Patent Grant
10272148
The content of the electronically submitted substitute sequence listing, file name 3043_0020001_SequenceListing.ascii, size 256,991 bytes; and date of creation Aug. 20, 2013, filed herewith, is incorporated herein by reference in its entirety.
The present invention relates to virus-like particles. More specifically, the present invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza virus-like particles.
Influenza is the leading cause of death in humans due to a respiratory virus, and during “flu season”, it is estimated that 10-20% of the population worldwide may be infected, leading to 250-500,000 deaths annually.
The current method of combating influenza in humans is by annual vaccination. The vaccine is usually a combination of several strains that are predicted to be the dominant strains for the coming flu-season, however the number of vaccine doses produced annually is not sufficient to vaccinate the world's population. For example, Canada and the United-States obtain enough vaccine doses to immunize about one third of their population, and in Europe, only about 17% can be vaccinated given current production—in the face of a worldwide flu pandemic, this production would be insufficient. Even if the necessary annual production could somehow be met in a given year, the dominant strains change from year to year, thus stockpiling at low-need times in the year is not practical. Economical, large scale production of an effective influenza vaccine is of significant interest to government and private industry alike.
Influenza haemagglutinin (HA) surface glycoprotein is both a receptor-binding and membrane fusion protein. It is a trimer of identical subunits, each containing two disulphide-linked polypeptides, HA1 and HA2, that are derived by proteolytic cleavage of a precursor, HA0, that has a signal peptide sequence at its N-terminus and a membrane anchor sequence at its C-terminus. Cleavage to form HA1 and HA2 generates the N-terminus of the smaller polypeptide, HA2, which has the membrane anchor sequence at its C-terminus. Cleavage is required for membrane fusion activity but not for immunogenicity. The HA2 N-terminal sequence is called the ‘fusion peptide’ because cleavage at similar hydrophobic sequences is also required for the activity of other virus fusion proteins, and because 20-residue synthetic peptide analogues of the sequence fuse membranes in vitro.
Generally, the surface of the globular ‘head’ comprises several flexible loops with well-characterized and variable antigenic regions designated as sites A, B, C, D and E (reviewed in Wiley et al., 1987. Annu. Rev Biochem 56:365-394). Insertion or replacement of short peptide sequences at some sites (e.g. B and E) for immunity studies have been described (Garcia-Sastré et al. 1995. Biologicals 23:171-178). Epidermal growth factor (EGF), single chain antibody (scFV) and the Fc domain of an IgG, ranging in size from 53 to 246 amino acids, have been inserted at the N-terminal end of a H7 and chimeras has been successfully expressed (Hatziioannou et al., 1999. Human Gene Therapy 10:1533-1544). More recently, 90 and 140 amino acid domains of Bacillus anthracis protective antigen have been fused to the amino terminus of a H3 (Li et al., 2005. J. Virol 79:10003-1002). Copeland (Copeland et al., 2005. J. Virol 79:6459-6471) describes the expression of the gp120 Env HIV surface glycoprotein on a H3 stalk, where the gp120 domain replaced the whole globular head of HA.
Several recombinant products have been developed as recombinant influenza vaccine candidates. These approaches have focused on the expression, production, and purification of influenza type A HA and NA proteins, including expression of these proteins using baculovirus infected insect cells (Crawford et al, 1999 Vaccine 17:2265-74; Johansson, 1999 Vaccine 17:2073-80), viral vectors, and DNA vaccine constructs (Olsen et al., 1997 Vaccine 15:1149-56).
Production of a non-infectious influenza virus strain for vaccine purposes is one way to avoid inadvertent infection. Alternatively, virus-like particles (VLPs) as substitutes for the cultured virus have been investigated. VLPs mimic the structure of the viral capsid, but lack a genome, and thus cannot replicate or provide a means for a secondary infection. Current influenza VLP production technologies rely on the co-expression of multiple viral proteins, and this dependence represents a drawback of these technologies since in case of a pandemic and of yearly epidemics, response time is crucial for vaccination. A simpler VLP production system, for example, one that relies on the expression of only one or a few viral proteins without requiring expression of non-structural viral proteins is desirable to accelerate the development of vaccines.
Enveloped viruses may obtain their lipid envelope when ‘budding’ out of the infected cell and obtain the membrane from the plasma membrane, or from that of an internal organelle. In mammalian or baculovirus cell systems, for example, influenza buds from the plasma membrane (Quan et al 2007 J. Virol 81:3514-3524). Only a few enveloped viruses are known to infect plants (for example, members of the Tospoviruses and Rhabdoviruses). Of the known plant enveloped viruses, they are characterized by budding from internal membranes of the host cell, and not from the plasma membrane. Although a small number of recombinant VLPs have been produced in plant hosts, none were derived from the plasma membrane, raising the question whether plasma membrane-derived VLPs, including influenza VLPs can be produced in plants.
Formation of VLPs, in any system, places considerable demands on the structure of the proteins—altering short stretches of sequence that correspond to selected surface loops of a globular structure may not have much of an effect on expression of the polypeptide itself, however structural studies are lacking to demonstrate the effect of such alterations on the formation of VLPs. The cooperation of the various regions and structures of HA (e.g. the membrane anchor sequences, the stalk or stem regions of the trimer that separate the globular head from the membranes) has evolved with the virus and may not be amendable to similar alterations without loss of HA trimer integrity and VLP formation.
The production of influenza HA VLPs has been previously described by the inventors in WO 2009/009876.
The present invention relates to virus-like particles. More specifically, the present invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza hemagglutinin virus-like particles.
It is an object of the invention to provide an improved chimeric influenza virus-like particle (VLP).
The present invention provides a polypeptide comprising a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA. The first and second influenza HA may independently be selected from the group comprising H1, H3, H5 and B. Furthermore, the polypeptide may comprise a signal peptide.
The present invention also provides a nucleic acid encoding the polypeptide comprising a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA, and the other subdomains are of one or more second influenza HA. The nucleic acid may also encode the polypeptide that comprises a signal peptide in addition to the SDC, HDC and TDC as defined.
A method of producing chimeric influenza virus like particles (VLPs) in a plant is also provided, the method comprising:
a) introducing a nucleic acid encoding a chimeric influenza HA comprising a signal peptide, a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA, and the other subdomains are of one or more second influenza HA into the plant, or portion thereof, and
b) incubating the plant, or portion thereof, under conditions that permit the expression of the nucleic acid, thereby producing the VLPs.
The present invention includes the method described above wherein in the step of introducing (step a), the nucleic acid is introduced in the plant in a transient manner. Alternatively, in the step of introducing (step a), the nucleic acid is introduced in the plant and is stably integrated. The method may further comprise a step of c) harvesting the host and purifying the VLPs.
The present invention provides a plant, or portion thereof, comprising a chimeric influenza HA, or a nucleotide sequence encoding the chimeric influenza HA, the chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA.
The plant, or portion thereof, may further comprise a nucleic acid comprising a nucleotide sequence encoding one or more than one chaperone protein operatively linked to a regulatory region active in a plant. The one or more than one chaperon proteins may be selected from the group comprising Hsp40 and Hsp70.
The present invention pertains to a virus like particle (VLP) comprising a chimeric influenza HA, the chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA. The VLP may further comprise plant-specific N-glycans, or modified N-glycans.
A composition comprising an effective dose of the VLP as just described and a pharmaceutically acceptable carrier is also provided.
In an alternate aspect of the present invention there is provided a method of inducing immunity to an influenza virus infection in a subject, comprising administering the VLP to the subject. The VLP may administered to a subject orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
Regulatory regions that may be operatively linked to a sequence encoding a chimeric HA protein include those that are operative in a plant cell, an insect cell or a yeast cell. Such regulatory regions may include a plastocyanin regulatory region, a regulatory region of Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO), chlorophyll a/b binding protein (CAB) or ST-LS1. Other regulatory regions include a 5′ UTR, 3′ UTR or terminator sequences. The plastocyanin regulatory region may be an alfalfa plastocyanin regulatory region; the 5′ UTR, 3′UTR or terminator sequences may also be alfalfa sequences.
The present invention provides a chimeric influenza HA polypeptide comprised of a first influenza and a second influenza, the first influenza and the second influenza may be independently selected from the group comprising B, H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15 and H16; with the proviso that the first influenza and the second influenza are not the same influenza type, subtype, or of the same origin.
In accordance with some aspects of the invention, the chimeric influenza HA polypeptide comprises a signal peptide sequence, the signal peptide sequence may be selected from the group comprising a native signal peptide sequence, an alfalfa PDI signal peptide sequence, an influenza H5 signal peptide sequence and an influenza H1 signal peptide sequence
The present invention provides a method for producing a VLP containing chimeric influenza hemagglutinin (HA) within a host capable of producing a VLP, including a plant, insect, or yeast comprising, introducing a nucleic acid encoding a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F′1, F′2 and F subdomain; the HDC comprises an RB, E1 and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA, into the host, and incubating the host under conditions that permit the expression of the nucleic acid, thereby producing the VLPs.
The production of VLPs in plants presents several advantages over the production of these particles in insect cell culture. Plant lipids can stimulate specific immune cells and enhance the immune response induced. Plant membranes are made of lipids, phosphatidylcholine (PC) and phosphatidylethanolamine (PE), and also contain glycosphingolipids that are unique to plants and some bacteria and protozoa. Sphingolipids are unusual in that they are not esters of glycerol like PC or PE but rather consist of a long chain amino alcohol that forms an amide linkage to a fatty acid chain containing more than 18 carbons. PC and PE as well as glycosphingolipids can bind to CD1 molecules expressed by mammalian immune cells such as antigen-presenting cells (APCs) like dentritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver. Furthermore, in addition to the potential adjuvant effect of the presence of plant lipids, the ability of plant N-glycans to facilitate the capture of glycoprotein antigens by antigen presenting cells, may be advantageous of the production of chimeric VLPs in plants. Without wishing to be bound by theory, it is anticipated that plant-made chimeric VLPs induce a stronger immune reaction than chimeric VLPs made in other manufacturing systems and that the immune reaction induced by these plant-made chimeric VLPs is stronger when compared to the immune reaction induced by live or attenuated whole virus vaccines.
Contrary to vaccines made of whole viruses, chimeric VLPs provide the advantage as they are non-infectious, thus restrictive biological containment is not as significant an issue as it would be working with a whole, infectious virus, and is not required for production. Plant-made chimeric VLPs provide a further advantage again by allowing the expression system to be grown in a greenhouse or field, thus being significantly more economical and suitable for scale-up.
Additionally, plants do not comprise the enzymes involved in synthesizing and adding sialic acid residues to proteins. VLPs may be produced in the absence of neuraminidase (NA), and there is no need to co-express NA, or to treat the producing cells or extract with sialidase (neuraminidase), to ensure VLP production in plants
This summary of the invention does not necessarily describe all features of the invention of the invention.
These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
The present invention relates to virus-like particles. More specifically, the present to invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza virus-like particles.
The following description is of a preferred embodiment.
The present invention provides a nucleic acid comprising a nucleotide sequence encoding a chimeric influenza hemagglutinin (HA) operatively linked to a regulatory region active in a plant.
Furthermore, the present invention provides a method of producing virus like particles (VLPs) in a plant. The method involves introducing a nucleic acid encoding a chimeric influenza HA operatively linked to a regulatory region active in the plant, into the plant, or portion of the plant, and incubating the plant or a portion of the plant under conditions that permit the expression of the nucleic acid, thereby producing the VLPs.
The present invention further provides for a VLP comprising a chimeric influenza HA. The VLP may be produced by the method as provided by the present invention.
By “chimeric protein” or “chimeric polypeptide”, it is meant a protein or polypeptide that comprises amino acid sequences from two or more than two sources, for example but not limited to, two or more influenza types or subtypes, or influenza's of a different origin, that are fused as a single polypeptide. The chimeric protein or polypeptide may include a signal peptide that is the same as, or heterologous with, the remainder of the polypeptide or protein. The chimeric protein or chimeric polypeptide may be produced as a transcript from a chimeric nucleotide sequence, and the chimeric protein or chimeric polypeptide cleaved following synthesis, and as required, associated to form a multimeric protein. Therefore, a chimeric protein or a chimeric polypeptide also includes a protein or polypeptide comprising subunits that are associated via disulphide bridges (i.e. a multimeric protein). For example, a chimeric polypeptide comprising amino acid sequences from two or more than two sources may be processed into subunits, and the subunits associated via disulphide bridges to produce a chimeric protein or chimeric polypeptide (see
The chimeric influenza HA according to various embodiments of the present invention may comprise a stem domain complex (SDC) a head domain complex (HDC) and a transmembrane domain complex (TDC), where one or more than one subdomain of either the SDC, HDC or TDC is of a first influenza HA type, subtype or from one origin, and one or more than one subdomain of either the SDC, HDC or TDC is from a second influenza HA type, subtype, or from a second or different origin. As described herein, the “SDC” comprises an F′1, F′2 and F subdomain, the “HDC” comprises an RB, E1 and E2 subdomain, the “TDC” comprises a TmD and Ctail subdomain (TMD/CT; see
The term “virus like particle” (VLP), or “virus-like particles” or “VLPs” refers to structures that self-assemble and comprise structural proteins such as influenza HA protein, or chimeric influenza HA protein. VLPs and chimeric VLPs are generally morphologically and antigenically similar to virions produced in an infection, but lack genetic information sufficient to replicate and thus are non-infectious. VLPs and chimeric VLPs may be produced in suitable host cells including plant host cells. Following extraction from the host cell and upon isolation and further purification under suitable conditions, VLPs and chimeric VLPs may be purified as intact structures.
Chimeric VLPs, or VLPs, produced from influenza derived proteins, in accordance with the present invention do not comprise M1 protein. The M1 protein is known to bind RNA (Wakefield and Brownlee, 1989) which is a contaminant of VLP preparation. The presence of RNA is undesired when obtaining regulatory approval for the chimeric VLP product, therefore a chimeric VLP preparation lacking RNA may be advantageous.
The chimeric VLPs of the present invention may be produced in a host cell that is characterized by lacking the ability to sialylate proteins, for example a plant cell, an insect cell, fungi, and other organisms including sponge, coelenterara, annelida, arthoropoda, mollusca, nemathelminthea, trochelmintes, plathelminthes, chaetognatha, tentaculate, chlamydia, spirochetes, gram-positive bacteria, cyanobacteria, archaebacteria, or the like. See, for example Gupta et al., 1999. Nucleic Acids Research 27:370-372; Toukach et al., 2007. Nucleic Acids Research 35:D280-D286; Nakahara et al., 2008. Nucleic Acids Research 36:D368-D371. The chimeric VLPs produced as described herein do not typically comprise neuraminidase (NA). However, NA may be co-expressed with HA should VLPs comprising HA and NA be desired.
The invention also provides VLPs comprising chimeric HA that obtain a lipid envelope from the plasma membrane of the cell in which the chimeric HA are expressed. For example, if the chimeric HA is expressed in a plant-based system, the resulting VLP may obtain a lipid envelope from the plasma membrane of the plant cell.
Generally, the term “lipid” refers to a fat-soluble (lipophilic), naturally-occurring molecules. A chimeric VLP produced in a plant according to some aspects of the invention may be complexed with plant-derived lipids. The plant-derived lipids may be in the form of a lipid bilayer, and may further comprise an envelope surrounding the VLP. The plant derived lipids may comprise lipid components of the plasma membrane of the plant where the VLP is produced, including phospholipids, tri-, di- and monoglycerides, as well as fat-soluble sterol or metabolites comprising sterols. Examples include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol, phosphatidylserine, glycosphingolipids, phytosterols or a combination thereof. A plant-derived lipid may alternately be referred to as a ‘plant lipid’. Examples of phytosterols include campesterol, stigmasterol, ergosterol, brassicasterol, delta-7-stigmasterol, delta-7-avenasterol, daunosterol, sitosterol, 24-methylcholesterol, cholesterol or beta-sitosterol—see, for example, Mongrand et al., 2004. As one of skill in the art would understand, the lipid composition of the plasma membrane of a cell may vary with the culture or growth conditions of the cell or organism, or species, from which the cell is obtained. Generally, beta-sitosterol is the most abundant phytosterol.
Cell membranes generally comprise lipid bilayers, as well as proteins for various functions. Localized concentrations of particular lipids may be found in the lipid bilayer, referred to as ‘lipid rafts’. These lipid raft microdomains may be enriched in sphingolipids and sterols. Without wishing to be bound by theory, lipid rafts may have significant roles in endo and exocytosis, entry or egress of viruses or other infectious agents, inter-cell signal transduction, interaction with other structural components of the cell or organism, such as intracellular and extracellular matrices.
The invention includes VLPs comprising chimeric HA, of which the subdomains may be obtained from any type, subtype of influenza virus which may infect humans, including, for example, B, H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15 and H16 types or subtypes. In some embodiments, the influenza virus may be of an H1, H3, H5 or B types or subtypes. Non limiting examples of H1, H3, H15 or B types or subtypes include the A/New Caledonia/20/99 subtype (H1N1) (“H1/NC”; SEQ ID NO:56), the H1 A/California 04/09 subtype (H1N1) (“H1/Cal”; SEQ ID NO:86), the A/Indonesia/5/05 sub-type (H5N1) (“H5/Indo”), A/Brisbane/59/2007 (“H1/Bri”), and B/Florida/4/2006 (“B/Flo”) and H3 A/Brisbane/10/2007 (“H3/Bri”). Furthermore, the chimeric HA may comprise one or more subdomains of a hemagglutinin that is isolated from one or more emerging or newly-identified influenza viruses.
The present invention also pertains to influenza viruses which infect other mammals or host animals, for example humans, primates, horses, pigs, birds, avian water fowl, migratory birds, quail, duck, geese, poultry, chicken, camel, canine, dogs, feline, cats, tiger, leopard, civet, mink, stone marten, ferrets, house pets, livestock, mice, rats, seal, whale and the like. Some influenza viruses may infect more than one host animal.
With reference to influenza virus, the term “hemagglutinin” or “HA” as used herein refers to a structural glycoprotein of influenza viral particles. The structure of influenza hemagglutinin is well-studied and demonstrates a high degree of conservation in secondary, tertiary and quaternary structure. This structural conservation is observed even though the amino acid sequence may vary (see, for example, Skehel and Wiley, 2000 Ann Rev Biochem 69:531-69; Vaccaro et al 2005; which is incorporated herein by reference). Nucleotide sequences encoding HA are well known, and are available for example, from the BioDefense and Public Health Database (for example at URL: biohealthbase.org/GSearch/home.do?decorator=Influenza) or the databases maintained by the National Center for Biotechnology Information (NCBI; for example at URL: ncbi.nlm.nih.gov/sites/entrez?db=nuccore&cmd=search&term=influenza) both of which are incorporated herein by reference.
The HA monomer may be subdivided in three functional domains—a stem domain, or stem domain cluster (SDC), a globular head domain, or head domain cluster (HDC) and a transmembrane domain cluster (TDC). The SDC comprises four subdomains, a fusion peptide F, F′1 and F′2 (this subdomain may be generally referred to as a ‘backbone’). The TDC comprises two subdomains, the transmembrane (TmD) and a C terminal tail (CT). The HDC comprises three subdomains, vestigial esterase domains E1′ and E2, and a receptor binding domain RB. The SDC and HDC may be collectively referred to as the ‘ectodomain’. A publication by Ha et al. 2002 (EMBO J. 21:865-875; which is incorporated herein by reference) illustrates the relative orientation of the various subdomains of the SDC and HDC in several influenza subtypes, based on Xray crystallographic structures. A schematic diagram of the subdomains relative to N and C termini of the HA1 and HA2 polypeptides is shown in
Amino acid variation is tolerated in hemagglutinins of influenza viruses. This variation provides for new strains that are continually being identified. Infectivity between the new strains may vary. However, formation of hemagglutinin trimers, which subsequently form VLPs is maintained. The present invention, therefore, provides for a hemagglutinin amino acid sequence comprising chimeric HA, or a nucleic acid encoding a chimeric hemagglutinin amino acid sequence, that forms VLPs in a plant, and includes known sequences and variant HA sequences that may develop. The present invention also pertains to the use of a chimeric HA polypeptide comprising a TDC, SDC and HDC. For example the chimeric HA protein may be HA0, or a cleaved chimeric HA comprising subdomains of HA1 and HA2 from two or more influenza types. The chimeric HA protein may be used in the production or formation of VLPs using a plant, or plant cell, expression system.
HA0 may be expressed and folded to form a trimer, which may subsequently assemble into VLPs. Cleavage of HA0 yields HA1 and HA2 polypeptides linked by a disulfide bridge (see
The HA0 polypeptide comprises several domains. The RB subdomain of the HDC comprises several loops in antigenic regions designated as site A-E. Antibodies that may neutralize infectious influenza virus are frequently targeted to one or more of these sites. The vestigial esterase subdomains (E1 and E2) may have a role in fusion, and may bind Ca++. The F, F′1 and F′2 domains interact and cooperate to form a stem, raising the head of the HA trimer above the membrane. A TmD and CT may be involved in anchoring of the folded HA to a membrane. The TmD may have a role in affinity of HA for lipid rafts, while the CT may have a role in secretion of HA, while some of the cysteine residues found in the CT subdomain may be palmitoylated. A signal peptide (SP) may also be found at the N terminus of the HA0 polypeptide.
Processing of an N-terminal signal peptide (SP) sequence during expression and/or secretion of influenza hemagglutinins may have a role in the folding of the HA. The term “signal peptide” refers generally to a short (about 5-30 amino acids) sequence of amino acids, found generally at the N-terminus of a hemagglutinin polypeptide that may direct translocation of the newly-translated polypeptide to a particular organelle, or aid in positioning of specific domains of the polypeptide chain relative to others. The signal peptide of hemagglutinins target the translocation of the protein into the endoplasmic reticulum and have been proposed to aid in positioning of the N-terminus proximal domain relative to a membrane-anchor domain of the nascent hemagglutinin polypeptide to aid in cleavage and folding of the mature hemagglutinin.
Insertion of HA within the endoplasmic reticulum (ER) membrane of the host cell, signal peptide cleavage and protein glycosylation are co-translational events. Correct folding of HA requires glycosylation of the protein and formation of at least 6 intra-chain disulfide bonds (see
A signal peptide may be native to the hemagglutinin, or a signal peptide may be heterologous with respect to the primary sequence of hemagglutinin being expressed. A chimeric HA may comprise a signal peptide from a first influenza type, subtype or strain with the balance of the HA from one or more than one different influenza type, subtype or strain. For example the native SP of HA subtypes B H1, H2, H3, H5, H6, H7, H9 or influenza type B may be used to express the HA in a plant system. In some embodiments of the invention, the SP may be of an influenza type B, H1, H3 or H5; or of the subtype H1/Bri, H1/NC, H5/Indo, H3/Bri or B/Flo.
A SP may also be non-native, for example, from a structural protein or hemagglutinin of a virus other than influenza, or from a plant, animal or bacterial polypeptide. A non limiting example of a signal peptide that may be used is that of alfalfa protein disulfide isomerase (PDI SP; nucleotides 32-109 of Accession No. Z11499; SEQ ID NO: 57;
The present invention therefore provides for a chimeric influenza hemagglutinin comprising a native, or a non-native signal peptide, and nucleic acids encoding such chimeric hemagglutinins.
Correct folding of the hemagglutinins may be important for stability of the protein, formation of multimers, formation of VLPs and function of the HA (ability to hemagglutinate), among other characteristics of influenza hemagglutinins. Folding of a protein may be influenced by one or more factors, including, but not limited to, the sequence of the protein, the relative abundance of the protein, the degree of intracellular crowding, the availability of cofactors that may bind or be transiently associated with the folded, partially folded or unfolded protein, the presence of one or more chaperone proteins, or the like.
Heat shock proteins (Hsp) or stress proteins are examples of chaperone proteins, which may participate in various cellular processes including protein synthesis, intracellular trafficking, prevention of misfolding, prevention of protein aggregation, assembly and disassembly of protein complexes, protein folding, and protein disaggregation. Examples of such chaperone proteins include, but are not limited to, Hsp60, Hsp65, Hsp 70, Hsp90, Hsp100, Hsp20-30, Hsp10, Hsp100-200, Hsp100, Hsp90, Lon, TF55, FKBPs, cyclophilins, ClpP, GrpE, ubiquitin, calnexin, and protein disulfide isomerases (see, for example, Macario, A. J. L., Cold Spring Harbor Laboratory Res. 25:59-70. 1995; Parsell, D. A. & Lindquist, S. Ann. Rev. Genet. 27:437-496 (1993); U.S. Pat. No. 5,232,833). As described herein, chaperone proteins, for example but not limited to Hsp40 and Hsp70 may be used to ensure folding of a chimeric HA.
Examples of Hsp70 include Hsp72 and Hsc73 from mammalian cells, DnaK from bacteria, particularly mycobacteria such as Mycobacterium leprae, Mycobacterium tuberculosis, and Mycobacterium bovis (such as Bacille-Calmette Guerin: referred to herein as Hsp71). DnaK from Escherichia coli, yeast and other prokaryotes, and BiP and Grp78 from eukaryotes, such as A. thaliana (Lin et al. 2001 (Cell Stress and Chaperones 6:201-208). A particular example of an Hsp70 is A. thaliana Hsp70 (encoded by Genbank ref: AY120747.1). Hsp70 is capable of specifically binding ATP as well as unfolded polypeptides and peptides, thereby participating in protein folding and unfolding as well as in the assembly and disassembly of protein complexes.
Examples of Hsp40 include DnaJ from prokaryotes such as E. coli and mycobacteria and HSJ1, HDJ1 and Hsp40 from eukaryotes, such as alfalfa (Frugis et al., 1999. Plant Molecular Biology 40:397-408). A particular example of an Hsp40 is M. sativa MsJ1 (AJ000995.1 or SEQ ID NO: 76). Hsp40 plays a role as a molecular chaperone in protein folding, thermotolerance and DNA replication, among other cellular activities.
Among Hsps, Hsp70 and its co-chaperone, Hsp40, are involved in the stabilization of translating and newly synthesized polypeptides before the synthesis is complete. Without wishing to be bound by theory, Hsp40 binds to the hydrophobic patches of unfolded (nascent or newly transferred) polypeptides, thus facilitating the interaction of Hsp70-ATP complex with the polypeptide. ATP hydrolysis leads to the formation of a stable complex between the polypeptide, Hsp70 and ADP, and release of Hsp40. The association of Hsp70-ADP complex with the hydrophobic patches of the polypeptide prevents their interaction with other hydrophobic patches, preventing the incorrect folding and the formation of aggregates with other proteins (reviewed in Hartl, F U. 1996. Nature 381:571-579).
Native chaperone proteins may be able to facilitate correct folding of low levels of recombinant protein, but as the expression levels increase, the abundance of native chaperones may become a limiting factor. High levels of expression of hemagglutinin in the agroinfiltrated leaves may lead to the accumulation of hemagglutinin polypeptides in the cytosol, and co-expression of one or more than one chaperone proteins such as Hsp70, Hsp40 or both Hsp70 and Hsp40 may reduce the level of misfolded or aggregated hemagglutinin polypeptides, and increase the number of polypeptides exhibiting tertiary and quaternary structural characteristics that allow for hemagglutination and/or formation of virus-like particles. SEQ ID NO: 77 is a nucleic acid sequence of a portion of construct number R850, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP40 (underlined). SEQ ID NO: 78 is a nucleic acid sequence of a portion of construct number R860, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP70 (underlined). SEQ ID NO: 79 is a nucleic acid sequence of a portion of construct number R870, from HindIII (in the multiple cloning site, 5 upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) encoding HSP40 (underlined italic) and HSP70 (underlined).
Therefore, the present invention also provides for a method of producing chimeric influenza VLPs in a plant, wherein a first nucleic acid encoding a chimeric influenza HA is co-expressed with a second nucleic acid encoding a chaperone. The first and second nucleic acids may be introduced to the plant in the same step, or may be introduced to the plant sequentially.
VLPs may be assessed for structure and size by, for example, hemagglutination assay, electron microscopy, or by size exclusion chromatography.
For size exclusion chromatography, total soluble proteins may be extracted from plant tissue by homogenizing (Polytron) sample of frozen-crushed plant material in extraction buffer, and insoluble material removed by centrifugation. Precipitation with PEG may also be of benefit. The soluble protein is quantified, and the extract passed through a Sephacryl™ column. Blue Dextran 2000 may be used as a calibration standard. Following chromatography, fractions may be further analyzed by immunoblot to determine the protein complement of the fraction.
The present invention also provides for a plant comprising a nucleic acid encoding one, or more than one chimeric influenza hemagglutinin and a nucleic acid encoding one or more than one chaperones.
The present invention includes nucleotide sequences:
SEQ ID NO: 63 (construct 690; a chimeric H5/H1 expression cassette comprising alfalfa plastocyanin promoter and 5′ UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3′ UTR and terminator sequences) and the underlined portion of SEQ ID NO:63 encoding SP, F1, E1 of H5/Indo-RB of H1/Bri-E2, F2, F, TMD/CT of H5/Indo;
SEQ ID NO: 64 (construct 691; a chimeric H5/H1 expression cassette comprising alfalfa plastocyanin promoter and 5′ UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3′ UTR and terminator sequences), and the underlined portion of SEQ ID NO:64, encoding SP, F′1, of H5/Indo-E1, RB. E2 of H1/Bri-F′2, F, TMD/CT of H5/Indo;
SEQ ID NO: 65 (construct 696; a chimeric H1/H5 expression cassette comprising alfalfa plastocyanin promoter and 5′ UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3′ UTR and terminator sequences) and the underlined portion of SEQ ID NO:65 encoding PDI SP-F′1, E1 of H1/NC-RB of H5/Indo-E2, F′2, F, TMD/CT of H1/NC;
SEQ ID NO: 68 (construct 733; the SpPDI H1/Bri expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of H1 form A/Brisbane/59/07 (H1N1), CPMV-HT 3′ UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:68, encoding PDI SP-F′1, E1, RB, E2, F′2, F, TMD/CT of H1/BRI;
SEQ ID NO: 69 (construct 734; a chimeric H5/H1 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3′ UTR and NOS terminator sequences). The coding sequence of chimeric HA is underlined, encoding the same chimeric HA as SEQ ID NO:63;
SEQ ID NO: 71 (construct 736; an HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of H3 form A/Brisbane/10/07 (H2N3), CPMV-HT 3′ UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO: 71 encoding PDI SP-F′1, E1, RB, E2, F2, F, TMD/CT of H3/Bri;
SEQ ID NO: 72 (construct 737; a chimeric H5/H3 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3′ UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:72 encoding PDI SP-F′1, E1, RB, E2, F′2, F, TMD/CT of H5/Indo;
SEQ ID NO: 74 (construct 739; an HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of HA form B/Florida/4/06, CPMV-HT 3′ UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:74 encoding PDI SP-F′1, E1, RB, E2, F′2, F, TMD/CT of B/Flo;
SEQ ID NO: 75 (construct 734; a chimeric H5/B expression cassette comprising the CaMV 35S promoter, CPMV-HT 5′ UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3′ UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:75 encoding PDI SP-F′1, E1, RB, E2, F′2, F of B/Flo-TND/CT of H5/Indo.
The present invention also includes a nucleotide sequence that hybridizes under stringent hybridisation conditions to the underlined portions of any one of SEQ ID NOs:63-65, 68, 69, and 71-75. The present invention also includes a nucleotide sequence that hybridizes under stringent hybridisation conditions to a complement of the underlined portions of any one of SEQ ID NOs:63-65, 68, 69, and 71-75. These nucleotide sequences that hybridize to the underlined portions of SEQ ID NOs:63-65, 68, 69, and 71-75, or a complement of the underlined portions of SEQ ID NOs:63-65, 68, 69, and 71-75, encode a chimeric hemagglutinin protein that, when expressed forms a chimeric VLP, and the chimeric VLP induces production of an antibody when administered to a subject. For example, expression of the nucleotide sequence within a plant cell forms a chimeric VLP, and the chimeric VLP may be used to produce an antibody that is capable of binding HA, including mature HA, HA0, HA1 or HA2 of one or more influenza types or subtypes. The chimeric VLP, when administered to a subject, induces an immune response.
Hybridization under stringent hybridization conditions is known in the art (see for example Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 and supplements; Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982; Sambrook and Russell, in Molecular Cloning: A Laboratory Manual, 3rd edition 2001; each of which is incorporated herein by reference). An example of one such stringent hybridization conditions may be about 16-20 hours hybridization in 4×SSC at 65° C., followed by washing in 0.1×SSC at 65° C. for an hour, or 2 washes in 0.1×SSC at 65° C. each for 20 or 30 minutes. Alternatively, an exemplary stringent hybridization condition could be overnight (16-20 hours) in 50% formamide, 4×SSC at 42° C., followed by washing in 0.1×SSC at 65° C. for an hour, or 2 washes in 0.1×SSC at 65° C. each for 20 or 30 minutes, or overnight (16-20 hours), or hybridization in Church aqueous phosphate buffer (7% SDS; 0.5M NaPO4 buffer pH 7.2; 10 mM EDTA) at 65° C., with 2 washes either at 50° C. in 0.1×SSC, 0.1% SDS for 20 or 30 minutes each, or 2 washes at 65° C. in 2×SSC, 0.1% SDS for 20 or 30 minutes each.
Additionally, the present invention includes nucleotide sequences that are characterized as having about 70, 75, 80, 85, 87, 90, 91, 92, 93 94, 95, 96, 97, 98, 99, 100% or any amount therebetween, sequence identity, or sequence similarity, with the nucleotide sequence encoding chimeric HA according to the underlined portions of any one of SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75, wherein the nucleotide sequence encodes a hemagglutinin protein that when expressed forms a chimeric VLP, and that the chimeric VLP induces the production of an antibody. For example, expression of the nucleotide sequence within a plant cell forms a chimeric VLP, and the chimeric VLP may be used to produce an antibody that is capable of binding HA, including mature HA, HA0, HA1, or HA2. The VLP, when administered to a subject, induces an immune response.
An “immune response” generally refers to a response of the adaptive immune system. The adaptive immune system generally comprises a humoral response, and a cell-mediated response. The humoral response is the aspect of immunity that is mediated by secreted antibodies, produced in the cells of the B lymphocyte lineage (B cell). Secreted antibodies bind to antigens on the surfaces of invading microbes (such as viruses or bacteria), which flags them for destruction. Humoral immunity is used generally to refer to antibody production and the processes that accompany it, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin promotion of phagocytosis, pathogen elimination and the like. The terms “modulate” or “modulation” or the like refer to an increase or decrease in a particular response or parameter, as determined by any of several assays generally known or used, some of which are exemplified herein.
A cell-mediated response is an immune response that does not involve antibodies but rather involves the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. Cell-mediated immunity is used generally to refer to some Th cell activation, Tc cell activation and T-cell mediated responses. Cell mediated immunity is of particular importance in responding to viral infections.
For example, the induction of antigen specific CD8 positive T lymphocytes may be measured using an ELISPOT assay; stimulation of CD4 positive T-lymphocytes may be measured using a proliferation assay. Anti-influenza antibody titres may be quantified using an ELISA assay; isotypes of antigen-specific or cross reactive antibodies may also be measured using anti-isotype antibodies (e.g. anti-IgG, IgA, IgE or IgM). Methods and techniques for performing such assays are well-known in the art.
A hemagglutination inhibition (HI, or HAI) assay may also be used to demonstrate the efficacy of antibodies induced by a vaccine, or vaccine composition comprising chimeric HA or chimeric VLP can inhibit the agglutination of red blood cells (RBC) by recombinant HA. Hemagglutination inhibitory antibody titers of serum samples may be evaluated by microtiter HAI (Aymard et al 1973). Erythrocytes from any of several species may be used—e.g. horse, turkey, chicken or the like. This assay gives indirect information on assembly of the HA trimer on the surface of VLP, confirming the proper presentation of antigenic sites on HAs.
Cross-reactivity HAI titres may also be used to demonstrate the efficacy of an immune response to other strains of virus related to the vaccine subtype. For example, serum from a subject immunized with a vaccine composition comprising a chimeric hemagglutinin comprising an HDC of a first influenza type or subtype may be used in an HAI assay with a second strain of whole virus or virus particles, and the HAI titer determined.
Without wishing to be bound by theory, the capacity of HA to bind to RBC from different animals is driven by the affinity of HA for sialic acids bound with α2,3 or α2,6 linkages and the presence of these sialic acids on the surface of RBC. Equine and avian HA from influenza viruses agglutinate erythrocytes from all several species, including turkeys, chickens, ducks, guinea pigs, humans, sheep, horses and cows; whereas human HAs will bind to erythrocytes of turkey, chickens, ducks, guinea pigs, humans and sheep (Ito T. et al, 1997, Virology, 227:493-499; Medeiros R et al, 2001. Virology 289:74-85).
Cytokine presence or levels may also be quantified. For example a T-helper cell response (Th1/Th2) will be characterized by the measurement of IFN-γ and IL-4 secreting cells using by ELISA (e.g. BD Biosciences OptEIA kits). Peripheral blood mononuclear cells (PBMC) or splenocytes obtained from a subject may be cultured, and the supernatant analyzed. T lymphocytes may also be quantified by fluorescence-activated cell sorting (FACS), using marker specific fluorescent labels and methods as are known in the art.
A microneutralization assay may also be conducted to characterize an immune response in a subject, see for example the methods of Rowe et al., 1973. Virus neutralization titers may be obtained several ways, including: 1) enumeration of lysis plaques (plaque assay) following crystal violet fixation/coloration of cells; 2) microscopic observation of cell lysis in culture; 3) ELISA and spectrophotometric detection of NP virus protein (correlate with virus infection of host cells)
Sequence identity or sequence similarity may be determined using a sequence comparison program, such as that provided within DNASIS (for example, using, but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k-tuple 2, floating gap 10, and window size 5). However, other methods of alignment of sequences for comparison are well-known in the art for example the algorithms of Smith & Waterman (1981, Adv. Appl. Math. 2:482), Needleman & Wunsch (J. Mol. Biol. 48:443, 1970), Pearson & Lipman (1988, Proc. Nat'l. Acad. Sci. USA 85:2444), and by computerized implementations of these algorithms (e.g. GAP, BESTFIT, FASTA, and BLAST (Altschul et al., 1990. J. Mol Biol 215:403-410), or by manual alignment and visual inspection. Nucleic acid or amino acid sequences may be compared or aligned and consensus sequences may be determined using any of several software packages known in the art, for example MULTALIN (Corpet F., 1988, Nucl. Acids Res., 16 (22), 10881-10890), BLAST, CLUSTAL or the like; alternately sequences may be aligned manually and similarities and differences between the sequences determined.
A fragment or portion of a protein, fusion protein or polypeptide includes a peptide or polypeptide comprising a subset of the amino acid complement of a particular protein or polypeptide, provided that the fragment can form a chimeric VLP when expressed. The fragment may, for example, comprise an antigenic region, a stress-response-inducing region, or a region comprising a functional domain of the protein or polypeptide. The fragment may also comprise a region or domain common to proteins of the same general family, or the fragment may include sufficient amino acid sequence to specifically identify the full-length protein from which it is derived.
For example, a fragment or portion may comprise from about 60% to about 100%, of the length of the full length of the protein, or any amount therebetween, provided that the fragment can form a chimeric VLP when expressed. For example, from about 60% to about 100%, from about 70% to about 100%, from about 80% to about 100%, from about 90% to about 100%, from about 95% to about 100%, of the length of the full length of the protein, or any amount therebetween. Alternately, a fragment or portion may be from about 150 to about 500 amino acids, or any amount therebetween, depending upon the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed. For example, a fragment may be from 150 to about 500 amino acids, or any amount therebetween, from about 200 to about 500 amino acids, or any amount therebetween, from about 250 to about 500 amino acids, or any amount therebetween, from about 300 to about 500 or any amount therebetween, from about 350 to about 500 amino acids, or any amount therebetween, from about 400 to about 500 or any amount therebetween, from about 450 to about 500 or any amount therebetween, depending upon the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed. For example, about 5, 10, 20, 30, 40 or 50 amino acids, or any amount therebetween may be removed from the C terminus, the N terminus or both the N and C terminus of a chimeric HA protein, provided that the fragment can form a chimeric VLP when expressed.
Numbering of amino acids in any given sequence are relative to the particular sequence, however one of skill can readily determine the ‘equivalency’ of a particular amino acid in a sequence based on structure and/or sequence. For example, if 6 N terminal amino acids were removed, this would change the specific numerical identity of the amino acid (e.g. relative to the full length of the protein), but would not alter the relative position of the amino acid in the structure.
The present invention describes, but is not limited to, expression of a nucleic acid encoding a chimeric HA in a plant portion of a plant, or a plant cell, and the production of chimeric influenza VLPs from the plant, suitable for vaccine production. Examples of such nucleic acids include, for example, but are not limited to, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75.
The present invention further provides expression of a nucleic acid encoding a chimeric HA, for example but not limited to SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75 in a plant, a portion of a plant, or a plant cell, and production of influenza vaccine candidates or reagents comprised of recombinant influenza structural proteins that self-assemble into functional and immunogenic homotypic macromolecular protein structures, including subviral influenza particles and chimeric influenza VLP, in transformed plant cells.
Therefore, the invention provides for chimeric VLPs, and a method for producing chimeric VLPs in a plant expression system, from the expression of a single chimeric envelope protein.
The nucleic acid encoding the chimeric HA of influenza subtypes, for example SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75 may be synthesized by reverse transcription and polymerase chain reaction (PCR) using HA RNA. As an example, the RNA may be isolated from H1/NC, H1/Bri, H3/Bri, B/Flo or H5/Indo, or from cells infected with these or other influenza virus types or subtypes. For reverse transcription and PCR, oligonucleotide primers specific for the HA RNA may be used. Additionally, a nucleic acid encoding a chimeric HA may be chemically synthesized using methods as would be known to one of skill in the art.
The present invention is further directed to a gene construct comprising a nucleic acid encoding a chimeric HA, as described above, operatively linked to a regulatory element that is operative in a plant. Examples of regulatory elements operative in a plant cell and that may be used in accordance with the present invention include but are not limited to a plastocyanin regulatory region (U.S. Pat. No. 7,125,978; which is incorporated herein by reference), or a regulatory region of Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO; U.S. Pat. No. 4,962,028; which is incorporated herein by reference), chlorophyll a/b binding protein (CAB; Leutwiler et al; 1986; which is incorporated herein by reference), ST-LS1 (associated with the oxygen-evolving complex of photosystem II and described by Stockhaus et al. 1987, 1989; which is incorporated herein by reference).
The gene construct of the present invention may also comprise a constitutive promoter that directs the expression of a gene that is operatively linked to the promoter throughout the various parts of a plant and continuously throughout plant development. A non-limiting example of a constitutive promoter is that associated with the CaMV 35S transcript (e.g. Odell et al., 1985, Nature, 313: 810-812, which is incorporated by reference).
An example of a sequence comprising a plastocyanin regulatory region is the sequence 5′ to the underlined sequenced encoding a PDI signal peptide of SEQ ID NO: 58. A regulatory element or regulatory region may enhance translation of a nucleotide sequence to which is it operatively linked, where the nucleotide sequence may encode a protein or polypeptide. Another example of a regulatory region, is that derived from the untranslated regions of the Cowpea Mosaic Virus (CPMV), which may be used to preferentially translate the nucleotide sequence to which it is operatively linked. This CPMV regulatory region is exploited in a hyper-translatable CMPV system (CPMV-HT; see, for example, Sainsbury et al, 2008, Plant Physiology 148: 1212-1218; Sainsbury et al., 2008 Plant Biotechnology Journal 6:82-92; both of which are incorporated herein by reference).
Therefore, an aspect of the invention provides for a nucleic acid comprising a regulatory region operatively linked to a sequence encoding a chimeric influenza HA. The regulatory region may be a plastocyanin regulatory element, and the chimeric influenza HA may comprise subdomains from H5/Indo, H1/Bri, H3/Bri, H1/NC, B/Flo influenza types, subtypes or strains. Nucleic acid sequences comprising a plastocyanin regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 63 and 64. Nucleic acid sequences comprising a 35S regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 68, 69 and 71-75.
In another aspect, the invention provides for a nucleic acid comprising a CPMV regulatory region and a chimeric influenza HA, comprising subdomains from H5/Indo, H1/Bri, H3/Bri, H1/NC, B/Flo influenza types, subtypes or strains. Nucleic acid sequences comprising a CPMP regulatory element and a chimeric HA are exemplified herein by SEQ ID NOs: 66-69 and 71-75.
Plant-produced chimeric influenza VLPs bud from the plasma membrane and the lipid composition of the chimeric VLPs reflects that of the plant cell or plant tissue type from which they are produced. The VLPs produced according to the present invention comprise chimeric HA of two or more than two types or subtypes of influenza, complexed with plant derived lipids. Plant lipids can stimulate specific immune cells and enhance the immune response induced.
Plant lipids such as PC (phosphatidyl choline) and PE (phosphatidyl ethanolamine), as well as glycosphingolipids can bind to CD1 molecules expressed by mammalian immune cells such as antigen-presenting cells (APCs) like dendritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver (reviewed in Tsuji M, 2006 Cell Mol Life Sci 63:1889-98). CD1 molecules are structurally similar to major histocompatibility complex (MHC) molecules of class I and their role is to present glycolipid antigens to NKT cells (Natural Killer T cells). Upon activation, NKT cells activate innate immune cells such as NK cells and dendritic cells and also activate adaptive immune cells like the antibody-producing B cells and T-cells.
The phytosterols present in an influenza VLP complexed with a lipid bilayer, such as an plasma-membrane derived envelope may provide for an advantageous vaccine composition. Without wishing to be bound by theory, plant-made VLPs, including those comprising chimeric HA, complexed with a lipid bilayer, such as a plasma-membrane derived envelope, may induce a stronger immune reaction than VLPs made in other expression systems, and may be similar to the immune reaction induced by live or attenuated whole virus vaccines.
Therefore, in some embodiments, the invention provides for a VLP comprising a chimeric HA, complexed with a plant-derived lipid bilayer. In some embodiments the plant-derived lipid bilayer may comprise the envelope of the VLP.
The VLP produced within a plant may include a chimeric HA comprising plant-specific N-glycans. Therefore, this invention also provides for a VLP comprising a chimeric HA having plant specific N-glycans.
Furthermore, modification of N-glycan in plants is known (see for example WO 2008/151440; which is incorporated herein by reference) and chimeric HA having modified N-glycans may be produced. A chimeric HA comprising a modified glycosylation pattern, for example with reduced fucosylated, xylosylated, or both, fucosylated and xylosylated, N-glycans may be obtained, or chimeric HA having a modified glycosylation pattern may be obtained, wherein the protein lacks fucosylation, xylosylation, or both, and comprises increased galactosylation. Furthermore, modulation of post-translational modifications, for example, the addition of terminal galactose may result in a reduction of fucosylation and xylosylation of the expressed chimeric HA when compared to a wild-type plant expressing chimeric HA.
For example, which is not to be considered limiting, the synthesis of chimeric HA having a modified glycosylation pattern may be achieved by co-expressing the protein of interest along with a nucleotide sequence encoding beta-1,4galactosyltransferase (GalT), for example, but not limited to mammalian GalT, or human GalT however GalT from another sources may also be used. The catalytic domain of GalT may also be fused to a CTS domain (i.e. the cytoplasmic tail, transmembrane domain, stem region) of N-acetylglucosaminyl transferase (GNT1), to produce a GNT1-GalT hybrid enzyme, and the hybrid enzyme may be co-expressed with HA. The HA may also be co-expressed along with a nucleotide sequence encoding N-acetylglucosaminyltransferase III (GnT-III), for example but not limited to mammalian GnT-III or human GnT-III, GnT-III from other sources may also be used. Additionally, a GNT1-GnT-III hybrid enzyme, comprising the CTS of GNT1 fused to GnT-III may also be used.
Therefore the present invention also includes VLP's comprising chimeric HA having modified N-glycans.
Without wishing to be bound by theory, the presence of plant N-glycans on a chimeric HA may stimulate the immune response by promoting the binding of HA by antigen presenting cells. Stimulation of the immune response using plant N glycan has been proposed by Saint-Jore-Dupas et al. (Trends Biotechnol 25: 317-23, 2007). Furthermore, the conformation of the VLP may be advantageous for the presentation of the antigen, and enhance the adjuvant effect of VLP when complexed with a plant derived lipid layer.
By “regulatory region”, “regulatory element” or “promoter” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association, or operatively linked, with a gene of interest, this may result in expression of the gene of interest. A regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation. A “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. “Regulatory region”, as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
In the context of this disclosure, the term “regulatory element” or “regulatory region” typically refers to a sequence of DNA, usually, but not always, upstream (5′) to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within introns, or 3′ of the sequence may also contribute to the regulation of expression of a coding region of interest. An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site. A promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression.
There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. A regulatory region that is developmentally regulated, or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well. Examples of tissue-specific regulatory regions, for example see-specific a regulatory region, include the napin promoter, and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). An example of a leaf-specific promoter includes the plastocyanin promoter (see, for example SEQ ID NO: 58); U.S. Pat. No. 7,125,978, which is incorporated herein by reference).
An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor that binds specifically to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I. R. P., 1998, Trends Plant Sci. 3, 352-358; which is incorporated by reference). Examples, of potential inducible promoters include, but not limited to, tetracycline-inducible promoter (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108; which is incorporated by reference), steroid inducible promoter (Aoyama, T. and Chua, N. H., 1997, Plant J. 2, 397-404; which is incorporated by reference) and ethanol-inducible promoter (Salter, M. G., et al, 1998, Plant Journal 16, 127-132; Caddick, M. X., et al, 1998, Nature Biotech. 16, 177-180, which are incorporated by reference) cytokinin inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, J. J., 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985; which are incorporated by reference) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971; which is incorporated by reference).
A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (Odell et al., 1985, Nature, 313: 810-812), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121), or tms 2 (U.S. Pat. No. 5,428,147, which is incorporated herein by reference), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant Mol. Biol. 29: 995-1004). The term “constitutive” as used herein does not necessarily indicate that a gene under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types even though variation in abundance is often observed. Constitutive regulatory elements may be coupled with other sequences to further enhance the transcription and/or translation of the nucleotide sequence to which they are operatively linked. For example, the CPMV-HT system is derived from the untranslated regions of the Cowpea mosaic virus (CPMV) and demonstrates enhanced translation of the associated coding sequence.
By “native” it is meant that the nucleic acid or amino acid sequence is naturally occurring, or “wild type”.
By “operatively linked” it is meant that the particular sequences, for example a regulatory element and a coding region of interest, interact either directly or indirectly to carry out an intended function, such as mediation or modulation of gene expression. The interaction of operatively linked sequences may, for example, be mediated by proteins that interact with the operatively linked sequences.
The one or more than one nucleotide sequence of the present invention may be expressed in any suitable plant host that is transformed by the nucleotide sequence, or constructs, or vectors of the present invention. Examples of suitable hosts include, but are not limited to, agricultural crops including alfalfa, canola, Brassica spp., maize, Nicotiana spp., alfalfa, potato, ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton and the like.
The one or more chimeric genetic constructs of the present invention can further comprise a 3′ untranslated region. A 3′ untranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3′ end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5′ AATAAA-3′ although variations are not uncommon.
Non-limiting examples of suitable 3′ regions are the 3′ transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene, plant genes such as the soybean storage protein genes, the small subunit of the ribulose-1,5-bisphosphate carboxylase gene (ssRUBISCO; U.S. Pat. No. 4,962,028; which is incorporated herein by reference), the promoter used in regulating plastocyanin expression, described in U.S. Pat. No. 7,125,978 (which is incorporated herein by reference).
One or more of the chimeric genetic constructs of the present invention may also include further enhancers, either translation or transcription enhancers, as may be required. Enhancers may be located 5′ or 3′ to the sequence being transcribed. Enhancer regions are well known to persons skilled in the art, and may include an ATG initiation codon, adjacent sequences or the like. The initiation codon, if present, may be in phase with the reading frame (“in frame”) of the coding sequence to provide for correct translation of the transcribed sequence.
To aid in identification of transformed plant cells, the constructs of this invention may be further manipulated to include plant selectable markers. Useful selectable markers include enzymes that provide for resistance to chemicals such as an antibiotic for example, gentamycin, hygromycin, kanamycin, or herbicides such as phosphinothrycin, glyphosate, chlorosulfuron, and the like. Similarly, enzymes providing for production of a compound identifiable by colour change such as GUS (beta-glucuronidase), or luminescence, such as luciferase or GFP, may be used.
Also considered part of this invention are transgenic plants, plant cells or seeds containing the chimeric gene construct of the present invention. Methods of regenerating whole plants from plant cells are also known in the art. In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques. Transgenic plants can also be generated without using tissue cultures.
Also considered part of this invention are transgenic plants, trees, yeast, bacteria, fungi, insect and animal cells containing the chimeric gene construct comprising a nucleic acid encoding recombinant, chimeric HA or HA0 for VLP production, in accordance with the present invention.
The regulatory elements of the present invention may also be combined with coding region of interest for expression within a range of host organisms that are amenable to transformation, or transient expression. Such organisms include, but are not limited to plants, both monocots and dicots, for example but not limited to corn, cereal plants, wheat, barley, oat, Nicotiana spp, Brassica spp, soybean, bean, pea, alfalfa, potato, tomato, ginseng, and Arabidopsis.
Methods for stable transformation, and regeneration of these organisms are established in the art and known to one of skill in the art. The method of obtaining transformed and regenerated plants is not critical to the present invention.
By “transformation” it is meant the interspecific transfer of genetic information (nucleotide sequence) that is manifested genotypically, phenotypically or both. The interspecific transfer of genetic information from a chimeric construct to a host may be heritable and the transfer of genetic information considered stable, or the transfer may be transient and the transfer of genetic information is not inheritable.
By the term “plant matter”, it is meant any material derived from a plant. Plant matter may comprise an entire plant, tissue, cells, or any fraction thereof. Further, plant matter may comprise intracellular plant components, extracellular plant components, liquid or solid extracts of plants, or a combination thereof. Further, plant matter may comprise plants, plant cells, tissue, a liquid extract, or a combination thereof, from plant leaves, stems, fruit, roots or a combination thereof. Plant matter may comprise a plant or portion thereof which has not been subjected to any processing steps. A portion of a plant may comprise plant matter. However, it is also contemplated that the plant material may be subjected to minimal processing steps as defined below, or more rigorous processing, including partial or substantial protein purification using techniques commonly known within the art including, but not limited to chromatography, electrophoresis and the like.
By the term “minimal processing” it is meant plant matter, for example, a plant or portion thereof comprising a protein of interest which is partially purified to yield a plant extract, homogenate, fraction of plant homogenate or the like (i.e. minimally processed). Partial purification may comprise, but is not limited to disrupting plant cellular structures thereby creating a composition comprising soluble plant components, and insoluble plant components which may be separated for example, but not limited to, by centrifugation, filtration or a combination thereof. In this regard, proteins secreted within the extracellular space of leaf or other tissues could be readily obtained using vacuum or centrifugal extraction, or tissues could be extracted under pressure by passage through rollers or grinding or the like to squeeze or liberate the protein free from within the extracellular space. Minimal processing could also involve preparation of crude extracts of soluble proteins, since these preparations would have negligible contamination from secondary plant products. Further, minimal processing may involve aqueous extraction of soluble protein from leaves, followed by precipitation with any suitable salt. Other methods may include large scale maceration and juice extraction in order to permit the direct use of the extract.
The plant matter, in the form of plant material or tissue may be orally delivered to a subject. The plant matter may be administered as part of a dietary supplement, along with other foods, or encapsulated. The plant matter or tissue may also be concentrated to improve or increase palatability, or provided along with other materials, ingredients, or pharmaceutical excipients, as required.
Examples of a subject or target organism that the VLPs of the present invention may be administered to include, but are not limited to, humans, primates, birds, water fowl, migratory birds, quail, duck, geese, poultry, chicken, swine, sheep, equine, horse, camel, canine, dogs, feline, cats, tiger, leopard, civet, mink, stone marten, ferrets, house pets, livestock, rabbits, mice, rats, guinea pigs or other rodents, seal, whale and the like. Such target organisms are exemplary, and are not to be considered limiting to the applications and uses of the present invention.
It is contemplated that a plant comprising the chimeric HA according to some embodiments of the invention, or expressing the VLP comprising the chimeric HA according to some embodiments of the invention, may be administered to a subject or target organism, in a variety of ways depending upon the need and the situation. For example, the chimeric HA obtained from the plant may be extracted prior to its use in either a crude, partially purified, or purified form. If the chimeric HA is to be at least partially purified, then it may be produced in either edible or non-edible plants. Furthermore, if the chimeric HA is orally administered, the plant tissue may be harvested and directly feed to the subject, or the harvested tissue may be dried prior to feeding, or an animal may be permitted to graze on the plant with no prior harvest taking place. It is also considered within the scope of this invention for the harvested plant tissues to be provided as a food supplement within animal feed. If the plant tissue is being feed to an animal with little or not further processing it is preferred that the plant tissue being administered is edible.
Post-transcriptional gene silencing (PTGS) may be involved in limiting expression of transgenes in plants, and co-expression of a suppressor of silencing from the potato virus Y (HcPro) may be used to counteract the specific degradation of transgene mRNAs (Brigneti et al., 1998). Alternate suppressors of silencing are well known in the art and may be used as described herein (Chiba et al., 2006, Virology 346:7-14; which is incorporated herein by reference), for example but not limited to, TEV-p1/HC-Pro (Tobacco etch virus-p1/HC-Pro), BYV-p21, p19 of Tomato bushy stunt virus (TBSV p19), capsid protein of Tomato crinkle virus (TCV-CP), 2b of Cucumber mosaic virus; CMV-2b), p25 of Potato virus X (PVX-p25), p11 of Potato virus M (PVM-p11), p11 of Potato virus S (PVS-p11), p16 of Blueberry scorch virus, (BScV-p16), p23 of Citrus tristeza virus (CTV-p23), p24 of Grapevine leafroll-associated virus-2, (GLRaV-2 p24), p10 of Grapevine virus A, (GVA-p10), p14 of Grapevine virus B (GVB-p14), p10 of Heracleum latent virus (HLV-p10), or p16 of Garlic common latent virus (GCLV-p16). Therefore, a suppressor of silencing, for example, but not limited to, HcPro, TEV-p1/HC-Pro, BYV-p21, TBSV p19, TCV-CP, CMV-2b, PVX-p25, PVM-p11, PVS-p11, BScV-p16, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10, may be co-expressed along with the nucleic acid sequence encoding the protein of interest to further ensure high levels of protein production within a plant.
Furthermore, VLPs produced as described herein do not comprise neuraminidase (NA). However, NA may be co-expressed with HA should VLPs comprising HA and NA be desired.
Therefore, the present invention further includes a suitable vector comprising the chimeric HA sequence suitable for use with either stable or transient expression systems. The genetic information may be also provided within one or more than one construct. For example, a nucleotide sequence encoding a protein of interest may be introduced in one construct, and a second nucleotide sequence encoding a protein that modifies glycosylation of the protein of interest may be introduced using a separate construct. These nucleotide sequences may then be co-expressed within a plant. However, a construct comprising a nucleotide sequence encoding both the protein of interest and the protein that modifies glycosylation profile of the protein of interest may also be used. In this case the nucleotide sequence would comprise a first sequence comprising a first nucleic acid sequence encoding the protein of interest operatively linked to a promoter or regulatory region, and a second sequence comprising a second nucleic acid sequence encoding the protein that modifies the glycosylation profile of the protein of interest, the second sequence operatively linked to a promoter or regulatory region.
By “co-expressed” it is meant that two, or more than two, nucleotide sequences are expressed at about the same time within the plant, and within the same tissue of the plant. However, the nucleotide sequences need not be expressed at exactly the same time. Rather, the two or more nucleotide sequences are expressed in a manner such that the encoded products have a chance to interact. For example, the protein that modifies glycosylation of the protein of interest may be expressed either before or during the period when the protein of interest is expressed so that modification of the glycosylation of the protein of interest takes place. The two or more than two nucleotide sequences can be co-expressed using a transient expression system, where the two or more sequences are introduced within the plant at about the same time under conditions that both sequences are expressed. Alternatively, a platform plant comprising one of the nucleotide sequences, for example the sequence encoding the protein that modifies the glycosylation profile of the protein of interest, may be transformed, either transiently or in a stable manner, with an additional sequence encoding the protein of interest. In this case, the sequence encoding the protein that modifies the glycosylation profile of the protein of interest may be expressed within a desired tissue, during a desired stage of development, or its expression may be induced using an inducible promoter, and the additional sequence encoding the protein of interest may be expressed under similar conditions and in the same tissue, to ensure that the nucleotide sequences are co-expressed.
The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, micro-injection, electroporation, infiltration, and the like. For reviews of such techniques see for example Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988); and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. D T. Dennis, D H Turpin, D D Lefebrve, D B Layzell (eds), Addison-Wesley, Langmans Ltd. London, pp. 561-579 (1997). Other methods include direct DNA uptake, the use of liposomes, electroporation, for example using protoplasts, micro-injection, microprojectiles or whiskers, and vacuum infiltration. See, for example, Bilang, et al. (Gene 100: 247-250 (1991), Scheid et al. (Mol. Gen. Genet. 228: 104-112, 1991), Guerche et al. (Plant Science 52: 111-116, 1987), Neuhause et al. (Theor. Appl Genet. 75: 30-36, 1987), Klein et al., Nature 327: 70-73 (1987); Howell et al. (Science 208: 1265, 1980), Horsch et al. (Science 227: 1229-1231, 1985), DeBlock et al., Plant Physiology 91: 694-701, 1989), Liu and Lomonossoff (J. Virol Meth, 105:343-348, 2002), U.S. Pat. Nos. 4,945,050; 5,036,006; 5,100,792; 6,403,865; 5,625,136, (all of which are hereby incorporated by reference).
Transient expression methods may be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343-348; which is incorporated herein by reference). Alternatively, a vacuum-based transient expression method, as described by Kapila et al. 1997 Plant Science 122:101-108 (incorporated herein by reference) may be used. These methods may include, for example, but are not limited to, a method of Agro-inoculation or Agro-infiltration, however, other transient methods may also be used as noted above. With either Agro-inoculation or Agro-infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enter the intercellular spaces of a tissue, for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant. After crossing the epidermis the Agrobacterium infect and transfer t-DNA copies into the cells. The t-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA inside the nucleus is transient.
The VLPs comprising chimeric HA provided by the present invention may be used in conjunction with an existing influenza vaccine, to supplement the vaccine, render it more efficacious, or to reduce the administration dosages necessary. As would be known to a person of skill in the art, the vaccine may be directed against one or more than one influenza virus. Examples of suitable vaccines include, but are not limited to, those commercially available from Sanofi-Pasteur, ID Biomedical, Merial, Sinovac, Chiron, Roche, MedImmune, GlaxoSmithKline, Novartis, Sanofi-Aventis, Serono, Shire Pharmaceuticals and the like.
If desired, the VLPs of the present invention may be admixed with a suitable adjuvant as would be known to one of skill in the art. Furthermore, the VLP may be used in a vaccine composition comprising an effective dose of the VLP for the treatment of a target organism, as defined above. Furthermore, the VLP produced according to the present invention may be combined with VLPs obtained using different influenza proteins, for example, neuraminidase (NA).
Therefore, the present invention provides a method for inducing immunity to influenza virus infection in an animal or target organism comprising administering an effective dose of a vaccine comprising one or more than one VLP. The vaccine may be administered orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
Compositions according to various embodiments of the invention may comprise VLPs of two or more influenza strains or subtypes. “Two or more” refers to two, three, four, five, six, seven, eight, nine, 10 or more strains or subtypes. The strains or subtypes represented may be of a single subtype (e.g. all H1N1, or all H5N1), or may be a combination of subtypes. Exemplary subtype and strains include H5/Indo, H1/Bri, H1/NC, H3/Bri, B/Flo. The choice of combination of strains and subtypes may depend on the geographical area of the subjects likely to be exposed to influenza, proximity of animal species to a human population to be immunized (e.g. species of waterfowl, agricultural animals such as swine, etc) and the strains they carry, are exposed to or are likely to be exposed to, predictions of antigenic drift within subtypes or strains, or combinations of these factors. Examples of combinations used in past years are available in the databases maintained by the World Health Organization (WHO) (see URL: who.int/csr/dieease/influenza/vaccine recommendations1/en).
The two or more VLPs may be expressed individually, and the purified or semi-purified VLPs subsequently combined. Alternately, the VLPs may be co-expressed in the same host, for example a plant, portion of plant, or plant cell. The VLPs may be combined or produced in a desired ratio, for example about equivalent ratios, or may be combined in such a manner that one subtype or strain comprises the majority of the VLPs in the composition.
Therefore, the invention provides for compositions comprising VLPs of two or more strains or subtypes.
Also provided is an article of manufacture, comprising packaging material and a composition comprising a VLP comprising a chimeric HA. The composition includes a physiologically or pharmaceutically acceptable excipient, and the packaging material may include a label which indicates the active ingredients of the composition (e.g. the VLP).
A kit comprising a composition comprising a nucleic acid encoding a chimeric HA as provided herein, along with instructions for use of the nucleic acid for production of chimeric HA, or VLPs comprising the chimeric HA is also provided. The kit may be useful for production of VLPs comprising the chimeric HA, and the instructions may include, for example, information on expressing the nucleic acid in a plant or a plant cell, instructions for harvesting and obtaining the VLPs from the plant or plant tissue.
In another embodiment, a kit for the preparation of a medicament, comprising a VLP comprising a chimeric HA, along with instructions for its use is provided. The instructions may comprise a series of steps for the preparation of the medicament, the medicament being useful for inducing a therapeutic or prophylactic immune response in a subject to whom it is administered. The kit may further comprise instructions addressing dose concentrations, dose intervals, preferred administration methods or the like.
The present invention will be further illustrated in the following examples. However it is to be understood that these examples are for illustrative purposes only, and should not be used to limit the scope of the present invention in any manner.
The sequences described herein are summarized below.
Methods and Materials
1. Assembly of HA Expression Cassettes
A—pCAMBIAPlasto
All manipulations were done using the general molecular biology protocols of Sambrook and Russell (2001; which is incorporated herein by reference). Table 1 presents oligonucleotide primers used for expression cassettes assembly. The first cloning step consisted in assembling a receptor plasmid containing upstream and downstream regulatory elements of the alfalfa plastocyanin gene. The plastocyanin promoter and 5′UTR sequences were amplified from alfalfa genomic DNA using oligonucleotide primers XmaI-pPlas.c (SEQ ID NO:1) and SacI-ATG-pPlas.r (SEQ ID NO:2). The resulting amplification product was digested with XmaI and SacI and ligated into pCAMBIA2300 (Cambia, Canberra, Australia), previously digested with the same enzymes, to create pCAMBIApromoPlasto. Similarly, the 3′UTR sequences and terminator of the plastocyanin gene was amplified from alfalfa genomic DNA using the following primers: SacI-PlasTer.c (SEQ ID NO:3) and EcoRI-PlasTer.r (SEQ ID NO:4), and the product was digested with SacI and EcoRI before being inserted into the same sites of pCAMBIApromoPlasto to create pCAMBIAPlasto.
B—Plasto-Native SP-H5 A/Indonesia/5/05 (Construct Number 660)
A fragment encoding hemagglutinin from influenza strain A/Indonesia/5/05 (H5N1; Acc. No. LANL ISDN125873) was synthesized by Epoch Biolabs (Sugar Land, Tex., USA). The fragment produced, containing the complete H5 coding region including the native signal peptide flanked by a HindIII site immediately upstream of the initial ATG, and a SacI site immediately downstream of the stop (TAA) codon, is presented in (SEQ ID NO:52;
C—Plasto-PDI SP-H1 A/New Caledonia/20/99 (Construct Number 540)
The open reading frame from the H1 gene of influenza strain A/New Caledonia/20/99 (H1N1) was synthesized in two fragments (Plant Biotechnology Institute, National Research Council, Saskatoon, Canada). A first fragment synthesized corresponds to the wild-type H1 coding sequence (GenBank acc. No. AY289929; SEQ ID NO: 54;
The first H1 fragment was digested with BglII and SacI and cloned into the same sites of a binary vector (pCAMBIAPlasto) containing the plastocyanin promoter and 5′ UTR fused to the signal peptide of alfalfa protein disulfide isomerase (PDI) gene (nucleotides 32-109; Accession No. Z11499; SEQ ID NO: 57;
D—Plasto-Native SP-H1 A/Brisbane/59/07 (Construct Number 774)
Expression cassette number 774, driving the expression of H1 from A/Brisbane/59/07, was assembled as follows. A synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3′ by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the plastocyanin ATG starting with a DraIII restriction site. The synthetic fragments also comprised a SacI site immediately downstream of the stop codon.
The synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The fragment synthesized is presented in SEQ ID NO. 60 (
E—CPMV HT-LC CM (Construct Number 828)
CPMV-HT expression cassettes use the 35S promoter to control the expression of an mRNA comprising a coding sequence of interest flanked, in 5′, by nucleotides 1-512 from the Cowpea mosaic virus (CPMV) RNA2 with mutated ATG at positions 115 and 161, and in 3′, by nucleotides 3330-3481 from the CPMV RNA2 (corresponding to the 3′ UTR) followed by the NOS terminator. Plasmid pBD-C5-1LC, (Sainsbury et al. 2008; Plant Biotechnology Journal 6: 82-92 and PCT Publication WO 2007/135480), was used for the assembly of CPMV-HT-based hemagglutinin expression cassettes. The mutation of ATGs at position 115 and 161 of the CPMV RNA2 was done using a PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Two separate PCRs were performed using pBD-C5-1LC as template. The primers for the first amplification were pBinPlus.2613c (SEQ ID NO: 9) and Mut-ATG115.r (SEQ ID NO: 10). The primers for the second amplification were Mut-ATG161.c (SEQ ID NO: 11) and LC-C5-1.110r (SEQ ID NO: 12). The two fragments obtained were mixed and used as template for a third amplification using pBinPlus.2613c (SEQ ID NO: 9) and LC-C5-1.110r (SEQ ID NO: 12) as primers. The resulting fragment was digested with PacI and ApaI and cloned into pBD-C5-1LC digested with the same enzymes. The construct generated, named 828, is presented in
F—H1 A/Brisbane/59/07 Receptor-Binding (RB) Domain in H5 A/Indonesia/5/05 Backbone (Construct Number 690)
A chimeric HA was made by replacing the RB domain in the H5 A/Indonesia/5/05 with that of H1 A/Brisbane/59/07 using the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a segment of the plastocyanin promoter fused to the natural signal peptide, the F′1 and E1 domains of the H5 A/Indonesia/5/05 was amplified using primers Plasto-443c (SEQ ID NO: 5) and E1 H1B-E1 H5I.r (SEQ ID NO:13) with construct number 660 (SEQ ID NO:53,
G—H1 A/Brisbane/59/07 Esterase and Receptor-Binding Domains (E1-RB-E2) in H5 A/Indonesia/5/05 Backbone (Construct Number 691)
A chimeric HA was assembled by replacing the E1-RB-E2 domains in H5 A/Indonesia/5/05 with those of H1 A/Brisbane/59/07 using the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a segment of the plastocyanin promoter fused to the natural signal peptide and the F′1 domain of H5 A/Indonesia/5/05 was amplified using primers Plasto-443c (SEQ ID NO:5) and E1 H1B-F′1 H5I.r (SEQ ID NO: 17) with construct number 660 (SEQ ID NO: 53;
H—H5 A/Indonesia/5/05 Receptor-Binding (RB) Domain in H1 A/New Caledonia/20/99 Backbone (Construct Number 696)
A chimeric HA was made by replacing the RB domain in the H1 A/New Caledonia/20/99 with that of H5 A/Indonesia/5/05 using the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a segment, of the plastocyanin promoter fused to the signal peptide of alfalfa protein disulfide isomerase (PDISP; Accession No. Z11499; nucleotides 32-109 of SEQ ID NO: 57;
I—Assembly of H1 A/Brisbane/59/2007 in CPMV-HT Expression Cassette (Construct Number 732).
The coding sequence of HA from H1 A/Brisbane/59/2007 was cloned into CPMV-HT as follows. Restriction sites ApaI (immediately upstream of ATG) and StuI (immediately downstream of the stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with primers ApaI-H1B.c (SEQ ID NO: 26) and StuI-H1B.r (SEQ ID NO: 27) using construct number 774 (SEQ ID NO: 61;
J—Assembly of SpPDI-H1 A/Brisbane/59/2007 in CPMV-HT Expression Cassette (Construct Number 733).
A sequence encoding the signal peptide of alfalfa protein disulfide isomerase (PDISP; nucleotides 32-109 of SEQ ID NO: 57
K—Assembly of H1 A/Brisbane/59/07 Receptor-Binding (RB) Domain in H5 A/Indonesia/5/05 Backbone in CPMV-HT Expression Cassette (Construct Number 734).
The coding sequence of chimeric HA consisting in RB domain from H1 A/Brisbane/59/07 in H5 A/Indonesia/5/05 backbone was cloned into CPMV-HT as follows. Restriction sites ApaI (immediately upstream of ATG) and StuI (immediately downstream of the stop codon) were added to the chimeric hemagglutinin coding sequence by performing a PCR amplification with primers ApaI-H5 (A-Indo).1c (SEQ ID NO: 31) and H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32) using construct number 690 (SEQ ID NO: 63;
L—Assembly of SpPDI-H3 A/Brisbane/10/2007 in CPMV-HT Expression Cassette (Construct Number 736).
A sequence encoding alfalfa PDI signal peptide fused to HA0 from H3 A/Brisbane/10/2007 was cloned into CPMV-HT as follows. First, a synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3′ by alfalfa plastocyanin gene sequence corresponding to the first 84 nucleotides (starting with a DraIII restriction site) upstream of the plastocyanin ATG. The synthetic fragment also comprised a SacI site immediately after the stop codon. Synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The fragment synthesized is presented in SEQ ID NO: 70 (
Second, the signal peptide of alfalfa protein disulfide isomerase (PDISP) (nucleotides 32-109; Accession No Z11499; SEQ ID NO: 57;
M—Assembly of Chimeric SpPDI-H3 A/Brisbane/10/2007 (Ectodomain)+H5 A/Indonesia/5/2005 (TmD+Cyto Tail) in CPMV-HT Expression Cassette (Construct Number 737).
A sequence encoding alfalfa PDI signal peptide fused to the ectodomain of H3 A/Brisbane/10/2007 and to the transmembrane and cytoplasmic domains of H5 A/Indonesia/5/2005 was cloned into CPMV-HT as follows. PDISP-H3 coding sequence was fused to the H5 transmembrane domain by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a fragment comprising PDISP signal peptide and ectodomain from H3 Brisbane was generated by amplification (with ApaI restriction site upstream of the PDISP initial ATG) using primers ApaI-SpPDI.c (SEQ ID NO: 30) and TmD H5I-H3B.r (SEQ ID NO: 36) with construct number 736 (SEQ ID NO: 71;
N—Assembly of SpPDI-HA B/Florida/4/2006 in CPMV-HT Expression Cassette (Construct Number 739).
A sequence encoding alfalfa PDI signal peptide fused to HA0 from HA B/Florida/4/2006 was cloned into CPMV-HT as follows. First, a synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3′ by alfalfa plastocyanin gene sequence corresponding to the first 84 nucleotides (starting with a DraIII restriction site) upstream of the plastocyanin ATG. The synthetic fragment also comprised a SacI restriction site immediately after the stop codon. The synthetic fragment was synthesized by Epoch Biolabs (Sugar Land, Tex., USA). The fragment synthesized is presented in SEQ ID NO: 73 (
Second, the signal peptide of alfalfa protein disulfide isomerase (PDISP) (nucleotides 32-109 of SEQ ID NO: 57;
O—Assembly of Chimeric SpPDI-HA B/Florida/4/2006 (Ectodomain)+H5 A/Indonesia/5/2005 (TmD+Cyto Tail) in CPMV-HT Expression Cassette (Construct Number 745).
A sequence encoding alfalfa PDI signal peptide fused to the ectodomain from HA B/Florida/4/2006 and to the transmembrane and cytoplasmic domains of H5 A/Indonesia/5/2005 was cloned into CPMV-HT as follows. PDISP-B/Florida/4/2006 ectodomain coding sequence was fused to the H5 transmembrane and cytoplasmic domains by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a fragment comprising PDISP signal peptide fused to the ectodomain from HA B/Florida/4/2006 was generated by amplification using primers ApaI-SpPDI.c (SEQ ID NO: 30) and TmD H5I-B Flo.r (SEQ ID NO: 41) with construct number 739 (SEQ ID NO: 74;
P—Assembly of Chimeric SpPDI-HA B/Florida/4/2006+H5 A/Indonesia/5/2005 (TmD+Cyto Tail) in 2X35S-CPMV-HT Expression Cassette (Construct Number 747).
A sequence encoding alfalfa PDI signal peptide fused to HA0 from HA B/Florida/4/2006 and to the transmembrane and cytoplasmic domain of H5 A/Indonesia/5/2005 was cloned into 2X35S-CPMV-HT as follows. The promoter switch was performed using the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). A first fragment containing 2X35S promoter (SEQ ID NO: 88;
using a plasmid containing the 2X35S promoter as template. In parallel, a second PCR was performed using primers 2X35S-CPMV 5′UTR.c (SEQ ID NO: 91) and ApaI-M prot.r (SEQ ID NO: 92):
TTGGAGAGG
TATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTGGG
using construct 745 (SEQ ID NO 75;
2. Assembly of Chaperone Expression Cassettes
Two heat shock protein (Hsp) expression cassettes were assembled. In a first cassette, expression of the Arabidopsis thaliana (ecotype Columbia) cytosolic HSP70 (Athsp70-1 in Lin et al. (2001) Cell Stress and Chaperones 6: 201-208) is controlled by a chimeric promoter combining elements of the alfalfa Nitrite reductase (Nir) and alfalfa Plastocyanin promoters (Nir/Plasto). A second cassette comprising the coding region of the alfalfa cytosolic HSP40 (MsJ1; Frugis et al. (1999) Plant Molecular Biology 40: 397-408) under the control of the chimeric Nir/Plasto promoter was also assembled.
An acceptor plasmid containing the alfalfa Nitrite reductase promoter (Nir), the GUS reporter gene and NOS terminator in plant binary vector was first assembled. Plasmid pNir3K51 (previously described in U.S. Pat. No. 6,420,548) was digested with HindIII and EcoRI. The resulting fragment was cloned into pCAMBIA2300 (Cambia, Canberra, Australia) digested by the same restriction enzyme to give pCAMBIA-Nir3K51.
Coding sequences for Hsp70 and Hsp40 were cloned separately in the acceptor plasmid pCAMBIANir3K51 by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26:77-85 (1995)).
For Hsp40, Msj1 coding sequence (SEQ ID NO: 76;
A dual Hsp expression plasmid was assembled as follows. R860 (SEQ ID NO: 78;
3. Assembly of Other Expression Cassettes
HcPro Expression Cassette
An HcPro construct (35HcPro) was prepared as described in Hamilton et al. (2002). All clones were sequenced to confirm the integrity of the constructs. The plasmids were used to transform Agrobacteium tumefaciens (AGL1; ATCC, Manassas, Va. 20108, USA) by electroporation (Mattanovich et al., 1989). The integrity of all A. tumefaciens strains were confirmed by restriction mapping.
P19 Expression Cassette
The coding sequence of p19 protein of tomato bushy stunt virus (TBSV) was linked to the alfalfa plastocyanin expression cassette by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)). In a first round of PCR, a segment of the plastocyanin promoter was amplified using primers Plasto-443c (SEQ ID NO: 5) and supP19-plasto.r (SEQ ID NO: 49) with construct 660 (SEQ ID NO: 53) as template. In parallel, another fragment containing the coding sequence of p19 was amplified with primers supP19-1c (SEQ ID NO: 50) and SupP19-SacI.r (SEQ ID NO: 51) using construct 35S:p19 as described in Voinnet et al. (The Plant Journal 33: 949-956 (2003)) as template. Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Plasto-443c (SEQ ID NO: 5) and SupP19-SacI.r (SEQ ID NO: 51). The resulting fragment was digested with BamHI (in the plastocyanin promoter) and SacI (at the end of the p19 coding sequence) and cloned into construct number 660 (SEQ ID NO: 53;
Construct Number 443
Construct number 443 corresponds to pCAMBIA2300 (empty vector).
TTAATCATCTTGAGAGAAAATGGAGAAAATAGTGCTTCTTCTTGC
TTGGAGAGG
TATTAAAATCTTAATAGGTTTTGATAAAAGCGAACGTG(
Agrobacterium strains used for expression of influenza
4. Preparation of Plant Biomass, Inoculum, Agroinfiltration, and Harvesting
Nicotiana benthamiana plants were grown from seeds in flats filled with a commercial peat moss substrate. The plants were allowed to grow in the greenhouse under a 16/8 photoperiod and a temperature regime of 25° C. day/20° C. night. Three weeks after seeding, individual plantlets were picked out, transplanted in pots and left to grow in the greenhouse for three additional weeks under the same environmental conditions. Prior to transformation, apical and axillary buds were removed at various times as indicated below, either by pinching the buds from the plant, or by chemically treating the plant
Agrobacteria transfected with each construct were grown in a YEB medium supplemented with 10 mM 2-[N-morpholino]ethanesulfonic acid (MES), 20 μM acetosyringone, 50 μg/ml kanamycin and 25 μg/ml of carbenicillin pH5.6 until they reached an OD600 between 0.6 and 1.6. Agrobacterium suspensions were centrifuged before use and resuspended in infiltration medium (10 mM MgCl2 and 10 mM MES pH 5.6). Syringe-infiltration was performed as described by Liu and Lomonossoff (2002, Journal of Virological Methods, 105:343-348). For vacuum-infiltration, A. tumefaciens suspensions were centrifuged, resuspended in the infiltration medium and stored overnight at 4° C. On the day of infiltration, culture batches were diluted in 2.5 culture volumes and allowed to warm before use. Whole plants of N. benthamiana or N. tabacum were placed upside down in the bacterial suspension in an air-tight stainless steel tank under a vacuum of 20-40 Torr for 2-min. Following syringe or vacuum infiltration, plants were returned to the greenhouse for a 4-5 day incubation period until harvest. Unless otherwise specified, all infiltrations were performed as co-infiltration with AGL1/35S-HcPro in a 1:1 ratio, except for CPMV-HT cassette-bearing strains which were co-infiltrated with strain AGL1/R472 in a 1:1 ratio.
5. Leaf Sampling and Total Protein Extraction
Following incubation, the aerial part of plants was harvested, frozen at −80° C., crushed into pieces. Total soluble proteins were extracted by homogenizing (Polytron) each sample of frozen-crushed plant material in 3 volumes of cold 50 mM Tris pH 8, 0.15 M NaCl, 0.04% sodium metabisulfite and 1 mM phenylmethanesulfonyl fluoride. After homogenization, the slurries were centrifuged at 20,000 g for 20 min at 4° C. and these clarified crude extracts (supernatant) kept for analyses. The total protein content of clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, Calif.) using bovine serum albumin as the reference standard.
6. Protein Analysis and Immunoblotting
Protein concentrations were determined by the BCA protein assay (Pierce Biochemicals, Rockport Ill.). Proteins were separated by SDS-PAGE under reducing conditions and stained with Coomassie Blue. Stained gels were scanned and densitometry analysis performed using ImageJ Software (NIH).
Proteins from elution fraction from SEC were precipitated with acetone (Bollag et al., 1996), resuspended in ⅕ volume in equilibration/elution buffer and separated by SDS-PAGE under reducing conditions and electrotransferred onto polyvinylene difluoride (PVDF) membranes (Roche Diagnostics Corporation, Indianapolis, Ind.) for immunodetection. Prior to immunoblotting, the membranes were blocked with 5% skim milk and 0.1% Tween-20 in Tris-buffered saline (TBS-T) for 16-18 h at 4° C.
Immunoblotting was performed by incubation with a suitable antibody (Table 6), in 2 μg/ml in 2% skim milk in TBS-Tween 20 0.1%. Secondary antibodies used for chemiluminescence detection were as indicated in Table 4, diluted as indicated in 2% skim milk in TBS-Tween 20 0.1%. Immunoreactive complexes were detected by chemiluminescence using luminol as the substrate (Roche Diagnostics Corporation). Horseradish peroxidase-enzyme conjugation of human IgG antibody was carried out by using the EZ-Link Plus® Activated Peroxidase conjugation kit (Pierce, Rockford, Ill.). Whole inactivated virus (WIV), used as controls of detection for H1, H3 and B subtypes, were purchased from National Institute for Biological Standards and Control (NIBSC).
7. Clarification and Concentration Prior to SEC
To improve resolution and increase signal in elution fractions, extracts to be loaded on size exclusion chromatography, crude protein extracts were clarified and concentrated using the following method. Extracts were centrifuged at 70 000 g, 4° C. for 20 min and the pellet was washed twice by resuspension in 1 volume (compared to the initial extract volume) of extraction buffer (50 mM Tris pH 8, 0.15 M NaCl) and centrifugation at 70 000 g, 4° C. for 20 min. The resulting pellet was resuspended in ⅓ volume (compared to the initial extract volume) and proteins (including VLPs) were precipitated by the addition of 20% (w/v) PEG 3350 followed by incubation on ice for 1 h. Precipitated proteins were recovered by centrifugation at 10 000 g, 4° C., 20 min, and resuspended in 1/15 volume (compared to the initial extract volume) of extraction buffer. After complete resuspension of proteins, a final centrifugation at 20 000 g, 4° C., 5 min was performed to pellet insolubles and the clear supernatant was recovered.
8. Size Exclusion Chromatography of Protein Extract
Size exclusion chromatography (SEC) columns of 32 ml Sephacryl™ S-500 high resolution beads (S-500 HR: GE Healthcare, Uppsala, Sweden, Cat. No. 17-0613-10) were packed and equilibrated with equilibration/elution buffer (50 mM Tris pH8, 150 mM NaCl). One and a half milliliter of crude protein extract was loaded onto the column followed by an elution step with 45 mL of equilibration/elution buffer. The elution was collected in fractions of 1.5 mL relative protein content of eluted fractions was monitored by mixing 10 μL of the fraction with 200 μL of diluted Bio-Rad protein dye reagent (Bio-Rad, Hercules, Calif. The column was washed with 2 column volumes of 0.2N NaOH followed by 10 column volumes of 50 mM Tris pH8, 150 mM NaCl, 20% ethanol. Each separation was followed by a calibration of the column with Blue Dextran 2000 (GE Healthcare Bio-Science Corp., Piscataway, N.J., USA). Elution profiles of Blue Dextran 2000 and host soluble proteins were compared between each separation to ensure uniformity of the elution profiles between the columns used.
The RB subdomain of H5/Indo may be replaced by an RB subdomain of H1, H3 or B HA. The resulting chimeric HA provides an SDC H5/Indo to form VLPs and present the RB subdomain comprising immunogenic sites of H1, H3 or B. The H5/Indo RB subdomain may be inserted on an H1 stem (H1/NC).
Amino acids 1-92 of SEQ ID NO: 105 are an F′1+E1 domain of H5/Indo; amino acids 93-259 are the RB head domain of H3/Brisbane; amino acids 260-548 are the E2+F′2 domain of H5/Indo.
Amino acids 1-92 of SEQ ID NO: 106 are an F′1+E1 domain of H5/Indo; amino acids 93-276 are the RB head domain of B/Florida; amino acids 277-565 are the E2+F′2 domain of H5/Indo.
Amino acids 1-42 of SEQ ID NO: 107 are an N terminal F′1 domain of H5/Indo; amino acids 43-228 are the E1-RB-E2 head domain of H3/Brisbane; amino acids 229-507 are the F′2 domain of H5/Indo.
Amino acids 1-42 of SEQ ID NO: 108 are an N terminal F′1 domain of H5/Indo; amino acids 43-281 are the E1-RB-E2 head domain of B/Florida; amino acids 282-556 are the F′2 domain of H5/Indo.
Amino acids 1-42 of SEQ ID NO: 109 are an N terminal F′1 domain of H1/NC; amino acids 43-273 are the E1-RB-E2 head domain of H5/Indo; amino acids 274-548 are the F′2 domain of H1/NC.
The fusion points for the various chimeras were selected so as to be as close to (but not necessarily directly at) the N and C termini of the various subdomains—without wishing to be bound by theory, these fusions were selected so as to maximize the stability of the chimeric HA. For example, structure and sequence conservation is observed at the N-terminus of the RB subdomain (Ha et al. 2002, EMBO J. 21:865-875; which is incorporated herein by reference). A less variable region in the primary sequence is found at the C-F/Y-P triad located at approximately 15 amino acids before, in the E1 subdomain. This cysteine is involved in disulfide bridge #3, which is conserved among HAs (see
The E1-RB-E2 subdomains of a first influenza type were replaced by E1-RB-E2 subdomains of a second influenza type. Such an arrangement may present a greater number of amino acids of the second type at the surface of the H5-VLP. In this example, the HDC of H1, H3 or B was placed on an H5/Indo SDC, and an HDC of H5/Indo on an H1/NC SDC (Table 5).
The junction of the HDC was defined with a conserved cysteine residue (comprising disulfide bridge #6 of HA type A and #7 in HA type B). The junction of the HDC at the C-terminus of the E2 subdomain was defined with another conserved cysteine residue comprising disulfide bridge #6 (the second amino acid of the F′2 subdomain) of influenza type H1 or H3 on an SDC of H5/Indo or for influenza type H5 on an SDC of H1. For the influenza B chimera, the junction was established the connection at the first Cysteine comprising of disulfide bridge #4 (located 4 amino acids away on the F′2 subdomain, and conserved among the HAs). The resulting chimeras do not exhibit any alteration in disulfide bridge patterns—the H1/H3/H5 hybrid HAs will contain 6 disulfide bridges and the B hybrid will have 7 of them.
To combine the high accumulation level of VLPs from H5 A/Indonesia/5/05 with the antigenicity characteristics of H1 A/Brisbane/59/2007, chimeric hemagglutinins were designed comprising domains from H1 A/Brisbane/59/2007 fused to an H5 A/Indonesia/5/05 stem domain cluster. Expression cassettes for the expression of the H5/H1 hemagglutinin fusions are represented in
To compare the accumulation level of H5/H1 chimeric hemagglutinins with that of their native forms, Nicotiana benthamiana plants were infiltrated with AGL1/774, AGL1/691 and AGL1/690, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-HA monoclonal antibodies. A unique band of approximately 75 kDa (
The fusion of the receptor-binding region from H1 A/Brisbane/59/2007 to the H5 A/Indonesia/5/05 backbone as a method of increasing accumulation of H1 antigen-presenting VLPs in plants was re-evaluated under the control of a strong CPMV-HT-based expression cassette. This fusion strategy was also compared to signal peptide replacement as mean of increasing accumulation level. Expression cassettes for the expression of the H5/H1 hemagglutinin fusions under CPMV-HT are represented in
Nicotiana benthamiana plants were infiltrated with AGL1/732, AGL1/733 or AGL1/734, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, protein were first extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-H1 (Brisbane) polyclonal antibodies. A unique band of approximately 75 kDa (
Use of an H1 backbone (from A/New Caledonia/20/99) for the presentation of H5 antigenic region was also evaluated. Expression cassettes for the expression of the H1/H5 hemagglutinin fusion are represented in
To compare the accumulation level of H1/H5 chimeric hemagglutinin with that of its native form, Nicotiana benthamiana plants were infiltrated with AGL1/660 and AGL1/696, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-H5 (Indonesia) polyclonal antibodies. A unique band of approximately 75 kDa (
The fusion of the ectodamain from H3 A/Brisbane/10/2007 or B Florida/4/2006 to the transmembrane and cytoplasmic subdomains from H5 A/Indonesia/5/05 was evaluated as a strategy to present hemagglutinin antigenic regions from H3 and B strains while increasing their accumulation level in plants. Expression cassettes for the expression of the H5/H3 and H5/B hemagglutinin fusions are represented in
Accumulation level of H5/B chimeric hemagglutinin (745) was compared with that of native HA B (739) in Nicotiana benthamiana plants. Plants were infiltrated with AGL1/739 and AGL1/745, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were first extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies. A unique band of approximately 75 kDa (
Similarly, accumulation level of H5/H3 chimeric hemagglutinin (737) was compared with that of its native form (736) in Nicotiana benthamiana plants. Plants were infiltrated with AGL1/736 and AGL1/737, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-H3 (Brisbane) polyclonal antibodies. A unique band of approximately 75 kDa (
The production of VLPs from expression of the H5/B chimeric hemagglutinin (construct no. 745) was evaluated using size exclusion chromatography. Concentrated protein extracts from AGL1/745-infiltrated plants (1.5 mL) were fractionated by size exclusion chromatography (SEC) on Sephacryl™ S-500 HR columns (GE Healthcare Bio-Science Corp., Piscataway, N.J., USA). As shown in
Expression of Hsp40 and Hsp70 in plants and co-expression with influenza hemagglutinins is described in co-pending application PCT/CA2009/000032. Cytosolic Hsp70 and Hsp40 (construct number R870) of plant origin may also be co-expressed with chimeric hemagglutinins, to increase their accumulation level in plants. The co-expression may be performed by agroinfiltration of N. benthamiana plants with a bacterial suspension containing a mixture (1:1:1 ratio) of AGL1 bearing the cassette for the expression of the desired chimeric HA with AGL1/R870 and AGL1/35SHcPro.
Accumulation level of H5/B chimeric hemagglutinin (B/Flo HDC and SDC fused with an H5/Indo TDC) was evaluated in co-expression with HSP40 and HSP70 in Nicotiana benthamiana plants. Plants were infiltrated with AGL1/747, AGL1/747+AGL1/443 (empty vector) or AGL1/747+AGL1/R870 (HSP40/HSP70), and the leaves were harvested after a six-day incubation period. To determine the accumulation level of H5/B chimeric HA in the agroinfiltrated leaves, proteins were first extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies. A unique band of approximately 75 kDa (
All citations are herein incorporated by reference, as if each individual publication was specifically and individually indicated to be incorporated by reference herein and as though it were fully set forth herein. Citation of references herein is not to be construed nor considered as an admission that such references are prior art to the present invention.
In the description a number of terms are used extensively and definitions are provided to facilitate understanding of various aspects of the invention. Use of examples in the specification, including examples of terms, is for illustrative purposes only and is not intended to limit the scope and meaning of the embodiments of the invention herein. Numeric ranges are inclusive of the numbers defining the range. In the specification, the word “comprising” is used as an open-ended term, substantially equivalent to the phrase “including, but not limited to,” and the word “comprises” has a corresponding meaning.
One or more currently preferred embodiments of the invention have been described by way of example. The invention includes all embodiments, modifications and variations substantially as hereinbefore described and with reference to the examples and figures. It will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims. Examples of such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way.
This application claims priority from U.S. Provisional Application No. 61/220,161 filed Jun. 24, 2009.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA2010/000983 | 6/25/2010 | WO | 00 | 4/17/2012 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2010/148511 | 12/29/2010 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5232833 | Sanders et al. | Aug 1993 | A |
| 5486510 | Bouic et al. | Jan 1996 | A |
| 5762939 | Smith et al. | Jun 1998 | A |
| 5858368 | Smith et al. | Jan 1999 | A |
| 5958422 | Lomonossoff | Sep 1999 | A |
| 6020169 | Lee et al. | Feb 2000 | A |
| 6042832 | Koprowski et al. | Mar 2000 | A |
| 6284875 | Turpen et al. | Sep 2001 | B1 |
| 6287570 | Foley | Sep 2001 | B1 |
| 6326470 | Cosgrove | Dec 2001 | B1 |
| 6489537 | Rea et al. | Dec 2002 | B1 |
| 6867293 | Andrews et al. | Mar 2005 | B2 |
| 7125978 | Vezina et al. | Oct 2006 | B1 |
| 7132291 | Cardineau et al. | Nov 2006 | B2 |
| 7763450 | Robinson et al. | Jul 2010 | B2 |
| 8124103 | Yusibov et al. | Feb 2012 | B2 |
| 8519113 | Lomonossoff | Aug 2013 | B2 |
| 8697088 | Smith et al. | Apr 2014 | B2 |
| 8771703 | Couture et al. | Jul 2014 | B2 |
| 9546375 | Couture et al. | Jan 2017 | B2 |
| 20010006950 | Punnonen et al. | Jul 2001 | A1 |
| 20030079248 | Mason et al. | Apr 2003 | A1 |
| 20040002061 | Kawaoka | Jan 2004 | A1 |
| 20050048074 | Cardineau et al. | Mar 2005 | A1 |
| 20050223430 | Bakker et al. | Oct 2005 | A1 |
| 20060252132 | Yang et al. | Nov 2006 | A1 |
| 20070286873 | Williams et al. | Dec 2007 | A1 |
| 20080008725 | Weeks-Levy et al. | Jan 2008 | A1 |
| 20080057538 | Belyaev | Mar 2008 | A1 |
| 20090311669 | Kawaoka | Dec 2009 | A1 |
| 20100143406 | Smith et al. | Jun 2010 | A1 |
| 20100167376 | Hogan et al. | Jul 2010 | A1 |
| 20100239610 | D'Aoust et al. | Sep 2010 | A1 |
| 20100310604 | D'Aoust et al. | Dec 2010 | A1 |
| 20110191915 | Couture et al. | Aug 2011 | A1 |
| 20110293650 | D'Aoust et al. | Dec 2011 | A1 |
| 20120189658 | Couture et al. | Jul 2012 | A1 |
| Number | Date | Country |
|---|---|---|
| 2 693 956 | Jan 2009 | CA |
| 2615 372 | Jan 2009 | CA |
| 2 707 235 | Jun 2009 | CA |
| 5551780 | Jul 2014 | JP |
| 598508 | Feb 2014 | NZ |
| WO 8603224 | Jun 1986 | WO |
| WO 0056906 | Sep 2000 | WO |
| WO 02074795 | Sep 2002 | WO |
| WO 03068163 | Aug 2003 | WO |
| WO 03068923 | Aug 2003 | WO |
| WO 03068993 | Aug 2003 | WO |
| WO 2004003207 | Jan 2004 | WO |
| WO 2004098530 | Nov 2004 | WO |
| WO 2004098533 | Nov 2004 | WO |
| WO 2005020889 | Mar 2005 | WO |
| WO 2006119516 | Nov 2006 | WO |
| WO 2007011904 | Jan 2007 | WO |
| WO 2007019094 | Feb 2007 | WO |
| WO 2007047831 | Apr 2007 | WO |
| WO 2007095318 | Aug 2007 | WO |
| WO 2007130327 | Nov 2007 | WO |
| WO 2008005777 | Jan 2008 | WO |
| WO 2008054540 | May 2008 | WO |
| WO 2008060669 | May 2008 | WO |
| WO 2008061243 | May 2008 | WO |
| WO 2008087391 | Jul 2008 | WO |
| WO 2008148104 | Dec 2008 | WO |
| WO 2008151440 | Dec 2008 | WO |
| WO 2009008573 | Jan 2009 | WO |
| WO 2009009876 | Jan 2009 | WO |
| WO 2009026397 | Feb 2009 | WO |
| WO 2009076778 | Jun 2009 | WO |
| WO 2009087391 | Jul 2009 | WO |
| WO 2010003225 | Jan 2010 | WO |
| WO 2010006452 | Jan 2010 | WO |
| WO 2010025285 | Mar 2010 | WO |
| WO 2010077712 | Jul 2010 | WO |
| WO 2011035423 | Mar 2011 | WO |
| Entry |
|---|
| Horimoto et al (Journal of Virology, 77(14), pp. 8031-8038, 2003). |
| Kaverin et al (J. of Virol, 78(1), pp. 240-249, 2004). |
| Doyle et al (JCB, 103, pp. 1193-1204, 1986). |
| Chen et al (J. Virol. 81(13), pp. 7111-7123, 2007); cited on IDS. |
| Gomord et al (TRENDS in Biotechnology, 23(11), pp. 559-565, 2005). |
| Giddings et al (Nature Biotechnology, 18, pp. 1151-1155, 2000). |
| Copeland et al (J. Virol., 79(10), pp. 6549-6471, 2005). |
| Yang et al (Science, 317(5839), pp. 8250828, 2007). |
| Wang et al (J. Virol., 2007, 81(20): 10869-10878). |
| Horimoto et al (Microbes and Infection, 2004, 6(6): 579-583). |
| Spitsin et al (Vaccine, 27, pp. 1289-1292, 2009; cited on IDS dated Dec. 31, 2014). |
| Li et al (Journal of Virology, 1992, 66(1): 399-404; cited on IDS dated Dec. 31, 2014). |
| Sainsbury et al (Plant Biotechnology Journal, 2008, 6(1): 82-92; cited on IDS dated Aug. 7, 2012). |
| Sagawa et al (Journal of General Virology, 1996, 77: 1483-1487). |
| Air, G.M., “Sequence relationships among the hemagglutinin genes of 12 subtypes of influenza A virus,” Proc. Natl. Acad. Sci. USA 78(12):7639-7643, National Academy of Sciences, United States (1981). |
| Arntzen, C. and Dodet, B., “Plant-derived vaccines and antibodies: potential and limitations,” Vaccine 23:1753-1756, Elsevier Ltd., England (2005). |
| Bao, Y., et al., “The Influenza Virus Resource at the National Center for Biotechnology Information,” J. Virol. 82(2):596-601, American Society for Microbiology, United States (2007). |
| Berger, A., et al., “Plant sterols: factors affecting their efficacy and safety as functional food ingredients,” Lipids Health Dis. 3:5, 19 pages, BioMed Central Ltd., England (2004). |
| Berman, H., et al., “Announcing the worldwide Protein Data Bank,” Nat. Struct. Biol. 10(12):980, Nature Publishing Group, England (2003). |
| Borisjuk et al., “Expression of avian flu antigen for bird immunization,” Plant Biology & Botany 2007 Joint Commission, 2 pages, Botanical Society of America, United States (2007) available at <http://2007.botanyconference.org/engine/search/index.php?func=detail&aid=1410>. |
| Bouic, P.J.D. and Lamprecht, J.H., “Plant Sterols and Sterolins: A Review of Their Immune-Modulating Properties”, Alter. Med. Rev. 4:170-177, Alternative Medicine Review, United States (1999). |
| Bouic, P., “The role of phytosterols and phytosterolins in immune modulation: a review of the past 10 years,” Current Opinion in Clinical Nutrition & Metabolic Care, 4(3):471-475, Thorne Research, Inc., England (2001). |
| Bouic, P.J.D., “Sterols and sterolins: new drugs for the immune system?” Drug Discovery Today, 7:775-778, Lippincott Williams & Wilkins, United States (2002). |
| Brigneti, G., et al., “Viral pathogenicity determinants are suppressors of transgenesilencing in Nicotiana benthamiana,” The EMBO Journal 17(22):6739-6746, Oxford University Press England (1998). |
| Chandler, G.L., “Influenza Hemagglutinin Expression in Nicotiana trabacum and Nicotiana benthamiana,” Masters in Science Thesis, Baylor University, Waco, Texas, 2007, 70 pages. |
| Chandrasekaran, A., et al., “Glycan topology determines human adaptation of avian H5N1 virus hemagglutinin,” Nature Biotechnology, 26(1):107-113, Nature Publishing Group, England (Jan. 2008). |
| Charland, N., et al., “An Innovative VLP-based Technology to Respond to Global Influenza Vaccine Needs,” Poster Abstracts, IDSA Seasonal and Pandemic Influenza Meeting, Arlington, Virginia, USA (May 2008). |
| Chen, B.J., et al., “Influenza Virus Hemagglutinin and Neuraminidase, but Not the Matrix Protein, Are Required for Assembly and Budding of Plasmid-Derived Virus-Like Particles,” J. Virol. 81(13):7111-7123, American Society for Microbiology, United States (2007). |
| Chen, Z., et al., “Stabilizing the glycosylation pattern of influenza B hemagglutinin following adaptation to growth in eggs,” Vaccine 26:361-371, Elsevier Ltd., England (Jan. 2008). |
| Chiba, M., et al., “Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon,” Virology 34627-14, Elsevier Inc., United States (2005). |
| Crawford, J ., et al,. “Baculovirus-derived hemagglutinin vaccines protect against lethal influenza infections by avian H5 and H7 subtypes,” Vaccine 17:2265-2274, Elsevier Science Ltd., England(1999). |
| Cross, K.J., et l., “Studies on influenza haemagglutinin fusion peptide mutants generated by reverse genetics,” EMBO J. 20(16):4432-4442, European Molecular Biology Organization, England (2001). |
| D'Aoust, M-A., et al., “Influenza Virus-like particles produced by transient expression in Nicotiana benthamiana induce a protective immune response against a lethal viral challenge in mice,” Plant Biotechnol. J. 6930-940, Blackwell Publishing Ltd., England (Dec. 2008). |
| D'Aoust, M-A., et al., “The production of hemagglutinin-based virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza,” Plant Biotechnol. J. 8:1-13, Blackwell Publishing Ltd., England (Jun. 2010). |
| Diaz-Vivancos, P., et al., “The apoplastic antioxidant system in Prunus: response to long-term plum pox virus infection,” J. Exp. Bot. 57(14):38 13-3 824, Oxford University Press, England (2006). |
| Fischer, R, et al., “Towards molecular farming in the future: transient protein expression in plants,” Biotechnol. Appl. Biochem. 302113-116, Portland Press Ltd., England (1999). |
| Fischer, R., et al., “Affinity-purification of a TMV-specific recombinant full-size antibody from a transgenic tobacco suspension culture,” J. Immunol. Methods 226:1-10, Elsevier Science B.V., Netherlands (1999). |
| Flandorfer, A., et al., “Chimeric Influenza A Viruses with a Functional Influenza B Virus Neuraminidase or Hemagglutinin,” J. Virol. 77(17):9116-9123, American Society for Microbiology, United States (2003). |
| Frugis, G., et al., “MsJ1, an alfalfa DnaJ-like gene, is tissue-specific and transcriptionally regulated during cell cycle,” Plant Mol. Biol. 40:397-408, Kluwer Academic Publishers, Netherlands (1999). |
| Galarza, J.M., et al., “Virus-Like Particle (VLP) Vaccine Conferred Complete Protection against a Lethal Influenza Virus Challenge,” Viral Immunol. 18(1):244-251, Mary Ann Liebert, Inc., United States (2005). |
| Gallagher, P., et al., “Addition of Carbohydrate Side Chains at Novel Sites on Influenza Virus Hamagglutinin Can Modulate the Folding, Transport, and Activity of the Molecule,”J. Cell Biol. 107(6):2059-2073, The Rockefeller University Press, United States (1988). |
| Gallagher, P.J., et al., “Glycosylation Requirements for Intracellular Transport and Function of the Hemagglutinin of Influenza Virus,” J. Virol. 66(12):7136-7145, American Society for Microbiology, United States (1992). |
| Gamblin, S.J., et al., “The Structure and Receptor Binding Properties of the 1918 Influenza Hemagglutinin,”Science 303:1838-1842, American Association for the Advancement of Science, United States (2004). |
| Garcea, R.L. and Gissmann, L., “Virus-like particles as vaccines and vessels for the delivery of small molecules,” Curr. Opin. Biotechnol. 15:513-517, Elsevier Ltd., England (2004). |
| Garten, R.J., et al., “Influenza A Virus (A/California/04/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds,” GenBank Accession No. FJ966082, NCBI Entrez Nucleotide, 2 pages, accessed Aug. 28, 2010 at <www.ncbi.nlm.nih.gov/nuccore/227809829>. |
| Gillim-Ross, L. and Subbarao, K., “Emerging Respiratory Viruses: Challenges and Vaccine Strategies,” Clin. Microbiol. Rev. 19(4):614-636, American Society for Microbiology, United States (2006). |
| Gömez-Puertas, P., et al., “Efficient formation of influenza virus-like particles: dependence on the expression levels of viral proteins,” J. Gen. Vir. 80:1635-1645, SGM, England (1999). |
| Gömez-Puertas, P., et al., “Influenza Virus Matrix Protein is the Major Driving Force in Virus Budding,” J. Virol. 74(24):11538-11547, American Society for Microbiology, United States (2000). |
| Grgacic, E.V.L. and Anderson, D.A., “Virus-like particles: Passport to immune recognition,” Methods 40:60-65, Elsevier Inc., United States (2006). |
| Gupta, R., et al., “O-GLYCBASE version 4.0: a revised database of O-glycosylated proteins,” Nucleic Acids Res. 27(1):370-372, Oxford University Press, England (1999). |
| Hahn, B-S., et al., “Expression of hemagglutinin-neuraminidase protein of Newcastle disease virus in transgenic tobacco,” Plant Biotechnol. Rep. 1:85-92, Korean Scociety for Plant Technology and Springer, Japan (2007). |
| Hamilton, A., et al., “Two classes of short interfering RNA in RNA silencing,” EMBO J. 21(17):4671-4679, European Molecular Biology Organization, England (2002). |
| Harbury, P.B., et al., “A Switch Between Two-, Three-, and Four-Stranded Coiled Coils in GCN4 Leucine Zipper Mutants,” Science 262:1401-1407, American Association for the Advancement of Science, Untied States (1993). |
| Hartl, F.U., “Molecular chaperones in cellular protein folding,” Nature 381(13):571-580, Nature Publishing Group, England (1996). |
| NCBI Entrez, Genbank Report, Accession No. FJ966082, Influenza A Virus (A/California/04/2009 H1N1), Dawood et al., collection date Apr. 2009, 3 pages. |
| Horimoto, T., et al., “Generation of Influenza A Viruses with Chimeric (Type A/B) Hemagglutinins,” J. Virol. 77(14):8031-8038, American Society for Microbiology, United States (2003). |
| Huang, Z., et al., “Plant-derived measles virus hamagglutinin protein induces neutralizing antibodies in mice,” Vaccine 19:2163-2171, Elsevier Science Ltd., England (2001). |
| Huang, Z., et al., “Virus-like Particle expression and assembly in plants: hepatitis B and Norwalk viruses,” Vaccine 23:1851-1858, Elsevier Ltd., England (2005). |
| Ito, T., et al., “Receptor Specificity of Influenza A Viruses Correlates with the Agglutination of Erythrocytes from Different Animal Species,” Virology 227:493-499, Academic Press, United States (1997). |
| Johansson, B.E., “Immunization with influenza A virus hemagglutinin and neuraminidase produced in recombinant baculovirus results in a balanced and broadened immune response superior to conventional vaccine,” Vaccine 17:2073-2080, Elsevier Science Ltd., England (1999). |
| Knossow, M. and SkeheL, J.J., “Variation and infectivity neutralization in influenza,” Immunology 119:1-7, Blackwell Publishing Ltd,, England (2006). |
| Latham, T. and Galarza, J.M., “Formation of Wild-Type and Chimeric Influenza Virus-Like Particles following Simultaneous Expression of Only Four Structural Proteins,” J. Virol. 75(13):6154-6165, American Society for Microbiology, United States (2001). |
| Lefebvre, B., et al., “Characterization of Lipid rafts from Medicago truncatula Root Plasma Membranes: A Proteomic Study Reveals the Presence of a Raft-Associated Redox System,” Plant Physiology 144:402-418, American Society of Plant Biologists, United States (2007). |
| Lin, B-L., et al., “Genomic analysis of the Hsp70 superfamily in Arabidopsis thaliana,” Cell Stress Chaperones 6(3):201-208, Cell Stress Society International, Netherlands (2001). |
| Liu, L. and Lomonossoff, G.P., “Agroinfection as a rapid method for prepagating Cowpea mosaic virus-based constructs,” J. Virol. Methods 105:343-348, Eisevier Science B.V., Netheriands (2002). |
| Low, D., et al., “Future of antibody purification,” J. Chromatogr. B 848:48-63, Elsevier B.V., Netherlands (2006). |
| Macala, L.J., et al., “Analysis of brain lipids by high performance thin-layer chromatography and densitometry,” J. Lipid Res. 24:1243-1250, American Society for Biochemistry and Molecular Biology, United States (1983). |
| Macario, A.J.L., “Heat-shock proteins and molecular chaperones: implications for pathogenesis, diagnostics, and therapeutics,” Int. J. Clin. Lab. Res. 25:59-70, Springer-Verlag, Germany (1995). |
| Mansour, M.M.F., et al., “Plasma membrane lipid alterations induced by NaCl in winter wheat roots,” Physiol. Plant. 92:473-478, Physiologia Plantarum, Denmark (1994). |
| Marozin, S., et al., “Antigenic and genetic diversity among swine influencza A H1N1 and H1N2 viruses in Europe,” J. Gen. Virol. 83 :735-745, SGM, England (2002). |
| Mason, H.S., et al., “Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice,” Proc. Natl. Acad, Sci. USA 93:5335-5340, National Academy of Sciences, United States (1996). |
| McCauley, J.W. and Mahy, W.J., “Structure and function of the influenza virus genome,” Biochem. J. 211:281-294, Portland Press, England (1983). |
| Medeiros, R., et al., “Hemagglutinin Residues of Recent Human A(H3N2) Influenza Viruses That Contribute to the Inability to Agglutinate Chicken Erythrocytes,” Virology 289:74-85, Academic Press, United States (2001). |
| Mena, I., et al., “Rescue of a Synthetic Chloramphenicol Acetyltransferase RNA into Influenza Virus-Like Particles Obtained from Recombinant Plasmids,” J. Virol. 70(8):5016-5024, American Society of Microbiology, United States (1996). |
| Meshcheryakova, Y.A., et al., “Cowpea Mosaic Virus Chimeric Particles Bearing the Ectodomain of Matrix Protein 2 (M2E) of the Influenza A Virus: Production and Characterization,” Mol. Biol. 43(4):685-694, Pleiades Publishing, Inc., Russia (Jul. 2008). |
| Mett, V., et al., “A plant-produced influenza subunit vaccine protects ferrets against virus challenge,” Influenza Other Respi. Viruses 2:33-40, Blackwell Publishing Ltd., England (Jan. 2008). |
| Mongrand, S., et a1., “Lipid Rafts in Higher Plant Cells,” J. Biol. Chem. 279(35):36277-36286, The American Society for Biochemistry and Molecular Biology, Inc., United States (2004). |
| Musiychuk, K., et al., “A launch vector for the production of vaccine antigens in plants,” Influenza Other Respi. Viruses 1:19-25, Blackwell Publishing Ltd., England (2007). |
| Nakahara, T., et al., “Glycoconjugate Data Bank: Structures—an annotated glycan structure database and N-glycan primary structure verification service,” Nucleic Acids Res. 36:D368-D371, Oxford University Press, England (2007). |
| Nemchinov, L.G. and Natilla, A., “Transient expression of the ectodomain of matrix protein 2 (M2e) of avian influenza A Virus in plants,” Protein Expr. Purif. 56:153-159, Elsevier Inc., United States (2007). |
| Neumann, G., et al., “Plasmid-Driven Formation of Influenza Virus-Like Particle,” J. Virol. 74(1):1547-551, American Society for Microbiology, United States (2000). |
| Nuttall, J., et al., “ER-resident chaperone interactions with recombinant antibodies in transgenic plants,” Eur. J. Biochem. 269:6042-6051, FEBS, England (2002). |
| Olsen, C.W., et al., “Immunogenicity and efficacy of baculovirus-expressed and DNA-based equine influenza virus hemagglutinin vaccines in mice,” Vaccine 15(10):1149-1156, Elsevier Science Ltd., England (1997). |
| Parsell, D.A. and Lindquist, S., et al., “Tile Function Of Heat-Shock Proteins in Stress Tolerance: Degradation and Reactivation of Damaged Proteins,” Annu. Rev. Genet. 27:2437-496, Annual Reviews Inc., United States. (1993). |
| Plotkin, J .B., et al., “Hemagglutinin sequence clusters and the antigenic evolution of influenza A Virus,” Proc. Natl. Acad. Sci. 99(9):6263-6268, American Association for the Advancement of Science, United States (2002). |
| Pushko, P., et al., “Influenza virus-like particles comprised of the HA, NA, and M1 proteins of H9N2 influenza virus induce protective immune responses in BALB/c mice,” Vaccine 23:5751-5759, Elsevier Science Ltd., England (2005). |
| Pwee, K-H. and GRAY, J.C., “The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants,” Plant J 3(3):437-449, Blackwell Scientific Publishers, England (1993). |
| Quan, F-S., et al., “Virus-Like Partile Vaccine Induces Protective Immunity against Homologous and Heterologous Strains of Influenza Virus,” J. Virol. 81(7):3514-3524, American Society for Microbiology, United States (2007). |
| Regnard, G.L., et al., “High level protein expression in plants through the use of a novel autonomously replicating geminivirus shuttle vector,” Plant Biotechnol. J. 8:38-46, Blackwell Publishing Ltd., England (Jan. 2010). |
| Rowe, T., et al., “Detection of Antibody to Avian Influenza A (H5N1) Virus in Human Serum by Using a Combination of Serologic Assays,” Journal of Clinical Microbiology 37(4):937-943, American Society for Microbiology, United States (1999). |
| Roy, P. and Noad, R., “Virus-like particles as a vaccine delivery system,” Hum. Vaccin. 4(6):5-8, Landes Bioscience, United States (Jan. 2008). |
| Sainsbury, F. and Lomonossoff, G.P., et al., “Extremely High-Level and Rapid Transient Protein Production in Plants without the Use of Viral Replication,” Plant Physiol. 148:1212-1218, American Society of Plant Biologists, United States (Nov. 2008). |
| Sainsbury, F., et al., “Expression of multiple proteins using full-length and deleted versions of cowpea mosaic virus RNA-2,” Plant Biotechnol. J. 6:82-92, Blackwell Publishing Ltd., England (2007). |
| Saint-Jore-Dupas, C., et al., “From planta to pharma with glycosylation in the toolbox,” Trends Biotechnol. 25(7):317-323, Elsevier Ltd., England (2007). |
| Salzberg, S.L., et al., “Gamma Analysis Linking Recent European and African Influenza (H5N1) Viruses,” Emerg. Infect. Dis. 13(5):733-718, National Center for Infectious Diseases, United States (2007). |
| Schillberg, S., et al., “Apoplastic and cytosolic expression of full-size antibodies and antibody fragments in Nicotiana tabacum,” Trangsgenic Res. 8:255-263, Kluwer Academic Publishers, Netherlands (1999). |
| Schillberg, S., et al., “Molecular farming of recombinant antibodies in plants,” Cell. Mol. Life Sci. 60:433-445, Birkhäuser Verlag, Switzerland (2003). |
| Shoji, Y., et al., “Plant-expressed HA as a seasonal influenza vaccine candidate,” Vaccine 26:2930-2934, Elsevier Ltd., England (Jun. 2008). |
| Skehel, J.J . and Wiley, D.C., “Receptor Binding and Membrane Fusion in Virus Entry: The Influenza Hemagglutinin,” Annu. Rev. Biochem. 69:2531-569, Annual Reviews, United States (2000). |
| Staehelin, L.A., “The plant ER: a dynamic organelle composed of a large number of discrete functional domains,” Plant J. 11(6):1151-1165, Blackwell Scientific Publishers, England (1997). |
| Toukach, P., et al., “Sharing of worldwide distributed carbohydrate-related digital resources: online connection of the Bacterial Carbohydrate Structure DataBase and GLYCOSCIENCES.de,” Nucleic Acids Res. 35 :D280-D286, Oxford University Press, England (2007). |
| Treanor, J.J ., et al., “Safety and Immunogenicity of a Baculovirus-Expressed Hemagglutinin Influenza Vaccine,” JAMA 297(14):1577-1582, American Medical Association, United States (2007). |
| Vaccaro, L., et al., “Plasticity of Influenza Haemagglutinin Fusion Peptides and Their Interaction with Lipid Bilayers,” Biophys. J. 88:25-36, The Biophysical Society, United States (2005). |
| Van Ree, R., et al., “β(1,2)-Xylose and α(1,3)-Fucose Residues Have a Strong Contriubtion in IgE Binding to Plant Glycoallergens,” J Biol. Chem. 275(15):11451-11458, The American Society for Biochemistry and Molecular Biology, Inc., United States (2000). |
| Wagner, R., et al., “Interdependence of Hemagglutinin Glycosylation and Neuraminidase as Regulators of Influenza Virus Growth: a Study by Reverse Genetics,” J. Virol. 74(14):6316-6323, American Society for Microbiology, United States (2000). |
| Wakefield, L. and Brownlee, G.G., “RNA-binding properties of influenza A virus matrix protein M1,” Nucleic Acids Res. 17(21):8569-8580, IRL Press, England (1989). |
| Wang, K., et al., “Expression and purification of an influenza hemagglutinin—one step closer to a recombinant protein-based influenza vaccine,” Vaccine 24:2176-2185, Elsevier Ltd., England (2006). |
| Wei, C-J., et al., “Comparative Efficacy of Neutralizing Antibodies Elicited by Recombinant Hemagglutinin Proteins from Avian H5N1 Influenza Virus,” J. Virol. 82(13):6200-6208, American Society for Microbiology, United States (Jul. 2008). |
| Weldon, W.C., et al., “Enhanced Immunogenicity of Stabilized Trimeric Soluble Influenza Hemagglutinin,” PLoS One 5(9):e12466, 8 pages, Public Library of Science, United States (Sep. 2010). |
| Wilson, I.B.H., et al., “Core α1,3-fucose is a key part of the epitope recognized by antibodies reacting against plant N-inked oligosaccharides and is present in a wide variety of plant extracts,” Glycobiology 8(7):651-661, Oxford University Press, England (1998). |
| Office Action dated Jan. 20, 2012 in Canadian Patent Application No. 2,693,956, assignee Medicago Inc., filed Jul. 11, 2008. |
| Office Action dated Jan. 26, 2011 in Canadian Patent Application No. 2,693,956, assignee Medicago Inc., filed Jul. 11, 2008. |
| Office Action dated Sep. 22, 2011 in Canadian Patent Application No. 2,693,956, assignee Medicago Inc., filed Jul. 11, 2008. |
| Office Action dated Jun. 1, 2011 in Canadian Patent Application No. 2,707,235, assignee Medicago Inc., filed Jan. 12, 2009. |
| Office Action dated Oct. 28, 2011 in Canadian Patent Application No. 2,707,235, assignee Medicago Inc., filed Jan. 12, 2009. |
| Office Action dated Nov. 30, 2011 in Canadian Patent Application No. 2,730,185, assignee Medicago Inc., filed Nov. 30, 2011. |
| Office Action dated Apr. 27, 2012 in Canadian Patent Application No. 2,730,185, assignee Medicago Inc., filed Nov. 30, 2011. |
| Office Action dated Jun. 28, 2011 in Canadian Patent Application No. 2,730,185, assignee assignee Medicago Inc., filed Nov. 30, 2011. |
| Office Action dated Feb. 16, 2012 in Canadian Patent Application No. 2,762,042, assignee Medicago Inc., filed Jun. 25, 20101. |
| Translation of Office Action dated Apr. 6, 2012 in Chinese Patent Application No. 200980126670.5, assignee Medicago Inc., filed Jul. 7, 2009. |
| Translation of Office Action dated Sep. 27, 2011 in Chinese Patent Application No. 200880107072.9, assignee Medicago Inc., filed Jul. 11, 2008. |
| Translation of Office Action dated Jan. 21, 2012 in Chinese Patent Application No. 200980109781.5, Medicago, Inc., filed Jan. 12, 2009. |
| Supplementary European Search Report for European Patent Application No. EP 08 78 3201, European Patent Office, Germany, dated Sep. 13, 2010. |
| Supplementary European Search Report for European Patent Application No. EP 09 70 0061, European Patent Office, Germany, dated Mar. 7, 2011. |
| Supplementary European Search Report for European Patent Application No. EP 09 79 3741, Munich, European Patent Office, Germany, dated Aug. 9, 2011. |
| International Preliminary Report on Patentability for International Patent Application No. PCT/CA2009/000032, The International Bureau of WIPO, Switzerland, dated Jul. 27, 2010. |
| International Preliminary Report on Patentability for International Patent Application No. PCT/CA2009/00094l, The International Bureau of WIPO, Switzerland, dated Jan. 11, 2011. |
| International Preliminary Report on Patentability for International Patent Application No. PCT/CA2009/000926, Canadian Intellectual Property Office, Canadian Intellectual Property Office, Canada, dated Nov. 5, 2010. |
| International Search Report for International Patent Application No. PCT/CA2009/000926, Canadian Intellectual Property Office, Canada, dated Oct. 1, 2009. |
| International Search Report for International Patent Application No. PCT/CA2008/001281, Canadian Intellectual Property Office, Canada, dated Oct. 7, 2008. |
| International Search Report for International Patent Application No. PCT/CA2009/000032, Canadian Intellectual Property Office, Canada, dated Apr. 30, 2009. |
| International Search Report for International Patent Application No. PCT/CA2010/001489, Canadian Intellectual Property Office, Canada, dated Nov. 30, 2010. |
| International Search Report for International Patent Application No. PCT/CA2011/001427, Canadian Intellectual Property Office, Canada, dated Mar. 20, 2012. |
| International Search Report for International Patent Application No. PCT/CA2011/001228, Canadian Intellectual Property Office, Canada, dated Jan. 18, 2012. |
| International Preliminary Report on Patentability for International Application No. PCT/CA2008/001281, Canadian Intellectual Property Office, Canada, dated Nov. 12, 2009. |
| International Search Report for International Patent Application No. PCT/CA2009/000041, Canadian Intellectual Property Office, Canada, dated Sep. 10, 2009. |
| Communication pursuant to Article 94(3) EPC for European Patent Application No. EP 08 783 201.0, Canadian Intellectual Property Office, Canada, dated May 26, 2011. |
| Office Action dated Mar. 8, 2011 in Vietnamese Patent Application No. 1-2012-00186, assignee Medicago Inc., filed Jan. 19, 2012. |
| Office Action dated Nov. 8, 2010 in New Zealand Patent Application No. 582360, assignee Medicago Inc., filed Feb. 13, 2010. |
| Office Action dated Apr. 15, 2011 in New Zealand Patent Application No. 590144, assignee Medicago Inc., filed Feb. 11, 2011. |
| Office Action dated Apr. 18, 2012 in Singapore Patent Application No. 201009568-5, assignee Medicago Inc., filed Jul. 2, 2009. |
| Office Action dated Mar. 2, 2011 in Singapore Patent Application No. 201000090-9, assignee Medicago Inc., filed Jul. 11, 2008. |
| Office Action dated Feb. 11, 2010 in Eurasian Patent Organization (EAPO) Patent Application No. 201000195/28, Russia. |
| Supplementary European Search Report for European Patent Application No. EP 09 79 3751, European Patent Office, Germany, completed Sep. 19, 2011. |
| Office Action dated Nov. 27, 2011 in Egyptian Patent Application No. PCT1222/2010, assignee Medicago Inc., Cairo, Egypt. |
| Asahi-Ozaki et al., “Intranasal administration of adjuvant-combined recombinant influenza virus HA vaccine protects mice from the lethal H5N1 virus infection,” Microbes and Infection (2006) 8:2706-2714, Elsevier Masson SAS, France. |
| Bilang, R. et al. “The 3′-terminal region of the hygromycin-B-resistance gene is important for its activity in Escherichia coli and Nicotiana tabacum,” Gene (1991) 100:247-250, Elsevier Science Publishers B.V., Netherlands. |
| Bright, R.A., et al., “Influenza virus-like particles elicit broader immune responses than whole virion inactivated influenza virus or recombinant hemagglutinin,” Vaccine (2007) 25:3871-3878, Elsevier Ltd., England. |
| Bright, R.A., et al. “Impact of glycosylation on the immunogenicity of a DNA-based influenza H5 HA vaccine,” Virology (2003) 308: 270-278, Elsevier Science, United States. |
| Firek, S., et al. “Secretion of a functional single-chain Fν protein in transgenic tobacco plants and cell suspension cultures,” Plant Molecular Biology (1993) 23:861-870, Kluwer Academic Publishers, Belgium. |
| Garten, R.J., et al. “Antigenic and Genetic Characteristics of Swine-Origin 2009 A(H1N1) Influenza Viruses Circulating in Humans,” Science (Jul. 2009) 325:197-201, American Association for the Advancement of Science, United States. |
| Giritch, A. et al. “Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors,” Proc. Natl. Acad. Sci. U.S.A. (2006) 103:14701-14706, The National Academy of Science of the USA, United States. |
| Hiatt, A. and Pauly, M., “Monoclonal antibodies from plants: A new speed record,” Proc. Natl. Acad. Sci. U.S.A. (2006) 103:14645-14646, The National Academy of Science of the USA, United States. |
| Hiatt, A., et al. “Production of antibodies in transgenic plants” Nature (1989) 342:76-78, Nature Publishing Group, England. |
| Houston, N.L., et al. “Phylogenetic Analyses Identify 10 Classes of the Protein Disulfide Isomerase Family in Plants, Including Single-Domain Protein Disulfide Isomerase-Related Proteins,” Plant Physiology (2005) 137:762-778, American Society of Plant Biologists, United States. |
| Huang, Z., et al. “A DNA Replicon System for Rapid High-Level Production of Virus-Like Particles in Plants,” Biotechnol. Bioeng. (Jul. 2009) 103(4):706-714, Wiley Periodicals, Inc., United States. |
| Huang, Z., et al. “High-Level Rapid Production of Full-Size Monoclonal Antibodies in Plants by a Single-Vector DNA Replicon System,” Biotechnol. Bioeng. (May 2010) 106(1):9-17, Wiley Periodicals, Inc., United States. |
| Certificate of granted patent 2011/01231 of Republic of South Africa dated Oct. 26, 2011. |
| Richter, L.J., et al. “Production of hepatitis B surface antigen in transgenic plants for oral immunization,” Nature Biotechnology (2000) 18:1167-1171, Nature America Inc., United States. |
| Shorrosh, B.S. and Dixon, R.A., “Molecular cloning of a putative plant endomembrane protein resembling vertebrate protein disulfide-isomerase and a phosphatidylinositol-specific phospholipase C,” Proc. Natl. Acad. Sci. USA (1991) 88(23):10941-10945, National Academy of Sciences, United States. |
| Certificate of granted patent from The Registry of Patents Singapore, Patent No. 158301 dated Apr. 30, 2012. |
| Twyman, R.M., et al. “Molecular farming in plants: host systems and expression technology,” TRENDS in Biotechnology (2003) 21(12) :570-578, Elsevier Ltd., England. |
| Vézina, L-P. et al. “Transient co-expression for fast and high-yield production of antibodies with human-like N-glycans in plants,” Plant Biotechnology Journal (Jun. 2009) 7(5):442-455, Blackwell Publishing Ltd., England. |
| Weissenhorn, W., et al. “Assembly of a rod-shaped chimera of a trimeric GCN4 zipper and the HIV-1 gp41 ectodomain expressed in Escherichia coli,” Proc. Natl. Acad. Sci. USA (1997) 94:6065-6069, The National Academy of Sciences, United States. |
| Wydro, M. et al. “Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana bentharniana,” Acta Biochimica Polonica (2006) 53(2):289-298, Panstwowe Wydawnictwo Naukowe, Poland. |
| Nucleotide sequence of“Influenza A virus (A/New Caledonia/20/99(H1N1)) hemagglutinin (HA) gene, complete cds,” GenBank Accession No. AY289929 (2003). |
| Nucleotide sequence of “M.sativa mRNA for protein disulfide isomerase,” GenBank Accession No. Z11499 (2006). |
| Office Action dated Sep. 6, 2012 in Canadian application CA 2,615,372. |
| Office Action dated Oct. 16, 2012 in Canadian application CA 2,693,956. |
| Office Action dated Mar. 1, 2013 in Canadian application CA 2,693,956. |
| Office Action dated Jun. 7, 2012 in Canadian application CA 2,707,235. |
| Office Action dated Sep. 28, 2012 in Canadian application CA 2,707,235. |
| Office Action dated Mar. 1, 2013 in Canadian application CA 2,707,235. |
| Office Action dated Sep. 6, 2012 in Canadian application CA 2,730,185. |
| Notice of Allowance dated Jun. 29, 2012 in Canadian application CA 2,762,042. |
| English translation of Chinese Office Action dated Nov. 27, 2012 in Chinese application CN 200980109781.5. |
| English translation of Chinese Office Action dated Nov. 5, 2012 in Chinese application CN 200980126670.5. |
| English translation of Chinese Office Action dated Mar. 15, 2013 in Chinese application CN 200980126670.5. |
| English translation of Chinese Office Action dated Jul. 24, 2012 in Chinese application CN 200880107072.9. |
| English translation of Chinese Office Action dated Feb. 21, 2013 in Chinese application CN 200880107072.9. |
| English translation of Chinese Office Action dated Jul. 16, 2012 in Chinese Application CN 200980134868.8. |
| English translation of Chinese Office Action dated Jan. 15, 2013 in Chinese application CN 200980134868.8. |
| English translation of Chinese Office Action dated Mar. 8, 2013 in Chinese application CN 200980136376.2. |
| English translation of Russian Office Action in Eurasian application EA 20100195/28. |
| English translation of Russian Office Action dated Aug. 28, 2012 in Eurasian application EA 201001198. |
| European Office Action dated Oct. 26, 2012 in European application EP 08783201.0. |
| European Decision to Grant dated Aug. 17, 2012 in European application EP 09700061.6. |
| European Search Report dated Dec. 20, 2011 in European application EP 09797336. |
| European Examination Report dated Aug. 23, 2012 in European application EP 09793751.0. |
| European Extended Search Report dated Jan. 3, 2013 in European application EP 10818191.8. |
| European Extended Search Report dated Feb. 15, 2013 in European application EP 12181077.4. |
| English translation of Office Action dated Oct. 8, 2012 in Indonesian application ID W-00201002481. |
| English translation of Office Action dated May 8, 2012 in Israeli application IL 203018. |
| English translation of Office Action dated May 9, 2012 in Israeli application IL 206967. |
| English translation of Office Action dated Oct. 25, 2012 in Israeli application IL 210215. |
| English translation of Office Action dated Nov. 25, 2012 in Israeli application IL 210451. |
| International Preliminary Report on Patentability in PCT/CA2011/001228 dated Dec. 4, 2012. |
| International Search Report in PCT/CA2009/001040 dated Nov. 10, 2009. |
| English translation of Office Action dated Mar. 6, 2013 (together with untranslated version) in Mexican application MX/a/2010/000525. |
| English translation of Office Action dated Mar. 6, 2013 (together with untranslated version) in Mexican application MX/a/2010/007962. |
| English translation of Office Action dated Mar. 6, 2013 (together with untranslated version) in Mexican application MX/a/2011/000459. |
| English translation of Office Action dated Sep. 19, 2012 (together with untranslated version) in Mexican application MX/a/2011/000657. |
| New Zealand 582360 Letters Patent Aug. 6, 2012. |
| New Zealand 587108 Examination Report dated Mar. 21, 2011. |
| New Zealand 587108 Examination Report dated Jun. 27, 2012. |
| New Zealand 587108 Examination Report dated Jan. 28, 2013. |
| New Zealand 590351 Examination Report dated May 4, 2011. |
| New Zealand 597401 Examination Report dated Jul. 9, 2012. |
| New Zealand 598508 Examination Report dated Nov. 15, 2012. |
| English translation of Office Action dated Mar. 13, 2013 in Thailand application TH 1101003761. |
| Restriction Requirement dated Aug. 13, 2012 in U.S. Appl. No. 12/669,033. |
| Office Action dated Oct. 4, 2012 in U.S. Appl. No. 12/669,033. |
| Restriction Requirement dated Sep. 27, 2012 in U.S. Appl. No. 12/863,772. |
| Office Action dated Dec. 14, 2012 in U.S. Appl. No. 12/863,772. |
| Restriction Requirement dated Dec. 6, 2012 in U.S. Appl. No. 13/001,111. |
| Office Action dated Apr. 2, 2013 in U.S. Appl. No. 13/001,111. |
| Restriction Requirement dated Mar. 25, 2013 in U.S. Appl. No. 13/748,531. |
| D'Aoust, M-A., et al., “The production of hemagglutinin-based virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza,” Plant Biotechnology Journal 8:607-619, Blackwell Publishing Ltd., England (Jun. 2010). |
| Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team, “Emergence of a Novel Swine-Origin Influenza A (H1N1) Virus in Humans,” N Engl J Med 360(25):2605-2615, Massachusetts Medical Society, United States (Jun. 2009). |
| Shorrosh, B.S. and Dixon, R.A., “Sequence analysis and development expression of an alfalfa protein disulfide isomerase,” Plant Molecular Biology 19:2319-321, Kluwer Academic Publishers, Belgium (1992). |
| Bertioli, D.J., et al., “Transgenic plants and insect cells expressing the coat protein of arabis mosaic virus produce empty virus-like particles,” J. Gen Virol. 72(8): 1801-1809, SGM, England (1991). |
| Eckert, D., et al., “Crystal Structure of GCN4-pIQI, a Trimeric Coiled Coil with Buried Polar Residues,” Journal of Molecular Biology 284:859-865, Academic Press, United States (1998). |
| Ellis, R.J., “The molecular chaperone concept,” Semin Cell Biol 1(1):1-9, Saunders Scientific Publications, United States (1990). |
| Klopfleisch, R., et al., “Neurotropism of Highly Pathogenic Avian Influenza Virus A/Chicken/Indonesia/2003 (H5N1) in Experimentally Infected Pigeons (Columbia livia f. domestica),” Vet Pathol 43:463-470, Karger, United States (2006). |
| Kobayashi, Y, et al., “Chaperones Hsp70 and Hsp40 Suppress Aggregate Formation and Apoptosis in Cultured Neuronal cells Expressing Truncated Androgen Receptor Protein with Expanded Polyglutamine Tract,” J Biol. Chem. 25(12):8772-8778, The American Society for Biochemistry and Molecular Biology, Inc., United States (2000). |
| Lelivelt, C.L.C., et al., “Stable plastid transformation in lettuce (Lactuca sativa L.),” Plant Molecular Biology 58:763-774, Springer, Germany (2005). |
| Li, S., et al., “Influenza A Virus Transfectants with Chimeric Hemagglutinins Containing Epitopes from Different Subtypes,” Journal of Virology 66(3):399-404, American Society for Microbiology, United States (1992). |
| Liu, L., et al., “Cowpea mosaic virus-based systems for the production of antigens and antibodies in plants,” Vaccine 23:1788-1792, Elsevier Ltd., England (2004). |
| Ma, J.K.C., et al., “The Production of Recombinant Pharmaceutical Proteins in Plants,” Nature Reviews Genetics 4(10):794-805, Nature Publishing Group, England (2003). |
| Mishin, V., et al., “Effect of Hemagglutinin Glycosylation on Influenza Virus Susceptibility to Neuraminidase Inhibitors,” Journal of Virology 79(19):12416-12424, American Society for Microbiology, United States (2005). |
| Mori, S.I., et al., “A novel amino acid substitution at the receptor-bindnig site on the hemagglutinin of H3N2 influenza A viruses isolated from 6 cases with acute encephalopathy during the 1997-1998 season in Tokyo,” Archives of Virology 144:147-155, Springer Verlag, Austria (1999). |
| Nobusawa, E., “Protective antigen of influenza virus,” Nihon Rinsho Japanese Journal of Clinical Medicine 55(1):2719-2724, Nippon Rinsho Co., Japan (1997). |
| Rivard, D., et al., “An in-built proteinase inhibitor system for the protection of recombinant proteins recovered from transgenic plants,” Plant Biotechnology Journal 4:359-368, Blackwell Publishing Ltd., England (2006). |
| Spitsin, S., et al., “Immunological assessment of plant-derived avian flu H5/HA1 variants,” Vaccine 27:1289-1292, Elsevier Ltd., England (Feb. 2009). |
| Tatulian, S.A. and Tamm, L.K., “Secondary Structure, Orientation, Oligomerization, and Lipid Interactions of the Transmembrane Domain of Influenza Hemagglutinin,” Biochemistry 39:496-507, American Chemical Society, United Sttaes (2000). |
| Warzecha, H., “Biopharmaceuticals from Plants: A Multitude of Options for Posttranslational Modifications,” Biotechnology and Genetic Engineering Reviews 25:315-330, Taylor & Francis Ltd., England (Feb. 2008). |
| Whitelam, G.C., “The Production of Recombinant Proteins in Plants,” J Sci Food Agric 68:1-9, SCI, England (1995). |
| Wiley, D.C. and Skehel, J.J., “The Structure and Function of the Hemagglutinin Membrane Glycoprotein of Influenza Virus,” Ann Rev Biochem 56(1):365-394, Annual Reviews Inc., United States (1987). |
| Yang, Z., et al., “Immunization by Avian H5 Influenza Hemagglutinin Mutants with Altered Receptor Binding Specificity,” Science 317:825-828, American Association for the Advancement of Science, United States (2007). |
| GenBank Report, Accession No. AFU70328, published Jul. 26, 2007, accessed at http://ibis.internal.epo/org/exam/dbfetch.jsp?id=GSP:AFU70328, accessed on Jan. 24, 2014. |
| GenBank Report, Accession No. EF541394.1, accessed at http://www.ncbi.nlm.nih/gov/nuccore/EF541394, accessed on Jul. 30, 2013. |
| Office Action dated May 21, 2013 in Australian Patent Application No. 2008278222, applicant Medicago Inc., filed Jul. 11, 2008. |
| Office Action dated Jun. 13, 2013 in Australian Patent Application No. 2009202819, applicant Medicago Inc., filed Jan. 12, 2009. |
| Office Action dated Mar. 26, 2014 in Australian Patent Application No. 2009267769, applicant Medicago Inc., filed Jul. 7, 2009. |
| Office Action dated Dec. 18, 2013 in Australian Patent Application No. 2010265766, applicant Medicago Inc., filed Jun. 25, 2010. |
| Notice of Allowance dated Aug. 14, 2013 in Canadian Patent Application No. 2,707,235, applicant Medicago Inc., filed Jan. 12, 2009. |
| Office Action dated Jun. 2, 2014 in Canadian Patent Application No. 2,730,185, applicant Medicago Inc., filed Jun. 2, 2014. |
| Notice of Allowance dated Aug. 7, 2013 in Canadian Patent Application No. 2,815,887, applicant Medicago Inc., filed Nov. 3, 2011. |
| Office Action dated Jul. 23, 2014 in Canadian Patent Application No. 2,821,574, applicant Medicago Inc., filed Dec. 22, 2011. |
| Office Action dated Jul. 23, 2013 in Chinese Patent Application No. 200980126670.5, applicant Medicago Inc., filed Jan. 7, 2011. |
| Office Action dated May 30, 2013 in Chinese Patent Application No. 200980134868.8, applicant Medicago Inc., filed Jul. 2, 2009. |
| Decision on Rejection dated Feb. 20, 2014 in Chinese Patent Application No. 200980134868.8, applicant Medicago Inc., filed Jul. 2, 2009. |
| Office Action dated Mar. 4, 2014 in Chinese Patent Application No. 201180064127.4, applicant Medicago Inc., filed Nov. 3, 2011. |
| Office Action dated Jun. 13, 2012 in Chinese Patent Application No. 200980136376.2, applicant Medicago Inc., filed Jul. 15, 2009. |
| Office Action dated Oct. 10, 2013 in Chinese Patent Application No. 200980136376.2, filed Jul. 15, 2009. |
| Office Action dated Jul. 1, 2014 in Chinese Patent Application No. 200980136376.2, filed Jul. 15, 2009. |
| Office Action dated Jun. 28, 2013 in Chinese Patent Application No. 201080035066.4, filed Jun. 25, 2010. |
| Office Action dated Feb. 19, 2014 in Chinese Patent Application No. 201080035066.4, filed Jun. 25, 2010. |
| Office Action dated Aug. 20, 2014 in Chinese Patent Application No. 201080035066.4, filed Jun. 25, 2010. |
| Office Action dated Jan. 13, 2014 in Chinese Patent Application No. 2013100216938, filed Jan. 12, 2009. |
| Office Action dated Sep. 23, 2014 in Chinese Patent Application No. 201310021693.8, filed Jan. 12, 2009. |
| Office Action dated Mar. 14, 2014 in Chinese Patent Application No. 201180065696.0, filed Dec. 22, 2011. |
| Office Action dated Dec. 26, 2013 in Eurasian Patent Application No. 201001198, filed Dec. 26, 2012. |
| Office Action dated Sep. 3, 2014 in Eurasian Patent Application No. 201001198, filed Dec. 26, 2012. |
| Office Action dated Aug. 27, 2013 in Egyptian Patent Application 2010010061, filed Dec. 1, 2010. |
| Office Action dated Sep. 3, 2014 in Egyptian Patent Application 2010010061, filed Dec. 1, 2010. |
| European Search Report dated Oct. 8, 2013 in European Patent Application No. 10 791 119, having an international filing date of Jun. 25, 2010. |
| Office Action dated May 31, 2013 in European Patent Application No. 08 78 3201, having an international filing date of Jul. 8, 2011. |
| Office Action dated Aug. 1, 2013 in European Patent Application No. 09 793 751, having an international filing date of Jul. 7, 2009. |
| Supplementary European Search Report dated Apr. 10, 2014 in European Patent Application No. 11 83 7364, having an international filed of Nov. 3, 2011. |
| Office Action dated Feb. 6, 2014 in European Patent Application No. 09 797 336, having an international filing date of Jul. 15, 2009. |
| Office Action dated Jul. 4, 2014 in European Patent Application No. 10 791 119, having an international filing date of Jun. 25, 2010. |
| Supplementary European Search Report dated Apr. 8, 2014 in European Patent Application No. 11 85 1176, having an international filing date of Dec. 22, 2011. |
| Office Action dated May 10, 2013 in Indonesian Patent Application No. W-00201002481, having an international filing date of Jan. 12, 2009. |
| Office Action dated Aug. 18, 2013 in Israeli Patent Application No. 203018, filed Jul. 11, 2008. |
| Office Action dated Mar. 30, 2014 in Israeli Patent Application No. 216937, filed Jun. 25, 2010. |
| Office Action dated Jan. 15, 2014 in Japanese Patent Application No. 2011-516934, filing date Oct. 27, 2011. |
| Office Action dated Jul. 17, 2013 in Japanese Patent Application No. 2010-516334, filing date Oct. 21, 2010. |
| Office Action dated Jan. 15, 2014 in Japanese Patent Application No. 2010-516334, filed Oct. 21, 2010. |
| Office Action dated Aug. 30, 2013 in Japanese Patent Application No. 2010-542486, filed Mar. 31, 2011. |
| Office Action dated Jan. 6, 2014 in Japanese Patent Application No. 2011-516935, filed Oct. 27, 2011. |
| Office Action dated Feb. 13, 2014 in Japanese Patent Application No. 2011-517725, filed Nov. 17, 2011. |
| Office Action dated May 28, 2013 in Japanese Patent Application No. 2012-516452, filed Dec. 6, 2012. |
| Office Action dated Dec. 3, 2013 in Japanese Patent Application No. 2012-516452, filed Dec. 6, 2012. |
| Office Action dated Jul. 18, 2014 in Japanese Patent Application No. 2012-516452, filed Dec. 6, 2012. |
| Office Action dated Aug. 7, 2013 in Korean Patent Application No. 10-2012-7001798, filed Jan. 20, 2012. |
| Office Action dated Sep. 15, 2014 in Malaysian Patent Application No. PI201000142, filed Jul. 11, 2008. |
| Office Action dated Dec. 5, 2013 in Mexican Patent Application No. MX/a/2010/007962, filed Jul. 7, 2009. |
| Office Action dated May 20, 2013 in Mexican Patent Application No. MX/a/2011/000657, filed Jul. 15, 2009. |
| Office Action dated Oct. 29, 2013 in Mexican Patent Application No. MX/a/2011/000657, filed Jul. 15, 2009. |
| Office Action dated Jul. 2, 2014 in Mexican Patent Application No. MX/a/2011/000657, filed Jul. 15, 2009. |
| Office Action dated Nov. 29, 2013 in New Zealand Patent Application No. 612603, filed Jun. 27, 2013. |
| Office Action dated Apr. 5, 2013 in Russian Patent Application No. 2011105073/10, filed Jul. 2, 2009. |
| Office Action dated Oct. 21, 2013 in Russian Patent Application No. 2011105073/10, filed Jul. 2, 2009. |
| Office Action dated Aug. 1, 2013 in Russian Patent Application No. 2011105885/10, filed Jul. 15, 2009. |
| Office Action dated Feb. 27, 2014 in Russian Patent Application No. 2011105885/10, filed Jul. 15, 2009. |
| Office Action dated Jun. 26, 2014 in Russian Patent Application No. 2012101946/10, filed Jun. 25, 2010. |
| Written Opinion in Singaporean Patent Application No. 201304594-3, filed Dec. 22, 2011. |
| Certificate of South African Patent, issued Oct. 30, 2013 in South African Patent Application No. 2010/05917, filed Aug. 19, 2010. |
| Office Action dated Sep. 18, 2014 in Thailand Patent Application No. 1101003761, filed Dec. 21, 2011. |
| Notice of Allowance dated Oct. 28, 2013 in U.S. Appl. No. 13/001,111, § 371 (c) date Dec. 23, 2010. |
| Office Action dated Jul. 12, 2013 in U.S. Appl. No. 13/054,452, § 371 (c) date Apr. 19, 2011. |
| Office Action dated May 8, 2014 in U.S. Appl. No. 13/054,452, § 371 (c) date Apr. 19, 2011. |
| Office Action dated Nov. 25, 2013 in U.S. Appl. No. 13/734,886, filed Jan. 4, 2013. |
| Office Action dated Mar. 20, 2014 in U.S. Appl. No. 13/734,886, filed Jan. 4, 2013. |
| Office Action dated Sep. 12, 2013 in U.S. Appl. No. 13/748,531, filed Jan. 23, 2013. |
| Office Action dated Jun. 18, 2014 in U.S. Appl. No. 13/748,531, filed Jan. 23, 2013. |
| Office Action dated Jul. 17, 2013 in U.S. Appl. No. 13/003,570, § 371 (c) date Apr. 26, 2011. |
| Office Action dated May 8, 2014 in U.S. Appl. No. 13/003,570, § 371 (c) date Apr. 26, 2011. |
| English language abstract of Chinese Patent Application No. CN 1861793A, Chinese Patent Office, espacenet database—Worldwide (2006). |
| Office Action dated Apr. 24, 2013 in Eurasian Patent Application No. 201001198, filed Dec. 26, 2012. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Oct. 7, 2016, in EP Application No. 10791119.0, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Denis, J., et al., “Immunogenicity of papaya mosaic virus-like particles fused to a hepatitis C virus epitope: Evidence for the critical function of multimerization,” Virology 363:59-68, Elsevier Inc., United States (2007). |
| GenBank, “Influenza A virus (A/Indonesia/5/05(H5N1)) segment 4 hemagglutinin (HA) gene, complete cds,” Accession No. EF541394.1, accessed at www.ncbi.nlm.nih.gov/nuccore/145284449?sat=12&satkey=4030144, accessed on Jun. 1, 2016, 2 pages. |
| Naito, T., et al., “Involvement of Hsp90 in Assembly and Nuclear Import of Influenza Virus RNA Polymerase Subunits,” Journal of Virology 81(3):1339-1349, American Society for Microbiology, United States (2007). |
| Office Action dated Aug. 12, 2016, in Chinese Patent Application No. 201310021693.8, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated May 18, 2016, in Egyptian Patent Application No. PCT 61/2010, applicant Medicago, Inc. |
| Office Action dated Oct. 1, 2015, in Eurasian Patent Application No. 201001198, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Foreign Associate Letter dated Aug. 24, 2016, regarding Office Action in Indonesian Patent Application No. W-00201000109, applicant Medicago, Inc. |
| Office Action, Notice of Final Rejection, dated Jan. 22, 2016, in Korean Patent Application No. 10-2010-7018343, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action, Reexamination, dated Jun. 2 2016, in Korean Patent Application No. 10-2010-7018343, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated Feb. 12, 2016, in U.S. Appl. No. 13/734,886, applicant Medicago, Inc., filed Jan. 4, 2013. |
| Notice of Allowance dated May 31, 2016, in U.S. Appl. No. 13/734,886, applicant Medicago, Inc., filed Jan. 4, 2013. |
| Notice of Allowance dated May 26, 2016, in U.S. Appl. No. 13/748,531, applicant Medicago, Inc., filed Jan. 23, 2013. |
| Notice of Allowance dated Jun. 29, 2016, in U.S. Appl. No. 13/003,570, applicant Medicago, Inc., filed Apr. 26, 2011. |
| Notice of Allowance dated May 31, 2016, in Canadian Patent Application No. 2,730,171, applicant Medicago, Inc., filed Jul. 7, 2009. |
| Waterhouse, P.M. and Helms, K., “Purification of Particles of Subterranean Clover Red Leaf Virus Using an Industrial-Grade Cellulase,” Journal of Virological Methods 8:321-329, Elsevier Science Publishers B.V., Netherlands (1984). |
| Office Action dated Oct. 4, 2016, in Canadian Patent Application No. 2,772,964, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Notice of Reexamination issued Sep. 20, 2016, in Chinese Patent Application No. 201080042336.4, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Communication pursuant to Article 94(3) EPC dated Nov. 17, 2015, in European Patent Application No. 10818191.8, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Communication pursuant to Article 94(3) EPC dated Jul. 26, 2016, in European Patent Application No. 10818191.8, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Foreign Associate Letter dated Jan. 22, 2016, regarding Office Action in Indonesian Patent Application No. W-00201201507, filed Aug. 1, 2007, applicant Medicago, Inc. |
| Notification of Defects dated May 23, 2016, in Israeli Patent Application No. 218422, applicant Medicago, Inc., filed Mar. 1, 2012. |
| GenBank, “hemagglutinin, partial [Influenza A virus (A/Indonesia/5/2005(H5N1))],” Accession No. ABW06108.1, accessed at https://www.ncbi.nlm.nih.gov/protein/157955423/, accessed on Dec. 20, 2016, 2 pages. |
| Kost, T.A., et al., “Baculovirus as versatile vectors for protein expression in insect and mammalian cells,” Nature Biotechnology 23(5):567-575, Nature Publishing Group, United States (2005). |
| Ma, J.K-C., et al., “Antibody processing and engineering in plants, and new strategies for vaccine production,” Vaccine 23:1814-1818, Elsevier Ltd., England (2005). |
| UniProt, “P09345 (HEMA_159A0),” accessed at http://www.uniprot.org/uniprot/P09345, accessed on Dec. 20, 2016, 9 pages. |
| Examination Report dated Sep. 7, 2016, in Australian Patent Application No. 2011349031, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Notice of Allowance dated Nov. 2, 2016, in Canadian Patent Application No. 2,821,574, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Aug. 10, 2016, in European Patent Application No. 11851176.5, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Decision to Grant a Patent dated Oct. 11, 2016, in Japanese Patent Application No. 2013-544982, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Substantive Examination Adverse Report dated Sep. 30, 2016, in Malaysian Patent Application No. PI 2013701052, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Foreign Associate Letter dated May 11, 2016, regarding Office Action, in Mexican Patent Application No. MX/a/2013/007270, applicant Medicago, Inc., filed Jun. 21, 2013. |
| Office Action dated Nov. 21, 2016, in Russian Patent Application No. 2013133734, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated Jun. 16, 2016, in U.S. Appl. No. 13/992,893, applicant Medicago, Inc., filed Aug. 23, 2013. |
| Foreign Associate Letter dated Jun. 16, 2016, regarding Office Action, Paper No. 08, dated Jun. 10, 2016, in Philippine Patent Application No. 1-2012-500565, applicant Medicago, Inc., filed Mar. 20, 2012. |
| Written Opinion dated May 17, 2016, in Singaporean Patent Application No. 201201471-8, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Jan. 12, 2016, in U.S. Appl. No. 13/497,767, applicant Medicago, Inc., filed Mar. 22, 2012. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Feb. 5, 2016, in European Patent Application No. 09797336.6, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Decision to grant a European patent pursuant to Article 97(1) EPC dated May 27, 2016, in European Patent Application No. 09797336.6, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jun. 24, 2016, in Korean Patent Application No. 10-2011-7002827, applicant Medicago, Inc., filed Feb. 7, 2011. |
| Office Action dated Mar. 31, 2016, in Malyasian Patent Application No. PI2011000210, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jan. 7, 2016, in U.S. Appl. No. 13/054,452, applicant Medicago, Inc., filed Apr. 19, 2011. |
| Notice of Allowance dated Oct. 4, 2016, in U.S. Appl. No. 13/054,452, applicant Medicago, Inc., filed Apr. 19, 2011. |
| GenBank, “Binary vector pEAQ-HT, complete sequence,” Accession No. GQ497234.1, accessed at https://www.ncbi.nlm.nih.gov/nuccore/GQ497234, accessed on Dec. 20, 2016, 5 pages. |
| Sainsbury, F., et al., “pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants,” Plant Biotechnology Journal 7:682-693, Blackwell Publishing Ltd., England (2009). |
| Examination Report dated Apr. 22, 2016, in Australian Patent Application No. 2011325827, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Notice of Acceptance dated Jul. 22, 2016, in Australian Patent Application No. 2011325827, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Decision on Rejection issued May 31, 2016, in Chinese Patent Application No. 201180064127.4, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Feb. 4, 2016, in European Patent Application No. 11837364.6, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated May 19, 2016, in European Patent Application No. 11837364.6, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Decision to grant a European patent pursuant to Article 97(1) EPC dated Sep. 29, 2016, in European Patent Application No. 11837364.6, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Decision to Grant dated Sep. 6, 2016 in Japanese Patent Application No. 2013-536965, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Office Action dated Mar. 14, 2016, in U.S. Appl. No. 13/883,439, applicant Medicago, Inc., filed Jul. 17, 2013. |
| Orlic, I.J.D., “Protoplast preparation (from plant tissue),” Ivaan.com, accessed at http://www.ivaan.com/protocols/128.html, Dec. 2006, accessed on May 8, 2014, 1 page. |
| Cover Page of Australian Patent, issued Mar. 19, 2015, in Australian Patent No. 2010265766, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Certificate of Australian Patent, dated Nov. 12, 2015, in Australian Patent No. 2010300034, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Notification of Reexamination dated May 26, 2015, in Chinese Patent Application No. 200980126670.5, applicant Medicago, Inc., filed Jul. 7, 2009. |
| Office Action dated Sep. 7, 2015, in Chinese Patent Application No. 201180064127.4, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Decision on rejection issued Dec. 14, 2015, in Chinese Patent Application No. 200980136376.2, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Nov. 26, 2015, in Chinese Patent Application No. 201310021693.8, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Communication pursuant to Article 94(3) EPC dated Aug. 12, 2015, in European Patent Application No. 09797336.6, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Summons to attend oral proceedings pursuant to Rule 115(1) EPC mailed Oct. 30, 2015, in European Patent Application No. 10791119.0, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Notice of Allowability dated Sep. 18, 2015, in Indonesian Patent Application No. W-00201002481, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Certificate of Israeli Patent, granted May 27, 2015, in Israeli Patent No. 230708, applicant Medicago, Inc., filed Nov. 7, 2008. |
| Office Action dated Oct. 27, 2015, in Japanese Patent Application No. 2013-536965, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Office Action dated Dec. 8, 2015, in Japanese Patent Application No. 2013-544982, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated Oct. 21, 2014, in Israeli Patent Application No. 218422, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Aug. 6, 2015, in Indian Patent Application No. 212/DELNP/2010, applicant Medicago, Inc., filed Jan. 12, 2010. |
| Decision of Grant dated Aug. 17, 2015, in Japanese Patent Application No. 2011-516935, applicant Medicago, Inc., filed Jul. 7, 2009. |
| Decision of Grant dated Aug. 17, 2015, in Japanese Patent Application No. 2011-517725, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jun. 16, 2015, in Japanese Patent Application No. 2012-516452, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Office Action dated Jun. 2, 2015, in Japanese Patent Application No. 2014-076395, applicant Medicago, Inc., filed Apr. 2, 2014. |
| Office Action dated Aug. 19, 2015, in Korean Patent Application No. 10-2011-7002827, applicant Medicago, Inc., filed Feb. 7, 2011. |
| Foreign Associate Letter regarding Office Action dated Dec. 7, 2015, in Mexican Patent Application No. MX/a/2011/013517, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Foreign Associate Letter regarding Office Action dated Jun. 15, 2015, in Mexican Patent Application No. MX/a/2011/013517, applicant Medicago, Inc., filed Jun. 25, 2010. |
| Office Action dated Jan. 22, 2015, in Russian Patent Application No. 2012101946/10(002681), applicant Medicago, Inc., filed Jun. 25, 2010. |
| Notice of Allowance dated Apr. 21, 2015, in Russian Patent Application No. 2012101946/10(002681), applicant Medicago, Inc., filed Jun. 25, 2010. |
| Office Action dated Oct. 7, 2015, in Russian Patent Application No. 2013133734, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated Aug. 14, 2015, in Singaporean Patent Application No. 2013053467, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Notice of Allowance dated Nov. 27, 2015, in Taiwanese Patent Application No. 100147730, applicant Medicago, Inc., filed Dec. 21, 2011. |
| Office Action dated Feb. 9, 2015, in U.S. Appl. No. 13/054,452, applicant Medicago, Inc., filed Apr. 19, 2011. |
| Advisory Action dated Nov. 3, 2015, in U.S. Appl. No. 13/734,886, applicant Medicago, Inc., filed Jan. 4, 2013. |
| Office Action dated Oct. 6, 2015, in U.S. Appl. No. 13/748,531, applicant Medicago, Inc., filed Jan. 23, 2013. |
| Office Action dated Dec. 2, 2015, in U.S. Appl. No. 13/003,570, applicant Medicago, Inc., filed Apr. 26, 2011. |
| Search Report completed Jul. 28, 2015, in Singaporean Patent Application No. 2013053467, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office action dated Sep. 15, 2017, for India Patent Application No. 650/DELNP/2012, Intellectual Property India, New Delhi, India. |
| Office action dated Jun. 8, 2017, for Vietnamese Patent Application No. 1-2012-00186, National Office of Intellectual Property, Hanoi, Vietnam. |
| Office action dated May 1, 2017, for India Patent Application No. 9255/DELNP/2010, Intellectual Property India, New Delhi, India. |
| Siminis, C.I., et al., “Catalase Is Differentially Expressed in Dividing and Nondividing Protoplasts,” Plant Physiol. Aug. 1994;105(4):1375-1383, Am. Soc. Plant Biologists, Rockville, MD. |
| Excerpted file history, U.S. Appl. No. 13/497,767, USPTO Office actions dated Jun. 30, 2017 and Nov. 25, 2016, U.S. Patent and Trademark Office, Alexandria, VA. |
| “Notification of Patent Registration Formalities” and “Notification on Grant of Patent Right for Invention,” for CN application No. 200980136376.2, dispatched Jun. 8, 2017, The State Intellectual Property Office of the People's Republic of China, Beijing, China. |
| “Decision for Patent Grant,” for KR Appl. No. 10-2011-7002827, dated Apr. 25, 2017, KIPO, Daejeon, South Korea. |
| “Notification of Reexamination,” for CN application No. 20110064127.4, dated May 8, 2017, The State Intellectual Property Office of the People's Republic of China, Beijing, China. |
| “Notification of defects” for Israeli patent application No. 251338, dated Jul. 26, 2017, The Registrar of Patents, Jerusalem, Israel. |
| “Substantive Examination Report” for Philippine application No. 1-2013-501230, dated Sep. 4, 2017, Intellectual Property Office of the Philippines, Taguig City, Philippines. |
| Office action for Russian Application No. 2013133734, dated Jun. 15, 2017, Federal Service for Intellectual Property (ROSPATENT), Moscow, Russia. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Apr. 3, 2017, in EP Application No. 10791119.0, European Patent Office, Munich, Germany. |
| Office action dated May 17, 2016, for Japanese Patent Application No. 2014-076395, Japanese Patent Office, Tokyo, Japan. |
| Foreign Associate Letter dated Feb. 20, 2017 regarding Office Action dated Feb. 15, 2017, in Mexican Patent Application No. MX/a/2011/013517, Mexican Institute of Industrial Property, Mexico City, Mexico. |
| Office action dated Apr. 5, 2017, for Vietnamese Patent Application No. 1-2012-00186, National Office of Intellectual Property, Hanoi, Vietnam. |
| Examination Report dated Oct. 28, 2016, for Korean Patent Application No. UAE/P/0043/2010, KIPO, Daejeon, South Korea. |
| Office Action dated Mar. 28, 2017, for Chinese Patent Application No, 201310021693.8, The State Intellectual Property Office of the People's Republic of China, Beijing, China. |
| Office action dated Dec. 26, 2016, for Japanese Patent Application No. 2016-000233, Japanese Patent Office, Tokyo, Japan. |
| Excerpted file history, U.S. Appl. No. 15/256,119, USPTO Office action dated Apr. 6, 2017, U.S. Patent and Trademark Office, Alexandria, VA. |
| Park, Kwan-Hwa, “Microbial production of yeast and plant cell wall lytic enzyme,” Research Report from University of Seoul, Research conducted from Oct. 1, 1984 to Sep. 30, 1987 (1988). |
| Examination Report dated Oct. 28, 2016, for Korean Patent Application No. UAE/P/0287/2012, KIPO, Daejeon, South Korea. |
| Communication under Rule 71(3) EPC, Intention to Grant, dated Apr. 10, 2017, in European Patent Application No. 10818191.8, European Patent Office, Munich, Germany. |
| Foreign Associate Letter dated Jan. 22, 2016, regarding Office action issued Dec. 3, 2015 in Indonesian Patent Application No. W-00201201507, Directorate General of Intellectual Property (DGIP), Jakarta Selatan, Indonesia. |
| Office action forwarded dated Mar. 15, 2017 in Korean Patent Application No. 10-2012-7010044, KIPO, Daejeon, South Korea. |
| Examination Report dated Nov. 10, 2016, in Singaporean Patent Application No. 201201471-8, Hungarian Intellectual Property Office, Budapest, Hungary. |
| De Vries, R.P., et al., “The Influenza A virus hemagglutinin glycosylation state affects receptor-binding specificity,” Virology 403:17-25, Elsevier Inc., United States (2010). |
| Search Report dated Apr. 6, 2016, for Korean Patent Application No. UAE/P/0065/2011, KIPO, Daejeon, South Korea. |
| Examination Report No. 1 dated Sep. 28, 2016, for Australian Patent Application No. 2015202195, Australian Patent Office, Sydney, Australia. |
| Office Action dated Dec. 7, 2016, for Canadian Patent Application No. 2,730,668, Canadian Intellectual Property Office, Vancouver, Canada. |
| Office Action dated Nov. 24, 2016, for Indonesian Patent Application No. W00201100221, General of Intellectual Property (DGIP), Jakarta Selatan, Indonesia. |
| Certificate of Grant dated Nov. 24, 2016, for Australian Patent Application No. 2011325827, Australian Patent Office, Sydney, Australia. |
| Excerpted file history, U.S. Appl. No. 13/883,439, USPTO Office action dated Jan. 19, 2017, U.S. Patent and Trademark Office, Alexandria, VA. |
| Office Action dated Feb. 23, 2017, for Chinese Patent Application No. 201180065696.0, The State Intellectual Property Office of the People's Republic of China, Beijing, China. |
| Decision to grant a European patent pursuant to Article 97(1) EPC, dated Jan. 19, 2017, for European Patent Application No. 11851176.5, European Patent Office, Munich, Germany. |
| Letters Patent dated Nov. 11, 2016, for Japanese Patent 6038041 (Patent Application No. 2013-544982), Japanese Patent Office, Tokyo, Japan. |
| Invitation to Respond to Written Opinion dated Apr. 13, 2017 and Written Opinion dated Feb. 28, 2017 for Singapore Patent Application No. 10201605096Q, Intellectual Property Office of Singapore, Singapore. |
| Excerpted file history, U.S. Appl. No. 13/992,893, USPTO Office action dated Mar. 30, 2017, U.S. Patent and Trademark Office, Alexandria, VA. |
| Davey, M.R., et al., “Plant protoplasts: status and biotechnological perspectives,” Biotechnology Advances 23(2):131-171, Elsevier Science, England (2005). |
| Gomord, V., et al., “Plant-specific glycosylation patterns in the context of therapeutic protein production,” Plant Biotechnology Journal 8(5):564-587, Oxford Wiley on behalf of the Society for Experimental Biology, Association of Applied Biologists, England (Jun. 2010). |
| Helenius, A. and Aebi, M., “Roles of N-Linked Glycans in the Endoplasmic Reticulum,” Annu. Rev. Biochem 73:1019-1049, Annual Reviews, United States (2004). |
| Power, J.B. and Cocking, E.C., “A Simple Method for the Isolation of Very Large Number of Leaf Protoplasts by using Mixtures of Cellulase and Pectinase,” Biochem J. 111(5):33P, Portland Press on behalf of the Biochemical Society, England (1969). |
| Sørensen, H.P. and Mortensen, K.K., “Advanced genetic strategies for recombinant protein expression in Escherichia coil,” Journal of Biotechnology 115(2):113-128, Elsevier Science Publishers, Netherlands (2005). |
| Takahashi, Y., et al., “A high-throughput screen of cell-death-inducing factors in Nicotiana benthamiana identifies a novel MAPKK that mediates INF1-induced cell death signaling and non-host resistance to Pseudomonas cichorii,” The Plant Journal 49(6):1030-1040, Oxford : Blackwell Scientific Publishers and BIOS Scientific Publishers in association with the Society for Experimental Biology, England (2007). |
| Wang, W., et al., “Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response,” TRENDS in Plant Science 9(5):244-252, Oxford : Elsevier Science, Ltd., England (2004). |
| Yigzaw, Y., et al., “Exploitation of the Adsorptive Properties of Depth Filters for Host Cell Protein Removal during Monoclonal Antibody Purification,” Biotechnol. Prog. 22(1):288-96, American Institute of Chemical Engineers, United States (2006). |
| Yokoyama, N., et al., “Co-expression of human chaperone Hsp70 and Hsdj or Hsp40 co-factor increases solubility of overexpressed target proteins in insect cells,” Biochimica et Biophysica Acta 1493:119-124, Elsevier Pub Co., Netherlands (2000). |
| Notice of Acceptance dated Jul. 2, 2015, in Australian Patent Application No. 2009267769, applicant Medicago Inc., filed Dec. 16, 2010. |
| Australian 2009270404 Examination Report dated Dec. 16, 2014. |
| Australian 2009270404 Examination Report dated May 7, 2015. |
| Australian 2010300034 Examination Report dated Nov. 6, 2013. |
| Australian 2010300034 Examination Report dated Dec. 24, 2014. |
| Office Action dated May 4, 2015, in Canadian Patent Application No. 2,730,171, applicant Medicago, Inc., filed Jul. 7, 2009. |
| Notice of Allowance dated Jun. 1, 2015, in Canadian Patent Application No. 2,730,185, applicant Medicago, Inc., filed Jul. 2, 2009. |
| Office Action dated Apr. 14, 2015, in Canadian Patent Application No. 2,730,668, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jul. 16, 2015, in Canadian Patent Application No. 2,821,574, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated May 26, 2015, in Chinese Patent Application No. 201310021693.8, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated Nov. 26, 2014, in Chinese Patent Application No. 201180064127.4, applicant Medicago, Inc., filed Nov. 3, 2011. |
| Office Action dated Mar. 25, 2015, in Chinese Patent Application No. 200980136376.2, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jul. 29, 2013, in Chinese Patent Application No. 201080042336.4, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Apr. 24, 2014, in Chinese Patent Application No. 201080042336.4, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Nov. 15, 2014, in Chinese Patent Application No. 201080042336.4, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Decision on Rejection dated May 28, 2015, in Chinese Patent Application No. 201080042336.4, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Dec. 23, 2014, in Chinese Patent Application No. 201180065696.0, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Decision on Rejection dated Jun. 26, 2015, in Chinese Patent Application No. 201180065696.0, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated Jun. 24, 2015, in Chinese Patent Application No. 201280047819.2, applicant Medicago, Inc., filed Sep. 28, 2012. |
| Decision to Grant dated Apr. 23, 2015, in European Patent No. 2294202, filed Jul. 7, 2009. |
| Office Action dated Mar. 27, 2015, in European Patent Application No. 11837364.6, applicant Medicago, Inc., filed Nov. 3, 2011. |
| European Patent Application No. 10818191.8 Examination Report dated Oct. 23, 2013. |
| Office Action dated Aug. 18, 2014, in European Patent Application No. 10818191.8, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Jan. 20, 2015, in European Patent Application No. 11 851 176.5, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Office Action dated Sep. 22, 2014, in Indonesian Patent Application No. W-00201002481, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated Jan. 9, 2015, in Indonesian Patent Application No. W-00201002481, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated Jan. 13, 2015, in Japanese Patent Application No. 2011- 516934, applicant Medicago, Inc., filed Oct. 27, 2011. |
| Final Office Action dated Dec. 24, 2014, Japanese Patent Application No. 2011-516935, applicant Medicago, Inc., filed Oct. 27, 2011. |
| Office Action dated Jan. 26, 2015, Japanese Patent Application No. 2011-517725, applicant Medicago, Inc., filed Nov. 17, 2011. |
| Office Action dated Oct. 29, 2013, in Japanese Patent Application No. 2012-530060, applicant Medicago, Inc., filed Feb. 14, 2013. |
| Office Action dated May 27, 2015, in Japanese Patent Application No. 2014-039035, applicant Medicago, Inc., filed May 29, 2014. |
| Office Action dated Dec. 22, 2014, in Korean Patent Application No. 10-2010-7002538, applicant Medicago, Inc., filed Jul. 11, 2008. |
| Decision of Grant dated Jul. 20, 2015, in Korean Patent Application No. 10-2010-7002538, applicant Medicago, Inc., filed Jul. 11, 2008. |
| Office Action dated May 21, 2015, in Korean Patent Application No. 10-2010-7018343, applicant Medicago, Inc., filed Jan. 12, 2009. |
| Office Action dated Feb. 11, 2014, in Mexican Patent Application No. MX/a/20I2/003372, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Aug. 27, 2014, in Mexican Patent Application No. MX/a/2012/003372, applicant Medicago, Inc., filed Sep. 21, 2010. |
| New Zealand 612603 Examination Report dated Mar. 19, 2015. |
| Notice of Acceptance dated Jul. 1, 2015, in New Zealand Patent Application No. 612603, applicant Medicago, Inc., filed Dec. 22, 2011. |
| Decision of Grant dated Jan. 23, 2015, in Russian Patent Application No. 2011105885/10, applicant Medicago, Inc., filed Jul. 15, 2009. |
| Office Action dated Jun. 19, 2014, in Russian Patent Application No. 2012115996/10, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Office Action dated Nov. 12, 2014, in Russian Patent Application No. 2012115996/10, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Notice of Allowance dated May 5, 2015, in Russian Patent Application No. 2012115996/10, applicant Medicago, Inc., filed Sep. 21, 2010. |
| Certificate of Singaporean Patent, issued Aug. 26, 2014, in Singaporean Patent No. 187500, filed Jan. 12, 2009. |
| Search Report and Written Opinion dated Apr. 16, 2014, in Singaporean Patent Application No. 201201471-8, filed Sep. 21, 2010. |
| Office Action dated Apr. 27, 2015, in Taiwanese Patent Application No. 100147730, applicant Medicago, Inc. |
| Office Action dated Dec. 5, 2014, in U.S. Appl. No. 13/734,886, filed Jan. 4, 2013. |
| Office Action dated Jun. 25, 2015, in U.S. Appl. No. 13/734,886, filed Jan. 4, 2013. |
| Office Action dated Jan. 5, 2015, in U.S. Appl. No. 13/748,531, filed Jan. 23, 2013. |
| Final Office Action dated Jun. 23, 2015, in U.S. Appl. No. 13/748,531, filed Jan. 23, 2013. |
| Office Action dated Sep. 4, 2014, in U.S. Appl. No. 13/497,767, 371 Date Mar. 22, 2012. |
| Office Action dated Jun. 24, 2015, in U.S. Appl. No. 13/497,767, 371 Date Mar. 22, 2012. |
| Office Action dated Feb. 11, 2015, in U.S. Appl. No. 13/003,570, 371 Date Apr. 26, 2011. |
| Number | Date | Country | |
|---|---|---|---|
| 20120189658 A1 | Jul 2012 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61220161 | Jun 2009 | US |
