Chimeric mammalian NPY Y.sub.5 receptors

TECHNICAL FIELD
The present invention relates to mammalian neuropeptide Y (NPY) receptors. More particularly, it relates to chimeric mammalian NPY Y.sub.5 receptors, nucleic acids and vectors encoding the receptors, methods for making the receptors, fragments or fusion proteins thereof using recombinant DNA methodology or chemical synthesis, and to methods for using the receptors in screening systems to identify compounds for the treatment of various diseases.
BACKGROUND OF THE INVENTION
Neuropeptide Y (NPY) is a 36 amino acid peptide that is widely distributed in both the central and peripheral nervous systems (1). As might be expected from its widespread distribution, NPY has a plethora of physiological actions, including effects on blood pressure, hormone release, gut motility, smooth muscle tone, sleep and circadian rhythms, feeding, thermogenesis, neuronal excitability, nociception, cognition, mood and emotional responses. NPY mediates these physiological effects via interaction with at least six distinct G protein-coupled receptors (designated Y.sub.1 -Y.sub.6) (2). It is possible that additional NPY receptors remain to be cloned and characterized. Available data indicate that the NPY Y.sub.5 receptor mediates the effects of NPY on feeding, thermogenesis, neuronal excitability and seizure activity, diuresis, natriuresis and calciuresis (3,4,5).
Several lines of evidence suggest that NPY plays a key role in the control of body weight. Central administration of NPY increases food intake and decreases thermogenesis in satiated animals while reductions in endogenous NPY via antisense oligonucleotide or immunoneutralization techniques leads to a decrease in food intake (1,6,7). As would be expected for an orexigenic peptide, hypothalamic NPY peptide and mRNA levels are increased after fasting and in genetically obese mice (8). In fact, recent experiments with transgenic mice lacking NPY indicate that NPY is required for the maintenance of the obese phenotype of ob/ob mice (9). Conversely, the satiety signal leptin appears to decrease food intake and body weight in part by decreasing NPY synthesis and release (10). The pharmacological properties of the Y.sub.5 receptor subtype most closely match the pharmacological properties of the receptor mediating the effects of NPY on feeding (3). These data suggest that NPY is a key modulator of body weight and that NPY Y.sub.5 receptor antagonists will be useful anti-obesity agents.
NPY has also been shown to block kainic acid-induced seizures in rats, suggesting that NPY may be a potent anti-epileptic agent (4). The pharmacological properties of the receptor that mediate the anti-epileptic effects of NPY are similar to the pharmacological properties of the Y.sub.5 receptor (4). Therefore, NPY Y.sub.5 receptor agonists may be useful anti-epileptic agents.
NPY also elicits a diuretic, natriuretic and calciuretic effect in the kidney (5). Again, the pharmacological properties of the receptor that mediates these effects are similar to the pharmacological properties of the Y.sub.5 receptor (5). It is conceivable, therefore, that NPY Y.sub.5 receptor agonists would be effective anti-hypertensive agents and/or useful in the treatment of disorders of calcium metabolism.
NPY has numerous physiological effects which cannot yet be conclusively ascribed to a particular NPY receptor subtype (1). It is certainly possible that some of these effects are due to interaction of NPY with the Y.sub.5 receptor. The involvement of NPY in sleep and other circadian rhythms suggests that Y.sub.5 receptor agonists might be useful in the treatment of sleep disorders, including jet lag. The known effects of NPY on hormone release suggest that Y.sub.5 agonists or antagonists might be useful as contraceptives or in the treatment of infertility or sexual dysfunction. NPY also regulates vascular tone in cerebral vessels, suggesting that Y.sub.5 agonists or antagonists might have value in the treatment of migraine. Since NPY is also known to be involved in the transmission of painful stimuli, Y.sub.5 agonists or antagonists might be useful analgesics. NPY has also been shown to have effects on cognitive processes and, hence, Y.sub.5 receptor agonists or antagonists might be effective cognition-enhancing agents. Disorders of gut motility could also be treated with a Y.sub.5 agonist or antagonist. NPY itself is also anxiolytic and, thus, Y.sub.5 receptor agonists might be useful anxiolytic agents. Finally, NPY is localized in brain regions that play a role in affective disorders, suggesting that Y.sub.5 ligands could be useful antidepressants or antipsychotic agents.
The present inventors have isolated cDNAs encoding the rat and human NPY Y.sub.5 receptors and used those nucleic acids to construct a novel chimeric cDNA construct that enables high levels of human NPY Y.sub.5 receptor expression.
U.S. Pat. No. 5,603,024 ('024 patent) refers to isolated cDNAs encoding human and rat NPY Y.sub.5 receptors. The cDNA sequences disclosed in the '024 patent, however, differ from the sequences of the cDNAs isolated by the present inventors and used in the construction of the novel chimeric receptor cDNA.
For example, the sequences of the human NPY Y.sub.5 receptor isolated by the present inventors and that disclosed in the '024 patent diverge prior to nucleotide number 82 of the '024 sequence. The net result of this divergence is that the translated human NPY Y.sub.5 receptor protein encoded by the '024 patent cDNA has 10 additional amino acids at the amino terminus relative to the translated protein encoded by the human cDNA isolated by the present inventors. Sequencing of the human NPY Y.sub.5 receptor gene reveals that the sequence disclosed in the '024 patent is in reality a genomic sequence.
Likewise, sequence analysis indicates that the rat NPY Y.sub.5 receptor cDNA sequence disclosed in the '024 patent is in fact a genomic sequence.
Similar conclusions were drawn in the recently published International Application WO 97/17440.
In view of the important role of the NPY Y.sub.5 receptor in many physiological processes and medical conditions, there is a need for materials and methods for identifying selective agonists and antagonists of the NPY Y.sub.5 receptor.
SUMMARY OF THE INVENTION
The present invention fills the foregoing need by providing such materials and methods. More particularly, this invention provides novel chimeric mammalian NPY Y.sub.5 receptors, nucleic acids encoding the receptors, and recombinant vectors and host cells comprising such nucleic acids.
The nucleic acids are selected from the group consisting of:
(a) a nucleic acid encoding a chimeric mammalian NPY Y.sub.5 receptor comprising an amino acid sequence defined by SEQ ID NO: 2 or a conservative or allelic variant thereof;
(b) a nucleic acid that hybridizes under moderately stringent conditions to the nucleic acid of (a) and encodes a polypeptide that (i) binds NPY and (ii) is at least 80% identical to a receptor encoded by the nucleic acid of (a); and
(c) a nucleic acid that, due to the degeneracy of the genetic code, encodes a chimeric mammalian NPY Y.sub.5 receptor encoded by a nucleic acid of (a) or (b).
This invention further provides a method for producing a chimeric mammalian NPY Y.sub.5 receptor comprising culturing a host cell comprising a nucleic acid encoding a mammalian NPY Y.sub.5 receptor comprising an amino acid sequence defined by SEQ ID NO: 2 or a conservative or allelic variant thereof, under conditions in which the nucleic acid is expressed. In one embodiment the receptor is isolated from the culture.
The present invention also provides a method for identifying a NPY Y.sub.5 agonist or antagonist comprising:
(a) contacting a chimeric mammalian NPY Y.sub.5 receptor having an amino acid sequence defined by SEQ ID NO: 2 or a conservative or allelic variant thereof, in the presence of a known amount of labeled NPY with a sample to be tested for the presence of a NPY Y.sub.5 agonist or antagonist; and
(b) measuring the amount of labeled NPY specifically bound to the receptor;
whereby a NPY Y.sub.5 agonist or antagonist in the sample is identified by measuring substantially reduced binding of the labeled NPY to the NPY Y.sub.5 receptor, compared to what would be measured in the absence of such agonist or antagonist.
The present invention further provides a functional assay for identifying receptor NPY Y.sub.5 agonists or anatagonists comprsing:
(a) contacting cells expressing a chimeric mammalian NPY Y.sub.5 receptor having an amino acid sequence defined by SEQ ID NO: 2 in the presence of a known amount of forskolin with a sample to be tested for the presence of a NPY Y.sub.5 agonist or antagonist; and
(b) measuring the amount of cyclic AMP (cAMP) present in the cells;
whereby a NPY Y.sub.5 agonist or antagonist in the sample is identified by measuring its effect on the forskolin-stimulated cAMP accumulation in cells expressing a chimeric mammalian NPY Y.sub.5 receptor, compared to what would be measured in the absence of such agonist or antagonist.
In a preferred embodiment, membranes isolated from mammalian cells comprising a nucleic acid encoding the chimeric NPY Y.sub.5 receptor are used as the source of the receptor.
This invention still further provides a method for treating NPY Y.sub.5 receptor-mediated medical conditions comprising administering to a mammal afflicted with a medical condition caused or mediated by NPY Y.sub.5 receptor, an effective amount of an agonist or an antagonist of the NPY Y.sub.5 receptor.
DESCRIPTION OF THE INVENTION
All references cited herein are hereby incorporated herein in their entirety by reference.
As used herein, the term "ligand" is defined to mean any molecule capable of specifically binding to the mammalian NPY Y.sub.5 receptors of the invention. Thus NPY itself is a ligand, as are agonists and antagonists that may compete with NPY for specific binding to the NPY Y.sub.5 receptors.
The term "analog(s)" means a chimeric mammalian NPY Y.sub.5 receptor of the invention which has been modified by deletion, addition, modification or substitution of one or more amino acid residues.
Some amino acid substitutions are preferably "conservative", with residues replaced with physicochemically similar residues, such as Gly/Ala, Asp/Glu, Val/Ile/Leu, Lys/Arg, Asn/Gln and Phe/Trp/Tyr. Analogs having such conservative substitutions typically retain substantial NPY Y.sub.5 binding activity. Other analogs, which have non-conservative substitutions such as Asn/Glu, Val/Tyr and His/Glu, may substantially lack such activity. Nevertheless, such analogs are useful because they can be used as antigens to elicit production of antibodies in an immunologically competent host. Because these analogs retain many of the epitopes (antigenic determinants) of the wild-type receptors from which they are derived, many antibodies produced against them can also bind to the active-conformation or denatured wild-type receptors. Accordingly, such antibodies can also be used, e.g., for the immunopurification or immunoassay of the wild-type receptors.
Some analogs are truncated variants in which residues have been successively deleted from the amino- and/or carboxyl-termini, while substantially retaining the characteristic ligand binding activity.
Modifications of amino acid residues may include but are not limited to aliphatic esters or amides of the carboxyl terminus or of residues containing carboxyl side chains, O-acyl derivatives of hydroxyl group-containing residues, and N-acyl derivatives of the amino-terminal amino acid or amino-group containing residues, e.g., lysine or arginine.
Other analogs are chimeric mammalian NPY Y.sub.5 receptors containing modifications, such as incorporation of unnatural amino acid residues, or phosphorylated amino acid residues such as phosphotyrosine, phosphoserine or phosphothreonine residues. Other potential modifications include sulfonation, biotinylation, or the addition of other moieties, particularly those which have molecular shapes similar to phosphate groups.
Analogs of the chimeric mammalian NPY Y.sub.5 receptors can be prepared by chemical synthesis or by using site-directed mutagenesis [Gillman et al., Gene 8:81 (1979); Roberts et al., Nature 328:731 (1987) or Innis (Ed.), 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, N.Y.] or the polymerase chain reaction method [PCR; Saiki et al., Science 239:487 (1988)], as exemplified by Daugherty et al. [Nucleic Acids Res. 19:2471 (1991)] to modify nucleic acids encoding the complete receptors. Adding epitope tags for purification or detection of recombinant products is envisioned.
General techniques for nucleic acid manipulation and expression that can be used to make the analogs are described generally, e.g., in Sambrook, et al., Molecular Cloning: A Laboratory Manual (2d ed.), 1989, Vols. 1-3, Cold Spring Harbor Laboratory. Techniques for the synthesis of polypeptides are described, for example, in Merrifield, J. Amer. Chem. Soc. 85:2149 (1963); Merrifield, Science 232:341 (1986); and Atherton et al., Solid Phase Peptide Synthesis: A Practical Approach, 1989, IRL Press, Oxford.
Still other analogs are prepared by the use of agents known in the art for their usefulness in cross-linking proteins through reactive side groups. Preferred derivatization sites with cross-linking agents are free amino groups, carbohydrate moieties and cysteine residues.
Protein Purification
The proteins, polypeptides and antigenic fragments of this invention can be purified by standard methods, including but not limited to salt or alcohol precipitation, preparative disc-gel electrophoresis, isoelectric focusing, high pressure liquid chromatography (HPLC), reversed-phase HPLC, gel filtration, cation and anion exchange and partition chromatography, and countercurrent distribution. Such purification methods are well known in the art and are disclosed, e.g., in Guide to Protein Purification, Methods in Enzymology, Vol. 182, M. Deutscher, Ed., 1990, Academic Press, New York, N.Y. More specific methods applicable to purification of the NPY Y.sub.5 receptors are described below.
Purification steps can be followed by carrying out assays for ligand binding activity as described below. Particularly where a receptor is being isolated from a cellular or tissue source, it is preferable to include one or more inhibitors of proteolytic enzymes is the assay system, such as phenylmethanesulfonyl fluoride (PMSF).
Nucleic Acids and Expression Vectors
As used herein, the term "isolated nucleic acid" means a nucleic acid such as an RNA or DNA molecule, or a mixed polymer, which is substantially separated from other components that are normally found in cells or in recombinant DNA expression systems. These components include but are not limited to ribosomes, polymerases, serum components, and flanking genomic sequences. The term thus embraces a nucleic acid which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule includes isolated forms of the molecule.
An isolated nucleic acid will generally be a homogeneous composition of molecules but may, in some embodiments, contain minor heterogeneity. Such heterogeneity is typically found at the ends of nucleic acid coding sequences or in regions not critical to a desired biological function or activity.
A "recombinant nucleic acid" is defined either by its method of production or structure. Some recombinant nucleic acids are thus made by the use of recombinant DNA techniques which involve human intervention, either in manipulation or selection. Others are made by fusing two fragments not naturally contiguous to each other. Engineered vectors are encompassed, as well as nucleic acids comprising sequences derived using any synthetic oligonucleotide process.
For example, a wild-type codon may be replaced with a redundant codon encoding the same amino acid residue or a conservative substitution, while at the same time introducing or removing a nucleic acid sequence recognition site. Similarly, nucleic acid segments encoding desired functions may be fused to generate a single genetic entity encoding a desired combination of functions not found together in nature. Although restriction enzyme recognition sites are often the target of such artificial manipulations, other site-specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design. Sequences encoding epitope tags for detection or purification as described above may also be incorporated.
A nucleic acid "fragment" is defined herein as a nucleotide sequence comprising at least about 17, generally at least about 25, preferably at least about 35, more preferably at least about 45, and most preferably at least about 55 or more contiguous nucleotides.
This invention further encompasses recombinant DNA molecules and fragments having sequences that are identical or highly homologous to those described herein. The nucleic acids of the invention may be operably linked to DNA segments which control transcription, translation, and DNA replication.
"Homologous nucleic acid sequences" are those which when aligned and compared exhibit significant similarities. Standards for homology in nucleic acids are either measures for homology generally used in the art by sequence comparison or based upon hybridization conditions, which are described in greater detail below.
Substantial nucleotide sequence homology is observed when there is identity in nucleotide residues in two sequences (or in their complementary strands) when optimally aligned to account for nucleotide insertions or deletions, in at least about 50%, preferably in at least about 75%, more preferably in at least about 90%, and most preferably in at least about 95% of the aligned nucleotides.
Substantial homology also exists when one sequence will hybridize under selective hybridization conditions to another. Typically, selective hybridization will occur when there is at least about 55% homology over a stretch of at least about 30 nucleotides, preferably at least about 65% over a stretch of at least about 25 nucleotides, more preferably at least about 75%, and most preferably at least about 90% over about 20 nucleotides. See, e.g., Kanehisa, Nucleic Acids Res. 12:203 (1984).
The lengths of such homology comparisons may encompass longer stretches and in certain embodiments may cover a sequence of at least about 17, preferably at least about 25, more preferably at least about 50, and most preferably at least about 75 nucleotide residues.
Stringency of conditions employed in hybridizations to establish homology are dependent upon factors such as salt concentration, temperature, the presence of organic solvents, and other parameters. Stringent temperature conditions usually include temperatures in excess of about 30.degree. C., often in excess of about 37.degree. C., typically in excess of about 45.degree. C., preferably in excess of about 55.degree. C., more preferably in excess of about 65.degree. C., and most preferably in excess of about 70.degree. C. Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 500 mM, more usually less than about 400 mM, preferably less than about 300 mM, more preferably less than about 200 mM, and most preferably less than about 150 mM. For example, salt concentrations of 100, 50 and 20 mM are used. The combination of the foregoing parameters, however, is more important than the measure of any single parameter. See, e.g., Wetmur et al., J. Mol. Biol. 31:349 (1968).
The term "substantially pure" is defined herein to mean a mammalian NPY Y.sub.5 receptor, nucleic acid or other material that is free from other contaminating proteins, nucleic acids, and other biologicals derived from an original source organism or recombinant DNA expression system. Purity may be assayed by standard methods and will typically exceed at least about 50%, preferably at least about 75%, more preferably at least about 90%, and most preferably at least about 95% purity. Purity evaluation may be made on a mass or molar basis.
Nucleic acids encoding the NPY Y.sub.5 receptors or fragments thereof can be prepared by standard methods. For example, DNA can be chemically synthesized using, e.g., the phosphoramidite solid support method of Matteucci et al. [J. Am. Chem. Soc. 103:3185 (1981)], the method of Yoo et al. [J. Biol. Chem. 764:17078 (1989)], or other well known methods. This can be done by sequentially linking a series of oligonucleotide cassettes comprising pairs of synthetic oligonucleotides, as described below.
Of course, due to the degeneracy of the genetic code, many different nucleotide sequences can encode the NPY Y.sub.5 receptors. The codons can be selected for optimal expression in prokaryotic or eukaryotic systems. Such degenerate variants are of course also encompassed by this invention.
Moreover, nucleic acids encoding the NPY Y.sub.5 receptors can readily be modified by nucleotide substitutions, nucleotide deletions, nucleotide insertions, and inversions of nucleotide stretches. Such modifications result in novel DNA sequences which encode antigens having immunogenic or antigenic activity in common with the wild-type receptors. These modified sequences can be used to produce wild-type or mutant receptors, or to enhance expression in a recombinant DNA system.
Insertion of the DNAs encoding the NPY Y.sub.5 receptors into a vector is easily accomplished when the termini of both the DNAs and the vector comprise compatible restriction sites. If this cannot be done, it may be necessary to modify the termini of the DNAs and/or vector by digesting back single-stranded DNA overhangs generated by restriction endonuclease cleavage to produce blunt ends, or to achieve the same result by filling in the single-stranded termini with an appropriate DNA polymerase.
Alternatively, desired sites may be produced, e.g., by ligating nucleotide sequences (linkers) onto the termini. Such linkers may comprise specific oligonucleotide sequences that define desired restriction sites. Restriction sites can also be generated by the use of the polymerase chain reaction (PCR). See, e.g., Saiki et al., Science 239:487 (1988). The cleaved vector and the DNA fragments may also be modified if required by homopolymeric tailing.
Recombinant expression vectors used in this invention are typically self-replicating DNA or RNA constructs comprising nucleic acids encoding one of the receptors, usually operably linked to suitable genetic control elements that are capable of regulating expression of the nucleic acids in compatible host cells. Genetic control elements may include a prokaryotic promoter system or a eukaryotic promoter expression control system, and typically include a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of mRNA expression, a sequence that encodes a suitable ribosome binding site, and sequences that terminate transcription and translation. Expression vectors also may contain an origin of replication that allows the vector to replicate independently of the host cell.
Vectors that could be used in this invention include microbial plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles which may facilitate integration of the nucleic acids into the genome of the host. Plasmids are the most commonly used form of vector but all other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985 and Supplements, Elsevier, N.Y., and Rodriguez et al. (eds.), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, Mass.
Expression of nucleic acids encoding the NPY Y.sub.5 receptors of this invention can be carried out by conventional methods in either prokaryotic or eukaryotic cells. Although strains of E, coli are employed most frequently in prokaryotic systems, many other bacteria such as various strains of Pseudomonas and Bacillus are know in the art and can be used as well.
Prokaryotic expression control sequences typically used include promoters, including those derived from the b-lactamase and lactose promoter systems [Chang et al., Nature 198:1056 (1977)], the tryptophan (trp) promoter system [Goeddel et al., Nucleic Acids Res. 8:4057 (1980)], the lambda P.sub.L promoter system [Shimatake et al., Nature 292:128 (1981)] and the tac promoter [De Boer et al., Proc. Natl. Acad. Sci. USA 292:128 (1983)]. Numerous expression vectors containing such control sequences are known in the art and available commercially.
Suitable host cells for expressing nucleic acids encoding the receptors include prokaryotes and higher eukaryotes. Prokaryotes include both gram negative and positive organisms, e.g., E. coli and B. subtiles. Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
Prokaryotic host-vector systems include a wide variety of vectors for many different species. As used herein, E. coli and its vectors will be used generically to include equivalent vectors used in other prokaryotes. A representative vector for amplifying DNA is pBR322 or many of its derivatives. Vectors that can be used to express the receptors include but are not limited to those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540). See Brosius et al., "Expression Vectors Employing Lambda-, trp-, lac-, and Ipp-derived Promoters", in Rodriguez and Denhardt (eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, pp. 205-236.
Higher eukaryotic tissue culture cells are preferred hosts for the recombinant production of the receptors. Although any higher eukaryotic tissue culture cell line might be used, including insect baculovirus expression systems, mammalian cells are preferred. Transformation or transfection and propagation of such cells has become a routine procedure. Examples of useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines.
Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also usually contain a selection gene or amplification gene. Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus. Representative examples of suitable expression vectors include pCR.RTM.3.1, pCDNA3.1, pClneo, pCD [Okayama et al., Mol. Cell Biol. 5:1136 (1985)], pMC1neo Poly-A [Thomas et al., Cell51:503 (1987)], pREP8, pSVSPORT and derivatives thereof, and baculovirus vectors such as pVL1392, pVL1393, pAcMP2 or pAcMP3.
Screening Systems and Methods
The NPY Y.sub.5 receptors of this invention can be employed in screening systems to identify agonists or antagonists of the receptors. Essentially, these systems provide methods for bringing together a mammalian NPY Y.sub.5 receptor, an appropriate known ligand, including NPY itself, and a sample to be tested for the presence of a NPY Y.sub.5 agonist or antagonist.
Two basic types of screening systems can be used, a labeled-ligand binding assay and a "functional" assay. A labeled ligand for use in the binding assay can be obtained by labeling NPY or a known NPY Y.sub.5 agonist or antagonist with a measurable group. In an example below, .sup.125 I-porcine peptide YY (PYY) is used as the ligand.
Typically, a given amount of one of the NPY Y.sub.5 receptors of the invention is contacted with increasing amounts of a labeled ligand, and the amount of the bound labeled ligand is measured after removing unbound labeled ligand by washing. As the amount of the labeled ligand is increased, a point is eventually reached at which all receptor binding sites are occupied or saturated. Specific receptor binding of the labeled ligand is abolished by a large excess of unlabled ligand.
Preferably, an assay system is used in which non-specific binding of the labeled ligand to the receptor is minimal. Non-specific binding is typically less than 25%, preferably less than 15%, and more preferably less than 10% of the total binding of the labeled ligand.
The amino acid sequence of NPY is conserved among various species, including humans. Therefore, NPY from one species may bind to NPY Y.sub.5 receptors from another species; e.g., porcine NPY binds to the rat receptor, as is illustrated in an Example below. For regulatory purposes, however, it may be desirable to use human NPY or an active fragment thereof as the NPY Y.sub.5 ligand in conjunction with the human receptor when screening for NPY Y.sub.5 receptor agonists or antagonists for human therapeutic purposes.
In principle, a binding assay of the invention could be carried out using a soluble receptor of the invention, e.g., following production and refolding by standard methods from an E. coli expression system, and the resulting receptor-labeled ligand complex could be precipitated, e.g., using an antibody against the receptor. The precipitate could then be washed and the amount of the bound labeled ligand could be measured.
Preferably, however, a nucleic acid encoding one of the NPY Y.sub.5 receptors of the invention is transfected into an apporpriate host cell, whereby the receptor will become incorporated into the membrane of the cell. A membrane fraction can then be isolated from the cell and used as a source of the receptor for assay. Preferably, binding of the labeled ligand to a membrane fraction from the untransfected host cell will be negligible, as is the case with COS-7 cells used in an Example below.
The binding assays of this invention can be used to identify both NPY Y.sub.5 receptor agonists and antagonists, because both will compete for binding to the receptor with the labeled ligand.
In the basic binding assay, the method for identifying a NPY Y.sub.5 receptor agonist or antagonist comprises:
(a) contacting a mammalian NPY Y.sub.5 receptor having an amino acid sequence defined by SEQ ID NO: 2 or a conservative or allelic variant thereof, in the presence of a known amount of labled NPY with a sample to be tested for the presence of a NPY Y.sub.5 receptor agonist or antagonist; and
(b) measuring the amount of labeled NPY bound to the receptor;
whereby a NPY Y.sub.5 receptor agonist or antagonist in the sample is identified by measuring substantially reduced binding of the labeled NPY to the receptor, compared to what would be measured in the absence of such agonist or antagonist.
The present invention further provides a functional assay for identifying receptor NPY Y.sub.5 agonists or anatagonists comprsing:
(a) contacting cells expressing a chimeric mammalian NPY Y.sub.5 receptor having an amino acid sequence defined by SEQ ID NO: 2 or a conservative or allelic variant thereof, in the presence of a known amount of forskolin with a sample to be tested for the presence of a NPY Y.sub.5 agonist or antagonist; and
(b) measuring the amount of cyclic AMP (cAMP) present in the cells;
whereby a NPY Y.sub.5 agonist or antagonist in the sample is identified by measuring its effect on the forskolin-stimulated cAMP accumulation in cells expressing a chimeric mammalian NPY Y.sub.5 receptor, compared to what would be measured in the absence of such agonist or antagonist.
The functional assay is based on the observation that NPY decreases forskolin-stimulated cAMP accumulation in cells expressing the NPY Y.sub.5 receptor. Antagonists are identified by determining their ability to block the inhibition of forskolin-stimulated cAMP activity elicited by NPY. Agonists are identified by their ability to decrease forskolin-stimulated cAMP accumulation in cells expressing the NPY Y.sub.5 receptor.

EXAMPLES
The present invention can be illustrated by the following examples. Unless otherwise indicated, percentages given below for solids in solid mixtures, liquids in liquids, and solids in liquids are on a wt/wt, vol/vol and wt/vol basis, respectively. Sterile conditions were generally maintained during cell culture.
Materials and Methods
Restriction and modification enzymes were obtained from New England Biolabs (Beverly, Mass.), Promega (Madison, Wis.) or Life Technologies (Gaithersburg, Md.).
Standard methods were used, as described, e.g., in Maniatis et al., Molecular Cloning: A Laboratory Manual, 1982, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook et al., Molecular Cloning: A Laboratory Manual, (2d ed.), Vols 1-3, 1989, Cold Spring Harbor Press, NY; Ausubel et al., Biology, Greene Publishing Associates, Brooklyn, NY; or Ausubel, et al. (1987 and Supplements), Current Protocols in Molecular Biology, Greene/Wiley, New York; Innis et al. (eds.) PCR Protocols: A Guide to Methods and Applications, 1990, Academic Press, N.Y.
Isolation of the Human NPY Y.sub.5 Receptor cDNA
Total RNA was isolated from the SK-N-MC human neuroblastoma cell line (American Type Culture Collection, Rockville, Md.) with the Tri Reagent kit (Molecular Research Center, Cincinnati, Ohio) according to the manufacturer's instructions. Poly A.sup.+ RNA was isolated from SK-N-MC cell total RNA with the Fast Track 2.0 kit (InVitrogen, San Diego, Calif.) according to the manufacturer's instructions. SK-N-MC cell cDNA was prepared by reverse transcription with the GeneAmp RNA PCR Kit (Perkin Elmer, Norwalk, Conn.). Reverse transcription was performed in a 20 ul reaction mixture containing 4.56 ug of SK-N-MC cell poly A.sup.+ RNA; 10 mM Tris-Cl (pH 8.3); 5 mM MgCl.sub.2 ; 50 mM KCl; 1 mM each of dATP, dCTP, dTTP and dGTP; 1 U RNase inhibitor; 2.5 U murine Moloney leukemia virus reverse transcriptase; and 0.15 uM oligonucleotide primer having the sequence GGGCTCGAGGTTCTTTCCTTGGTAAACAGTGAG (SEQ ID NO: 3). Nucleotides 10-33 of this primer correspond to nucleotides 1434-1457 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 while nucleotides 14-33 of this primer correspond to nucleotides 1399-1418 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. The reverse transcription mixture was placed in a Perkin Elmer 9600 thermocycler and subjected to one cycle of 42.degree. C. for 15 minutes, 99.degree. C. for 5 minutes and 5.degree. C. for 5 minutes.
The human NPY Y.sub.5 receptor cDNA was isolated from SK-N-MC cell cDNA by the polymerase chain reaction (PCR). The components of the PCR reaction were 10 mM Tris Cl (pH 8.3), 2 mM MgCl.sub.2, 50 mM KCl, 2 ul of SK-N-MC cell cDNA from the reverse transcription reaction and 15 pmol of the oligonucleotide primers GGGGGATCCTGACAAATGTCTTTTTATTCCAAG (sense primer) (SEQ ID NO: 4) and GGGCTCGAGGTTCTTTCCTTGGTAAACAGTGAG (antisense primer) (SEQ ID NO: 5). Nucleotides 10-33 of the sense primer correspond to nucleotides 55-78 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 20-43 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. Nucleotides 10-33 of the antisense primer correspond to nucleotides 1434-1457 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 while nucleotides 14-33 of the antisense primer correspond to nucleotides 1399-1418 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. The PCR reaction was initially denatured at 94.degree. C. for 1 minute. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 30 seconds, annealing at 59.degree. C. for 30 seconds, and elongation at 72.degree. C. for 30 seconds. Subsequently, a final cycle of elongation was performed at 72.degree. C. for 7 minutes. The reaction was then held at 4.degree. C. until use. A 1402 bp product flanked by 5' BamHI and 3' Xhol restriction enzyme sites was obtained in this PCR reaction and was confirmed by DNA sequence analysis to incorporate nucleotides 55-1457 of the sequence reported by Gerald et al in U.S. Pat. No. 5,602,024 and nucleotides 20-1418 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. This 1402 bp product was ligated into the plasmid pCR3.1 (InVitrogen) to yield a construct known as pCR3.1-hY.sub.5A. When transfected into COS1 cells, this construct did not yield detectable expression of the human Y.sub.5 receptor (Table 1).
Examination of the sequence of the 1402 bp human NPY Y.sub.5 receptor cDNA and the sequences reported by Gerald et al. in U.S. Pat. No. 5,602,024 and GenBank accession number U56079 revealed that there were two in frame initiation codons at the 5' end of the cDNA. In an effort to improve expression of the human NPY Y.sub.5 receptor, the 1402 bp human NPY Y.sub.5 receptor cDNA was modified to remove the first initiation codon and the intervening nucleotides between the first and second initiation codons. In addition, a Kozak consensus sequence was added to improve expression. This was accomplished by PCR in which 100 ng of pCR3.1-hY.sub.5A was used as the template along with the oligonucleotide primers TTTGGATCCACCATGGATTTAGAG (sense primer) (SEQ ID NO: 6) and TACCTGACAATGGCAATTGATATT (antisense primer) (SEQ ID NO: 7). Nucleotides 13-24 of the sense primer correspond to nucleotides 91-102 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 56-67 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. The antisense primer corresponds to nucleotides 486-509 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 451-474 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. The PCR reaction was initially denatured at 94.degree. C. for 1 minute. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 45 seconds, annealing at 53.degree. C. for 45 seconds, and elongation at 72.degree. C. for 1 minute. Subsequently, a final cycle of elongation was performed at 72.degree. C. for 7 minutes. The reaction was then held at 4.degree. C. until use. This PCR reaction yielded a 419 bp product that incorporated nucleotides 91-509 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 (nucleotides 56-474 of the sequence deposited by Gerald et al. in GenBank under accession number U56079) flanked by BamHI (5') and Munl (3') restriction enzyme sites. To construct a full length human NPY Y.sub.5 receptor cDNA beginning at the second initiation codon, the plasmid pCR3.1-hY.sub.5 A was digested with BamHI and Munl restriction enzymes and the 5983 bp fragment containing the plasmid backbone and the 3' 983 bp of the human NPY Y.sub.5 receptor cDNA was purified. This 5983 bp fragment was ligated to the 419 bp PCR product, which had also been digested with BamHI and Munl. This plasmid construct is known as pCR3.1-hY.sub.5B. Subsequently, pCR3.1-hY.sub.5 B and the plasmid pcDNA3 (InVitrogen) were digested with the restriction enzymes BamHI and Xbal. The 1350 bp human NPY Y.sub.5 cDNA and the pcDNA3 plasmid were purified and were ligated to one another. The resulting plasmid was designated pcDNA3-hY.sub.5B. When transfected into COS1 cells, this construct did not yield detectable expression of the human Y.sub.5 receptor. (Table 1) In a further effort to improve expression of the human NPY Y.sub.5 receptor, the native 5' untranslated region of the human NPY Y.sub.5 receptor was appended to the 5' end of pCR3.1-hY.sub.5B. The native 5' untranslated region of the human NPY Y.sub.5 receptor cDNA was isolated by 5' rapid amplification of cDNA ends (5' RACE) via the Elongase Kit from Life Technologies (Gaithersburg, Md.). PCR reactions were carried out in a 50 ul volume containing 100 ng DNA from a SK-N-MC cell cDNA library constructed in pcDNA3; 300 nM T7 (sense) primer (TAATACGACTCACTATAGGG (SEQ ID NO: 8)); 100 nM antisense primer (AAGGCATAATATGGCACATGAC (SEQ ID NO: 9) corresponding to nucleotides 424-445 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and nucleotides 389-410 of the sequence deposited by Gerald et al. in GenBank under accession number U56079); 200 uM each of dATP, dCTP, dGTP and dTTP; 60 mM Tris-SO.sub.4 (pH 9.1); 18 mM (NH.sub.4).sub.2 SO.sub.4 ; 1 ul Elongase enzyme mix; and 2 mM MgSO.sub.4. The PCR reaction was initially denatured at 94.degree. C. for 30 seconds. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 30 seconds, annealing at 55.degree. C. for 30 seconds, and elongation at 72.degree. C. for 60 seconds. Subsequently, a final cycle of elongation was performed at 72.degree. C. for 7 minutes. 5 ul of this PCR reaction was then reamplified under the same conditions except that the primers used were 300 nM T7 (sense) primer (TAATACGACTCACTATAGGG (SEQ ID NO: 10)) and 100 nM antisense primer (ACTTACAAATGTATAGAGCCC (SEQ ID NO: 11), corresponding to nucleotides 226-246 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and nucleotides 191-211 of the sequence deposited by Gerald et al. in GenBank under accession number U56079). The resulting 400 bp product was purified and ligated into pCR2.1 (InVitrogen) to yield the plasmid pCR2.1-hY.sub.5 5' UTR . Sequencing of pCR2.1-hY.sub.5 5' UTR revealed that the second initiation codon in the sequence reported by Gerald et al in U.S. Pat. No. 5,602,024 is actually the correct initiation codon. The sequence of the 5' end of the human NPY Y.sub.5 cDNA diverged from the sequence reported by Gerald et al. at nucleotide 82 (nucleotide 47 of the sequence deposited by Gerald et al. in GenBank under accession number U56079). Subsequent analysis revealed that the sequence reported by Gerald et al. prior to the point of divergence from our sequence is actually genomic sequence rather than cDNA sequence. To construct a human NPY Y.sub.5 receptor cDNA expression plasmid that incorporates the native 5' untranslated region of the cDNA, pcDNA3-hY.sub.5B was digested with BamHI, purified, ligated to EcoRI conversion linkers (New England Biolabs) and digested with EcoRI. Simultaneously, pCR2.1-hY.sub.5 5' UTR was digested with EcoRI and the 300 bp fragment corresponding to the 5' untranslated region of the human NPY Y.sub.5 receptor DNA and the first 73 bp of the coding sequence was purified. The first 73 bp of the coding sequence correspond to nucleotides 91-164 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and nucleotides 56-129 of the sequence deposited by Gerald et al. in GenBank under accession number U56079. This 300 bp fragment was ligated to EcoRI digested pcDNA3-hY.sub.5B. The resulting plasmid, designated pcDNA3-hY.sub.5D, contains a 1633 bp DNA insert (SEQ ID NO: 20) consisting of a 6 bp BamH1 site, 254 bp of 5' untranslated sequence, the entire 1338 bp coding region, 29 bp of the 3' untranslated region of the human NPY Y.sub.5 receptor cDNA and a 6 bp Xba1 site. Subsequently, pcDNA3-hY.sub.5D was digested with BamHI and Xbal and the 1621 bp hY.sub.5D cDNA construct was purified and ligated to the expression vector pcDNA3.1 that had been also been digested with BamHI and Xbal. The resulting construct was designated pcDNA3.1-hY.sub.5D. When transfected into COS1 cells, this construct did yield reasonable levels of expression of the human Y.sub.5 receptor. Therefore, the correct coding sequence and the presence of native 5' untranslated sequence is critical for expression of the native human Y.sub.5 receptor.
Isolation of the Rat NPY Y.sub.5 Receptor cDNA
Rat hypothalamus poly A.sup.+ RNA was purchased from Clontech (Palo Alto, Calif.). Rat hypothalamus cDNA was prepared by reverse transcription with the GeneAmp RNA PCR Kit (Perkin Elmer, Norwalk, Conn.). Reverse transcription was performed in a 20 ul reaction mixture containing 200 ng of rat hypothalamus poly A.sup.+ RNA; 10 mM Tris-Cl (pH 8.3); 5 mM MgCl.sub.2 ; 50 mM KCl; 1 mM each of dATP, dCTP, dTTP and dGTP; 1U RNase inhibitor; 2.5 U murine Moloney leukemia virus reverse transcriptase; and 0.15 uM oligonucleotide primer having the sequence GGGCTCGAGGCACAGAGAGAATCATGACATGTG (SEQ ID NO: 12). Nucleotides 10-33 of this primer correspond to nucleotides 1420-1443 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 1385-1408 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. The reverse transcription mixture was placed in a Perkin Elmer 9600 thermocycler and subjected to one cycle of 42.degree. C. for 15 minutes, 99.degree. C. for 5 minutes and 5.degree. C. for 5 minutes.
The rat NPY Y.sub.5 receptor cDNA was isolated via the PCR. The PCR reaction consisted of 10 mM Tris Cl (pH 8.3), 2 mM MgCl.sub.2, 50 mM KCl, 2 ul of rat hypothalamus cDNA from the reverse transcription reaction and 15 pmol of the oligonucleotide primers GGGGGATCCGCTGCTAATGGACGTCCTCTTCTT (SEQ ID NO: 13) (sense primer) and GGGCTCGAGGCACAGAGAGAATCATGACATGTG (SEQ ID NO: 14) (antisense primer). Nucleotides 10-33 of the sense primer correspond to nucleotides 54-77 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 19-42 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. Nucleotides 10-33 of the antisense primer correspond to nucleotides 1420-1443 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 1385-1408 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. The PCR reaction was initially denatured at 94.degree. C. for 1 minute. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 30 seconds, annealing at 57.degree. C. for 30 seconds, and elongation at 72.degree. C. for 30 seconds. Subsequently, a final cycle of elongation was performed at 72.degree. C. for 7 minutes. The reaction was then held at 4.degree. C. until use. A 1402 bp product flanked by 5' BamHI and 3' Xhol restriction enzyme sites was obtained in this PCR reaction and was confirmed by DNA sequence analysis to incorporate nucleotides 54-1443 of the sequence reported by Gerald et al in U.S. Pat. No. 5,602,024 and nucleotides 19-1408 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. This 1402 bp product was ligated into the plasmid pCR3.1 (InVitrogen) to yield a construct known as pCR3.1-rY.sub.5A. When transfected into COS1 cells, this construct yielded reasonable expression of the rat Y.sub.5 receptor (Table 1).
As was the case with the human NPY Y.sub.5 receptor cDNA, examination of the sequence of the 1402 bp rat NPY Y.sub.5 receptor cDNA and the sequences reported by Gerald et al. in U.S. Pat. No. 5,602,024 and GenBank accession number U56078 revealed that there were two in frame initiation codons at the 5' end of the cDNA. In an effort to improve expression of the rat NPY Y.sub.5 receptor, the 1402 bp rat NPY Y.sub.5 receptor cDNA was modified to remove the first initiation codon and the intervening nucleotides between the first and second initiation codons. In addition, a Kozak consensus sequence was added to improve expression. This was accomplished by the PCR. The PCR reaction consisted of 20 mM Tris-Cl (pH 8.8); 2 mM MgSO.sub.4 ; 10 mM KCl; 10 mM (NH.sub.4).sub.2 SO.sub.4 ; 0.1% Triton X-100; 100 ug/ml bovine serum albumin; 25 mM each of dATP, dTTP, dCTP and dGTP; 5 U Pfu polymerase (Stratagene, La Jolla, Calif.); 100 ng pCR3.1-rY.sub.5A ; and 15 pmol of the oligonucleotide primers TTTGGATCCACCATGGAGTTTAAG (SEQ ID NO:15) (sense primer) and AGGAAGTAGCCATGGTTTGCCGTT (SEQ ID NO: 16) (antisense primer). Nucleotides 13-24 of the sense primer correspond to nucleotides 94-105 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 59-70 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. The antisense primer corresponds to nucleotides 546-569 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and to nucleotides 511-534 of the sequence deposited by Gerald et al. in GenBank under accession number U56078. The PCR reaction was initially denatured at 94.degree. C. for 1 minute. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 45 seconds, annealing at 55.2.degree. C. for 45 seconds, and elongation at 72.degree. C. for 1 minute. The reaction was then held at 4.degree. C. until use. This PCR reaction yielded a 420 bp product that incorporated nucleotides 94-569 of the sequence reported by Gerald et al. in U.S. Pat. No. 5,602,024 and nucleotides 59-534 of the sequence deposited by Gerald et al. in GenBank under accession number U56078 flanked by BamHI (5') and Munl (3') restriction enzyme sites. To construct a full length rat NPY Y.sub.5 receptor cDNA beginning at the second initiation codon, the plasmid pCR3.1-rY.sub.5A was digested with BamHI and Munl restriction enzymes and the 5982 bp fragment containing the plasmid backbone and the 3' 982 bp of the rat NPY Y.sub.5 receptor cDNA was purified. This 5982 bp fragment was ligated to the 420 bp PCR product, which had also been digested with BamHI and Munl. This plasmid construct is known as pCR3.1-rY.sub.5B. This construct yielded low but detectable levels of the rat Y.sub.5 receptor when transfected into COS1 cells.
In a further effort to improve expression of the rat NPY Y.sub.5 receptor, the native 5' untranslated region of the rat NPY Y.sub.5 receptor was appended to the 5' end of pCR3.1-rY.sub.5B. The native rat NPY Y.sub.5 5' untranslated sequence was isolated by the PCR. Rat brain poly A.sup.+ RNA was purchased from Clontech. Rat brain cDNA was prepared by reverse transcription with the Perkin Elmer GeneAmp RNA PCR kit. The reverse transcription reaction was performed in a 20 ul volume containing 200 ng rat brain poly A.sup.+ RNA; 10 mM Tris-Cl (pH 8.3); 5 mM MgCl.sub.2 ; 50 mM KCl; 1 mM each of dATP, dTTP, dCTP and dGTP; 1 U RNase inhibitor; 2.5 U murine Moloney leukemia virus reverse transcriptase; and 0.15 uM oligonucleotide primer having the sequence GGAGCAAAACAGGACGAC (SEQ ID NO: 17). This primer corresponds to nucleotides 509-526 of the sequence deposited in GenBank by Hu et al. under accession number U66274. The reverse transcription mixture was placed in a Perkin Elmer 9600 thermocycler and subjected to one cycle of 42.degree. C. for 15 minutes, 99.degree. C. for 5 minutes and 5.degree. C. for 5 minutes. The entire reverse transcription reaction containing rat brain cDNA was then used in a PCR reaction that also included 10 mM Tris-Cl (pH 8.3); 3 mM MgCl.sub.2 ; 50 mM KCl; 0.15 uM oligonucleotide primers CGCGGATCCCCGAGGTGCTTCTAAAAC (SEQ ID NO: 18) (sense primer) and GGAGCAAAACAGGACGAC (SEQ ID NO: 19) (antisense primer). Nucleotides 10-27 of the sense primer correspond to nucleotides 72-89, while the antisense primer corresponds to nucleotides 509-526 of the sequence deposited in GenBank by Hu et al. under accession number U66274. The PCR reaction was initially denatured at 94.degree. C. for 105 seconds. The PCR was then carried out for 35 cycles with each cycle of PCR consisting of denaturation at 94.degree. C. for 60 seconds, annealing at 54.degree. C. for 60 seconds, and elongation at 72.degree. C. for 60 seconds. Subsequently, a final cycle of elongation was performed at 72.degree. C. for 7 minutes. The reaction was then held at 4.degree. C. until use. Two products of 446 bp and 569 bp were obtained in this PCR reaction and were ligated into the pCR3.1 vector (InVitrogen). Sequencing revealed that the 446 bp product was identical to nucleotides 72-509 of the sequence deposited by Hu et al. in GenBank under accession number U66274 with the exception of nucleotide 237 (C in our sequence vs. T in the sequence of Hu et al.). The 569 bp product was also identical to the sequence deposited in GenBank under accession number U66274 except that it had a 123 bp insertion between nucleotides 232 and 233 of GenBank sequence U66274. This product also had the same single nucleotide transversion as the first product (i.e. nucleotide 237 of GenBank sequence U66274 converted from T to C in our sequence). This second product in pCR3.1 was designated pCR3.1-rY.sub.5 5' UTR. To construct a rat NPY Y.sub.5 receptor cDNA expression plasmid that incorporates the native 5' untranslated region of the cDNA, the plasmid pCR3.1-rY.sub.5A was digested with the Kpnl and Xbal and the rat NPY Y.sub.5 receptor cDNA was purified and ligated into pUC18 that had also been digested with Kpnl and Xbal. The resulting plasmid was designated pUC18-rY.sub.5A. pUC18-rY.sub.5A was then digested with BamHI and BseRI and the resulting 3966 bp fragment was purified. This fragment consists of 2659 bp of pUC18 backbone and the 3' 1307 bp of the rat NPY Y.sub.5 cDNA. Simultaneously, pCR3.1-rY.sub.5 5' UTR was digested with BamHI and BseRI and the resulting 322 bp fragment consisting of nucleotides 72-272 of GenBank sequence U66274 as well as the novel 123 bp insertion between nucleotides 232 and 233 was purified. These two fragments were ligated to give the construct designated pUC18-rY.sub.5C. Finally, pUC18-rY.sub.5C was digested with BamHI and Xbal and the resulting 1655 rY.sub.5C cDNA (SEQ ID NO: 22) was purified and ligated into pcDNA3.1 that had also been digested with BamHI and Xbal. This construct was designated pcDNA3.1-rY.sub.5C. When transfected into COS1 cells, this construct yielded reasonable expression of the rat Y.sub.5 receptor (Table 1).
Preparation of the Rat/Human Chimeric NPY Y.sub.5 Receptor cDNA
The expression of the pcDNA3-rY.sub.5C construct was significantly better than the similar pcDNA3.1-hY.sub.5D construct (see data in Table 1). The major differences between these two constructs are in the sequence of the 5' untranslated region and in the sequence of the extreme 5' end of the coding region. Therefore, a chimeric construct was constructed in which the 5' untranslated region and the extreme 5' end of the coding region of the rat NPY Y.sub.5 receptor cDNA from the pcDNA3-rY.sub.5C construct was substituted for the corresponding region of the pcDNA3.1-hY.sub.5D construct. pcDNA3.1-hY.sub.5D was digested with Munl and the resulting 5.62 kb fragment was purified. This fragment contains a 4.65 kb piece of the pcDNA3.1 vector (nucleotides 983-161) and nucleotides 661-1633 of the hY.sub.5D cDNA sequence. Simultaneously, pcDNA3-rY.sub.5C was also digested with Munl and the resulting 1.47 kb fragment was purified. This fragment contains nucleotides 161-930 of the pcDNA3 vector and nucleotides 1-700 of the rY.sub.5C cDNA sequence. The 5.62 kb Munl fragment from pcDNA3.1-hY.sub.5D and the 1.47 kb Munl fragment from pcDNA3-rY.sub.5C were ligated to generate a construct in the pcDNA3.1 vector backbone that consisted of the first 700 bp of the rY.sub.5C cDNA sequence appended to nucleotides 661-1633 of the hY.sub.5D cDNA sequence. Subsequently, nucleotides 495 and 634 of the Y.sub.5 sequence were changed from G to C and C to T, respectively, with the QuikChange Site-Directed Mutagenesis kit (Stratagene). This resulted in the conversion of Val.sup.66 and Ala.sup.112 encoded by the rY.sub.5C cDNA to the corresponding amino acids encoded by the hY.sub.5D cDNA (Leu and Val, respectively). The resulting plasmid was designated pcDNA3.1-rhY.sub.5 and contains a 1672 bp DNA insert (SEQ ID NO: 1) consisting of the 5' untranslated region (299 bp) as well as the first 105 bp of the coding sequence of the rY.sub.5C construct appended to nucleotides 365-1633 of the hY.sub.5D cDNA sequence. The protein encoded by this construct consists of the first 35 amino acids of the rat Y.sub.5 receptor appended to amino acids 36-445 of the human Y.sub.5 receptor. When transfected into COS1 cells, this construct yielded levels of expression higher than the native human Y.sub.5 receptor and similar or greater levels of expression than the native rat Y.sub.5 receptor. The pharmacological properties of this hybrid receptor were similar to those of the native human Y.sub.5 receptor (Table 2).
Transfection of COS1 Cells
COS1 cells were obtained from the American Type Culture Collection (Rockville, Md.). COS1 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat inactivated fetal calf serum and were grown at 37.degree. C., 5% CO.sub.2. The cells were seeded at 3.times.10.sup.6 cells/150 mm tissue culture dish in DMEM supplemented with 10% heat inactivated fetal calf serum. Twenty four hours later, the medium was replaced with DMEM supplemented with 10% heat inactivated fetal calf serum, 20 mM HEPES (pH 7.3), 100 U/ml penicillin, 100 ug/ml streptomycin, 1 ug/ml NPY Y.sub.5 receptor expression plasmid, 50 ug/ml DEAE dextran, 100 uM chloroquine and the cells were incubated in this solution for 3.5 hours. The cells were subsequently incubated for 2-3 minutes with 10% dimethyl sulfoxide in Dulbecco's phosphate buffered saline (PBS), washed once with PBS and incubated 60-72 hours in DMEM supplemented with 10% fetal calf serum, 100 U/ml penicillin and 100 ug/ml streptomycin.
Transfection of CHO Cells
CHO cells were plated at 1.times.10.sup.6 cells/dish in 100 mm dishes in Ham's F12 medium (Life Technologies) supplemented with 10% heat inactivated fetal calf serum (ICN, Costa Mesa, Calif.). Twenty four hours later, 8 ug of pcDNA3.1-rhY.sub.5 was transfected into the CHO cells with lipofectamine (Life Technologies) according to the manufacturer's instructions. After incubating the cells for 24 hours with the lipofectamine/pcDNA3.1-rhY.sub.5 mixture, the medium was aspirated and replaced with fresh Ham's F12 medium/10% heat inactivated fetal calf serum. Twenty four hours later (48 hours after initiation of transfection), the cells were detached from the dish with trypsin/EDTA (Life Technologies) and replated at approximately 1.times.10.sup.8 to 1.times.10.sup.9 cells/dish in new 100 mm dishes in Ham's F12 medium supplemented with 10% heat inactivated fetal calf serum and 400 ug/ml G418 (Life Technologies). The medium was replaced every 3-4 days with fresh Ham's F12 medium supplemented with 10% heat inactivated fetal calf serum and 400 ug/ml G418. When single, well-isolated colonies were evident (usually after 1-2 weeks), cloning cylinders were placed around individual colonies and the cells in each colony were removed from the dish with trypsin/EDTA. Cells from individual colonies were transferred to 24 well plates and expanded to generate individual cell lines. The cell lines were then screened for binding of [.sup.125 l]PYY as described below to identify cell lines expressing the rhY.sub.5 receptor. Cell lines expressing the rhY.sub.5 receptor were maintained in Ham's F12 medium supplemented with 10% heat-inactivated fetal calf serum and 200 ug/ml G418.
Preparation of COS1 and CHO Cell Membranes
COS1 or CHO cells were placed on ice and washed once with ice cold PBS. The cells are scraped into membrane buffer (50 mM HEPES [pH 7.2], 0.25 mg/ml Pefabloc [Boehringer Mannheim, Indianapolis, Ind.], 25 ug/ml leupeptin [Sigma, St. Louis, Mo.], 25 ug/ml aprotinin [Sigma]), transferred to a Dounce homogenizer and homogenized on ice. The homogenate is centrifuged at 15,000 rpm in a Sorvall SS34 rotor at 4.degree. C. and the membrane pellet is resuspended in membrane buffer via homogenization. The homogenate is again centrifuged at 15,000 rpm in a Sorvall SS34 rotor at 4.degree. C. and the membrane pellet is resuspended in membrane buffer via homogenization. The membrane homogenate is then stored frozen at -80.degree. C. until use.
Radioligand Binding to NPY Receptors
Binding of [.sup.125 l] porcine peptide YY (PYY) (NEN, Boston, Mass., 2200 Ci/mmol) to the NPY receptors expressed in COS or CHO cell membranes was performed in binding buffer (50 mM HEPES [pH 7.2], 0.1% bovine serum albumin [RIA grade], 2.5 mM CaCl.sub.2, and 1 mM MgCl.sub.2). Saturation binding assays were performed in binding buffer containing 0.01-2 nM [.sup.125 l] PYY and 2.5-5 ug of membrane protein (50 ul final volume). Competition binding assays were carried out in binding buffer containing 5-10 ug membrane protein, 0.1 nM [.sup.125 l] PYY and various concentrations of competing peptides (200 ul final volume). In all cases, nonspecific binding was defined as binding in the presence of 1 uM unlabeled human NPY. to determine nonspecific binding. Binding assays were incubated at room temperature for 90 minutes and were terminated by rapid vacuum filtration through glass fiber filters in 96-well format (Multiscreen FB Filter Plates, Millipore, Bedford, Mass. or Unifilter-96 GF/C, Packard, Meriden, Conn.) Prior to filtration the glass fiber filters were pretreated with 100 ul of 0.3 % polyethylenimine. Each filter was then washed 3 times with 100 ul of PBS. Radioactivity trapped on the filters was then counted by standard gamma counting techniques.
Assay of Inhibition of Forskolin-Stimulated cAMP Formation by NPY Receptors
CHO cells expressing NPY receptors were seeded into 96-well, flat-bottom tissue culture plates at a density of 20,000 cells per well. After approximately 48 hours, the cell monolayers were rinsed twice with Hank's balanced salt solution (HBSS; Life Technologies), then preincubated for 10 minutes at 37.degree. C. with 125 .mu.l/well of assay buffer (HBSS supplemented with 4 mM MgCl.sub.2, 10 mM HEPES, 0.2% BSA, 1 mM 3-isobutyl-1-methylxanthine [IBMX, Sigma Chemical Co., St. Louis, Mo.]). Subsequently, the assay buffer was removed and replaced with assay buffer containing 1 .mu.M forskolin (Sigma) and various concentrations of NPY or NPY analogues. After 10 minutes at 37.degree. C., the medium was removed and 75 .mu.l of ethanol was added to the cell monolayers. The tissue culture plates were agitated on a platform shaker for 15 minutes after which the plates were transferred to a warm water bath to evaporate the ethanol. The cell residues were dissolved in 200-250 .mu.l FlashPlate assay buffer. The amount of cAMP in each well was quantified using the [.sup.125 l]-cAMP FlashPlate kit (Dupont-NEN, Boston, Mass.) according to the manufacturer's protocol.
Radioligand Binding Data
The level of expression of the various NPY Y.sub.5 receptor constructs after transient expression in COS1 cells is shown in Table 1.
TABLE 1______________________________________The level of expression of each receptor construct was measured by radioligand binding at an [.sup.125 I]pYY concentration of 100 pM. All receptors were expressed transiently in COS1 cells. Level of Expression Receptor Construct (fmol/mg protein)______________________________________pCR3.1-hY.sub.5A 0 pcDNA3-hY.sub.5B 0 pcDNA3.1-hY.sub.5D 103 pcDNA3.1-rhY.sub.5 298 pCR3.1-rY.sub.5A 100 pCR3.1-rY.sub.5B 38 pcDNA3.1-rY.sub.5C 225______________________________________
The affinity of a series of peptides for the rhY.sub.5 receptor construct was very similar to that of the native human Y.sub.5 receptor construct as shown in Table 2.
TABLE 2______________________________________Affinity of NPY and related peptides for the human Y.sub.5 receptor and the rat/human hybrid Y.sub.5 receptor. Peptide affinities were measured in competition binding assays with membranes from COS1 cells transiently expressing the human Y.sub.5 and rat/human hybrid Y.sub.5 receptors. K.sub.i (nM)Peptide Human Y.sub.5 Hybrid Y.sub.5______________________________________NPY 1.36 0.64 NPY (13-36) 11.5 12.6 [Leu.sup.31, Pro.sup.34 ]NPY 5.1 0.76 Human PP 1.6 2.86 Rat PP 60 75.6______________________________________
Assay for Identification of an NPY Y.sub.5 Receptor Antagonist
Because the rhY.sub.5 receptor cDNA can be expressed at high levels in mammalian cells, it can be used to screen for ligands that bind to the human Y.sub.5 receptor. In a typical assay, membranes from mammalian cells expressing the rhY.sub.5 receptor are incubated with [.sup.125 l]PYY and either vehicle (typically dimethyl sulfoxide) or test substances dissolved in vehicle. All assays are incubated in round bottom 96 well plates or, alternatively, in higher density plate formats. The assay is carried out as described in the preceding section (Radioligand Binding to NPY Receptors). The test substances are initially tested at a single concentration of between 10.sup.-6 to 10.sup.-5 M. Test substances can either be screened individually or as mixtures of test substances (typically 8-10 test substances per assay). Test substances that inhibit [.sup.125 l]PYY binding to a level greater than or equal to 50% of the [.sup.125 l]PYY binding observed in the presence of the vehicle alone are considered to be active. Active test substances are then tested over a range of concentrations (typically 10.sup.-12 to 10.sup.-5 M) and the equilibrium dissociation constant of the test substance at the rhY.sub.5 receptor is determined. The equilibrium dissociation constant of the test substance can be determined by calculating the amount of [.sup.125 I]PYY binding at each concentration of the test substance and plotting these values as a function of the concentration of test substance. These data can then be fit to a logistic function by standard curve fitting software. Such software can then calculate the concentration of test substance that reduces [.sup.125 I]PYY binding to 50% of the level of [.sup.125 I]PYY binding observed in the presence of vehicle alone. This concentration of test substance is referred to as the IC.sub.50. The equilibrium dissociation constant can then be determined according to the following equation described by Cheng and Prusoff (11):
K.sub.i =IC.sub.50 /(1+([L]/K.sub.D))
where K.sub.i is the equilibrium dissociation constant of the test substance for the Y.sub.5 receptor, IC.sub.50 is the concentration of test substance that reduces [.sup.125 I]PYY binding to 50% of the level of [.sup.125 I]PYY binding observed in the presence of vehicle alone, [L] is the concentration of [.sup.125 I]PYY used in the assay and K.sub.D is the equilibrium dissociation constant of [.sup.125 I]PYY for the NPY Y.sub.5 receptor. Test substances having equilibrium dissociation constants of 10 nM or less would be considered to be potential drug candidates.
An alternative assay would be to use scintillation proximity assay (SPA) technology to perform the radioligand binding assay. In this assay, mammalian cell membranes expressing the rhY.sub.5 receptor are incubated with SPA beads (Amersham, Naperville, Ill.), [.sup.125 I]PYY and test substances. During the reaction, membranes bind to the SPA beads and [.sup.125 I]PYY and test substances compete for binding to the Y.sub.5 receptor. After a sufficient time, the reactions are placed in a scintillation counter and the amount of [.sup.125 I]PYY bound to the rhY.sub.5 receptor is quantitated by scintillation counting.
An alternative assay would be to determine the effect of test substances on the inhibition of forskolin-stimulated cAMP formation mediated by the Y.sub.5 receptor. To identify compounds that activate the rhY.sub.5 receptor (i.e. Y.sub.5 receptor agonists), test substances would be substituted for NPY in the standard assay described above. The test substances are initially tested at a single concentration of between 10.sup.-6 to 10.sup.-5 M. Test substances can either be screened individually or as mixtures of test substances (typically 8-10 test substances per assay). Test substances that give greater than 20% inhibition of forskolin-stimulated cAMP formation would be considered to be active. Active test substances are then tested over a range of concentrations (typically 10.sup.-12 to 10.sup.-5 M) and the EC.sub.50 would be determined. The EC.sub.50 is defined as the concentration of test substance that gives 50% of the maximal inhibition of forskolin-induced cAMP formation attainable. Compounds having an EC.sub.50 less than 10 nM would be considered to be potential drug candidates. To identify compounds that are antagonists of the rhY.sub.5 receptor, test substances would be screened for their ability to inhibit the NPY-induced decrease in forskolin-stimulated cAMP formation. NPY is usually used at a concentration of 10.sup..times.8 to 10.sup.-7 M while the test substances are initially tested at a single concentration of 10.sup.-6 to 10.sup.-5 M. Test substances can either be screened individually or as mixtures of test substances (typically 8-10 test substances per assay). Test substances that give greater than 50% inhibition of the NPY-induced decrease in forskolin-stimulated cAMP formation are considered to be active. Active test substances are then tested over a range of concentrations (typically 10.sup.-12 to 10.sup.-5 M) and the IC.sub.50 would be determined. The IC.sub.50 is defined as the concentration of test substance that gives a 50% inhibition of the NPY-induced decrease of forskolin-induced cAMP formation. Compounds having an EC.sub.50 less than 10 nM would be considered to be potential drug candidates.
Literature Cited
1. Wahlestedt, C. and Reis, D. J.: Neuropeptide Y-related peptides and their receptors-Are the receptor potential therapeutic drug targets? Annu. Rev. Pharmacol. Toxicol. 32: 309-352, 1993.
2. Blomqvist, A. G. and Herzog, H.: Y-receptor subtypes--how many more? Trends Neurosci 20: 294-298, 1997.
3. Gerald, C., Walker, M. W., Criscione, L., Gustafson, E. L., Batzl-Hartmann, C., Smith, K. E., Vaysse, P., Durkin, M. M., Laz, T. M., Linemeyer, D. L., Schaffhauser, A. O., Whitebread, S., Hofbauer, K. G., Taber, R. I., Branchek, T. A. and Weinshank, R. L.: A receptor subtype involved in neuropeptide-Y-induced food intake (see comments). Nature 382: 168-171, 1996.
4. Woldbye, D. P., Larsen, P. J., Mikkelsen, J. D., Klemp, K., Madsen, T. M. and Bolwig, T. G.: Powerful inhibition of kainic acid seizures by neuropeptide Y via Y5-like receptors (see comments). Nat Med 3: 761-764, 1997.
5. Bischoff, A., Avramidis, P., Erdbrugger, W., Munter, K. and Michel, M. C.: Receptor subtypes Y1 and Y5 are involved in the renal effects of neuropeptide Y. Br J Pharmacol 120: 1335-1343, 1997.
6. Akabayashi, A., Watanabe, Y., Wahlestedt, C., McEwen, B. S., Paez X. and Leibowitz, S. F.: Hypothalamic neuropeptide Y, its gene expression and receptor activity: relation to circulating corticosterone in adrenalectomized rats. Brain Res 665: 201-212, 1994.
7. Dube, M. B., Xu, B., Crowley, W. R., Kalra, P. S. and Kalra, S. P.: Evidence that neuropeptide Y is a physiological signal for normal food intake. Brain Res 646: 341-344, 1994.
8. Wilding, J. P., Gilbey, S. G., Bailey, C. J., Batt, R. A., Williams, G., Ghatei, M. A. and Bloom, S. R.: Increased neuropeptide-Y messenger ribonucleic acid (mRNA) and decreased neurotensin mRNA in the hypothalamus of the obese (ob/ob) mouse. Endocrinology 132: 1939-1944, 1993.
9. Erickson, J. C., Hollopeter, G. and Palmiter, R. D.: Attenuation of the obesity syndrome of ob/ob mice by the loss of neuropeptide Y. Science 274: 1704-1707, 1996.
10. Stephens, T. W., Basinski, M., Bristow, P. K., Bue-Valleskey, J. M., Burgett, S. G., Craft, L., Hale, J., Hoffmann, J., Hsiung, H. M., Kriaciunas, A. et al.: The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377: 530-532, 1995.
11 Cheng, Y. and Prusoff, W. H.: Relationship between the inhibition constant (K.sub.i) and the concentration of inhibitor which causes 50 percent inhibition (I.sub.50) of an enzymatic reaction. Biochem. Pharmacol. 22:3099-3108, 1973.
__________________________________________________________________________# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 23 - - - - (2) INFORMATION FOR SEQ ID NO:1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1672 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 300..1634 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: - - GGATCCCCGA GGTGCTTCTA AAACCCTGGC GGCTCCGGAG CCCCTCCTTC CC -#ACCACCGC 60 - - CTCCAGGTCC TGCTCCTGCC GCCACCGCTT CCATCTGGAG CAGAAGCGAC CG -#CGCTCAGC 120 - - CACGTACCCC GGAGTCCAGG CACCCGCAGC GGCCGGGGCA TCCCGAGCTG GC -#CATACACC 180 - - GGGAGACAGC TGTGCCCTTG GGTTTGCAAG GTGGCTTGGA AGTCAACTGC CA -#GTAGGAAA 240 - - TAGCCATCCA CACACCTGAG TTCCAAGGGG GAAGAAAGAG ATTCTTATCT GA -#TTCTAGT 299 - - ATG GAG TTT AAG CTT GAG GAG CAT TTT AAC AA - #G ACA TTT GTC ACAGAG 347 Met Glu Phe Lys Leu Glu Glu His Phe Asn Ly - #s Thr Phe Val Thr Glu 1 5 - # 10 - # 15 - - AAC AAT ACA GCT GCT GCT CGG AAT GCA GCC TT - #C CCT GCC TGG GAG GAC 395 Asn Asn Thr Ala Ala Ala Arg Asn Ala Ala Ph - #e Pro Ala Trp Glu Asp 20 - # 25 - # 30 - - TAC AGA GGC AGC GTA GAC GAT TTA CAA TAC TT - #T CTG ATT GGG CTC TAT 443 Tyr Arg Gly Ser Val Asp Asp Leu Gln Tyr Ph - #e Leu Ile Gly Leu Tyr 35 - # 40 - # 45 - - ACA TTC GTA AGT CTT CTT GGC TTT ATG GGC AA - #T CTA CTT ATT TTA ATG 491 Thr Phe Val Ser Leu Leu Gly Phe Met Gly As - #n Leu Leu Ile Leu Met 50 - # 55 - # 60 - - GCT CTT ATG AAA AAG CGC AAT CAG AAG ACT AC - #A GTG AAC TTT CTC ATA 539 Ala Leu Met Lys Lys Arg Asn Gln Lys Thr Th - #r Val Asn Phe Leu Ile 65 - # 70 - # 75 - # 80 - - GGC AAC CTG GCC TTC TCC GAC ATC TTG GTC GT - #C CTG TTT TGC TCC CCT 587 Gly Asn Leu Ala Phe Ser Asp Ile Leu Val Va - #l Leu Phe Cys Ser Pro 85 - # 90 - # 95 - - TTC ACC CTG ACC TCT GTC TTG TTG GAT CAG TG - #G ATG TTT GGC AAA GTC 635 Phe Thr Leu Thr Ser Val Leu Leu Asp Gln Tr - #p Met Phe Gly Lys Val 100 - # 105 - # 110 - - ATG TGC CAT ATC ATG CCG TTC CTT CAA TGT GT - #G TCA GTT CTG GTT TCA 683 Met Cys His Ile Met Pro Phe Leu Gln Cys Va - #l Ser Val Leu Val Ser 115 - # 120 - # 125 - - ACT CTG ATT TTA ATA TCA ATT GCC ATT GTC AG - #G TAT CAT ATG ATA AAA 731 Thr Leu Ile Leu Ile Ser Ile Ala Ile Val Ar - #g Tyr His Met Ile Lys 130 - # 135 - # 140 - - CAT CCC ATA TCT AAT AAT TTA ACA GCA AAC CA - #T GGC TAC TTT CTG ATA 779 His Pro Ile Ser Asn Asn Leu Thr Ala Asn Hi - #s Gly Tyr Phe Leu Ile 145 1 - #50 1 - #55 1 -#60 - - GCT ACT GTC TGG ACA CTA GGT TTT GCC ATC TG - #T TCT CCC CTT CCAGTG 827 Ala Thr Val Trp Thr Leu Gly Phe Ala Ile Cy - #s Ser Pro Leu Pro Val 165 - # 170 - # 175 - - TTT CAC AGT CTT GTG GAA CTT CAA GAA ACA TT - #T GGT TCA GCA TTG CTG 875 Phe His Ser Leu Val Glu Leu Gln Glu Thr Ph - #e Gly Ser Ala Leu Leu 180 - # 185 - # 190 - - AGC AGC AGG TAT TTA TGT GTT GAG TCA TGG CC - #A TCT GAT TCA TAC AGA 923 Ser Ser Arg Tyr Leu Cys Val Glu Ser Trp Pr - #o Ser Asp Ser Tyr Arg 195 - # 200 - # 205 - - ATT GCC TTT ACT ATC TCT TTA TTG CTA GTT CA - #G TAT ATT CTG CCC TTA 971 Ile Ala Phe Thr Ile Ser Leu Leu Leu Val Gl - #n Tyr Ile Leu Pro Leu 210 - # 215 - # 220 - - GTT TGT CTT ACT GTA AGT CAT ACA AGT GTC TG - #C AGA AGT ATA AGC TGT 1019 Val Cys Leu Thr Val Ser His Thr Ser Val Cy - #s Arg Ser Ile Ser Cys 225 2 - #30 2 - #35 2 -#40 - - GGA TTG TCC AAC AAA GAA AAC AGA CTT GAA GA - #A AAT GAG ATG ATCAAC 1067 Gly Leu Ser Asn Lys Glu Asn Arg Leu Glu Gl - #u Asn Glu Met Ile Asn 245 - # 250 - # 255 - - TTA ACT CTT CAT CCA TCC AAA AAG AGT GGG CC - #T CAG GTG AAA CTC TCT 1115 Leu Thr Leu His Pro Ser Lys Lys Ser Gly Pr - #o Gln Val Lys Leu Ser 260 - # 265 - # 270 - - GGC AGC CAT AAA TGG AGT TAT TCA TTC ATC AA - #A AAA CAC AGA AGA AGA 1163 Gly Ser His Lys Trp Ser Tyr Ser Phe Ile Ly - #s Lys His Arg Arg Arg 275 - # 280 - # 285 - - TAT AGC AAG AAG ACA GCA TGT GTG TTA CCT GC - #T CCA GAA AGA CCT TCT 1211 Tyr Ser Lys Lys Thr Ala Cys Val Leu Pro Al - #a Pro Glu Arg Pro Ser 290 - # 295 - # 300 - - CAA GAG AAC CAC TCC AGA ATA CTT CCA GAA AA - #C TTT GGC TCT GTA AGA 1259 Gln Glu Asn His Ser Arg Ile Leu Pro Glu As - #n Phe Gly Ser Val Arg 305 3 - #10 3 - #15 3 -#20 - - AGT CAG CTC TCT TCA TCC AGT AAG TTC ATA CC - #A GGG GTC CCC ACTTGC 1307 Ser Gln Leu Ser Ser Ser Ser Lys Phe Ile Pr - #o Gly Val Pro Thr Cys 325 - # 330 - # 335 - - TTT GAG ATA AAA CCT GAA GAA AAT TCA GAT GT - #T CAT GAA TTG AGA GTA 1355 Phe Glu Ile Lys Pro Glu Glu Asn Ser Asp Va - #l His Glu Leu Arg Val 340 - # 345 - # 350 - - AAA CGT TCT GTT ACA AGA ATA AAA AAG AGA TC - #T CGA AGT GTT TTC TAC 1403 Lys Arg Ser Val Thr Arg Ile Lys Lys Arg Se - #r Arg Ser Val Phe Tyr 355 - # 360 - # 365 - - AGA CTG ACC ATA CTG ATA TTA GTA TTT GCT GT - #T AGT TGG ATG CCA CTA 1451 Arg Leu Thr Ile Leu Ile Leu Val Phe Ala Va - #l Ser Trp Met Pro Leu 370 - # 375 - # 380 - - CAC CTT TTC CAT GTG GTA ACT GAT TTT AAT GA - #C AAT CTT ATT TCA AAT 1499 His Leu Phe His Val Val Thr Asp Phe Asn As - #p Asn Leu Ile Ser Asn 385 3 - #90 3 - #95 4 -#00 - - AGG CAT TTC AAG TTG GTG TAT TGC ATT TGT CA - #T TTG TTG GGC ATGATG 1547 Arg His Phe Lys Leu Val Tyr Cys Ile Cys Hi - #s Leu Leu Gly Met Met 405 - # 410 - # 415 - - TCC TGT TGT CTT AAT CCA ATT CTA TAT GGG TT - #T CTT AAT AAT GGG ATT 1595 Ser Cys Cys Leu Asn Pro Ile Leu Tyr Gly Ph - #e Leu Asn Asn Gly Ile 420 - # 425 - # 430 - - AAA GCT GAT TTA GTG TCC CTT ATA CAC TGT CT - #T CAT ATG TAATAATTCT 1644 Lys Ala Asp Leu Val Ser Leu Ile His Cys Le - #u His Met 435 - # 440 - # 445 - - CACTGTTTAC CAAGGAAAGA ACCTCGAG - # - # 1672 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 445 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: - - Met Glu Phe Lys Leu Glu Glu His Phe Asn Ly - #s Thr Phe Val Thr Glu 1 5 - # 10 - # 15 - - Asn Asn Thr Ala Ala Ala Arg Asn Ala Ala Ph - #e Pro Ala Trp Glu Asp 20 - # 25 - # 30 - - Tyr Arg Gly Ser Val Asp Asp Leu Gln Tyr Ph - #e Leu Ile Gly Leu Tyr 35 - # 40 - # 45 - - Thr Phe Val Ser Leu Leu Gly Phe Met Gly As - #n Leu Leu Ile Leu Met 50 - # 55 - # 60 - - Ala Leu Met Lys Lys Arg Asn Gln Lys Thr Th - #r Val Asn Phe Leu Ile 65 - # 70 - # 75 - # 80 - - Gly Asn Leu Ala Phe Ser Asp Ile Leu Val Va - #l Leu Phe Cys Ser Pro 85 - # 90 - # 95 - - Phe Thr Leu Thr Ser Val Leu Leu Asp Gln Tr - #p Met Phe Gly Lys Val 100 - # 105 - # 110 - - Met Cys His Ile Met Pro Phe Leu Gln Cys Va - #l Ser Val Leu Val Ser 115 - # 120 - # 125 - - Thr Leu Ile Leu Ile Ser Ile Ala Ile Val Ar - #g Tyr His Met Ile Lys 130 - # 135 - # 140 - - His Pro Ile Ser Asn Asn Leu Thr Ala Asn Hi - #s Gly Tyr Phe Leu Ile 145 1 - #50 1 - #55 1 -#60 - - Ala Thr Val Trp Thr Leu Gly Phe Ala Ile Cy - #s Ser Pro Leu ProVal 165 - # 170 - # 175 - - Phe His Ser Leu Val Glu Leu Gln Glu Thr Ph - #e Gly Ser Ala Leu Leu 180 - # 185 - # 190 - - Ser Ser Arg Tyr Leu Cys Val Glu Ser Trp Pr - #o Ser Asp Ser Tyr Arg 195 - # 200 - # 205 - - Ile Ala Phe Thr Ile Ser Leu Leu Leu Val Gl - #n Tyr Ile Leu Pro Leu 210 - # 215 - # 220 - - Val Cys Leu Thr Val Ser His Thr Ser Val Cy - #s Arg Ser Ile Ser Cys 225 2 - #30 2 - #35 2 -#40 - - Gly Leu Ser Asn Lys Glu Asn Arg Leu Glu Gl - #u Asn Glu Met IleAsn 245 - # 250 - # 255 - - Leu Thr Leu His Pro Ser Lys Lys Ser Gly Pr - #o Gln Val Lys Leu Ser 260 - # 265 - # 270 - - Gly Ser His Lys Trp Ser Tyr Ser Phe Ile Ly - #s Lys His Arg Arg Arg 275 - # 280 - # 285 - - Tyr Ser Lys Lys Thr Ala Cys Val Leu Pro Al - #a Pro Glu Arg Pro Ser 290 - # 295 - # 300 - - Gln Glu Asn His Ser Arg Ile Leu Pro Glu As - #n Phe Gly Ser Val Arg 305 3 - #10 3 - #15 3 -#20 - - Ser Gln Leu Ser Ser Ser Ser Lys Phe Ile Pr - #o Gly Val Pro ThrCys 325 - # 330 - # 335 - - Phe Glu Ile Lys Pro Glu Glu Asn Ser Asp Va - #l His Glu Leu Arg Val 340 - # 345 - # 350 - - Lys Arg Ser Val Thr Arg Ile Lys Lys Arg Se - #r Arg Ser Val Phe Tyr 355 - # 360 - # 365 - - Arg Leu Thr Ile Leu Ile Leu Val Phe Ala Va - #l Ser Trp Met Pro Leu 370 - # 375 - # 380 - - His Leu Phe His Val Val Thr Asp Phe Asn As - #p Asn Leu Ile Ser Asn 385 3 - #90 3 - #95 4 -#00 - - Arg His Phe Lys Leu Val Tyr Cys Ile Cys Hi - #s Leu Leu Gly MetMet 405 - # 410 - # 415 - - Ser Cys Cys Leu Asn Pro Ile Leu Tyr Gly Ph - #e Leu Asn Asn Gly Ile 420 - # 425 - # 430 - - Lys Ala Asp Leu Val Ser Leu Ile His Cys Le - #u His Met 435 - # 440 - # 445 - - - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: - - GGGCTCGAGG TTCTTTCCTT GGTAAACAGT GAG - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: - - GGGGGATCCT GACAAATGTC TTTTTATTCC AAG - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: - - GGGCTCGAGG TTCTTTCCTT GGTAAACAGT GAG - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: - - TTTGGATCCA CCATGGATTT AGAG - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: - - TACCTGACAA TGGCAATTGA TATT - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: - - TAATACGACT CACTATAGGG - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO:9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: - - AAGGCATAAT ATGGCACATG AC - # - # 22 - - - - (2) INFORMATION FOR SEQ ID NO:10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: - - TAATACGACT CACTATAGGG - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO:11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: - - ACTTACAAAT GTATAGAGCC C - # - # - #21 - - - - (2) INFORMATION FOR SEQ ID NO:12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: - - GGGCTCGAGG CACAGAGAGA ATCATGACAT GTG - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: - - GGGGGATCCG CTGCTAATGG ACGTCCTCTT CTT - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: - - GGGCTCGAGG CACAGAGAGA ATCATGACAT GTG - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO:15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: - - TTTGGATCCA CCATGGAGTT TAAG - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: - - AGGAAGTAGC CATGGTTTGC CGTT - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: - - GGAGCAAAAC AGGACGAC - # - # - # 18 - - - - (2) INFORMATION FOR SEQ ID NO:18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: - - CGCGGATCCC CGAGGTGCTT CTAAAAC - # - # 27 - - - - (2) INFORMATION FOR SEQ ID NO:19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: - - GGAGCAAAAC AGGACGAC - # - # - # 18 - - - - (2) INFORMATION FOR SEQ ID NO:20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1633 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 261..1595 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: - - GGATCCGAAG GGGTTCGAAT TCCCCACCGC CGCCTCCAGG TCCTGCTCCC GC -#TGCTGCCG 60 - - CCACCGCCGG GGTGCAGGAG CGATCGCGCT GGGCCGCGCT CCCGGGAGCC CA -#GGGCCTGC 120 - - AGCGGCCGGG GCGCCCCGAG GTCTGCTCAT TGTGTTTTTC AGGAAAAAGG AA -#GGGAAAGG 180 - - GTGTTACAAG GAAAGGCTAT CGGTAACAAC TGACCTGCCA CAAAGTTAGA AG -#AAAGGATT 240 - - GATTCAAGAA AGACTATAAT ATG GAT TTA GAG CTC GAC GA - #G TAT TAT AAC 290 - # Met Asp Leu Glu Leu Asp Glu Tyr - #Tyr Asn - # 1 - # 5 - # 10 - - AAG ACA CTT GCC ACA GAG AAT AAT ACT GCT GC - #C ACT CGG AAT TCT GAT 338 Lys Thr Leu Ala Thr Glu Asn Asn Thr Ala Al - #a Thr Arg Asn Ser Asp 15 - # 20 - # 25 - - TTC CCA GTC TGG GAT GAC TAT AAA AGC AGT GT - #A GAT GAC TTA CAG TAT 386 Phe Pro Val Trp Asp Asp Tyr Lys Ser Ser Va - #l Asp Asp Leu Gln Tyr 30 - # 35 - # 40 - - TTT CTG ATT GGG CTC TAT ACA TTT GTA AGT CT - #T CTT GGC TTT ATG GGG 434 Phe Leu Ile Gly Leu Tyr Thr Phe Val Ser Le - #u Leu Gly Phe Met Gly 45 - # 50 - # 55 - - AAT CTA CTT ATT TTA ATG GCT CTC ATG AAA AA - #G CGT AAT CAG AAG ACT 482 Asn Leu Leu Ile Leu Met Ala Leu Met Lys Ly - #s Arg Asn Gln Lys Thr 60 - # 65 - # 70 - - ACG GTA AAC TTC CTC ATA GGC AAT CTG GCC TT - #T TCT GAT ATC TTG GTT 530 Thr Val Asn Phe Leu Ile Gly Asn Leu Ala Ph - #e Ser Asp Ile Leu Val 75 - # 80 - # 85 - # 90 - - GTG CTG TTT TGC TCA CCT TTC ACA CTG ACG TC - #T GTC TTG CTG GAT CAG 578 Val Leu Phe Cys Ser Pro Phe Thr Leu Thr Se - #r Val Leu Leu Asp Gln 95 - # 100 - # 105 - - TGG ATG TTT GGC AAA GTC ATG TGC CAT ATT AT - #G CCT TTT CTT CAA TGT 626 Trp Met Phe Gly Lys Val Met Cys His Ile Me - #t Pro Phe Leu Gln Cys 110 - # 115 - # 120 - - GTG TCA GTT TTG GTT TCA ACT TTA ATT TTA AT - #A TCA ATT GCC ATT GTC 674 Val Ser Val Leu Val Ser Thr Leu Ile Leu Il - #e Ser Ile Ala Ile Val 125 - # 130 - # 135 - - AGG TAT CAT ATG ATA AAA CAT CCC ATA TCT AA - #T AAT TTA ACA GCA AAC 722 Arg Tyr His Met Ile Lys His Pro Ile Ser As - #n Asn Leu Thr Ala Asn 140 - # 145 - # 150 - - CAT GGC TAC TTT CTG ATA GCT ACT GTC TGG AC - #A CTA GGT TTT GCC ATC 770 His Gly Tyr Phe Leu Ile Ala Thr Val Trp Th - #r Leu Gly Phe Ala Ile 155 1 - #60 1 - #65 1 -#70 - - TGT TCT CCC CTT CCA GTG TTT CAC AGT CTT GT - #G GAA CTT CAA GAAACA 818 Cys Ser Pro Leu Pro Val Phe His Ser Leu Va - #l Glu Leu Gln Glu Thr 175 - # 180 - # 185 - - TTT GGT TCA GCA TTG CTG AGC AGC AGG TAT TT - #A TGT GTT GAG TCA TGG 866 Phe Gly Ser Ala Leu Leu Ser Ser Arg Tyr Le - #u Cys Val Glu Ser Trp 190 - # 195 - # 200 - - CCA TCT GAT TCA TAC AGA ATT GCC TTT ACT AT - #C TCT TTA TTG CTA GTT 914 Pro Ser Asp Ser Tyr Arg Ile Ala Phe Thr Il - #e Ser Leu Leu Leu Val 205 - # 210 - # 215 - - CAG TAT ATT CTG CCC TTA GTT TGT CTT ACT GT - #A AGT CAT ACA AGT GTC 962 Gln Tyr Ile Leu Pro Leu Val Cys Leu Thr Va - #l Ser His Thr Ser Val 220 - # 225 - # 230 - - TGC AGA AGT ATA AGC TGT GGA TTG TCC AAC AA - #A GAA AAC AGA CTT GAA 1010 Cys Arg Ser Ile Ser Cys Gly Leu Ser Asn Ly - #s Glu Asn Arg Leu Glu 235 2 - #40 2 - #45 2 -#50 - - GAA AAT GAG ATG ATC AAC TTA ACT CTT CAT CC - #A TCC AAA AAG AGTGGG 1058 Glu Asn Glu Met Ile Asn Leu Thr Leu His Pr - #o Ser Lys Lys Ser Gly 255 - # 260 - # 265 - - CCT CAG GTG AAA CTC TCT GGC AGC CAT AAA TG - #G AGT TAT TCA TTC ATC 1106 Pro Gln Val Lys Leu Ser Gly Ser His Lys Tr - #p Ser Tyr Ser Phe Ile 270 - # 275 - # 280 - - AAA AAA CAC AGA AGA AGA TAT AGC AAG AAG AC - #A GCA TGT GTG TTA CCT 1154 Lys Lys His Arg Arg Arg Tyr Ser Lys Lys Th - #r Ala Cys Val Leu Pro 285 - # 290 - # 295 - - GCT CCA GAA AGA CCT TCT CAA GAG AAC CAC TC - #C AGA ATA CTT CCA GAA 1202 Ala Pro Glu Arg Pro Ser Gln Glu Asn His Se - #r Arg Ile Leu Pro Glu 300 - # 305 - # 310 - - AAC TTT GGC TCT GTA AGA AGT CAG CTC TCT TC - #A TCC AGT AAG TTC ATA 1250 Asn Phe Gly Ser Val Arg Ser Gln Leu Ser Se - #r Ser Ser Lys Phe Ile 315 3 - #20 3 - #25 3 -#30 - - CCA GGG GTC CCC ACT TGC TTT GAG ATA AAA CC - #T GAA GAA AAT TCAGAT 1298 Pro Gly Val Pro Thr Cys Phe Glu Ile Lys Pr - #o Glu Glu Asn Ser Asp 335 - # 340 - # 345 - - GTT CAT GAA TTG AGA GTA AAA CGT TCT GTT AC - #A AGA ATA AAA AAG AGA 1346 Val His Glu Leu Arg Val Lys Arg Ser Val Th - #r Arg Ile Lys Lys Arg 350 - # 355 - # 360 - - TCT CGA AGT GTT TTC TAC AGA CTG ACC ATA CT - #G ATA TTA GTA TTT GCT 1394 Ser Arg Ser Val Phe Tyr Arg Leu Thr Ile Le - #u Ile Leu Val Phe Ala 365 - # 370 - # 375 - - GTT AGT TGG ATG CCA CTA CAC CTT TTC CAT GT - #G GTA ACT GAT TTT AAT 1442 Val Ser Trp Met Pro Leu His Leu Phe His Va - #l Val Thr Asp Phe Asn 380 - # 385 - # 390 - - GAC AAT CTT ATT TCA AAT AGG CAT TTC AAG TT - #G GTG TAT TGC ATT TGT 1490 Asp Asn Leu Ile Ser Asn Arg His Phe Lys Le - #u Val Tyr Cys Ile Cys 395 4 - #00 4 - #05 4 -#10 - - CAT TTG TTG GGC ATG ATG TCC TGT TGT CTT AA - #T CCA ATT CTA TATGGG 1538 His Leu Leu Gly Met Met Ser Cys Cys Leu As - #n Pro Ile Leu Tyr Gly 415 - # 420 - # 425 - - TTT CTT AAT AAT GGG ATT AAA GCT GAT TTA GT - #G TCC CTT ATA CAC TGT 1586 Phe Leu Asn Asn Gly Ile Lys Ala Asp Leu Va - #l Ser Leu Ile His Cys 430 - # 435 - # 440 - - CTT CAT ATG TAATAATTCT CACTGTTTAC CAAGGAAAGA ACCTCGAG - # 1633 Leu His Met 445 - - - - (2) INFORMATION FOR SEQ ID NO:21: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 445 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: - - Met Asp Leu Glu Leu Asp Glu Tyr Tyr Asn Ly - #s Thr Leu Ala Thr Glu 1 5 - # 10 - # 15 - - Asn Asn Thr Ala Ala Thr Arg Asn Ser Asp Ph - #e Pro Val Trp Asp Asp 20 - # 25 - # 30 - - Tyr Lys Ser Ser Val Asp Asp Leu Gln Tyr Ph - #e Leu Ile Gly Leu Tyr 35 - # 40 - # 45 - - Thr Phe Val Ser Leu Leu Gly Phe Met Gly As - #n Leu Leu Ile Leu Met 50 - # 55 - # 60 - - Ala Leu Met Lys Lys Arg Asn Gln Lys Thr Th - #r Val Asn Phe Leu Ile 65 - # 70 - # 75 - # 80 - - Gly Asn Leu Ala Phe Ser Asp Ile Leu Val Va - #l Leu Phe Cys Ser Pro 85 - # 90 - # 95 - - Phe Thr Leu Thr Ser Val Leu Leu Asp Gln Tr - #p Met Phe Gly Lys Val 100 - # 105 - # 110 - - Met Cys His Ile Met Pro Phe Leu Gln Cys Va - #l Ser Val Leu Val Ser 115 - # 120 - # 125 - - Thr Leu Ile Leu Ile Ser Ile Ala Ile Val Ar - #g Tyr His Met Ile Lys 130 - # 135 - # 140 - - His Pro Ile Ser Asn Asn Leu Thr Ala Asn Hi - #s Gly Tyr Phe Leu Ile 145 1 - #50 1 - #55 1 -#60 - - Ala Thr Val Trp Thr Leu Gly Phe Ala Ile Cy - #s Ser Pro Leu ProVal 165 - # 170 - # 175 - - Phe His Ser Leu Val Glu Leu Gln Glu Thr Ph - #e Gly Ser Ala Leu Leu 180 - # 185 - # 190 - - Ser Ser Arg Tyr Leu Cys Val Glu Ser Trp Pr - #o Ser Asp Ser Tyr Arg 195 - # 200 - # 205 - - Ile Ala Phe Thr Ile Ser Leu Leu Leu Val Gl - #n Tyr Ile Leu Pro Leu 210 - # 215 - # 220 - - Val Cys Leu Thr Val Ser His Thr Ser Val Cy - #s Arg Ser Ile Ser Cys 225 2 - #30 2 - #35 2 -#40 - - Gly Leu Ser Asn Lys Glu Asn Arg Leu Glu Gl - #u Asn Glu Met IleAsn 245 - # 250 - # 255 - - Leu Thr Leu His Pro Ser Lys Lys Ser Gly Pr - #o Gln Val Lys Leu Ser 260 - # 265 - # 270 - - Gly Ser His Lys Trp Ser Tyr Ser Phe Ile Ly - #s Lys His Arg Arg Arg 275 - # 280 - # 285 - - Tyr Ser Lys Lys Thr Ala Cys Val Leu Pro Al - #a Pro Glu Arg Pro Ser 290 - # 295 - # 300 - - Gln Glu Asn His Ser Arg Ile Leu Pro Glu As - #n Phe Gly Ser Val Arg 305 3 - #10 3 - #15 3 -#20 - - Ser Gln Leu Ser Ser Ser Ser Lys Phe Ile Pr - #o Gly Val Pro ThrCys 325 - # 330 - # 335 - - Phe Glu Ile Lys Pro Glu Glu Asn Ser Asp Va - #l His Glu Leu Arg Val 340 - # 345 - # 350 - - Lys Arg Ser Val Thr Arg Ile Lys Lys Arg Se - #r Arg Ser Val Phe Tyr 355 - # 360 - # 365 - - Arg Leu Thr Ile Leu Ile Leu Val Phe Ala Va - #l Ser Trp Met Pro Leu 370 - # 375 - # 380 - - His Leu Phe His Val Val Thr Asp Phe Asn As - #p Asn Leu Ile Ser Asn 385 3 - #90 3 - #95 4 -#00 - - Arg His Phe Lys Leu Val Tyr Cys Ile Cys Hi - #s Leu Leu Gly MetMet 405 - # 410 - # 415 - - Ser Cys Cys Leu Asn Pro Ile Leu Tyr Gly Ph - #e Leu Asn Asn Gly Ile 420 - # 425 - # 430 - - Lys Ala Asp Leu Val Ser Leu Ile His Cys Le - #u His Met 435 - # 440 - # 445 - - - - (2) INFORMATION FOR SEQ ID NO:22: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1655 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 300..1634 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: - - GGATCCCCGA GGTGCTTCTA AAACCCTGGC GGCTCCGGAG CCCCTCCTTC CC -#ACCACCGC 60 - - CTCCAGGTCC TGCTCCTGCC GCCACCGCTT CCATCTGGAG CAGAAGCGAC CG -#CGCTCAGC 120 - - CACGTACCCC GGAGTCCAGG CACCCGCAGC GGCCGGGGCA TCCCGAGCTG GC -#CATACACC 180 - - GGGAGACAGC TGTGCCCTTG GGTTTGCAAG GTGGCTTGGA AGTCAACTGC CA -#GTAGGAAA 240 - - TAGCCATCCA CACACCTGAG TTCCAAGGGG GAAGAAAGAG ATTCTTATCT GA -#TTCTAGT 299 - - ATG GAG TTT AAG CTT GAG GAG CAT TTT AAC AA - #G ACA TTT GTC ACAGAG 347 Met Glu Phe Lys Leu Glu Glu His Phe Asn Ly - #s Thr Phe Val Thr Glu 1 5 - # 10 - # 15 - - AAC AAT ACA GCT GCT GCT CGG AAT GCA GCC TT - #C CCT GCC TGG GAG GAC 395 Asn Asn Thr Ala Ala Ala Arg Asn Ala Ala Ph - #e Pro Ala Trp Glu Asp 20 - # 25 - # 30 - - TAC AGA GGC AGC GTA GAC GAT TTA CAA TAC TT - #T CTG ATT GGG CTC TAT 443 Tyr Arg Gly Ser Val Asp Asp Leu Gln Tyr Ph - #e Leu Ile Gly Leu Tyr 35 - # 40 - # 45 - - ACA TTC GTA AGT CTT CTT GGC TTT ATG GGC AA - #T CTA CTT ATT TTA ATG 491 Thr Phe Val Ser Leu Leu Gly Phe Met Gly As - #n Leu Leu Ile Leu Met 50 - # 55 - # 60 - - GCT GTT ATG AAA AAG CGC AAT CAG AAG ACT AC - #A GTG AAC TTT CTC ATA 539 Ala Val Met Lys Lys Arg Asn Gln Lys Thr Th - #r Val Asn Phe Leu Ile 65 - # 70 - # 75 - # 80 - - GGC AAC CTG GCC TTC TCC GAC ATC TTG GTC GT - #C CTG TTT TGC TCC CCT 587 Gly Asn Leu Ala Phe Ser Asp Ile Leu Val Va - #l Leu Phe Cys Ser Pro 85 - # 90 - # 95 - - TTC ACC CTG ACC TCT GTC TTG TTG GAT CAG TG - #G ATG TTT GGC AAA GCC 635 Phe Thr Leu Thr Ser Val Leu Leu Asp Gln Tr - #p Met Phe Gly Lys Ala 100 - # 105 - # 110 - - ATG TGC CAT ATC ATG CCG TTC CTT CAA TGT GT - #G TCA GTT CTG GTT TCA 683 Met Cys His Ile Met Pro Phe Leu Gln Cys Va - #l Ser Val Leu Val Ser 115 - # 120 - # 125 - - ACT CTG ATT TTA ATA TCA ATT GCC ATT GTC AG - #G TAT CAT ATG ATA AAG 731 Thr Leu Ile Leu Ile Ser Ile Ala Ile Val Ar - #g Tyr His Met Ile Lys 130 - # 135 - # 140 - - CAC CCT ATT TCT AAC AAT TTA ACG GCA AAC CA - #T GGC TAC TTC CTG ATA 779 His Pro Ile Ser Asn Asn Leu Thr Ala Asn Hi - #s Gly Tyr Phe Leu Ile 145 1 - #50 1 - #55 1 -#60 - - GCT ACT GTC TGG ACA CTG GGC TTT GCC ATC TG - #T TCT CCC CTC CCAGTG 827 Ala Thr Val Trp Thr Leu Gly Phe Ala Ile Cy - #s Ser Pro Leu Pro Val 165 - # 170 - # 175 - - TTT CAC AGT CTT GTG GAA CTT AAG GAG ACC TT - #T GGC TCA GCA CTG CTG 875 Phe His Ser Leu Val Glu Leu Lys Glu Thr Ph - #e Gly Ser Ala Leu Leu 180 - # 185 - # 190 - - AGT AGC AAA TAT CTC TGT GTT GAG TCA TGG CC - #C TCT GAT TCA TAC AGA 923 Ser Ser Lys Tyr Leu Cys Val Glu Ser Trp Pr - #o Ser Asp Ser Tyr Arg 195 - # 200 - # 205 - - ATT GCT TTC ACA ATC TCT TTA TTG CTA GTG CA - #G TAT ATC CTG CCT CTA 971 Ile Ala Phe Thr Ile Ser Leu Leu Leu Val Gl - #n Tyr Ile Leu Pro Leu 210 - # 215 - # 220 - - GTA TGT TTA ACG GTA AGT CAT ACC AGC GTC TG - #C CGA AGC ATA AGC TGT 1019 Val Cys Leu Thr Val Ser His Thr Ser Val Cy - #s Arg Ser Ile Ser Cys 225 2 - #30 2 - #35 2 -#40 - - GGA TTG TCC CAC AAA GAA AAC AGA CTC GAA GA - #A AAT GAG ATG ATCAAC 1067 Gly Leu Ser His Lys Glu Asn Arg Leu Glu Gl - #u Asn Glu Met Ile Asn 245 - # 250 - # 255 - - TTA ACC CTA CAG CCA TCC AAA AAG AGC AGG AA - #C CAG GCA AAA ACC CCC 1115 Leu Thr Leu Gln Pro Ser Lys Lys Ser Arg As - #n Gln Ala Lys Thr Pro 260 - # 265 - # 270 - - AGC ACT CAA AAG TGG AGC TAC TCA TTC ATC AG - #A AAG CAC AGA AGG AGG 1163 Ser Thr Gln Lys Trp Ser Tyr Ser Phe Ile Ar - #g Lys His Arg Arg Arg 275 - # 280 - # 285 - - TAC AGC AAG AAG ACG GCC TGT GTC TTA CCC GC - #C CCA GCA GGA CCT TCC 1211 Tyr Ser Lys Lys Thr Ala Cys Val Leu Pro Al - #a Pro Ala Gly Pro Ser 290 - # 295 - # 300 - - CAG GGG AAG CAC CTA GCC GTT CCA GAA AAT CC - #A GCC TCC GTC CGT AGC 1259 Gln Gly Lys His Leu Ala Val Pro Glu Asn Pr - #o Ala Ser Val Arg Ser 305 3 - #10 3 - #15 3 -#20 - - CAG CTG TCG CCA TCC AGT AAG GTC ATT CCA GG - #G GTC CCA ATC TGCTTT 1307 Gln Leu Ser Pro Ser Ser Lys Val Ile Pro Gl - #y Val Pro Ile Cys Phe 325 - # 330 - # 335 - - GAG GTG AAA CCT GAA GAA AGC TCA GAT GCT CA - #T GAG ATG AGA GTC AAG 1355 Glu Val Lys Pro Glu Glu Ser Ser Asp Ala Hi - #s Glu Met Arg Val Lys 340 - # 345 - # 350 - - CGT TCC ATC ACT AGA ATA AAA AAG AGA TCT CG - #A AGT GTT TTC TAC AGA 1403 Arg Ser Ile Thr Arg Ile Lys Lys Arg Ser Ar - #g Ser Val Phe Tyr Arg 355 - # 360 - # 365 - - CTG ACC ATA CTG ATA CTC GTG TTC GCC GTT AG - #C TGG ATG CCA CTC CAC 1451 Leu Thr Ile Leu Ile Leu Val Phe Ala Val Se - #r Trp Met Pro Leu His 370 - # 375 - # 380 - - GTC TTC CAC GTG GTG ACT GAC TTC AAT GAT AA - #C TTG ATT TCC AAT AGG 1499 Val Phe His Val Val Thr Asp Phe Asn Asp As - #n Leu Ile Ser Asn Arg 385 3 - #90 3 - #95 4 -#00 - - CAT TTC AAG CTG GTA TAC TGC ATC TGT CAC TT - #G TTA GGC ATG ATGTCC 1547 His Phe Lys Leu Val Tyr Cys Ile Cys His Le - #u Leu Gly Met Met Ser 405 - # 410 - # 415 - - TGT TGT CTA AAT CCG ATC CTA TAT GGT TTC CT - #T AAT AAT GGT ATC AAA 1595 Cys Cys Leu Asn Pro Ile Leu Tyr Gly Phe Le - #u Asn Asn Gly Ile Lys 420 - # 425 - # 430 - - GCA GAC TTG AGA GCC CTT ATC CAC TGC CTA CA - #C ATG TCA TGATTCTCTC 1644 Ala Asp Leu Arg Ala Leu Ile His Cys Leu Hi - #s Met Ser 435 - # 440 - # 445 - - TGTGCCTCGA G - # - # - # 1655 - - - - (2) INFORMATION FOR SEQ ID NO:23: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 445 amino - #acids (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: - - Met Glu Phe Lys Leu Glu Glu His Phe Asn Ly - #s Thr Phe Val Thr Glu 1 5 - # 10 - # 15 - - Asn Asn Thr Ala Ala Ala Arg Asn Ala Ala Ph - #e Pro Ala Trp Glu Asp 20 - # 25 - # 30 - - Tyr Arg Gly Ser Val Asp Asp Leu Gln Tyr Ph - #e Leu Ile Gly Leu Tyr 35 - # 40 - # 45 - - Thr Phe Val Ser Leu Leu Gly Phe Met Gly As - #n Leu Leu Ile Leu Met 50 - # 55 - # 60 - - Ala Val Met Lys Lys Arg Asn Gln Lys Thr Th - #r Val Asn Phe Leu Ile 65 - # 70 - # 75 - # 80 - - Gly Asn Leu Ala Phe Ser Asp Ile Leu Val Va - #l Leu Phe Cys Ser Pro 85 - # 90 - # 95 - - Phe Thr Leu Thr Ser Val Leu Leu Asp Gln Tr - #p Met Phe Gly Lys Ala 100 - # 105 - # 110 - - Met Cys His Ile Met Pro Phe Leu Gln Cys Va - #l Ser Val Leu Val Ser 115 - # 120 - # 125 - - Thr Leu Ile Leu Ile Ser Ile Ala Ile Val Ar - #g Tyr His Met Ile Lys 130 - # 135 - # 140 - - His Pro Ile Ser Asn Asn Leu Thr Ala Asn Hi - #s Gly Tyr Phe Leu Ile 145 1 - #50 1 - #55 1 -#60 - - Ala Thr Val Trp Thr Leu Gly Phe Ala Ile Cy - #s Ser Pro Leu ProVal 165 - # 170 - # 175 - - Phe His Ser Leu Val Glu Leu Lys Glu Thr Ph - #e Gly Ser Ala Leu Leu 180 - # 185 - # 190 - - Ser Ser Lys Tyr Leu Cys Val Glu Ser Trp Pr - #o Ser Asp Ser Tyr Arg 195 - # 200 - # 205 - - Ile Ala Phe Thr Ile Ser Leu Leu Leu Val Gl - #n Tyr Ile Leu Pro Leu 210 - # 215 - # 220 - - Val Cys Leu Thr Val Ser His Thr Ser Val Cy - #s Arg Ser Ile Ser Cys 225 2 - #30 2 - #35 2 -#40 - - Gly Leu Ser His Lys Glu Asn Arg Leu Glu Gl - #u Asn Glu Met IleAsn 245 - # 250 - # 255 - - Leu Thr Leu Gln Pro Ser Lys Lys Ser Arg As - #n Gln Ala Lys Thr Pro 260 - # 265 - # 270 - - Ser Thr Gln Lys Trp Ser Tyr Ser Phe Ile Ar - #g Lys His Arg Arg Arg 275 - # 280 - # 285 - - Tyr Ser Lys Lys Thr Ala Cys Val Leu Pro Al - #a Pro Ala Gly Pro Ser 290 - # 295 - # 300 - - Gln Gly Lys His Leu Ala Val Pro Glu Asn Pr - #o Ala Ser Val Arg Ser 305 3 - #10 3 - #15 3 -#20 - - Gln Leu Ser Pro Ser Ser Lys Val Ile Pro Gl - #y Val Pro Ile CysPhe 325 - # 330 - # 335 - - Glu Val Lys Pro Glu Glu Ser Ser Asp Ala Hi - #s Glu Met Arg Val Lys 340 - # 345 - # 350 - - Arg Ser Ile Thr Arg Ile Lys Lys Arg Ser Ar - #g Ser Val Phe Tyr Arg 355 - # 360 - # 365 - - Leu Thr Ile Leu Ile Leu Val Phe Ala Val Se - #r Trp Met Pro Leu His 370 - # 375 - # 380 - - Val Phe His Val Val Thr Asp Phe Asn Asp As - #n Leu Ile Ser Asn Arg 385 3 - #90 3 - #95 4 -#00 - - His Phe Lys Leu Val Tyr Cys Ile Cys His Le - #u Leu Gly Met MetSer 405 - # 410 - # 415 - - Cys Cys Leu Asn Pro Ile Leu Tyr Gly Phe Le - #u Asn Asn Gly Ile Lys 420 - # 425 - # 430 - - Ala Asp Leu Arg Ala Leu Ile His Cys Leu Hi - #s Met Ser 435 - # 440 - # 445__________________________________________________________________________

Chimeric mammalian NPY Y.sub.5 receptors

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

US Referenced Citations (1)

Foreign Referenced Citations (1)

Non-Patent Literature Citations (14)