Chimaeric hepadnavirus core antigen proteins

Abstract
Particles, useful as a delivery system for an epitope, are composed of a chimaeric hepadnavirus core antigen protein wherein a foreign amino acid sequence comprising an epitope is inserted in or replaces all or part of the sequence of amino acid residues from 68 to 90 in the case where the core antigen is hepatitis B core antigen or the corresponding amino acid sequence in the case of the core antigen of another hepadnavirus.
Description


[0001] This invention relates to the construction of chimaeric hepadnavirus core antigen proteins.


[0002] Hepatitis B virus is a hepadnavirus virus with a partly double stranded genome of 3200 nucleotides. The viral DNA is surrounded by the viral coded core antigen (HBcAg) which is enclosed by the similarly coded surface antigen (Robinson, Ann. Rev. Microbiol. 31, 357-377, 1977). Removal of the surface antigen by mild detergent treatment leaves a core particle 27 nm in diameter composed of HBcAg and the viral DNA. HBcAg has been expressed in microbial cells as the native polypeptide and as a derivative fused to the terminal eight residues of beta-galactosidase (see Murray et al, EMBO J. 3, 645-650, 1984 for refs).


[0003] When synthesized in E. coli the core protein self assembles into 27 nm particles which can be visualized under the electron microscope (Cohen and Richmond, Nature, 296, 677-678, 1982) and which are immunogenic in laboratory animals (Stahl et al, Proc. Natl. Acad. Sci. USA 79, 1606-1610, 1982). The amino acid sequence of the core antigen shows a region towards the carboxy terminus which is homologous with that found in protamines (DNA binding proteins). By inference, it has been suggested that this part of the molecule interacts with DNA during assembly of core particles (Pasek et al, Nature, 282, 575-579, 1979).


[0004] The use of recombinant particles comprising hepatitis B core antigen and heterologous protein sequences as potent immunogenic moieties is well documented. We have previously shown that addition of heterologous sequences to the amino terminus of the protein results in the spontaneous assembly of particulate structures on the surface of which the heterologous epitope is presented at high density and which are highly immunogenic when inoculated into experimental animals (Clarke et al, Nature 330, 381-384, 1987). Similar results have been reported by other groups using our system (e.g. Chang et al, 2nd International Symposium on positive strand RNA viruses, Vienna, Austria, 1989, abstract 010).


[0005] Subsequent experiments by other groups have shown that it is also possible to replace approximately 40 amino acids from the carboxy terminus of the protein with heterologous sequences and still maintain particle morphogenesis (Stahl & Murray, Proc. Natl. Acad. Sci. USA, 86 6283-6287, 1989). Moreover these particles are also immunogenic although, apparently, less so than the amino terminal fusions.


[0006] Despite the fact that these fusion particles induce excellent immune responses against the added epitope there still remains room for improvement from several points of view. Firstly, the immune responses against the added epitope, although excellent, do not compare with the parallel responses generated against the HBcAg sequences. Secondly, in both the amino and carboxy terminal fusions the added epitope possesses inherent flexibility because it is only covalently bound at one end. This may be disadvantageous for conformationally rigid epitopes. Thirdly, a model of the structure of hepatitis B core antigen has predicted that, naturally, both the amino and carboxy termini of the protein are located internally within the particles (Argos & Fuller, EMBO J. 1, 819-824, 1988).


[0007] It is only the inherently hydrophilic nature of most of the heterologous epitopes which directs them to the surface. We have now located a region of high immunogenicity in a surface region of HBcAg particles. A vector encoding HBcAg and having a restriction site in this region of high immunogenicity has been constructed. Foreign sequences have been inserted at the restriction site, enabling chimaeric HBcAg proteins to be expressed. The chimaeric proteins self-assemble into particles having a foreign epitope exposed on their surface.


[0008] Accordingly, the present invention provides particles composed of a chimaeric hepadnavirus core protein wherein a foreign amino acid sequence comprising an epitope is inserted in or replaces all or part of the sequence of amino acid residues from 68 to 90 in the case where the core antigen is HBcAg or the corresponding amino acid sequence in the case of another hepadnavirus core antigen. HBcAg residues are numbered according to Ono et al, Nucl. Acid. Res. 11, 1747-1757, 1983. Corresponding residues of the core protein of another hepadnavirus may be determined by lining up the sequences of HBcAg and the other core protein.


[0009] The chimaeric protein particles can be used to raise antibody specific for the epitope carried by the chimaeric protein. Antibody can therefore be raised in a mammal by administering to the mammal an effective amount of the particles composed of the chimaeric protein wherein the foreign sequence comprises an epitope capable of inducing antibody of the desired specificity. The chimaeric protein particles may be presented for this purpose as a component of a pharmaceutical or veterinary composition also comprising a pharmaceutically or veterinarily acceptable carrier.


[0010] The invention also provides a DNA sequence encoding a hepadnavirus core protein and having (a) a restriction site within the sequence encoding HBcAg amino acid residues 68 to 90 or the corresponding sequence of the core protein of another hepadnavirus or (b) two restriction sites flanking the sequence encoding HBcAg amino acid residues 68 to 90, a part of the sequence encoding HBcAg amino acid residues 68 to 90 or the corresponding sequence of the core protein of another hepadnavirus. Where HBcAg codons 68 to 90 or their counterpart codons for the core protein of another hapadnavirus have been deleted completely or in part, the restriction site is located appropriately in the sequence remaining. Where two restriction sites are provided, typically they are cut by the same restriction enzyme.


[0011] A vector can be constructed which incorporates such a DNA sequence. The vector can be provided in a host. The vector provides a starting point for the preparation of a vector capable of expressing the chimaeric protein of the invention. For this purpose, a DNA sequence needs to be constructed which encodes the chimaeric protein. More particularly, a vector is required which incorporates such a DNA sequence and which is capable, when provided in a suitable host, of expressing the chimaeric protein.


[0012] A vector capable of expressing the chimaeric protein is prepared by inserting a DNA sequence encoding the foreign sequence into a vector which encodes a hepadnavirus core protein and which has a restriction site or sites (a) or (b) as above. Preferably a restriction site (a) occurs at HBcAg codons 80 and 81 or at the corresponding codons for the core protein of another hepadnavirus. Alternatively, two restriction sites (b) may be provided at HBcAg codons 68 and 69 at one flank and at 80 and 81 at the other flank or, again, at the corresponding codons for the core protein of another hepadnavirus. The resulting vector encoding the chimaeric protein is typically provided in a compatible host.


[0013] To obtain the chimaeric protein, a host is cultured under such conditions that the chimaeric protein is expressed. The host is provided with an expression vector encoding the chimaeric protein. The chimaeric protein self-assembles into particles when expressed, and can then be isolated. These particles closely resemble the 27 nm core particles composed of HBcAg and viral DNA which can be obtained by denaturing hepatitis B virus. The foreign epitope is exposed on the outer particle surface.


[0014] The chimaeric protein comprises a foreign amino acid sequence comprising an epitope. By “foreign” is meant that the sequence is not part of the sequence of the hepadnavirus core protein. The foreign sequence inserted into or replacing all or part of HBcAg amino acid residues 68 to 90 is not therefore part or all of the insert of 39 amino acids near the predicted position of the HBel epitope of avian hepatitis viruses, in particular of viruses from ducks (Feitelson and Miller, Proc. Natl. Acad. Sci. USA, 85, 6162-6166, 1988). The hepadnavirus core protein portion of the chimaeric protein is typically a mammalian hepadnavirus core antigen, in particular the human HBcAg or woodchuck WHcAg. Hepatitis B virus adw serotype HBcAg may be used.


[0015] Any foreign epitope, i.e. an epitope which is not an epitope of a hepadnavirus core protein, can be presented as part of the chimaeric protein. The epitope is a sequence of amino acid residues capable of raising antibody. The epitope may be an epitope capable of raising neutralising antibody, for example an epitope of an infectious agent or pathogen such as a virus or bacterium. It may be an epitope of a non-infectious agent such as a growth hormone. The foreign sequence may comprise repeats of an epitope, for example up to eight or up to four copies of an epitope. Two copies of an epitope may therefore be present in the foreign sequence. A foreign sequence may comprise two or more different epitopes, for example three or four.


[0016] As examples of viruses whose epitopes may be presented there may be mentioned hepatitis A virus, hepatitis B virus, influenza virus, foot-and-mouth disease virus, poliovirus (PV), herpes simplex virus, rabies virus, feline leukaemia virus, human immunodeficiency virus type 1 (HIV-1), HIV-2, simian immunodeficiency virus (SIV), human rhinovirus (HRV), dengue virus and yellow fever virus. The epitope presented by the chimaeric protein may be therefore an epitope of HBsAg, of the pre-S region of HBsAg or of HRV2.


[0017] The foreign sequence in the chimaeric protein may be up to 100, for example up to 50, amino acid residues long. The foreign sequence may therefore be up to 40, up to 30, up to 20 or up to 10 amino acid residues in length. The foreign sequence comprises the epitope against which it is desired to induce antibody. The foreign sequence may also comprise further amino acid residues at either or both ends of the epitope.


[0018] Where further amino acid residues are present, these may be determined by the manipulations necessary to insert DNA encoding a desired foreign epitope into a vector encoding a hepadnavirus core antigen. They may be the amino acids which naturally flank the epitope. Up to 10, for example up to 4, further amino acids may be provided at either or each end of the foreign epitope.


[0019] The foreign sequence may be inserted in the sequence of HBcAg residues from 68 to 90, for example 69 to 90, 71 to 90 or 75 to 85 or corresponding residues of another hepadnavirus core protein. Most preferred is to insert the foreign sequence between HBcAg amino acid residues 80 and 81 or corresponding residues of another hepadnavirus core protein. Alternatively, all or part of the sequence of core protein residues may be replaced by the foreign sequence. HBcAg amino acid residues 75 to 85, 80 and 81 or preferably 70 to 79 or corresponding residues of another hepadnavirus core protein may therefore be replaced by the foreign sequence. Where a foreign sequence replaces all or part of the native core protein sequence, the inserted foreign sequence is generally not shorter than the HBcAg sequence it replaces.


[0020] A second foreign amino acid sequence may be fused to the N-terminus or C-terminus of the amino acid sequence of the core protein. This second foreign sequence may also comprise an epitope. This epitope may be identical to or different from the epitope inserted into or replacing all or part of HBcAg amino acid residues 68 to 90 or the corresponding residues of the core protein of another hepadnavirus (the first epitope). Any foreign epitope may be present as the second epitope, as described above in connection with the first epitope. The length and construction of the foreign sequence containing the second epitope may also be as described above in connection with the first epitope.


[0021] In order to prepare the chimaeric protein, an expression vector is first constructed. Thus a DNA sequence encoding the desired chimaeric protein is provided. An expression vector is prepared which incorporates the DNA sequence and which is capable of expressing the chimaeric protein when provided in a suitable host. Appropriate transcriptional and translational control elements are provided, including a promoter for the DNA sequence, a transcriptional terminal site, and translational start and stop codons. The DNA sequence is provided in the correct frame such as to enable expression of the polypeptide to occur in a host compatible with the vector.


[0022] An appropriate vector capable of expressing the chimaeric protein may be constructed from an HBcAg expression vector having a restriction site (a) or two restriction sites (b) as above. The restriction site (a) may be provided within the DNA sequence encoding HBcAg amino acid residues 71 to 90 or the counterpart residues of the core protein of another hepadnavirus, for example.


[0023] A DNA sequence encoding the foreign amino acid sequence is inserted into the HBcAg expression vector at the restriction site (a) or in place of the DNA sequence flanked by restriction sites (b). The HBcAg expression vector is digested with the appropriate restriction endonuclease(s) and dephosphorylated. The DNA sequence encoding the foreign sequence is ligated into the cut expression vector. The inserted DNA sequence is typically prepared by standard techniques of oligonucleotide synthesis.


[0024] A or each restriction site in the HBcAg expression vector is preferably provided in the HBcAg coding sequence such that the HBcAg amino acid sequence is not altered. A restriction site (a) may occur at HBcAg codons 80 and 81 or the counterpart codons for another hepadnavirus core protein. Preferably, a NheI site is provided in the HBcAg coding sequence at codons 80 and 81. E. coli XL-1 Blue harbouring plasmid pPV-Nhe, which is an HBcAg expression vector provided with such a NheI site, was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on Sep. 12, 1989 under accession number NCIMB 40210.


[0025] An alternative or additional preferred restriction site spans HBcAg codons 68 and 69 or the counterpart codons for another hepadnavirus core protein. Suitably, a NheI site (underlined) is provided as follows:
167     68     69ACG    CTA    GCT T      L      A 


[0026]

E. coli
XL-1 Blue harbouring plasmid pPN2, which is an HBcAg expression vector provided with a NheI site at codons 80 and 81 and with a NheI site at codons 68 and 69 as above, was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on Aug. 20, 1990 under accession number NCIMB 40312.


[0027] Introduction of a novel restriction site can be achieved in either of two ways. First it may be achieved by replacement of a small restriction fragment coding for this region by a series of synthetic oligonucleotides coding for this region and incorporating the novel restriction site (see Example 1).


[0028] Secondly it may be achieved by site directed mutagenesis of the same coding region (see Example 5). This may typically be carried out by initially sub-cloning a restriction fragment representing this region into a vector such as M13mp18 which can produce single stranded DNA. Site directed mutagenesis may then be achieved using specific mismatched synthetic oligonucleotides by standard methods. Such a mutated restriction fragment can then be replaced into the parent gene in a suitable expression vector.


[0029] In the case of an HBcAg expression vector having all or part of the HBcAg coding sequence from amino acids 68 to 90, for example 71 to 90, replaced by a restriction site, a DNA sequence encoding the foreign amino acid sequence may be inserted as described above. This DNA sequence may encode, besides a Lys residue, one or more natural HBcAg residues so that part of the natural HBcAg amino acid sequence is provided between residues 68 and 90. HBcAg residues 68, 69 and 70 may be provided in this way, for example.


[0030] The expression vectors encoding a chimaeric protein are provided in an appropriate host. The chimaeric protein is then expressed. Cells harbouring the vector are grown/cultured so as to enable expression to occur. The chimaeric protein that is expressed self-assembles into particles. The chimaeric particles may then be isolated.


[0031] Any appropriate host-vector system may be employed. The vector may be plasmid. In that event, a bacterial or yeast host may be used for example E. coli or S. cerevisiae. Alternatively, the vector may be a viral vector. This may be used to transfect cells of a mammalian cell line, such as Chinese hamster ovary (CHO) cells, in order to cause polypeptide expression.


[0032] The chimaeric protein may be used as a vaccine for a human or animal. It may be administered in any appropriate fashion. The choice of whether an oral route or a parenteral route such as sub-cutaneous, intravenous or intramuscular administration is adopted and of the dose depends upon the purpose of the vaccination and whether it is a human or mammal being vaccinated. Similar criteria govern the physiologically acceptable carrier or diluent employed in the vaccine preparation. Conventional formulations, carriers or diluents may be used. Typically, however, the fusion protein is administered in an amount of 1-1000 μg per dose, more preferably from 10-100 μg per dose, by either the oral or the parenteral route.






[0033] The following Examples illustrate the invention. In the accompanying drawings:


[0034]
FIG. 1 shows plasmid pBc404 is shown. B, E and P denote restriction sites for BamHI, EcoRI and PstI respectively; tac denotes the tac promoter; ori denotes the origin of replication; bla denotes β-lactamase and SD denotes the Shine-Dalgarno sequence.


[0035]
FIG. 2 shows the construction of plasmid pPV-Nhe.


REFERENCE EXAMPLE


Preparation of HBcAg Provided at its N-Terminus with a Short Extension Comprising PV1 Mahoney VP1 Residues 95 to 104

[0036] An expression plasmid pPV404 was prepared from the parent plasmid pBc404 shown in FIG. 1. E. coli JM101 harbouring pBc404 was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on Feb. 9, 1989 under accession number NCIMB 40111. Synthetic oligonucleotides representing amino acids 95 to 104 of VP1 from PV1 Mahoney were ligated into pBc404 using T4 ligase by standard procedures. This resulted in pPV404. The synthetic oligonucleotides, how they anneal together and the coding sequence of the N-terminal extension are as follows:
21. AATTCAGATAATCCAGCTAGTACTACCAACAAAGATAAG (39)2. GATCCTTATCTTTGTTGGTAGTACTAGCTGGATTATCTG (39) AATTCAG ATAATCCAGC TAGTACTACC AACAAAGATA AG     GTC TATTAGGTCG ATCATGATGG TTGTTTCTAT TCCTAGG 10       20         30        40 ATGAATTCAGATAATCCAGCTAGTACTACCAACAAAGATAAGGATCC.....CORE5  M  N  S  D  N  P  A  S  T  T  N  K  D  K  D  |        ||                             | LINKER              POLIOVIRUS



Example 1


Preparation of Plasmid pPV-Nhe

[0037] A series of peptides 20 amino acids in length were chemically synthesised. These peptides overlapped each other by 10 amino acids and together represented the whole amino acid sequence of the core protein from hepatitis B virus and serotype. Each of these peptides was used to coat microtitre plates in carbonate coating buffer and was used in an enzyme-linked immunosorbent assay (ELISA) analysis with sera from guinea pigs. The guinea pigs had been inoculated with bacterially-expressed hepatitis B core particles.


[0038] One of the peptides, corresponding to amino acids 71 to 90, gave an extremely powerful reaction. This indicated that core particles had elicited antibodies in vivo which reacted with the linear peptide sequence. The sequence corresponded roughly to the reported HBel epitope of hepatitis B core particles (Williams and LeBouvier, Bibilotheca Haematologica 42, 71-75, 1976). Our results suggested that the insertion into or replacement of this immunodominant region of HBcAg by a foreign epitope may result in a chimaeric protein displaying enhanced immunogenicity with regard to the foreign epitope. We therefore undertook to insert foreign sequences into the adw core sequence.


[0039] The strategy which we followed is shown in FIG. 2. The initial plasmid was plasmid pPV404. This plasmid expresses large amounts of chimaeric particles in bacteria which are highly immunogenic in animals. The strategy involved the introduction of a unique NheI restriction site at amino acid positions 80-81 in the core gene. This does not result in an amino acid change in the core protein. The nature of the mutation is shown below:
3Amino acid L   E   D   P   A   S   R   D   L adwTTG GAA GAT CCA GCA TCC AGG GAT CTAadw-NheITTG GAA GAT CCA GCT AGC AGG GAT CTA                Nhe1


[0040] Initially plasmid pPV404 was digested with restriction enzymes XbaI and AccIII resulting in two fragments of 3.96 kbp and 340 bp. These fragments were separated by electrophoresis on low melting point agarose, excised and the smaller fragment was then further digested with XhoII resulting in 3 fragments as shown in FIG. 2.


[0041] Concomitantly two oligonucleotides were synthesised with sequences as shown in FIG. 2. These oligonucleotides were annealed and phosphorylated by standard procedures such that they represented a linker sequence with XhoII compatible “sticky ends” and an internal NheI site. These oligonucleotides were then ligated into the 340 bp fragment by standard procedures to replace the 19 bp natural XhoII fragment. This ligated material was then ligated back into the large 3.96 kbp fragment and transformed into E. coli strain XL-1 Blue by standard methods.


[0042] The design of this strategy did not exclude the possibility of the natural 19 bp XhoII fragment reinserting itself into the vector. To select for bacteria harbouring plasmids containing the new NheI site, a culture was prepared from all the recombinant clones generated during the transformation. This culture was then used to extract plasmid DNA representing the whole “library” of colonies. After caesium chloride purification this DNA was digested with NheI.


[0043] Only those recombinant plasmids carrying the new linker would have been digested in this way resulting in linearisation of this population. Linear DNA was therefore purified from the rest of the undigested plasmid molecules by agarose gel electrophoresis and, after religation, was transformed back into E. coli to generate a pool of NheI positive transformants. Individual clones were analysed by restriction mapping. Those clones which were confirmed to have an inserted NheI site were further characterised by DNA sequencing. The restriction map of one of the resulting clones pPV-Nhe, which possessed the correct sequence, is shown in FIG. 2.


[0044] As previously stated, the design of the experiment ensured the maintenance of the correct HBcAg amino acid sequence. It was not surprising therefore that expression analysis after induction with isopropyl-beta-D-thiogalactopyranoside (IPTG) confirmed the presence of a high yield of PV-HBcAg particles.



EXAMPLE 2


Preparation of Particles Composed of Chimaeric HBcAg Proteins

[0045] The ability of pPV-Nhe to express heterologous sequences was initially assessed by insertion of epitopes from human rhinovirus type 2 (HRV2) and hepatitis B surface antigen (HBsAg). This was achieved by insertion of synthetic oligonucleotides coding for each sequence flanked by NheI cohesive ends into NheI digested and dephosphorylated pPV-Nhe. The sequences inserted at the NheI site of pPV-Nhe are shown below:
4HRV2 VP2                     Epitope     {overscore (|                                              |)}A S V K A E T R L N P D L Q P T E C A SCTAGCGTTAAAGCGGAAACGCGTTTGAACCAGATCTGCAACCGACCGAATGCG    GCAATTTCGCCTTTGCGCAAACTTGGCTCTAGACGTTGGCTGGCTTACGCGATCHBsAg 139-147                     Epitope           {overscore (|                        |)}A S G A C T K P T D G N C A G A SCTAGCGGTGCATGCACAAAACCTACTGATGGTAACTGCCCAGGTG    GCCACGTACGTGTTTTGGATGACTACCATTGACGCGTCCACGATC


[0046] Plasmids ligated with the synthetic oligonucleotides were transformed into E. coli strain XL-1 Blue. Each new construct was designed so that a diagnostic internal restriction site was present allowing rapid screening of the resulting clones. The internal restriction sites were MluI for HRV2 and SphI for HBsAg. Resulting clones possessing correct restriction sites were cultured to high density in nutrient broth and expression of chimaeric proteins was induced by addition of IPTG to the medium. Following incubation for 6 to 8 hours at 37° C. bacterial cells were harvested by centrifugation, lysed by standard procedures and expressed proteins analysed by PAGE, Western blotting and ELISA. The presence of particulate structures was determined by sucrose density gradient centrifugation.


[0047] Expression of chimaeric proteins comprising either the HRV2 epitope or the HBsAg was observed. The chimaeric proteins self-assembled into particles. Detailed expression analysis on the HRV2 epitope construct showed that expression levels were very high in bacteria, that particle formation was maintained and that the chimaeric protein reacted with anti-HRV2 sera by Western blotting. ELISA analysis also showed that the HRV2 epitope was exposed on the particle surface.



EXAMPLE 3


Preparation of further Particulate Chimaeric HBcAG Proteins

[0048] Further epitopes have been inserted into pPV-Nhe. Synthetic oligonucleotides were ligated together to prepare a DNA fragment encoding the epitope and having cohesive Nhe I ends. The DNA fragment was inserted into Nhe I—digested and dephosphorylated pPV-Nhe. Plasmids ligated with the DNA fragment were transformed into


[0049]

E. coli
strain XL-1 Blue.


[0050] Clones were cultured to high density in nutrient broth and expression of chimaeric protein was induced by addition of IPTG to the medium. Following incubation for 6 to 8 hours at 37° C. bacterial cells were harvested by centrifugation, lysed by standard procedures and expressed proteins analysed by PAGE, Western blotting and/or ELISA. The presence of particulate structures was determined by sucrose density gradient centrifugation.


[0051] Chimaeric proteins presenting the following epitopes were obtained in this way. In each case the epitope was flanked by A-S residues due to the cloning procedure.


[0052] 1. QE1-amino acid residues 15 to 47 from the Pre-S1 region of hepatitis B virus (HBV). This region is implicated in virus-cell interactions. The sequence was derived from the adw serotype.
5(a) Synthetic oligonucleotides{overscore (|                        |                           )}|      10         20     |   30         40         50CTAGTAACT TAAGTGTGCC AAATCCATTA GGATTTCTGC CAGATCATCA   |ATTGA ATTCACACGG TTTAGGTAAT CCTAAAGACG GTCTAGTAGT{overscore (    |   60         70         80         90        100)}GTTAGATCCA GCATTTGGAG CTAATTCGAC CAATCCAGAT TGGGACTTCACAATCTAGGT CGTAAACCTC GATTAACCTG GTTAGGTCTA ACCCTGAAGT                                                                         |      110ATCCATCTGTAGCTACACG ATC|(b) Coding sequence        10        20        30        40     50GCTAGTAACTTAAGTGTGCCAAATCCATTAGGATTTCTGCCAGATCATCAGTTAGAT A  S| N  L  S  V  P  N  P  L  G  F  L  P  D  H  Q  L  DCCAGCATTTGGAGCTAATTCGACCAATCCAGATTGGGACTTCAATCCATGTGCTAG P  A  F  G  A  N  S  T  N  P  D  W  D  F  N  P  C |A  S


[0053] 2. QM2-133-144 from Pre-S2 region of HBV. This region is a sequential epitope in HBV and can protect chimpanzees from infection. The sequence was derived from the adw serotype.
6(a) Synthetic oligoriucleotides                                                    10         20         30         40    |CTAGTGATC CGCGCGTGCG CGGCTTATAC TTACCGGCGG GAG  |ACTAG GCGCGCACGC GCCGAATATG AATGGCCGCC CTCGATC|(b) Coding sequence        10          20      30     40GCTAGTGATCCGCGCGTGCGCGGCTTATACTTACCGGCGGGAGCTAGC A  S| D  P  R  V  R  G  L  Y  L  P  A  G  A  S 


[0054] 3. QE2-120-153 from Pre-S2 region of HBV. This is a larger version of 2. The sequence was derived from the adw serotype.
7(a) Synthetic oligonucleotides                           |                               |                       |                             ||      10         20    |     30         40         50CTAGCATGC AATGGAATAG CACCGCCTTA CACCAAGCTT TGCAGGACCC   |GTACG TTACCTTACT GTGGCGCAAT GTGGTTCGAA ACGTCCTGGG                                                      |       60         70         80   |     90        100TCGAGTACGT GGCTTATACT TACCGGCGCG AGGATCAAGC AGCGGCACCGAGCTCATGCA CCGAATATGA ATGGCCGCCC TCCTAGTTCG TCGCCGTGGC        |       110TTAATCCGGAATTACGCCG ATC|(b) Coding sequence        10           20      30       40        50GCTAGCATGCAATGGAATAGCACCGCGTTACACCAAGCTTTGCAGGACCCTCGAGT A  S| M  Q  W  N  S  T  A  L  H  Q  A  L  Q  D  P  R  V  60        70        80           90    100ACGTGGCTTATACTTACCGGCGGGAGGATCAAGCAGCGGCACCGTTAATCC  R  G  L  Y  L  P  A  G  G  S  S  S  G  T  V  N  P110GGCTACG|A  S 


[0055] 4. pPD1-110-148, a couplex epitope from HBsAg.
8(a) Synthetic oligonucleotides                                                    |      10         20         30     |   40         50CTAGTATTC CTGGGTCAAC GACCACGAGC ACCGGACCAT GCAAGACGTG   ATAAG GACCCAGTTG CTGGTGCTCG TGGCCTGGTA CGTTCTGCAC                                                              60   |     70         80         90     |  100TACTACACCA GCACAAGGTA ACTCCAAGTT CCCGAGCTGC TGCTGCACAAATGATGTGGT CGTGTTCCAT TGAGGTTCAA GGGCTCGACG ACGACGTGTT|                            |                                              |       100        120AACCTACTGA TGGTAACTGC ACTGTTGGATGACT ACCATTGACG TGACGATC|(b) Coding sequence        10        20        30        40        50     GCTAGTATTCCTGGGTCAACGACCACGAGCACCGGACCATGCAAGACGTGTACTA A  S| I  P  G  S  T  T  T  S  T  G  P  C  K  T  C  T   60        70        80           90    100       100CACCAGCACAAGGTAACTCCAAGTTCCCGAGCTGCTGCTGCACAAAACCTACTGAT  P  A  Q  G  N  S  K  F  P  S  C  C  C  T  K  P  T  D       120TGGTAACTGCACTGCTAGC  G  N  C  T |A  S 


[0056] 5. pPA1-VP1 101-110 HAV (Hepatitis A virus)
9(a) Synthetic oligonucleotides               471CTAGCAATTCGAATAACAAGGAGTATACATTTCCGG    GTTAAGCTTATTGTTCCTCATATGTAAAGGCCGATC               472(b) Coding sequence        10        20        30        40GCTAGCAATTCGAATAACAAGGAGTATACATTTCCGGCTAGC A  S| N  S  N  N  K  E  Y  T  F  P  A | S


[0057] 6. pPA2-VP1 13-24 HAV
10(a) Synthetic oligonucleotides                473CTAGCACTGAACAGAATGTTCCGGATCCTCAGGTTGGAG    GTGACTTGTCTTACAAGGCCTAGGAGTCCAACCTCGATC                474(b) Coding sequence        10        20        30        40GCTAGCACTGAACAGAATGTTCCGGATCCTCAGGTTGGAGCTAGC A  S| T  E  Q  N  V  P  D  P  Q  V  G  A |S


[0058] 7. pPA3-VP3 61-83 HAV
11 (a)      Synthetic oligonucleotides                                                  |475               |466                    |476 CTAGCGCAGCACAATTTCCCTTCAATGCAAGCGATTCAGTC     GCGTCGTGTTAAAGGGAAGTTACGTTCG    |478                     |469GGACAACAGATAAAGCTAAGTCAGCCTGTTGTCTATTTC                     |477                     GTTATACCTGTGGATCCTG|CAATATGGACACCTAGGACGATC| (b)      Coding sequence        10        20        30       40       50A  A  Q  F  P  F  N  A  S  D  S  V G  Q  Q  I K   60        70        80 GGTTATACCTGTGGATCCTGCTAGC   V  I  P  V  D  P 


[0059] 8. pPA4-VP1 160-182 HAV
12 (a)      Synthetic oligonucleotides                                                    |491               |492                    493 CTAGCACACCTGTTGGACTAGCAGTAGATACTCCCTGGGTTGAGAA     GTGTGGACAACCTGATCGTCATCTATGAGGGACCCAACTCTT    |496                     |495AGAGTCAGCATCTCAGTCGT                    |494                 CTATCGATTGACTATG|GATAGCTAACTGATACGATC| (b)      Coding sequence       10          20        30         40 GCTAGCACACCTGTTGGACTAGCAGTAGATACTCCCTGGG T  P  V  G  L  A  V  D  T  P  W  V50   TTGAGAAAGAGTCAE  K  E  S     60        70 GCACTATCGATTGACTATGCTAGC  A  L  S  I  D  Y 


[0060] 9. pPA5-VP2 40-60 HAV
13 (a)      Synthetic oligonucleotides                                                   |497                             |498 CTAGCGTTGAACCTCTACGAACCTCGGTTGACAAAC     GCAACTTGGAGATGCTTGGAGCCAACTGTTTG    |501                |500         CCGGGTCAAAGAGAACTCGGCCCAGTTTCTCTTGAG            |499              AAGGTGAGAAAG|TTCCACTCTTTCGATC|(b)      Coding sequence        10        20        30        40GCTAGCGTTGAACCTCTACGAACCTCGGTTGACAAACCCG V  E  P  L  R  T  S  V  D  K  P  G50   GGTCAAAGAGAAC  S  K  R  T     60        70TCAAGGTGAGAAAGCTAGC  Q  G  E  K 


[0061] 10. Amino acids 735-752 from gp41 of HIV-1. This is a potential neutralising epitope for HIV.
14(a)      Synthetic oligonucleotides       10         20         30         40         50         60CTAGCGACC GCCCTGAGGG CATCGAGGAA GAGGGCGGTG AGCGCGATCG TGATCGTTCAG    GCTGG CGGGACTCCC GTAGCTCCTT CTCCCGCCAC TCGCGCTAGC ACTAGCAAGTCGATC(b)      Coding sequence        10        20        30        40         50GCTAGCGACCGCCCTGAGGGCATCGAGGAAGAGGGCGGTGAGCGCGATCGTGAT D  R  P  E  G  I  E  E  E  G  G  E  R  D  R  D    60CGTTCAGCTAGC R  S 


[0062] 11. Epitope from feline leukaemia virus gp70 (197-219) implicated in induction of neutralizing antibodies.
15a)  Synthetic oligonucleotides      10         20         30         40         50         60         70         80CTAGTACTA TCACTCCACC ACAGGCCATG GGTCCAAACT TAGTCTTACC AGATCAAAAG CCACCAAGTC GTCAAG    ATGAT AGTGAGGTGG TGTCCGGTAC CCAGGTTTGA ATCAGAATGG TGTAGTTTTC GGTGGTTCAG CAGTTCGATCb)  Coding sequence        10        20        30        40GCTAGTACTATCACTCCACCACAGGCCATGGGTCCAAACTTA T  I  T  P  P  Q  A  M  G  P  N  L      50        60        70        80GTCTTACCAGATCAAAAGCCACCAAGTCGTCAAGCTAGC V  L  P  D  Q  K  P  P  S  R  Q 



EXAMPLE 4


Preparation of Chimaeric Protein having a HRV2 Epitone at both the Amino Terminus and Inserted between HBcAg Residues 80 and 81

[0063] Oligonucleotides coding for the HRV2 VP2 epitope shown in Example 2 were inserted into the pPV-Nhe vector as specified in that Example. The recombinant vector was digested with EcoRI and BamHI. A band of approximately 4.4 kb was purified by low melting point agarose gel electrophoresis. Synthetic oligonucleotides representing amino acids 156 to 170 of VP2 from HRV2 were ligated into the recombinant vector using T4 ligase by standard procedures. The synthetic oligonucleotides, how they anneal together and the coding sequence of the N-terminal extension were as follows:
161.  AATTCAGTTAAAGCGGAAACGCGTTTG2.  AACCCAGATCTGCAACCGACCGAATGCCGG3.  GATCCCGGCATTCGGTCGGTTGCA4.  GATCTGGGTTCAAACGCGTTTCCGCTTTAACTGAATTCAGTTAAAGCGGAAACGCGTTTGAACCCAGATCTGCAACCGACCGAATGCCGG    GTCAATTTCGCCTTTGCGCAAACTTGGGTCTAGACGTTGGCTGGCTTACGGCCTAG                                     30ATG AAT TCA GTT AAA GCG GAA ACG CGT TTG AAC CCA GAT CTG CAA M   N   S   V   K   A   E   T   R   L   N   P   D   L   Q  LINKER                             HRV2                 60CCG ACC GAA TGC CGG GAT CC P   T   E   C   R   D


[0064] The resulting plasmid was transformed into E. coli strain XL-1 Blue. Clones were cultured to high density in nutrient broth. Expression of chimaeric protein was achieved as described in Example 2. Expressed proteins were analysed by PAGE, Western blotting and ELISA. The presence of particulate structures was determined by sucrose density gradient centrifugation.



EXAMPLE 5


Preparation of Plasmid pPN2 which enables Replacement of Part of HBcAg Amino Acid Sequence

[0065] The entire HBcAg gene was subcloned into a-vector capable of producing single stranded DNA. This was carried out specifically using a technique known as sticky foot mutagenesis. Initially the core gene from pPV-NheI (Example 1) was amplified by polymerase chain reaction using two oligonucleotides as shown below:
171)TACGCAAACCGGCTCTCCCCGAATTCGTTGACAATTAATCATCGGCT                                       lacZ               tac2)TTGGGAAGGGCGATCGGTGCGGATCCTAACATTCGAGATTCGCGAGA                                  lacZ         |     HBcAg


[0066] The resulting fragment (600 base pairs) therefore has lacZ complementary sequences at each end. In parallel, single stranded uracil rich DNA was prepared from a commercial vector pBS-SK(+) (Stratagene) which contains a complete lacz gene. This single stranded DNA was mixed with the PCR fragment whereon the newly introduced lacZ flanking regions annealed with the single stranded vector. This annealed duplex was then double stranded using DNA polymerase and trasfected into E. coli strain XL1-Blue. Colonies were assayed for presence of correct recombinant plasmid by restriction mapping.


[0067] This plasmid (Q9) therefore carries an entire copy of the PV-NheI HBcAg gene under transcriptional control of the lac promoter. It also, being pBS derived, is capable of producing a single stranded DNA. Such single stranded DNA (uracil rich) was therefore prepared and used to produce an additional NheI restriction site at amino acids 68 and 69 of the HBcAg protein. This was carried out by annealing a synthetic oligonucleotide with single stranded DNA from Q9, polymerising and removing parental template as before. The oligonucleotide used for the mutagenesis was:
18GGAATTGATGACGCTAGCTACCTGGGTGGG             NheI


[0068] Recombinant DNA was transfected into E. coli XL-1 Blue and colonies analysed by direct sequencing of the resultant DNA by primer extension. The sequence of the mutated region in pPN2 is as shown with both NheI sites underlined. The region between the two restriction sites can be substituted with synthetic oligonucleotides coding for the required epitope.
19ACG CTA GCT ACC TGG GTG GGT AAT AAT TTG GAA GAT CCA GCT AGC T   L   A   T   W   V   G   N   N   L   E   D   P   A   S



EXAMPLE 6


Animal Tests Immunisation Protocol

[0069] Femal Dunkin Hartley guinea-pigs weighing about 400g were each inoculated intramuscularly with a 0.5 ml dose of a chimaeric HBcAg protein preparation formulated in incomplete Freund's adjuvant (IFA). Groups of four animals were inoculated with a specified dose of purified core particles and boosted once at either 56 or 70 days with the same initial dose. Blood samples were taken at 14 day intervals throughout the experiment.


[0070] ELISA


[0071] Antipeptide, antivirus and anti-particle activity in serum samples was measured by a modification of an indirect or double antibody sandwich ELISA method. In the sandwich ELISA polyclonal antipeptide serum (1:200) was used to capture serial dilutions of particles in PBS and 2% dried milk powder. In the indirect ELISA 2 μg/ml of peptide, particle or virus were coated directly onto microtitre plates. In each case the plates were washed and incubated with test serum samples. Following incubation at 37C for 1-2 hours plates were rewashed and anti-IgG-peroxidase conjugate was added. After a further hour at 37° C. the plates were washed and an enzyme substrate (0.04% o-phenylenediamine and 0.004% hydrogen peroxide in 0.1M phosphate 0.05M citrate buffer) was added. The resulting colour development was stopped with sulphuric acid and the A492 was measured in a Titertek Multiskan (Flow Labs).


[0072] The A492 values obtained from dilutions of post-inoculation samples were plotted against the log10 reciprocal antiserum dilution and the antibody titre was calculated by reference to a negative standard (a 1:10 dilution of pre-inoculation serum).


[0073] Results


[0074] 1. Guinea pigs were inoculated intramuscularly with 20 μg or 2 μg of particles obtained in Example 3.1 composed of the PreS1-HBcAg chimaeric protein. Bleeds were taken at regular intervals. In each case a peptide composed of the PreS1 insert in the chimaeric HBcAg protein (392), HBcAg with no insert (control) and PreS1-HBcAg particles were coated onto enzyme-linked immunosorbent assay (ELISA) dishes and then assayed against dilutions of the antisera collected. The results are shown in Table 1. Very high levels of antipeptide, antiHBcAg and antiPreS1-HBcAg particles antibody were achieved.


[0075] 2. The procedure was the same as in 1 except:


[0076] guinea pigs were inoculated with particles obtained in Example 3.2 composed of the small PreS2 epitope-HBcAg chimaeric protein;


[0077] a peptide composed of the PreS2 insert (393), HBcAg, PreS2-HBcAg particles and yeast-derived HBsAg particles with PreS2 epitopes incorporated were coated onto ELISA dishes.


[0078] The results are shown in Table 2. Very high levels of antibody were again induced in the guinea pigs.


[0079] 3. The immune responses induced in guinea pigs and rabbits by particles composed of a chimaeric HBcAg protein in which a HRV2 VP2 epitope is inserted in accordance with the invention (“insert”, Example 2) and by particles composed of a chimaeric HBcAg protein in which the same HRV2 VP2 epitope is fused to the amino terminus of HBcAg (“terminal”) were compared. The “terminal” chimaeric HBcAg protein was prepared in accordance with the procedure described in JP-A-196299/88. The results are shown in Tables 3 and 4 and are ELISA endpoint titres (log10). The ELISA plates were coated with either a peptide composed of the HRV2 VP2 epitope or HBV. The “insert” chimaeric HBcAg protein gave superior results: higher anti-HRV peptide titres and lower anti-HBV titres.


[0080] 4. The neutralising antibody responses were looked at of the guinea pigs and rabbits of 3. above. In particular, the responses of the animals to two inoculations of the “insert” particles were assayed. The results are shown in Table 5.


[0081] 5. Rabbits and guinea pigs were inoculated intramuscularly with particles composed of the chimaeric HBsAg 139-147 epitope-HBcAg protein of Example 2. Anti-peptide 139-147 (αpep 448) and anti-HBsAg (αHBsAg) responses were determined using three doses of particles. The results are shown in Table 6. The data shown are titres (log10) prior to a first booster inoculation at 42 days and at the final bleeds day 98. In terms of anti-HBsAg activity, good antibody levels were observed in final bleeds in rabbits and, particularly, in guinea pigs.
20TABLE 1PreSl-HBcAg392 (2 μg/ml)HBcAg (2 μg/ml)(2 μg/ml)Group 120 μg14 3.572.893.7828 4.483.734.2842 4.544.164.5971*4.633.873.7977 5.394.204.4484 4.694.244.4698*5.154.324.73Group 22 μg14 2.733.153.3028*4.203.693.5742 4.223.393.3971*4.163.773.9377 4.023.773.9484 4.153.953.9098*4.604.414.31ELISA end point titres log10 *mean of group of individuals


[0082]

21





TABLE 2










Response of guinea pigs to preS2 (QM2/PE3) cores (small epitope)










Test antigen












Days post primary
peptide

QM2
HBsAg +


inoculation
393
HBcAg
cores
preS2










(a) 20 μg dose











 0**
<1*  
<1
<1
<1


14 
2.5
2.2
3.3
2.1


28 
3.2
3.0
4.1
3.1


42 
3.6
3.3
4.2
3.4


70**
3.6
4.4
4.5
3.8


77 
3.9
4.4
4.5
3.9


84 
4.2
4.7
5.2
4.4


98 
4.1
4.6
4.9
4.1







(b) 2 μg dose











 0**
<1*  
<1
<1
<1


14 
2.0
2.0
3.0
1.9


28 
2.1
2.6
3.5
2.2


42 
2.3
3.3
3.3
2.3


70 
2.5
3.7
3.7
3.0


77 
3.2
4.2
4.1
3.5


84 
3.7
4.8
4.7
4.0


98 
3.4
4.6
4.9
4.2






*log10 end point titre




**inoculations








[0083]

22





TABLE 3










Comparative immunogenicity of “insert” and “terminal” HBcAg/HRV


peptide fusion protein particles in guinea pigs











28 days
56 days
28 days


Peptide dose
post primary
post primary
post boost













(μg)
insert
terminal
insert
terminal
insert
terminal










(a) Anti-HRV peptide













1.5
 3.6*
2.7
4.1
2.9
4.8
3.6


0.15
2.5
1.3
3.1
2.3
4.3
2.9


0.015
1.9
<1.0
2.1
<1.0
3.5
<1.0







(b) Anti-HRV













1.5
 3.9*
1.6
4.2
1.5
5.1
2.8


0.15
2.3
1.2
2.5
1.6
4.2
2.5


0.015
1.6
1.2
1.8
1.0
3.5
1.0






*ELISA endpoint titre (log10)








[0084]

23





TABLE 4










Comparative immunogenicity of “insert” and “terminal” HBcAg/HRV


peptide fusion protein particles in rabbits











28 days
56 days
28 days


Peptide dose
post primary
post primary
post boost













(μg)
insert
terminal
insert
terminal
insert
terminal










(a) Anti-HRV peptide













1.5
 3.0*
2.2
3.2
2.4
4.2
2.9


0.15
2.7
1.5
2.4
1.5
3.1
1.7


0.015
2.1
N.D.
1.8
N.D.
2.7
N.D.







(b) Anti-HRV













1.5
 2.1*
1.2
2.5
1.1
4.0
1.4


0.15
1.8
1.1
2.0
1.1
2.8
1.5


0.015
1.7
N.D.
1.6
N.D.
2.4
N.D.






N.D. = not determined




*ELISA endpoint titre (log10)








[0085]

24







TABLE 5











Neutralization titre

















(a) Guinea pigs



peptide dose


(μg)








1.5
90% Plaque reduction


0.15
90, 30, 50, 25


0.015
20, 5



<5, <5








(b) Rabbits



peptide dose


(μg)








1.5
90% Plaque reduction


0.15
300, 5


0.015
10, 15



<5, <5










[0086]

25








TABLE 6











Ist Inoc.
2nd Inoc.






















chimaeric
Rabbits
20
μg
αpep448
3.3
3.4


HBsAg 139 −



αHBsAg
1.6
2.7


147 HBcAg

2
μg
αpep448
2.6
3.0


protein



αHBsAg
1.3
2.4




0.2
μg
αpep448
2.7
3.2






αHBsAg
1.2
1.4



Guinea
20
μg
αpep448
3.9
5.1



Pigs


αHBsAg
3.6
5.0




2
μg
αpep448
3.0
4.3






αHBsAg
1.9
4.0




0.2
μg
αpep448
2.1
4.0






αHBsAg
<1
2.4










Claims
  • 1. Particles composed of a chimaeric hepadnavirus core antigen protein wherein a foreign amino acid sequence comprising an epitope is inserted in or replaces all or part of the sequence of amino acid residues from 68 to 90 in the case where the core antigen is hepatitis B core antigen or the corresponding amino acid sequence in the case of the core antigen of another hepadnavirus.
  • 2. Particles according to claim 1, wherein the foreign amino acid sequence is inserted in or replaces all or part of the sequence of HBcAg residues from 71 to 90 or of the corresponding sequence of the core antigen of another hepadnavirus.
  • 3. Particles according to claim 2, wherein the foreign amino acid sequence is inserted between HBcAg residues 80 and 81 or between the corresponding residues of the core protein of another hepadnavirus.
  • 4. Particles according to claim 2, wherein the foreign amino acid sequence replaces HBcAg residues 70 to 79 or the corresponding residues of the core antigen of another hepadnavirus.
  • 5. Particles according to any one of the preceding claims, wherein the epitope is an epitope of hepatitis A virus, hepatitis B virus, influenza virus, foot-and-mouth disease virus, poliovirus, herpes simplex virus, rabies virus, feline leukaemia virus, human immunodeficiency virus type 1 or 2, simian immunodeficiency virus, human rhinovirus, dengue virus or yellow fever virus.
  • 6. A vector which comprises a DNA sequence encoding a chimaeric protein as specified in any one of the preceding claims and which is capable, when provided in a suitable host, of expressing the chimaeric protein.
  • 7. A host transformed with a vector according to claim 6 so that the chimaeric protein is able to be expressed therein.
  • 8. A process for the preparation of particles as claimed in any one of claims 1 to 5, which process comprises culturing a host according to claim 7 under such conditions that the chimaeric protein is expressed therein and recovering particles composed of the chimaeric protein which thus form.
  • 9. A process for the preparation of a host as claimed in claim 7, which process comprises transforming a host with a compatible expression vector according to claim 6.
  • 10. An expression vector which comprises a DNA sequence encoding a hepadnavirus core antigen and having (a) a restriction site within the sequence encoding HBcAg amino acid residues 68 to 90 or the corresponding sequence of the core protein of another hepadnavirus or (b) two restriction sites flanking a said sequence or a part of a said sequence.
  • 11. A vector according to claim 10, wherein the restriction site (a) is provided within the sequence encoding HBcAg amino acid residues 71 to 90 or the corresponding sequence of the core protein of another hepadnavirus.
  • 12. A vector according to claim 11, wherein the restriction site (a) occurs at HBcAg codons 80 and 81 or at the corresponding core protein codons of another hepadnavirus.
  • 13. A vector according to claim 10, wherein two restriction sites (b) are provided at HBcAg codons 68 and 69 or at the corresponding core antigen codons of another hepadnavirus at one flank and at HBcAg codons 80 and 81 or at the corresponding core antigen codons of another hepadnavirus at the other flank.
  • 14. A vector according to claim 10, which is pPV-Nhe (NCIMB 40210) or pPN2 (NCIMB 40312).
  • 15. A process for the preparation of a vector as claimed in claim 6 which process comprises: (i) digesting with the appropriate restriction endonuclease(s) an expression vector as claimed in any one of claims 10 to 14 such as to cut the vector at restriction site (a) or restriction site (b); (ii) dephosphorylating the digested vector; and (iii) ligating a DNA sequence encoding a foreign amino acid sequence comprising an epitope into the vector.
  • 16. A pharmaceutical or veterinary formulation comprising a pharmaceutically or veterinarily acceptable carrier or diluent and, as active ingredient, particles as claimed in any one of claims 1 to 5.
Priority Claims (2)
Number Date Country Kind
8921172.6 Sep 1989 GB
9017728.8 Aug 1990 GB
Continuations (3)
Number Date Country
Parent 08253220 Jun 1994 US
Child 10252001 Sep 2002 US
Parent 07959496 Oct 1992 US
Child 08253220 Jun 1994 US
Parent 07580914 Sep 1990 US
Child 07959496 Oct 1992 US