is a humanized antibody. In some embodiments the antibody is a chimeric antibody. In some embodiments the antibody is an antibody fragment. In some embodiments the antibody also binds cynomologous monkey CD25.
In another aspect, provided herein is a method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of any one of the antibodies or pharmaceutical compositions described herein. In some embodiments, provided herein is a method of depleting the number of regulatory T cells in a subject comprising administering to the subject a therapeutically effective amount of any one of the antibodies or pharmaceutical compositions described herein. In some embodiments, the subject suffers from cancer; in other embodiments, the subject suffers from an autoimmune-related disease or disorder.
In another aspect, provided herein is a method of depleting the number of regulatory T cells in a sample comprising peripheral blood mononuclear cells comprising contacting the sample with any one of the antibodies described herein.
In related aspects, provided herein are pharmaceutical compositions or kits comprising any one or more of the antibodies described herein, nucleic acid sequences encoding any of the antibodies described herein, vectors comprising the nucleic acid and phage expressing any of the antibodies described herein.
All of the above features described herein (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.
The present application can be understood by reference to the following description taken in conjunction with the accompanying figures.
Provided herein are antibodies that specifically bind to CD25. The antibodies may be human, chimeric or humanized. Also provided herein are methods of use and methods of making the antibodies described. For example, the CD25 antibodies may be used therapeutically to treat cancer, comprising administering to a subject in need thereof an antibody or a pharmaceutical composition thereof. Also provided are methods of producing the CD25 antibodies described herein.
Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary methods and materials are described.
The headings provided herein are not limitations of the various aspects or embodiments of the invention. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.
Numeric ranges are inclusive of the numbers defining the range.
The term antibody, as used herein, includes but is not limited to a monoclonal antibody, polyclonal antibody, human antibody, humanized antibody, non-human antibody, chimeric antibody, monovalent antibody and antigen-binding fragments of the antibody (e.g Fab fragment, a Fab′2 fragment, or a scFV). Also provided herein are antibody-drug conjugates, bispecific antibodies, and multispecific antibodies that exhibit specificity for CD25. A non-human antibody (e.g. a mouse antibody) may be “humanized” using conventional techniques (e.g. by introducing changes in the framework region, while retaining mouse CDRs).
The terms “polynucleotide” and “nucleic acid” are used interchangeably herein, and refer to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. The terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms encompass nucleic acids containing known analogues of natural nucleotides and having similar binding properties, and are metabolized in a manner similar to naturally-occurring nucleotides, unless specifically limited or stated otherwise.
When a nucleic acid or amino acid sequence is said to have a certain percent “sequence identity” or “identity” or is a certain percent “identical” to another nucleic acid or amino acid sequence, that percentage of bases or amino acids are the same, and in the same relative position, when the sequences are aligned, when comparing the two sequences.
The terms “individual,” “subject,” and “patient” are used interchangeably herein and refer to any subject for whom treatment or therapy is desired. The subject may be a mammalian subject. Mammalian subjects include, e. g., humans, non-human primates, rodents, (e.g., rats, mice), lagomorphs (e.g., rabbits), ungulates (e.g., cows, sheep, pigs, horses, goats, and the like), etc. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a companion animal (e.g. cats, dogs).
Antibodies
Provided herein are antibodies that specifically bind to CD25. Such antibodies are capable of binding to the CD25 antigen either alone or associated with other molecules to form high affinity IL-2 receptors which is present on regulatory T cells.
In some embodiments, the CD25 antibody is a humanized antibody that specifically binds to CD25.
In some embodiments, the CD25 antibody is a chimeric antibody that for example a mouse-human chimeric antibody, e.g. an antibody that comprises mouse variable domains, and a human constant region.
A CD25 antibody of the disclosure can be any of a human IgA, IgD, IgE, IgG, or IgM antibody. The IgA antibody can be an IgA1 or an IgA2 antibody. The IgG antibody can be an IgG1, IgG2, IgG2a, IgG2b, IgG3 or IgG4 antibody. A combination of any of these antibodies can also be made and used. In some embodiments, the constant region is of the IgG type, e.g. of the human IgG type. In some embodiments, the constant region is of the IgG1 type, e.g. of the human IgG1 type.
In some embodiments, the CD25 antibody exhibits cross reactivity to more than one species, for example specifically binds to both human CD25 and non-human CD25, for example specifically binds to both human CD25 and cynomolgus monkey CD25.
The KD (affinity constant) of the antibodies provided herein range from about 10{circumflex over ( )}−5 to about 10{circumflex over ( )}−14 nM. In some embodiments the KD of the antibodies provided herein range from about 10{circumflex over ( )}−8 to about 10{circumflex over ( )}−12 nM. In exemplary embodiments, the KD of a CD25 antibody is at least about 10{circumflex over ( )}−5 nM, about 10{circumflex over ( )}−6 nM, about 10{circumflex over ( )}−7 nM nM, about 10{circumflex over ( )}−8 nM, about 10{circumflex over ( )}−9 nM, about 10{circumflex over ( )}−10 nM, about 10{circumflex over ( )}−11 nM, about 10{circumflex over ( )}−12 nM, about 10{circumflex over ( )}−13 nM, or even about 10{circumflex over ( )}−14 nM.
The Kd (off-rate constant) of the antibodies provided herein range from about 10{circumflex over ( )}−2 to about 10{circumflex over ( )}−6 1/s.
In some embodiments, the CD25 antibody exhibits the same affinity (KD) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH. In some embodiments, the CD25 antibody exhibits the same off-rate (Kd) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH.
In some embodiments, the CD25 antibody exhibits different affinities (different KD) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH. In some embodiments, the CD25 antibody exhibits different off-rate constants (different Kd) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH.
In some embodiments, the CD25 antibody exhibits a lower affinity (higher KD) for the CD25 antigen at physiological pH (about 7.4) than at a pH that is lower than physiological pH, for example when the pH is 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or lower. In exemplary embodiments, the antibody exhibits a higher affinity for the CD25 antigen at a pH of about 6.5, when compared to the affinity at a pH of about 7.4. In some embodiments, such antibodies are useful for retaining activity, or exhibiting enhanced activity in an acidic environment, a hypoxic environment, for example a tumor microenvironment.
In some embodiments, the antibody is a non IL-2-blocking antibody (a non IL-2 blocker)—that is, the binding of the antibody to CD25 does not disrupt or prevent binding of the IL-2 ligand to CD25 (the IL-2 alpha chain), and does not affect IL-2 mediated signal transduction, e.g. signaling through the IL-2/JAK3/STAT-5 signaling pathway. In some embodiments, the antibody does not disrupt the binding of IL-2 ligand to CD25 (IL-2 alpha chain), and binds to a different epitope than where the 7G7B6 antibody binds. In some embodiments, the antibody does not disrupt the binding of the IL-2 ligand to CD25 (IL-2 alpha chain), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor.
In some embodiments, the antibody is an IL-2 blocking antibody (IL-2 blocker), e.g., the antibody disrupts or prevents binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the receptor, and decreases or inhibits IL-2 mediated signal transduction. In certain embodiments, the antibody disrupts or prevents binding of the IL-2 ligand to CD25. In some embodiments, the antibody disrupts or prevents the binding of the IL-2 ligand to CD25, and binds to a different epitope than to which either daclizumab or baciliximab bind.
In some embodiments, the CD25 antibody is a partially blocking antibody (partial IL-2 blocker), and partially, but not completely, disrupts binding of the IL-2 ligand to the alpha, beta, and/or gamma chains of the IL-2 receptor (CD25), and/or partially, but not completely decreases IL-2 mediated signal transduction.
In some embodiments, the CD25 antibody disrupts or prevents heterotrimerization of the alpha, beta, and gamma IL-2 chains. In some embodiments, the antibody does not block binding of the IL-2 ligand with CD25, but does disrupt or prevent heterotrimerization of the alpha, beta, and gamma IL-2 chains. In certain embodiments, the antibody selectively binds to regulatory T cells. In other embodiments, the antibody selectively binds T effector cells.
In some embodiments, binding of the CD25 antibody leads to the depletion of regulatory T cells (Tregs), while allowing for expansion of effector T cells (Teff).
In some embodiments, the antibody binds to CD25 in the trans orientation. In other embodiments the antibody binds to CD25 in the cis orientation. In still further embodiments, the antibody is capable of binding to CD25 in either the cis or the trans configuration.
In some embodiments, the CD25 antibody exhibits greater binding affinity to CD25, as compared to the binding of 7G7B6 (anti-human CD25 with mouse IgG2a Fc receptor; IL-2 non blocker; BioXcell) to CD25.
Tables 1A-1L, 2A-2C, 3A-3C, 4A-4B, 5A-5B, 6, and 7 and
In some embodiments, the CD25 antibody comprises a “V-D-J-region” heavy chain sequence presented in any one of Table 2A, Table 2B, and Table 2C, and a “V-J-region” light chain sequence presented in any one of Table 3A, Table 3B, and Table 3C, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the antibody comprises the heavy chain variable region sequence from a particular antibody clone so named by its given “ID” (or a humanized version thereof) and the light chain variable region sequence from the same antibody clone (e.g. the light chain from clone identified by the same “ID”) (or a humanized version thereof). Thus, the antibody clone of origin can be identified by the ID shown in Tables 2A-2C or 3A-3C. For example, in such embodiments, the CD25 antibody comprises the heavy chain variable region of antibody clone “AHH03760” as presented in row 1 of Table 2B (or a humanized version thereof) and the light chain variable region of antibody clone “AHH03760” as presented in row 3 of Table 3B (or a humanized version thereof). In other embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone so named by its given “ID” (or a humanized version thereof) and the light chain variable region sequence from a different antibody clone (e.g. the light chain from clone identified by the same “ID”) (or a humanized version thereof).
In some embodiments, the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in any one of Table 2A, Table 2B, and Table 2C, and a CDRL1, a CDRL2, and a CDRL3 presented in any one of Table 3A, Table 3B, and Table 3C. In such embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone. As discussed above, the antibody clone of origin can be identified by the ID shown in Tables 2A-2C or 3A-3C.
In some embodiments, the CD25 antibody comprises a heavy chain variable region presented in Table 4A, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The variable region may include the contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequences to form a complete variable region, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a light chain variable region presented in Table 4B, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The variable region may include the contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequences to form a complete variable region, humanized versions thereof, or an amino acid sequence comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 4A and a complete light chain variable region as presented in Table 4B, including humanized versions thereof, and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from the same antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from a different antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The antibody clone of origin can be identified by the ID shown in Tables 4A and 4B.
In some embodiments, the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in Table 4A, and a CDRL1, a CDRL2, and a CDRL3 presented in Table 4B. In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from a different antibody clone. As discussed above, the antibody clone of origin can be identified by the ID shown in Tables 4A and 4B.
In some embodiments, the CD25 antibody comprises a heavy chain variable region presented in Table 5A, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The variable region may include the contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequences to form a complete variable region, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a light chain variable region presented in Table 5B, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The variable region may include the contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequences to form a complete variable region, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 5A and a complete light chain variable region as presented in Table 5B, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from the same antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. In other embodiments, the CD25 antibody comprises the heavy chain variable region sequence from a particular antibody clone and the light chain variable region sequence from a different antibody clone, including humanized versions thereof and amino acid sequences comprising at least a 80%, at least a 85%, at least a 90%, or at least a 95% sequence identity thereto. The antibody clone of origin can be identified by the ID shown in Tables 5A and 5B.
In some embodiments, the CD25 antibody comprises a CDRH1, a CDRH2, and a CDRH3 presented in Table 5A, and a CDRL1, a CDRL2, and a CDRL3 presented in Table 5B. In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 from a particular antibody clone and the CDRL1, CDRL2, and CDRL3 from a different antibody clone. As discussed above, the antibody clone of origin can be identified by the ID shown in Tables 5A and 5B.
In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or
In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or
In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or
In some embodiments, VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in
In some embodiments, VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or contained in the sequences presented in
In some embodiments, VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in
In some embodiments, the VH of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A. In some embodiments, the VL of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B. In some embodiments, the antibody comprises a VH comprising the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A, and a VL comprising the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B.
In some embodiments, the antibody comprises the D5 CDR1, CDR2, and CDR3 amino acid sequences, the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B, or humanized versions of the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B.
In some embodiments, the antibody comprises the D11 CDR1, CDR2, and CDR3 amino acid sequences, the D11 VH and D11 VL amino acid sequences presented in Tables 1C and 1D, or humanized versions of the D11 VH and D11 VL amino acid sequences presented in Tables 1C and 1D.
In some embodiments, the antibody comprises the D16 CDR1, CDR2, and CDR3 amino acid sequences, the D16 VH and D16 VL amino acid sequences presented in Tables 1E and 1F, or humanized versions of the D16 VH and D16 VL amino acid sequences presented in Tables 1E and 1F.
In some embodiments, the antibody comprises the D17 CDR1, CDR2, and CDR3 amino acid sequences, the D17 VH and D17 VL amino acid sequences presented in Tables 1G and 1H, or humanized versions of the D17 VH and D17 VL amino acid sequences presented in Tables 1G and 1H.
In some embodiments, the antibody comprises the D34 CDR1, CDR2, and CDR3 amino acid sequences, the D34 VH and D34 VL amino acid sequences presented in Tables 11 and 1J, or humanized versions of the D34 VH and D34 VL amino acid sequences presented in Tables 11 and 1J.
In some embodiments, the antibody comprises the D36 CDR1, CDR2, and CDR3 amino acid sequences, the D36 VH and D36 VL amino acid sequences presented in Tables 1K and 1L, or the humanized versions of the D36 VH and D36 VL amino acid sequences presented in Tables 1K and 1L.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1 clones presented in Table 5A.
In some embodiments, the CD25 antibody comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1 clones presented in Table 5B.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, and CDRH3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1 clones presented in Table 5A; and the CD25 antibody comprises the CDRL1, CDRL2, and CDRL3 amino acid sequences of any one of the AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1 clones presented in Table 5B.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04507 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04522 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04526 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04527 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04734 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH04750 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05214 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05247 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05249 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05251 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05256 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05257 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05258 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05259 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05268 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05271 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05274 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05280 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05285 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH05286 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4501 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4502 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4503 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4505 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4509 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4511 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4518 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4523 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4524 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of AH4525 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D11 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D17 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D34 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D36 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of D5 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1C4 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D10 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D7 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1E3 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, AND CDRL3 amino acid sequences of BP003-T2P1D1 (presented in Tables 5A and 5B respectively); in some embodiments, the CD25 antibody is a humanized antibody.
In some embodiments, the CD25 antibody is conjugated for a variety of purposes including, but not limited to, for use in therapeutics and detection/diagnostics.
Also provided herein are nucleic acid sequences encoding any of the CD25 antibodies provided herein. Exemplary nucleic acid sequences encoding the D5, D11, D16, D17, D34, and D36 VH and VL regions are provided in Tables 1A-1L—one can use humanized versions thereof. Also provided herein are vectors comprising any of the nucleic acids encoding the antibodies, phage comprising such vectors, and host cells comprising such vectors.
Antibody Generation and Testing
The CD25 antibodies described herein can be generated by injection of a CD25 complete or partial immunogen into an animal, e.g. a mouse or a rabbit. CD25 immunoge positive B-cells from the animal can be collected, and phage libraries generated therefrom. In some embodiments, the phage express Fab fragments of candidate CD25 antibodies. The phage can undergo multiple rounds of screening (referred to herein as phage panning), for example against successively lower concentrations of a CD25 antigen, to select for those Fab fragments capable of binding CD25 with high affinities. The phage can be screened against CD25 antigen coated beads, or some other substrate, for example. In some embodiments, the screening is carried out a physiological pH (e.g. about pH 7.4). In other embodiments, the screening is carried out at a lower pH, for example, at a pH of about 6.5 to screen for Fab fragments capable of binding the CD25 antigen at a lower pH, for example, for use in a therapeutic context, e.g. for use in a hypoxic, acidic tumor microenvironment.
The CD25 antibodies generated herein may be tested for efficacy using a number of in vitro, in vivo, ex vivo, and/or cell-based assays.
In some embodiments, the CD25 antibodies herein can be assayed for, and further selected based on their ability to deplete regulatory T cells. In particular embodiments, the CD25 antibodies herein can be assayed for, and further selected based on their ability to deplete regulatory T cells in an acidic environment, e.g at a pH lower than physiological pH, e.g. at pH 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or lower.
In some embodiments, the CD25 antibodies herein can be assayed for, and further selected based on a pSTAT5 in vitro assay, to assay for the signaling through the IL-2/IL-2 receptor pathway, the maintenance of which indicates that the antibody is not an IL-2 blocking antibody.
In some embodiments, the CD25 antibodies herein can be assayed for using biosensor screening to characterize molecular interactions.
In some embodiments, the CD25 antibodies herein can be assayed for competition for binding against other known CD25 antibodies, with known mechanisms.
In some embodiments, the CD25 antibodies herein can be assayed for epitope specificity.
In some embodiments, the CD25 antibodies herein can be assayed for their capacity to be a non IL-2 blocker, an IL-2 blocker, or a partial IL-2 blocker.
Therapeutic Uses
Provided herein are CD25 antibodies for therapeutic use, e.g. for use in proliferative diseases or disorders such as cancer or for use in autoimmune diseases.
Accordingly provided herein are methods of treating a cancer comprising administering to a subject in need thereof a therapeutically effective amount of a therapeutic CD25 antibody. In some embodiments, the cancer is a primary cancer. In some embodiments, the cancer is a metastatic cancer. In some embodiments, the cancer involves a solid tumor; in other embodiments, the cancer involves a liquid tumor, e.g. a blood based cancer. In exemplary embodiments, the CD25 antibody is a non IL-2 blocking antibody.
Accordingly provided herein are methods of treating an autoimmune-related disease or disorder comprising administering to a subject in need thereof a therapeutically effective amount of a therapeutic CD25 antibody. In exemplary embodiments, the CD25 antibody is an IL-2 blocking antibody.
As used herein, a subject refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sport, or pet animals, such as dogs, horses, rabbits, cattle, pigs, hamsters, gerbils, mice, ferrets, rats, cats, and the like. Subjects may be male or female.
The administration of any of the therapeutic CD25 antibodies provided herein may be administered in combination with other known drugs/treatments (e.g. small molecule drugs, or biologics. The administration may be sequential or concurrent.
In vivo administration of the therapeutic CD25 antibodies described herein may be carried out intravenously, intratumorally, intracranially, intralesionally (e.g. intralesional injection, direct contact diffusion), intracavitary (intraperitoneal, intralpleural, intrauterine, intrarectal), intraperitoneally, intramuscularly, subcutaneously, topically, orally, transdermally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In an exemplary embodiment, the route of administration is by intravenous injection.
A therapeutically effective amount of the therapeutic antibody will be administered. The appropriate dosage of the therapeutic antibody may be determined based on the severity of the cancer, the clinical condition of the subject, the subject's clinical history and response to the treatment, and the discretion of the attending physician
The dosage amounts of the CD25 antibodies provided herein may vary from about 1 ng/kg up to about 1000 mg/kg of a subject's body weight or more per day, depending upon the route of administration. For repeated administrations over several days or longer, depending on the severity of the cancer, the treatment may be sustained until a desired suppression of symptoms is achieved. Dosage regimens may be useful, depending on the pattern of pharmacokinetic decay that the physician wishes to achieve. For example, dosing an individual from one to twenty-one times a week is provided herein. In certain embodiments, dosing frequency is three times per day, twice per day, once per day, once every other day, once weekly, once every two weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, or once monthly, once every two months, once every three months, or longer. Progress of the therapy is may be monitored by conventional techniques and assays. The dosing regimen may vary over time independently of the dose used.
Diagnostic Uses
The CD25 antibodies provided herein may be used for diagnostic and detection purposes. Depending on the application, the CD25 antibody may be detected and quantified in vivo or in vitro.
The CD25 antibodies provided herein are amendable for use in a variety of immunoassays. These immunoassays include, but are not limited to enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (MA), flow cytometry, a radioimmunoassay, an immunofluorescence assay, spectrophotometry, radiography, electrophoresis, high performance liquid chromatography (HPLC), or thin layer chromatography (TLC).
The CD25 antibodies provided herein may be comprise a detectable label, for example detectable by spectroscopic, photochemical, biochemical, immunochemical, fluorescent, electrical, optical or chemical methods. Useful labels in the present disclosure include, but are not limited to fluorescent dyes, radiolabels, enzymes, colorimetric lables, avidin or biotin.
In some embodiments, the CD25 antibody is radiolabeled with an isotope, useful for imaging by nuclear medicine equipment (SPECT, PET, or scintigraphy).
Pharmaceutical Compositions
The disclosure provides compositions comprising therapeutic CD25 antibodies, In some embodiments the composition is sterile. The pharmaceutical compositions generally comprise an effective amount of the therapeutic antibody in a pharmaceutically acceptable excipient.
Kits and Articles of Manufacture
The disclosure also provides for kits comprising any of the CD25 antibodies described herein, e.g. for either therapeutic or diagnostic uses. In some embodiments, the kits further contain a component selected from any of secondary antibodies, reagents for immunohistochemistry analysis, pharmaceutically acceptable excipient and instruction manual and any combination thereof. In some embodiments, the kit comprises any one or more of the therapeutic compositions described herein, with one or more pharmaceutically acceptable excipients.
The present application also provides articles of manufacture comprising any one of the therapeutic or diagnostic compositions or kits described herein. Examples of an article of manufacture include vials (e.g. sealed vials).
The description provided herein sets forth numerous exemplary configurations, methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure, but is instead provided as a description of exemplary embodiments.
The following examples are included for illustrative purposes and are not intend to limit the scope of the invention.
Embodiment 1. A monoclonal CD25 antibody which binds to human CD25, and possesses at least one of the following characteristics:
a. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds;
b. the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor;
c. the antibody disrupts the binding of the IL-2 ligand to the alpha (CD25), beta, and/or gamma chains of the IL-2 receptor, and binds to a different epitope than to which daclizumab or baciliximab bind;
d. the antibody exhibits a higher affinity of binding to CD25 at pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4;
e. the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or
f. the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or
g. the VH of the antibody comprises any one of the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A, and 6 or contained in the sequences presented in
h. the VL of the CD25 antibody comprises any one of the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B and 7, or contained in the sequences presented in
i. the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6 and the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
Embodiment 2. The antibody of embodiment 1, wherein the antibody possesses at least two, at least three, at least four, at least five, or at least six of the characteristics provided therein.
Embodiment 3. The antibody of embodiment 1, wherein the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), and binds to a different epitope than to which 7G7B6 binds.
Embodiment 4. The antibody of embodiment 1, wherein the antibody does not disrupt the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), but does disrupt the trimerization of the beta, gamma, and alpha (CD25) chains of the IL-2 receptor.
Embodiment 5. The antibody of embodiment 1, wherein the antibody disrupts the binding of the IL-2 ligand to the IL-2 receptor, and binds to a different epitope than to which Daclizumab or Baciliximab bind.
Embodiment 6. The antibody of embodiment 1, wherein the antibody exhibits a higher affinity of binding to CD25 at a pH lower than 7.4, when compared to the affinity of binding to CD25 at a pH of 7.4.
Embodiment 7. The antibody of embodiment 6, wherein the antibody exhibits a higher affinity of binding to CD25 at a pH of about 6.5.
Embodiment 8. The antibody of any one of embodiments 1 to 7, wherein the antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or
Embodiment 9. The antibody of any one of embodiments 1 to 8, wherein the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or
Embodiment 10. The antibody of any one of embodiments 1 to 7, wherein the VH of the antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or contained in the sequences presented in
Embodiment 11. The antibody of any one of embodiments 1 to 7 and embodiment 10, wherein the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or contained in the sequences presented in
Embodiment 12. The antibody of any one of embodiments 1 to 10, wherein the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.
Embodiment 13. The antibody of any one of embodiments 1 to 10, wherein the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.
Embodiment 14. The antibody of any one of embodiments 1 to 13, wherein the antibody is a human antibody.
Embodiment 15. The antibody of any one of embodiments 1 to 13, wherein the antibody is a humanized antibody.
Embodiment 16. The antibody of any one of embodiments 1 to 13, wherein the antibody is a chimeric antibody.
Embodiment 17. The antibody of embodiment 16, wherein the antibody comprises a mouse variable domain, and a human constant domain.
Embodiment 18. The antibody of any one of embodiments 1 to 15, wherein the antibody is an antibody fragment.
Embodiment 19. The antibody of any one of embodiments 1 to 18, wherein the antibody also binds cynomologous monkey CD25.
Embodiment 20. A pharmaceutical composition comprising any one of the antibodies of embodiments 1 to 19.
Embodiment 21. A nucleic acid sequence encoding any one of the antibodies of embodiments 1 to 19.
Embodiment 22. A vector comprising the nucleic acid sequence of embodiment 21.
Embodiment 23. A phage expressing any one of the antibodies of embodiments 1 to 19.
Embodiment 24. A method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
Embodiment 25. A method of depleting the number of regulatory T cells in a subject comprising administering to the subject a therapeutically effective amount of any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
Embodiment 26. The method of embodiment 24 or 25, wherein the subject suffers from cancer.
Embodiment 27. The method of embodiment 24 or 25, wherein the subject suffers from an autoimmune-related disease or disorder.
Embodiment 28. A method of depleting the number of regulatory T cells in a sample comprising peripheral blood mononuclear cells comprising contacting the sample with any one of the antibodies of embodiments 1 to 19.
Embodiment 29. A kit comprising any one of the antibodies of embodiments 1 to 19 or the pharmaceutical composition of embodiment 20.
Full length CD25 conjugated to KLH was injected into five difference BalbC mice. All injections were done via the tail vein. The immunization protocol was as follows:
Splenocytes and Leukocytes from four of the five mice were used to generate four phage libraries. The phage libraries contained phage, expressing antigen binding (Fab) fragments. More specifically, a M13 phagemid library using materials from the immunized animals was constructed as follows. (i) Total RNA from leukocytes and splenocytes was extracted; (ii) VH and VL genes were amplified with specific primers; and (iii) VH and VL fragments were inserted into GenScript's M13 phagemid vector by two-step cloning. The library size >2×10{circumflex over ( )}8; the insert rate was >90%, and the in-frame rate was >80%. The library was a high diversity library, with at >95% of unique sequences.
3 rounds of phage panning of the Fab-containing phage libraries were carried out, using an ELISA-based assay. The phage were screened against beads coated with CD25. Each round was carried out with a decreasing concentration of CD25. Individual phage clones were expressed in E. coli TG1 cells (plated on LB/carbenicillin). Single colonies were cultured in 0.4 ml 2YT broth for 30 min at 37° C., and then infected with M13 K07 helper phage for 3 hours at 37° C. Then 50 μg/ml carbenicillin and 10 μg/ml Kanamycin were added to the culture which was then grown overnight at 25° C. The next day, phage was harvested from the cultures.
Positive clones were sequenced as follows. Positive hit clones were cultured overnight and plasmid DNA was prepared with a Qiagen plasmid miniprep kit. Purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for sanger sequencing. The VH sequence was obtained with the sequencing primers (ACGCCTGCGAAGTCACCCAT (SEQ ID NO: 1497)) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC (SEQ ID NO: 1498)). The VL sequence was obtained with the sequencing primer (AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 1499)), or CGGATAACAATTTCACACAG (SEQ ID NO: 1500).
Tables 4A, 4B, 5A, and 5B show additional clones after similar panning protocols.
Further pH-based phage panning was carried out.
Further phage panning was carried out to select for Fab candidates that bind CD25 at lower pH ranges, to select for binders that could bind, for example, in a hypoxic, acidic tumor microenvironment.
The four mouse HuCD25 immunized phage libraries (7807, 7808, 7809, 7810) were transformed by electroporation in TG1 and phage propagated with the addition of CM13 using standard Phage Display protocols (Barbas et al., 2001). TG1 cultures secreting phage were PEG precipitated with PEG/NaCl after incubation on ice for one hour.
The phage libraries (7807, 7808, 7809, 7810) were used for specific pH selections using standard protocols. To deplete antibodies that bind with high affinity at physiological pH, subtractive panning was first carried out by counter-selection of 3×10{circumflex over ( )}11 pfu phage (1000-fold representation of a 3×10{circumflex over ( )}8) at pH 7.4 by absorption for 1 hour on ELISA plates coated with 10 ug/ml full-length CD25 (400 nM) in PBST pH 7.4. Resulting phage supernatant was collected and pH was adjusted to pH 6.5 with PB ST. Subsequent phage panning selections were carried out at pH 6.5
Panning selections were pre-cleared with 25 microliters streptavidin dynabeads with no CD25 antigen after 1 hour incubation. Phage were then added to new pre-blocked Eppendorf LoBind tube. Biotinylated full-length CD25 antigen was added at 100 nM concentration for one hour. Samples were then incubated with 25 microliters streptavidin beads RT for one hour. Samples were pelleted and washed using magnet/magnetic beads 7-9 times with PBST. Tubes were changed twice to remove residual phage.
To elute phage, 800 microliters Glycine pH 2.2 were added to beads and incubated for no more than ten minutes. They were then neutralized with high pH Tris 9.0. Eluted phage were added to 1 ml TG1 freshly grown (0D600-0.5), and incubated for 20-30 minutes. Fractional log dilution series were plated on plates, and the remainder was transferred to 25 ml 2×YT (2×Yeast Tryptone Broth). These steps were repeated two additional times for a total of three panning rounds, followed by Phage ELISA and Octet screening of periplasmic extracts.
Sequencing
Positive hit clones were cultured overnight and plasmid DNA was prepared with a Qiagen plasmid miniprep kit. Purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for sanger sequencing. The VH sequence was obtained with the sequencing primer (ACGCCTGCGAAGTCACCCAT (SEQ ID NO: 1497)) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC (SEQ ID NO: 1498)). The VL sequence was obtained with the sequencing primer (AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 1499)) or (CGGATAACAATTTCACACAG (SEQ ID NO: 1500)). VH and VL V-D-J arrangements, nucleic acid alignments, and amino acid alignments were identified by IMGT High V-Quest.
Sequences for selected Fab clones D5, D11, D16, D17, D34, and D36 are presented in Tables 1A-1L.
ELISA/Extract Preparation
Phage ELISA, for assessing CD25 binding to Fab phage, and periplasmic extract preparation for Fab Octet screening were conducted essentially as described, with modifications noted (Schwimmer et al., 2013).
The CD25 antigen was diluted in PBS, pH 7.4. 50 microliters of antigen solution were made containing 1 ug of CD25 for each well of a 96-well plate to be coated. 50 microliters of antigen solution was added to the ELISA plate wells and incubate overnight at 4° C. Following the incubation, wells were washed twice with PBS, and wells were blocked by adding 200 microliters of 1×PBST 2.0% BSA and incubated for 2 hours at 25° C. Phage were diluted two-fold in 1×PBST 1.0% BSA, pH 6.5. 50 microliters were added per and incubated for 5 minutes at room temperature. The blocking solution was shaken out of the wells, and 50 ul of the dilute phage preparation was added to each well, and incubated for 1 hour at room temperature. The ELISA plate wells were washed 3-5 times with 200 microliters PBST pH 6.5. HRP-conjugated anti-M13 antibodies were diluted (Abcam, ab50370) 1:5000 with 1×PBST 1.0% BSA pH 6.5. 50 microliters of diluted secondary antibody conjugate was added to each well, and incubated for 1 hour at room temperature. ELISA plate wells were washed 3-5 times with 200 microliters PBST pH 6.5. The ECL Lumo substrate was prepared (e.g. Supersignal ELISA Pico Chemiluminescent Substrate) as described, into a 1:1 mixture. 50 microliters substrate solution was added to each well, incubated at room temperature for 5 to 60 minutes before reading.
Colonies were inoculated in 0.03-4 ml 2×YT 0.2% Glucose with 0.1 ml overnight culture (1 ml cultures in 96-well plate or 4 ml cultures in 14-ml falcon tubes). They were incubated at 250-700 rpm for 1.5-2 hours at 37° C. until the OD600˜0.5-1.0. Cultures were induced with 50-400 ul IPTG 0.025-0.1M. In some cases, the temperature was reduced to 30° C. with shaking at 250 rpm. They were then incubated overnight. Next day cultures were harvested by pelleting 3400 rcf for 10-15 minutes. The supernatant was discarded.
Cultures were resuspended with 50-75 ul PPB buffer (30 mM Tris-HCl, pH 8.0, 1 mM EDTA, 20% Sucrose) with 1× Halt Protease Inhibitor and incubated on a rocking platform for 15 minutes at room temperature or 4° C. for 10 min. Cultures were resuspended with 150-225 ul of cold ddH20 with 1× Halt Protease Inhibitor and incubated on a rocking platform for one hour at room temperature or 4° C. for 1-2 hours. The lysate suspension was spun at 15000 rcf for 10-15 min at 4C. Supernatant was collected and diluted.
Fab Expression and Purification Protocol
Single E. coli colonies were inoculated and grown in 50 2×YT 0.2% Glucose with 0.03-0.5 ml overnight culture in plates or 50 mL cultures. Cultures were incubated at 250-700 rpm at 37° C. for 1.5-hours. Cultures were induced with 50 ul of 25 mM-1M IPTG. The temperature was reduced to 30° C. and rpm to 150. Incubation was done overnight. 50 ml cultures or plates were harvested by pelleting 3400 rcf for 15 minutes. The supernatant was discarded. Cell pellets from 50 mL cultures were placed in a −80° C. freezer for 1 hour, while cultures grown in plates had 75 uL of PPB added with 1× Halt protease inhibitor, EDTA-free (Thermo Fisher Scientific) and vortexed. Plates were shaken at 4° C. for 10 minutes at 1000 rpm. The volume of 225 uL of cold water with 1× Halt protease inhibitor, EDTA-free (Thermo Fisher Scientific) was added to each well. Samples were mixed and shaken at 4° C. for 1-2 hours at max speed i.e. 1000 rpm. Plates were spun at 3500 rpm for 10 mins at 4° C. The supernatant (PPE) was transferred to fresh plates and stored at −20° C. Cell pellets from the 50 mL cultures were removed from the freezer and 5 ml PBS, 10 mM Imidazole was added with 2.5 mg/ml lysozyme and 1× Halt protease inhibitor, EDTA-free (Thermo Fisher Scientific). These were incubated at room temperature for 30 minutes once pellet had fully thawed/mixed. The lysate was centrifuged for 15 minutes at 3400 rcf. The supernatant was removed and pellet discarded. 500 ul Ni-NTA resin was added (pre-washed and pelleted) or a Ni-NTA spin column was used for Fab purification. Incubate with cleared lysate for 30 min-1 hr. This was spun at 1500 rcf. These were washed 5 times with 1 ml PBS, 10 mM Imidazole. Buffer was discarded after each spin. 1 ml PBS, 200 mM Imidazole were added and mixed, incubated for 30 minutes and spun at 1500 rcf for 15 minutes. The eluted protein was stored at 4° C. or 20° C. after determining protein concentration. Zeba columns were used for desalting/buffer exchange.
Octet/Biosensor Screening of Fabs
For Octet Koff rate screening in raw supernatants, 50 ul of lysate was used in 384-well Pall ForteBio Octet plates. Data was collected on an Octet RED 384 (MD ForteBio). Briefly, Human CD25 was coupled to AR2G tips (1 ug/ml). For data collection, baseline was assessed in PBST 1% BSA buffer at pH 6.5 for 60 seconds. Tips were then moved to 50 ul lysate pH6.5 adjusted and association measured for 300 seconds. Finally, tips were moved to PBST 1% BSA buffer at pH 6.5. Tips were then regenerated with 200 mM Tris-Glycine, pH 2.5 and neutralization with PBST, 1% BSA, pH 6.5. For data analysis, Double referencing was performed on Octet HT 11.0 software (no CD25 on tip as well as blank reference well), for reference subtraction.
Biosensor assays were carried out to determine whether selected Fabs would block IL-2 binding to CD25.
Octet/Biosensor Screening of Human IgG1 Antibodies
A subset of selected 40 Fabs were reformatted to contain a human IgG1 (referred to herein as human IgG1 antibodies), and data were collected these. The Fabs selected for reformatting are show in Tables 5A (heavy chains) and Table 5B (light chains). The Koff rates and affinity of the different reformatted IgG1 antibodies were evaluated on a FortéBio® Octet RED384™ bio-layer interferometry instrument. Purified antibodies were covalently immobilized on amine reactive biosensors (Fortebio® AR2G), and excess reactive esters were blocked with ethanolamine. Sensors were then dipped into running buffer as a baseline, transferred to wells containing 300 nM full-length CD25, and then transferred back into running buffer. Association of CD25 and subsequent dissociation was recorded in duplicate. Association of running buffer only (to control for sensor drift), and additional sensors with immobilized IgG from human ND serum (to control for non-specific IgG binding), were run as controls. The observed on and off rates were fit using a 1:1 binding fit model, and the equilibrium binding constant (KD) was calculated.
Epitope binning of reformatted human IgG1 antibodies were done using cross-competition assays performed in the classical sandwich format, which involves collecting a baseline, immobilizing the sample antibody onto the biosensor, capturing the antigen, and then incubating with a competitive analyte. The competitive analyte can bind the captured CD25 only if its binding epitope does not overlap with that of the immobilized antibody. Purified antibodies were covalently immobilized on amine reactive biosensors (Fortebio® AR2G), and excess reactive esters were blocked with ethanolamine. Sensors were dipped into running buffer as a baseline, followed by full-length CD25. Then the sensors were transferred to wells containing a competitive analyte (IL-2, 7G7B6, Basiliximab, Daclizumab) or running buffer as a reference. Sensors were regenerated when necessary by exposing them to 3 cycles of 0.1 M Glycine pH 2.0 for 10 seconds, followed by running buffer for 10 seconds.
Results
Table 8 shows that the Fab clones tested exhibited similar binding kinetics at physiological and acidic pH.
Additional epitope mapping of functional epitopes will be performed by Alanine Mutagensis. This method is used as an orthogonal method for binning antibodies as it operates on the functional epitope, rather than the structural epitope defined by competition assays. Various pairs of surface-accessible residues are selected for mutagenesis. Computational modeling is used to confirm that the alanine mutations selected for use in these assays do not impact global or local stability.
Cell Binding Assays for CD25 Specific Binding of Human IgG Antibodies
To validate antibody binding to CD25 on cells and for specificity, three cell lines SUDHL-1 and SUDHL-2 (human large diffuse histiocytic lymphoma cell lines, ATCC) and HEK IL-2 reporter cells (Invivogen) were used to test for CD25 binding. SUDHL-1 and HEK IL-2 reporter cell lines are CD25+, while SUDHL-2 are CD25− cells. For each cell line, 100,000 cells were plated in a 96 well round bottom plate in cell buffer (PBS+2% HI FBS) and centrifuged. Antibody concentrations from 1-10 ug/mL were used to test the binding of each antibody. Cell were resuspended in 100 uL of antibodies/well and incubated for 20 minutes on ice. After incubation, cells were centrifuged at 300×g for 5 minutes at room temperature, and resuspended and washed with ice cold cell buffer. Cells were then stained with an anti-human Fc secondary antibody conjugated to AF647 (Biolegend) and incubated on ice for 20 min in the dark. Cells were centrifuged, washed and resuspended in cold cell buffer with DAPI and analyzed using flow cytometry (Cytoflex, Becton Dickinson). DAPI+ cell were excluded from analysis. The mean fluorescence intensity was calculated using the median (FlowJo, TreeStar).
Recombinant CD25 Cynomolgus Monkey Binding of Human IgG1 Clones
To test for binding to recombinant cynomolgus monkey (cyno) CD25, microtiter plates were coated with 80 ul of 1 ug/ml Cyno CD25 in 50 mM sodium carbonate pH 9.6) at 4° C. overnight. The next day, remove the protein from the wells and block with 200 ul PBS/0.1% BSA/0.05% tween20. The plate was incubated for 1 hour at room temperature. Human IgG1 reformatted Fab clones (human IgG1 antibodies) starting 25 nM and 3 fold serially were diluted in PBT buffer and added to the plate for incubation at RT for 1 hour. The plate was then washed and then 1:2500 dilution of HRP conjugate anti-Fab antibody was added. The plate was washed 5-10 times with PBS/tween20 to remove non-specific binders. TMB perxidase substrate and peroxidase solution were added and incubated for the time needed to develop with 80 uL of ELISA stop solution added at the end. OD measurements were then taken at 450 nM using a plate reader (SpectraMax iD3 Plate Reader, Molecular Devices).
pSTAT5 Assay for Screening Biological Activity of Fab Clones on Highly Purified Human Regulatory T Cells
The IL-2/JAK3/STAT-5 signaling pathway is involved in the survival and expansion of Tregs. This pathway initiates and maintains the expression of the transcription factor Foxp3, a factor that is essential for the suppressive activity of Tregs. When IL-2 binds to IL-2R, JAK proteins get activated; they are tyrosine kinases that are bound to the cytoplasmic regions of IL-2 receptors. This initiates trans-phosphorylation on specific tyrosine residues generating docking sites for STAT proteins to be recruited and phosphorylated. Dimerized and phosphorylated STATs are then translocated to the nucleus to bind specific DNA sequences, regulating the transcription of several target genes, such as Foxp3 and CD25 in Tregs.
In this example, the functionality of selected Fabs when bound to CD25 on primary human regulatory T cells was assessed. This assay allowed for determination which are IL-2 blockers, non-blockers and partial blockers, as well as potency, based on pSTAT5 levels. Controls used in the assay include a known IL-2 blocker (Daclizumab) and IL-2 non-blocker (7G7B6). First, fresh PBMC cells were isolated from leukocyte reduction system chambers (Stanford Blood Center). Equal volume of cell buffer (PBS+2% HI FBS) was added to each blood sample and added to a Ficoll Paque filled inside a 50 mL SepMate conical tube (Stem Cell Technologies) and followed standard protocol for PBMC isolation using SepMate tubes. To isolate human T regulatory cells from PBMCs, the EasySep Human CD4+CD127low CD25+ Regulatory T cell isolation kit (Stem Cell Technologies) and Regulatory Human CD4+CD25+ T cell kit (Dynabeads) were used. Respective isolation kit protocols were used for magnetic based isolation of cells. Treg isolation was confirmed by staining cells with anti-human CD4, CD25, CD127 antibodies and intracellular Foxp3 staining (BD Biosciences). For the pSTAT5 assay, 100,000 Tregs were plated in a 96 well round bottom plate and centrifuged. Antibody concentrations from 1-5 ug/mL were used. Tregs were resuspended in 50 uL of antibodies/well and incubated for 15 minutes in 37° C. incubator. Next, dilutions for IL-2 were prepared starting at 100 ng/mL concentration with 10 fold dilutions in cell media. IL-2 dilutions were added to the wells at 50 uL/well for 10 minutes in 37° C. incubator. After incubation, the plate was centrifuged at 300×g for 5 minutes at room temperature, and resuspended in 100 uL/well of room temperature fixation buffer (BD Biosciences), for 15 min at room temperature. Cells were spun down and resuspended in cold cell buffer (PBS+2% HI FBS). Cells were then resuspended in 100 uL/well of ice cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 minutes. Cells were washed with cell buffer and resuspended in 50 uL of prepared pSTAT5 antibody for analysis using flow cytometry (Cytoflex, Becton Dickinson).
pSTAT5 Assay for Screening Biological Activity of Antibody Clones Using HEK IL-2 Reporter Cells
In this example, clones were tested using the HEK IL-2 reporter cell line (Invivogen). This cell line was generated by Invivogen to monitor the activation of the JAK-STAT pathway with the binding of IL-2. To obtain a fully active human IL-2 signaling pathway, the reporter cell line was created by stably transfecting HEK293 cells with human IL-2Rα, IL-2Rβ and IL-2Rγ genes, and JAK3 and STATS genes. This assay presents a high throughput method for evaluating IL-2 physiology and characterization of IL-2 blockers, non-blockers, partial blockers, with the addition of antibodies and competitors in the presence of IL-2, based on pSTAT5 levels. Controls used in the assay include a known IL-2 blocker (Daclizumab and Basiliximab) and IL-2 non-blocker (7G7B6). For a pSTAT5 assay, 100,000 cells were plated in a 96 well round bottom plate and centrifuged. Antibody concentrations from 1-5 ug/mL) were used. HEK cells were resuspended in 50 uL of antibodies/well and incubated for 15 minutes in 37° C. incubator. Next, dilutions for IL-2 were prepared starting at 10 ng/mL concentration with 10 fold dilutions in cell media. IL-2 dilutions were added to the wells at 50 uL/well for 10 minutes in 37° C. incubator. After incubation, the plate was centrifuged at 300×g for 5 minutes at room temperature, and resuspended in 100 uL/well of room temperature fixation buffer (BD Biosciences), for 15 min at room temperature. Cells were spun down and resuspended in cold cell buffer (PBS+2% HI FBS). Cells were then resuspended in 100 uL/well of ice cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 minutes. Cells were washed with cell buffer and resuspended in 50 uL of prepared pSTAT5 antibody for analysis using flow cytometry (Cytoflex, Becton Dickinson). Percent pSTAT5+ cells were quantified based on the parental population and values were normalized to IL-2 at 10 ng/mL concentration.
Results
Subsequent assays will include the Fab form of Daclizumab and 7G7B6 as well as testing the same Fab clones on multiple donors. In addition, the pSTAT5 assay will be performed at lower pH levels (pH 6.4-6.7) to recapitulate pH of the tumor microenvironment against clone activity at physiological pH.
Continued pSTAT5 studies may be done to test these antibody clones using primary Tregs and multiple donors.
Functional Cell Killing Assay ADCC and ADCP
One of the mechanisms for Treg depletion is through antibody-dependent cell cytotoxicity (ADCC). This is a cell-mediated immune defense mechanism that usually causes cell death, triggered by the recognition of immune/effector cells to antibodies bound to a specific antigen on a target cell. To elicit ADCC, antibodies with the human Fc subclass, IgG1, is commonly chosen for its effector functions with the ability to bind to the three Fc receptors: FcγRI (CD64), FCγRII (CD32), and FcγRIIIA (CD16), that are expressed on immune cells such as NK cells, monocytes and granulocytes. NK cells predominantly express FcγRIIIA and considered to be the main effector cell in ADCC
In this example, ADCC was quantified using a Lactate dehydrogenase (LDH) Cytotoxicity plate-based colorimetric assay (Thermo Fisher). In this assay, the release of LDH is proportional to the amount of cell killing. Lactate dehydrogenase (LDH) is a cytosolic enzyme, present in all cells, that is released when the plasma membrane is damaged. Extracellular LDH in the media is quantified by a coupled enzymatic reaction in which LDH catalyzes the conversion of lactate to pyruvate via NAD+ reduction to NADH. By addition of diaphorase, NADH is reduced to a tetrazolium salt (INT) to form a formazan product that can be measured at 490 nm. Controls for the assay include the use of Rituximab (anti-CD20 antibody) on human Raji lymphoma cell line and Daclizumab on SUDHL-1 cells (both antibodies are known to induce ADCC). Additional controls include: non-glycosylated human IgG1, as a negative control and non-fucosylated human IgG1, as a positive control. As a first initial screen, reformatted clones were tested in the ADCC assay at one concentration (10 ug/mL) using PBMCs from a single donor. Human PBMCs (ASTARTE Biologics) were thawed the day before and cultured overnight with X-VIVO 15 or 20 media (Lonza) at 37C in 5% CO2 incubator. On the day of experiment, PBMCs and SUDHL-1 target cells were counted and resuspended in X-VIVO 15 (Lonza, phenol red) serum free medium. Antibody dilutions were prepared starting with 10 ug/ml with 5 fold serial dilutions. Target cells were then plated in a 96 well 50 μL/well in a 96-well white flat bottom opaque plate (CORNING Ref #3917) and 10 μL/well antibody dilution was added to the target cells and incubated at 37° C. and 5% CO2 incubator for 30 min. After the incubation, PBMCs were added to the target cells (50 μL/well). For control target cells for spontaneous and max LDH release calculation, 50 μL/well of assay medium (X-VIVO15, phenol red free) was added. The co-incubation (ADCC induction) was done by incubating the plate for 4 h at 37° C. and 5% CO2 incubator 45 min before the co-incubation completed, 10% Triton X100 solution (in PBS) was added to the wells to calculate Max LDH release (10 μL/well, 11× dilution factor). After the incubation, 50 μL/well of the reaction substrate was plated in a 96-well plate (clear flat bottom) and then 50 μL/well of the supernatant of the assay plate was transferred to the reaction substrate. The plate was developed in the dark at RT for 30 min. After the incubation, 50 μL/well of stop solution was added and absorbance 490 nm and 680 nm was measured by using a plate reader (SpectraMax iD3 Plate Reader, Molecular Devices).
Additionally, function antibody-dependent cell phagocytosis (ADCP) assays will also be performed to test activity of macrophages to phagocytose Treg cells upon antibody binding. This may be an additional mechanism of action for Treg depletion. Fc receptor FCγRIIa (CD32b) on macrophages is thought to be the dominant inducer for ADCP. In this assay, primary Tregs will be used as target cells with human monocyte-derived macrophages as effector cells. PBMCs will be isolated from leukocyte reduction system chambers (Stanford Blood Center) for monocyte isolation using CD14 microbeads (Miltenyi Biotec) and for Tregs using Regulatory Human CD4+CD25+ T cell kit (Dynabeads) and Human Treg Cell Differentiation kit (R&D Systems). Monocytes will be cultured for 5-7 days with human serum or M-CSF in media. At days 5-7, macrophages will be cocultured with pre-labeled Tregs (labeled with a fixable viability dye (Invitrogen)) for 2-4 hours at 10 to 1 effector to target ratio with addition of anti-CD25 antibodies and controls, and fixed with fixation buffer (BD Bioscienes). Macrophages will be stained with CD14 to identify macrophages from labeled Tregs, and analyzed for the phagocytic population defined as CD14+ and Treg labeled+ population using flow cytometry. Anti-CD25 antibodies are expected to also induce ADCP.
Results
Subsequent studies will include additional donors of PBMCs and NK cells as effectors for functional ADCC killing assays.
Characterization, In Vitro
Subsequent in vitro characterizations will include T-cell activation and Treg suppression studies to evaluate the impact of CD25 antibodies on T-effector cell responses in the absence and presence of Treg cells. Readouts for activation will include intracellular granzyme B, proliferation and cytokine release (e.g. IL-2, IFNγ, TNF-α). Specifically, human primary conventional T cells (T cony cells) from healthy donors and donors with specific antigen responses (e.g. human cytomegalovirus or influenza flu antigens) will be labeled with a cell proliferation dye (e.g. ThermoFisher) and treated with varying concentrations of CD25 and control antibodies (1-10 ug/mL), followed by activation using CD3/CD28 beads and incubated with and without Tregs for incubation at 37° C., 5% CO2 for 48-72 hours. To evaluate T cell activation, supernatants will be collected for cytokine analysis and cells will be stained with fixable viability dye (e.g. Thermofisher) and with surface anti human T cell markers: CD3, CD4, CD8, CD45RA, CD25, followed by fixation and permeabilization for staining of intracellular Granzyme B and Foxp3. Cells will be analyzed using flow cytometry for Granzyme B positive and proliferating cells.
Characterization, In Vivo
In vivo activity of CD25 antibodies using a mouse xenograft tumor model. These experiments will help to distinguish differences in CD25 antibodies based on CD25+ tumor depletion via ADCC and/or ADCP. Candidate antibodies will be produced as mouse IgG2a isotype antibodies and used in immunodeficient RAG−/− knockout mice (with functional NK and APC cells, but no mature B or T lymphocytes). Animals will be subcutaneously engrafted with CD25+ human cell lines (e.g SUDHL-1, a CD25+ anaplastic large cell lymphoma). Various size tumors (palpable, 100-500 mm3) may be used to discern the differences between antibodies. Animals will be treated with different doses of CD25 antibodies (e.g. 1-10 mg/kg, 3× weekly or once daily) and monitored for changes in body weight and TGI.
Drug Efficacy and MOA Studies in Mouse Xenograft Tumor Models in Humanized Mice.
The more effective antibodies for tumor growth inhibition via Treg depletion and increased intratumoral Teff/Treg ratio with increased T effector cell activity will be tested in various human tumor models (e.g. liver, breast, melanoma, gastric, NSCLC and colon cancer) to establish efficacy and mechanism of action. Some studies may include using the triple negative breast cancer cell line MDA-MB-231, a gastric cell line, melanoma cell line A375 and liver cancer cell line Huh-7 as well as human PDX models that have been well characterized and have either shown correlations between infiltrated Tregs and tumor growth and/or have been treated with PD-1 antibody combinations in humanized mice engrafted with human PBMCs and/or CD34+ cells. In these models, tumors will be subcutaneously engrafted until tumors reach a range of sizes from palpable to 100-500 mm3, and treated with various doses of CD25 antibodies and dosing schedules (e.g. 1-10 mg/kg, 3× weekly or once daily). Animal health scoring, bodyweight, tumor growth as well as immunophenotyping of blood and tumors will be performed to characterize tumor and immune cell composition and tumor infilitrating cells, and cytokine secretion using flow cytometry, Meso Scale Discovery multiplex plates and histology.
Combination studies in mouse xenograft tumor models in humanized mice. Once the lead candidate and indication is established based on efficacy and MOA studies, we will perform combination studies using a wide range of agents to increase immunogenicity and activation of other pathways for immune activation (e.g. chemotherapy, checkpoint inhibitors, TLR agonists, vaccines). Combination experiments will be conducted in similar tumor models used in efficacy and MOA studies.
All patents, patent applications, publications, documents, web links, and articles cited herein are incorporated herein by reference in their entireties.
This application is a continuation of International Application No. PCT/US2019/061552, filed Nov. 14, 2019, which claims the priority benefit of U.S. Provisional Application No. 62/767,405, filed on Nov. 14, 2018, the entire contents of which are hereby incorporated by reference in their entirety for all purposes.
| Number | Date | Country | |
|---|---|---|---|
| 62767405 | Nov 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2019/061552 | Nov 2019 | US |
| Child | 17320125 | US |
