Patent Application
20080020000
All references set forth herein which describe in more detail procedures, devices or compositions relevant to this invention are incorporated by reference in their entirety.
BA-05 is the name given to the protein of this invention made by ligating a cDNA sequence encoding C3 to a fusogenic 19-mer peptide. To demonstrate the method for making a fusion protein of this invention, an example of an antennapedia sequence added to the C-terminus of the C3 polypeptide can be used.
The stop codon at the 3′ end of the DNA sequence can be replaced with an EcoR1 site by polymerase chain reaction (PCR) using the primers 5′GAA TTC TTT AGG ATT GAT AGC TGT GCC 3+ (SEQ ID NO: 1) and 5′GGT GGC GAC CAT CCT CCA AAA 3′ (SEQ ID NO: 2). The PCR product can be sub-cloned into a pSTBlue-1 vector (Novagen, city), then cloned into a pGEX-4T vector using BamH I and Not I restriction site. This vector can be called pGEX-4T/C3. An antennapedia sequence useful to add to the 3′ end of C3 in pGEX-4T/C3 can be created by PCR from the pET-3a vector (Bloch-Gallego (1993) 120: 485-492; and Derossi (1994) 269: 10444-10450), subcloned into a pSTBlue-1 blunt vector, then cloned into the pGEX-4T/C3, using the restriction sites EcoR I and Sal I, creating pGEX-4T/C3APL.
DNA sequence analysis can be performed on the sequence producing the best response according to this invention.
pGEX-4T/C3APL clone (Seq ID NO: 3) is a currently preferred sequence and provides a protein that is a preferred composition of this invention.
An example of a C3-like fusion protein is denoted pGEX-4T/C3APLT (Seq ID NO: 4).
Two PCR primers are designed to transfer one series of recombinant constructs (BA-05) into the pET system: Upper primer: 5′ ggatctggttccgcgtcatatgtctagagtcgacctg 3′ (Seq ID NO:38) Lower primer: 5′ cgcggatccattagttctctccttcttccacttc 3′ (SEQ ID NO:39).
A BamHI site at the 5′ end of SEQ ID NO:39 is ggatccatta; the TGA is replaced by TAAT (atta, in SEQ ID NO:39).
A program useful to amplify the product using Pfu polymerase comprises: 95° C. 5′ 1 cycle, then 94° C. 2′→56° C. 2′→70° C. 2′ 10 cycles, then 94° C. 2′→70° C. 3′ 30 cycles and hold at 4° C. A QIAEXII kit (Qiagen) can be used to purify an agarose gel slice containing a desired DNA band. The insert and vector are digested with BamHI and NdeI following the instructions of the manufacturer, purified using agarose gel electrophoresis and a QIAEXII kit (Qiagen), and incubated together overnight with T4 DNA ligase following the manufacturer's directions.
E. coli (DH5alpha, or preferably, XL1-Blue) is transformed with the ligation mixture. The clones can be checked by small scale induction and SDS-PAGE and can be assured by immunoblotting of the crude lysates with anti-C3 antibody. Plasmid DNA is purified, and can be assessed for purity. DNA sequencing can be performed (e.g., by LiCor technology in which the entire strand is sequenced for the full length of the clone).
A first construct prepared in this fashion (pET3a-BA-07, SEQ ID NO:7) matched the theoretical DNA sequence of construct pGEX/APLT with a slight change in the 5.
A second construct, pET9a-BA-07, can be prepared by subcloning the insert from pET3a-BA-07 into the pET9a vector by cleaving the pET3a construct with BamHI and NdeI (New England BioLabs, Beverly, Mass.) according to the manufacturers instructions. pET9a plasmid DNA can be cleaved with the same enzymes. The insert DNA and the vector DNA can be purified by agarose gel electrophoresis. The insert can be ligated into the new vector using T4 DNA ligase (New England BioLabs, Beverly, Mass.). The ligated DNA can be transformed into DH5alpha cells and DNA can be prepared using QIAGEN mini and maxi kits. Clones can be characterized by restriction digestion and DNA sequencing of the insert in both directions (e.g., BioS&T, Lachine, Quebec). The construct DNA can be transformed into BL21 (DE3) cells and BL21(DE3)/pLysS cells.
pET9a-BA-07 protein expression (SEQ ID NO: 57) is superior in BL21(DE3) compared to BL21(DE3)/pLysS.
The proteins of the present invention may be prepared from bacterial cell extracts, or through the use of recombinant techniques by transformation, transfection, or infection of a host cell with all or part of a fusion protein-encoding DNA fragment such as a BA-05-encoding DNA fragment) with an antennapedia-derived transport sequence in a suitable expression vehicle.
One skilled in the field of molecular biology will understand that any of a wide variety of expression systems can be used to provide a recombinant protein of this invention. The precise host cell used is not usually critical to the invention, but variations in yields are expected from one host cell type to another.
A fusion protein can be purified by utilising protein purification techniques known in the art such as affinity purification techniques or column chromatography using resins that separate molecules on the basis of properties such as charge, size and hydrophobicity. Useful affinity techniques include those employing an antibody (e.g., GST) specific for the fusion protein being expressed. Histidine-tagged proteins can be selectively eluted with imidazole-containing buffers. Alternatively, recombinant protein can be fused to an immunoglobulin Fc domain. Such a fusion protein can be readily purified using a protein A column.
Any of these techniques can be automated and optimized to provide superior reproducibility and high throughput by use of commercially available liquid chromatography equipment specialized for protein purification. It is envisioned that small molecule, peptide or other mimetics of the above described antagonists are also encompassed by the invention.
The ability of BA-05 and BA-07 to inactivate Rho can be demonstrated using a cell culture assay. In this assay the cancer cell line is plated on tissue culture under the conditions that are to be utilized. For example, NG108 cells can be plated and left to proliferate until semi-confluent. NG108 is a neuroblastoma X glioma formed by Sendai virus-induced fusion of the mouse neuroblastoma clone N18TG-2 and the rat glioma clone C6 BU-1. The cells are then harvested, homogenized, and a Rho pull down assay is performed. The pull down assay uses a “bait” that binds to active Rho. In our assay we can use, for example, Rho binding domain (RBD) from Rhoteckin. Other proteins, such as Rho kinase, can also be used. The “bait” is linked to a bead so that it can be precipitated from the homogenate. RBD binds to the GTP-Rho in the homogenate and does not bind to GDP-Rho. In this way, active Rho in the cell culture can be assessed quantitatively. The extent that BA-07 inactivates Rho in a cell line can be demonstrated by treating a sample of cells of the cell line before performing a pull down assay.
A pull-down assay can be used to determine the amount of active Rho in a solid tumour. A tumour sample is homogenized in buffer, a pull-down assay performed, and the amount of GTP Rho can be compared with the amount found in a non-cancerous tissue. This assay to detect active Rho can be used as a diagnostic for tumours that comprise cells with highly activated levels of Rho and which can respond according to this invention, for example to BA-07 therapy. Measure of activated Rho can be more sensitive than simply examining expression levels of Rho.
An in situ pull down assay can be used to detect GTP-Rho in histological sections. For this assay, cryosections (each about 16 μm in thickness) of tumour samples are incubated, after post fixation with 4% PFA, with a bacterial lysate containing the RBG-GST overnight at 4° C. The sections are then washed 3 times in TBS, blocked in 3% BSA for about 1 hr at room temperature and incubated with an anti-GST antibody (Cell signalling, New England Biolabs, Mississauga, Canada) and with cell-type specific antibodies to identifiy specific cells, and incubated overnight at 4° C. the sections are washed in TBS and incubated for 2 hr at room temperature with FITC, Texas Red or Rhodamine conjugated secondary antibodies to reveal immunoreactivity (Jackson ImmunoResearch, Mississauga, Canada).
With respect to this invention, a useful fusion protein designated as BA-05 has the following DNA coding sequence here displayed using conventional G, A, T, and C nomenclature: In oligonucleotide sequences of this invention, the symbols G, C, A, and T have their conventional meaning.
An amino acid residue comprises the group —NH—CR1R2—CO— when the amino acid residue is located internally in a peptide. The residue is formed from the corresponding amino acid NH2—CR1R2—COOH, wherein R1 and R2 are substituents subtended at the central carbon of the amino acid to comprise the remainder of the amino acid, by loss of H2O to form an amide or a peptide bond with other amino acids, one at the nitrogen and one at the carboxylic acid carbonyl. An amino acid residue at the N-terminus of a peptide comprises the group NH2—CR1R2—CO— in which the carbonyl is bonded by a peptide bond with another amino acid residue in the peptide. An amino acid residue at the C-terminus of a peptide comprises the group —NH—CR1R2—COOH in which the nitrogen is bonded by a peptide bond with another amino acid residue in the peptide.
Amino acid residues that can be present in peptide and protein sequences of this invention are sometimes referred to as three letter codes or single letter codes commonly used in the art, which codes comprise: glycine as Gly or G; alanine as Ala or A; valine as Val or V; leucine as Leu or L; isoleucine as Ile or I; methionine as Met or M; phenylalanine as Phe or F; tryptophan Trp or W; proline as Pro or P; serine as Ser or S; threonine as Thr or T; cysteine as Cys or C; tyrosine as Tyr or Y; asparagine as Asn or N; glutamine as Gln or Q; aspartic acid Asp or D; glutamic acid Glu or E; lysine as Lys or K; arginine as Arg or R; and histidine as His or H. Other amino acids that are not essential amino acids can be introduced using methods of peptide synthesis known in the art or by chemical modification such as by acylation (such as by reaction of a lysine epsilon amine group with an active ester comprising a carbonyl group to achieve a bond between the epsilon amine and the carbonyl group), alkylation, urea formation, urethane formation, and the like to add to the peptide chain chemical functional groups containing hydrophobic groups (e.g., C-1 to C-18 alkyl and/or aralkyl, which may be saturated, unsaturated, or contain carbocylic groups such as a proline amide), to add positively charged groups such as quaternary ammonium alkyl groups or basic amino groups that can be protonated at a pH found in a patient with cancer, or both.
In peptides and proteins of this invention, relatively non-polar and hydrophobic amino acid residues can comprise G, A, V, L, I, M, F, W, and P; relatively polar and hydrophilic amino acid residues can comprise S, T, C, Y, N, and Q; anionic and hydrophilic amino acid residues can comprise D and E, wherein in each of D and E a carboxylic acid functional group can be in deprotonated form as an anionic carboxylate; cationic and hydrophilic amino acid residues can comprise K in which the basic epsilon primary amino group can be in protonated form as a cationic ammonium group, H in which the imidazole nitrogen can be in protonated form to provide an imidazolium cationic group, and R which can comprise a protonated amidate group.
In one aspect, a pharmaceutical composition comprising a fusion protein of this invention can be administered, for example by injection or by a topical application such as by a coating method or other method as described herein to a tissue proximal to or comprising a first tumor in a mammal in need of treatment and can inhibit migration of a metastatic tumor cell in the mammal, the tumor cell originating from a site of the first tumor in the mammal, to a site in healthy or normal tissue of the mammal which is functionally related and proximal to the tissue in which the first tumor resides. For example, a pharmaceutical composition comprising a fusion protein of this invention can be administered to a kidney tissue proximal to or comprising a kidney tumor a mammal and can inhibit migration of a metastatic kidney tumor cell from the tumor in the kidney to healthy tissue in the same kidney in which the first tumor resides.
In another aspect, a pharmaceutical composition comprising a fusion protein of this invention can be administered, for example by injection or by coating or other method as described herein to a tissue proximal to or comprising a first tumor in a mammal in need of treatment, and can inhibit migration of a metastatic tumor cell in the mammal, the tumor cell originating from a site at the first tumor in the mammal, to a site in a healthy or normal tissue or organ in the mammal that is functionally separate from or remote from the tissue in which the first tumor resides. For example, a pharmaceutical composition comprising a fusion protein of this invention be administered to a tissue in the brain comprising a brain tumor, and can inhibit migration of a metastatic brain tumor cell into healthy tissues elsewhere in the body such as liver, spleen or lung tissue.
In another aspect, after administration of a pharmaceutical composition comprising a fusion protein of this invention to a patient in need of treatment, metastatic migration of a malignant tumor cell is prevented or inhibited, and can substantially reduce or completely prevent formation of a secondary tumor and can prevent the spread of malignant cancer in a patient.
The therapeutic effectiveness of a pharmaceutical composition comprising a fusion protein of this invention (such as BA-05) as an anti-metastatic agent can be demonstrated, for example quantitatively, by means of an in vitro two-dimensional cell invasion assay. In one such assay, inhibition of metastatic migration ability of a malignant cell can be measured through the use of purchased Boyden chambers. Boyden chambers have 2 compartments, wherein the upper and lower compartments are separated by a membrane. The extent of cell migration is measured by plating a total number of cells in the upper compartment, and counting the fraction of that total number of cells that migrate to the lower compartment. Growth factors can be added to the lower compartment to enhance cell migration. This model is useful as a model of cancer cell migration in vivo in a mammal. To test the ability of a pharmaceutical composition comprising a fusion protein of this invention (such as BA-07 in sterile phosphate buffered saline that is isotonic with blood of a mammal) to block migration of tumor cells, the composition comprising BA-07 is added at different concentrations of BA-07 to the cancer cells in the upper compartment. The fraction of the total number of cells that migrate to the lower compartment in the presence of fusion protein composition are counted and compared with controls in which the fusion protein is at zero concentration. The number of cancer cells that migrate in a control experiment model such migration in a cancer patient who is not treated with a composition of this invention. The number of cancer cells that migrate in the presence of an aliquot of a composition of this invention model such migration in a cancer patient who is treated with an aliquot of a composition of this invention. The difference between the latter and the control experimental cell migration numbers can be expressed in per cent and can range from 100% (i.e., complete inhibition of migration of a metastatic cell) to about 5%, preferably from 100% to about 50%, more preferably from about 100% to about 75%, and most preferably from about 100% to about 90%. A 0% amount can be observed when a first control vehicle is compared with a second control vehicle which may be the same as the first control vehicle. A calculation of this per cent is given by solving the expression={(number of cells migrating in the control minus number of cells migrating in the presence of fusion protein) divided by (number of cells migrating in the control)}. times 100%.
The therapeutic effectiveness of a pharmaceutical composition comprising a fusion protein of this invention (such as BA-05) as an anti-metastatic agent can be demonstrated at least qualitatively and in one aspect by means of an in vitro three-dimensional cell invasion assay. In one such assay, inhibition of metastatic migration ability of a malignant cell can be measured by the change in the relative ability of a malignant cell to migrate through a MATRIGEL™ matrix after treatment of the cell with a pharmaceutically acceptable formulation of this invention comprising a fusion protein of this invention in a carrier vehicle relative to the ability of the malignant cell to migrate through the MATRIGEL® matrix after treatment with the carrier vehicle as a reference control, the carrier vehicle containing no fusion protein. In one aspect, a fusion protein of this invention can inhibit migration of a metastatic tumor cell in a tissue matrix model to produce an inhibitory change as a reduction in rate of migration of the cell or as a reduction in the distance of migration of the cell in a time period.
The relative change in the distance of migration of a malignant cell through a model matrix is equal to the difference in the distance of migration of a cell in the presence of the fusion protein plus vehicle and the distance of migration of the cell in the presence of a control vehicle in the absence of the fusion protein, the difference divided by the distance of migration of the control vehicle. The relative changes can be expressed in per cent and can range from 100% (complete inhibition of migration of a metastatic cell) to about about 5%, preferably from 100% to about 50%, more preferably from about 100% to about 75%, and most preferably from about 100% to about 90%. A 0% amount can be observed when a first control vehicle is compared with a second control vehicle which may be the same as the first control vehicle.
In one embodiment, comparison of efficacies of two fusion proteins A and B of this invention, which fusion proteins differ from each other in their amino acid sequence, such as for example in their respective membrane penetration enhancing sequence, may provide different observed percentages of inhibition of migration of a given tumor cell type causes by A and by B. The relative differences (either absolute percentage such as 100% by A versus 80% by B, or qualitative differences such as A is better than B) in inhibition may be the same from tumor type to tumor type or may change from tumor type to tumor type.
In one aspect, a fusion protein of this invention can substantially (100%) inhibit metastatic migration of at least one type of tumor cell.
In another aspect, a fusion protein of this invention can substantially (100%) inhibit metastatic migration of at least two types of tumor cell.
A useful assay is based on the observed ability of an invasive tumor cell to migrate through an artificial basement membrane (MATRIGEL™). In this assay, the change in the ability of different cancer cell types, each with a differing ability to migrate through the MATRIGEL™ in the absence of treatment with a composition of this invention, and hence a differing metastatic invasiveness are evaluated by exposure to a concentration or dose range of a fusion protein of this invention from 0.1 μg/ml to 100 μg/ml. A preferred concentration range is about 0.0001 micrograms of fusion protein per cubic centimeter (cc) of tissue to about 100 micrograms per cubic centimeter of tissue.
Matrigel™ Matrix (BD Biosciences) is a solubulized basement membrane preparation extracted from EHS mouse sarcoma, a tumor rich in ECM proteins. Its major components are laminin, collagen IV, heparan sulfate proteoglycans, and entactin. At room temperature, BD Matrigel™ Matrix polymerizes to produce biologically active matrix material which can mimic mammalian cellular basement membrane, wherein cells can behave in vitro in a manner similar to in vivo conditions. Matrigel™ Matrix can provide a physiologically relevant environment for studies of cell morphology, biochemical function, migration or invasion, and gene expression.
In one aspect, a pharmaceutical composition comprising a fusion protein of this invention can be administered, for example by injection or by coating or other method as described herein to a tissue proximal to or comprising a first tumor in a mammal in need of treatment and can inhibit the process of angiogenesis of a metastatic tumor cell or group of tumor cells in the mammal, the tumor cell or group of cells originating from a site of the first tumor in the mammal, to a site in healthy or normal tissue of the mammal which is functionally related and proximal to the tissue in which the first tumor resides. For example, a pharmaceutical composition comprising a fusion protein of this invention can be administered to a kidney tissue proximal to or comprising a kidney tumor a mammal and can inhibit the process of angiogenesis of a metastatic kidney tumor cell from the tumor in the kidney in healthy tissue in the same kidney in which the first tumor resides.
In another aspect, a pharmaceutical composition comprising a fusion protein of this invention can be administered, for example by injection or by coating or other method as described herein to a tissue proximal to or comprising a first tumor in a mammal in need of treatment, and can inhibit the process of angiogenesis associated with growth of a metastatic tumor cell in the mammal, the tumor cell originating from a site at the first tumor in the mammal to a site in a healthy or normal tissue or organ in the mammal that is functionally separate from or remote from the tissue in which the first tumor resides. For example, a pharmaceutical composition comprising a fusion protein of this invention be administered to a tissue in the brain comprising a brain tumor, and can inhibit angiogenesis of a metastatic brain tumor cell in healthy tissues elsewhere in the body such as in liver, spleen or lung tissue.
In another aspect, after administration of a pharmaceutical composition comprising a fusion protein of this invention to a patient in need of treatment, angiogenesis associated with metastatic formation and growth of a malignant tumor cell can be prevented or inhibited. Administration of a pharmaceutical composition comprising a fusion protein of this invention to a patient in need of treatment, can substantially reduce or completely prevent angiogenesis associated with the formation of a secondary tumor and can prevent the spread and rooting of malignant cancer in a patient.
Formation of new blood vessels by angiogenesis is important in growth of a first tumor and subsequent growth of a second tumor formed from a cell or group of cells of the first tumor by metastasis. Inhibition of angiogenesis by a pharmaceutical composition comprising a fusion protein of this invention such as BA-07 can be evaluated in an in vitro system useful for the study of angiogenesis in the growth of a tumor, i.e., a system comprising cultivation of endothelial cells in the presence of an extract of basement membrane (Matrigel). In the experimental observation conditions, capillary-like structures or tubules associated with angiogenesis or blood vessel capillary formation can be viewed under a microscope. The inhibitory effect of a fusion protein of this invention such as BA-05 on the progress of angiogenesis or on the formation of a tubular capillary network or on the disruption of the process or progress of tumor-associated angiogenesis can be observed by following the disappearance of tubular structures in a Matrigel assay.
In a Matrigel assay, Matrigel (about 12.5 mg/mL) is thawed at about 4° C. The matrix (about 50 uL) is added to each well of a 96 well plate and allowed to solidify for about 10 min at about 37° C. The wells containing solid Matrigel are incubated for about 30 min with HUVEC cells at a concentration of about 15,000 cells per well. When the cells are adhered, medium is removed and replaced by fresh medium supplemented with a fusion protein of this invention such as BA-05 and incubated at 37° C. for about 6 to about 8 hours. Control wells are incubated with medium alone. To analyze the growth, tube formation can be visualized by microscopy at, for example, about 50× magnification. The relative mean length, Yx, of an angiogenesis-derived capillary network observed in an evaluation of a pharmaceutical composition comprising a fusion protein, x, of this invention can be quantified using Northern Eclipse software according to the instructions.
Data from a typical Matrigel assay experiment, for example relating to the effect of a pharmaceutical composition comprising a fusion protein designated as BA-05 on length of an angiogenesis-derived capillary network are summarized in Table 1. These data show that the network formation was inhibited by approximately 13% to about 20% under the dose and formulation conditions used versus the inhibition produced by a control vehicle wherein zero inhibition provides 100% growth. This effect on angiogenesis can be enhanced by using higher doses of fusion protein and by preincubation of the HUVEC cells with BA-05 prior to addition of the cells to Matrigel.
Demonstration that a fusion protein of this invention, such as BA-07, can affect multiple aspects of the phenotypes of malignant cells can be shown by monitoring tritiated thymidine incorporation in proliferating and growing cells, wherein tritiated thymidine added to cell culture medium is taken into the cells and becomes part of the thymidine triphosphate pool therein which is used by each cell to synthesize DNA. Tritiated thymidine becomes covalently incorporated into DNA macromolecules in each of the cells. In cells that are not growing or in cells that are undergoing death by apoptosis or by necrosis, tritiated thymidine is either not taken up into the cell or is released into the cell medium upon lysis of the cell. Tritiated thymidine incorporation can be used as an overall measurement of the effect of a fusion protein of this invention such as BA-07 on cell growth, cell division, cell stasis, and cell death. Cell lines in which BA-07 induces a decrease in 3H-thymidin comprise: human endometrial cancer cell line HEC 1B, human colorectal cancer cell line CaCo2, human melanoma cancer cell line SK-MEL-2, and human CNS cancer cell line A-172.
Data in Table 2 illustrate the effects of changes in dosage amounts of a composition comprising a fusion protein of this invention, BA-07, administered to each of eight representative human cancer cell lines on tritiated thymidine incorporation into the eight human cancer cell lines: HEC 1B, Caco-2, SK-MEL-1, HT1080, MCF7, SW480, 293S, and A172. The dose of fusion protein BA-07 administered ranged 50-fold from about 1 micrograms per milliliter to about 10 micrograms per milliliter to about 50 micrograms per milliliter (ug/mL).
It was unexpectedly observed that these human tumor cell lines exhibit reduced cell proliferation in the presence of the fusion protein. Table 2 shows the percent of growth compared to a control value of 100%.
Tumor cell lines can be divided into three separate groups with respect to tritiated thymidine incorporation A composition of this invention comprising fusion protein BA-07 exhibits a pronounced effect on cell proliferation in the HEC 1B cell line, which is an endometrial carcinoma cell line, with an inhibition of proliferation related to a 50% inhibitory concentration (IC50) of less than 1 ug/mL. In addition to the inhibition, there is a dose-response effect of increasing inhibition at the higher concentration of BA-07.
In Caco 2 and SK-MEL-1 cell lines, shown in Table 2, a fusion protein exhibits a strong inhibitory effect on cell proliferation as evidenced by lower level of tritiated thymidine incorporation into the cells of each cell line.
Abbreviations Used in this Disclosure.
The invention is further illustrated in various embodiments and aspects by the following non-limiting examples.
To demonstrate a method useful to prepare a fusion protein of this invention, an example of an antennapedia sequence added to the C-terminus of the C3 polypeptide is used. The DNA sequence to be added to the C-terminus can be any DNA sequence that will result in addition of at least one amino acid to the C-terminus of C3 polypeptide. The stop codon at the 3′ end of the DNA can be replaced with an EcoR1 site by polymerase chain reaction (PCR) using the primers 5′GAA TTC TTT AGG ATT GAT AGC TGT GCC 3′ (SEQ ID NO: 1) and 5′GGT GGC GAC CAT CCT CCA AAA 3′ (SEQ ID NO: 2). The PCR product can be sub-cloned into a pSTBlue-1 vector (Novagen, Madison, Wis.), then cloned into a pGEX-4T (Amersham Biosciences, Baie d'Urfe, Quebec) vector using BamH I and Not I restriction site. This vector can be called pGEX-4T/C3 and provides a general method to prepare a fusion protein of this invention. An antennapedia sequence useful to add to the 3′ end of C3 in pGEX-4T/C3 can be created by PCR from the pET-3a vector containing the antennapedia sequence (Bloch-Gallego (1993) 120: 485-492; and Derossi (1994) 269: 10444-10450), subcloned into a pSTBlue-1 blunt vector, then cloned into the pGEX-4T/C3, using the restriction sites EcoR I and Sal I, creating pGEX-4T/BA-14. Manipulations of the target plasmid sequence, such as employing nucleases present in plasmid DNA or purchased enzymes that result in new DNA sequences, exonuclease III digestion or site-directed mutagenesis using two synthetic oligonucleotides containing the desired DNA sequence incorporated into the pGEX4T/BA-14, can be used to produce novel DNA sequences that when expressed in an appropriate system produce proteins that can be purified by standard methods such as affinity chromatography or standard chromatography using methods such as ion exchange to separate by charge, size exclusion chromatography to separate by size, and other methods of protein purification. The proteins are tested in assays for ability to permeate cells, and the proteins are tested in assays for their ability to antagonize Rho activity. DNA sequence analysis can be performed on the plasmid sequences that produce responses better than that of C3 exotransferase, each compared as a control. pGEX-4T/BA-14 clone (Seq ID NO: 3) is a currently preferred sequence and provides a protein that is a preferred composition of this invention. An example of a C3-like fusion protein is denoted pGEX-4T/BA-05 (SEQ ID NO:37).
The proteins of the present invention may be prepared from bacterial cell extracts, or through the use of recombinant techniques by transformation, transfection, or infection of a host cell with all or part of a fusion protein-encoding DNA fragment such as a BA-05-encoding DNA fragment) with an antennapedia-derived transport sequence in a suitable expression vehicle.
The method of example 1 can be used to prepare a fusion protein designated BA-05, which fusion protein contains an amino acid sequence. BA-05 is the name given to the protein made by ligating a cDNA encoding C3 to a cDNA encoding a fusogenic 19-mer peptide.
An example of a C3-like fusion protein is denoted pGEX4T/BA-05 (SEQ ID NO:37).
This C3-like fusion protein is prepared by the method described to manipulate the antennapedia DNA into the pGEX4T/C3 DNA. Twenty or more C3-like fusion proteins are expressed and are purified as described by the manufacturer (Amersham BioSciences, Baie D'Urfé, Québec). The twenty proteins are examined for ability to inactivate Rho in an in vitro system. Proteins inactivating Rho to a greater extent, as measured by increased neurite outgrowth compared to vehicle control or control glutathione-S-transferase (GST) protein are subjected to further analysis. The products of this process can include proteins such as BA-14, a protein described in the general example, or new fusion proteins produced by the cloning method, which fusion proteins can have properties such as molecular weight and activity in Rho inactivation bioassays different than the fusion protein BA-14 molecule or different from a control of non-fusion protein C3 protein. New fusion proteins can contain a C3 amino acid sequence, but will be altered at the carboxyl terminus due to the method employed.
The method of example 1 can be used to prepare BA-07, which contains the following amino acid sequence:
Two PCR primers are designed to transfer one series of recombinant constructs (BA-05) into the pET-9a vector (Novagen, Madison, Wis.) to create BA-07 protein when expressed in an appropriate expression system: Upper primer: 5′ ggatctggttccgcgtcatatgtctagagtcgacctg 3′ (Seq ID NO: 38) Lower primer: 5′ cgcggatccattagttctccttcttccacttc 3′ (SEQ ID NO: 39). A BamHI site at the 5′ end of Seq ID NO: 39 is ggatccatta; the TGA is replaced by TAAT (atta, in SEQ ID NO: 39).
A program useful to amplify the product using Pfu polymerase comprises: 95° C. 5′ 1 cycle, then 94° C. 2′ ®56° C. 2′ ®70° C. 2′ 10 cycles, then 94° C. 2′ ®70° C. 3′ 30 cycles and hold at 4° C. A QIAEXII kit (Qiagen) can be used to purify an agarose gel slice containing a desired DNA band. The insert and vector are digested with BamHI and NdeI following the instructions of the manufacturer (New England BioLabs, Beverly, Mass.), purified using agarose gel electrophoresis and a QIAEXII kit (Qiagen), and incubated together overnight with T4 DNA ligase following the manufacturer's directions.
E. coli (DH5alpha, or preferably, XL1-Blue) is transformed with the ligation mixture. The clones can be checked by small scale induction and SDS-PAGE and can be assured by immunoblotting of the crude lysates with anti-C3 antibody. Plasmid DNA is purified, and can be assessed for purity. DNA sequencing can be performed (e.g., by LiCor technology in which the entire strand is sequenced for the full length of the clone).
A first construct prepared in this fashion (pET3a-BA-07, SEQ ID NO:7) matched the theoretical DNA sequence of construct pGEX/BA-05 with a slight change in the 5′ terminus due to the cloning strategy.
A second construct, pET9a-BA-07, can be prepared by subcloning the insert from pET3a-BA-07 into the pET9a vector by cleaving the pET3a construct with BamHI and NdeI (New England BioLabs, Beverly, Mass.) according to the manufacturers instructions. pET9a plasmid DNA can be cleaved with the same enzymes. The insert DNA and the vector DNA can be purified by agarose gel electrophoresis. The insert can be ligated into the new vector using T4 DNA ligase (New England BioLabs, Beverly, Mass.). The ligated DNA can be transformed into DH5alpha cells and DNA can be prepared using QIAGEN mini and maxi kits. Clones can be characterized by restriction digestion and DNA sequencing of the insert in both directions (e.g., by BioS&T, Lachine, Quebec). The construct DNA can be transformed into BL21 (DE3) cells, BL21(DE3)/pLysS cells (Novagen, Madison, Wis.) or another suitable expression system.
Cell lines are tested for mycoplasma and found to be negative prior to the initiation of the studies. Cell lines are obtained from ATCC. The line HEC-1B is cultured in E-MEM supplemented with 10% FBS and 1% HEPES. The line Caco-2 is cultured in E-MEM supplemented with 20% FBS, 1% HEPES, 1 mM sodium pyruvate and 0.1 mM of non-essential amino acid. The line SK-MEL-1 is cultured in McCoy's supplemented with 10% FBS and 1% HEPES.
Volumes of 100 μl of each 2× working solution of fusion protein, positive and vehicle controls are plated in triplicate in 96-well microtiter plates containing cells (4×103/100 μl), yielding a final volume of 200 μl. The plates are placed at 37° C. incubator with 100% humidity and 5% CO2. After about 54 hours of incubation, a volume of 20 μl of tritiated thymidine (3H-thymidine) (ICN, Montreal, Canada), containing 1.0 μCi, is added to each well. The 3H-thymidine is prepared in RPMI-1640 supplemented with 10% FBS. The cultures are incubated in the same conditions as stated above, for a further 18 hours. At the end of the incubation, the cells are harvested with an automated cell harvester (Tomtec), and the incorporated Counts per minute (cpm) of 3H-thymidine is measured with a microplate scintillation counter (TopCount NXT, Packard).
Demonstration that a fusion protein of this invention, such as BA-07, can affect multiple aspects of the phenotypes of malignant cells can be shown by monitoring tritiated thymidine incorporation in proliferating and growing cells, wherein tritiated thymidine added to cell culture medium is taken into the cells and becomes part of the thymidine triphosphate pool therein which is used by each cell to synthesize DNA. Tritiated thymidine becomes covalently incorporated into DNA macromolecules in each of the cells. In cells that are not growing or in cells that are undergoing death by apoptosis or by necrosis, tritiated thymidine is either not taken up into the cell or is released into the cell medium upon lysis of the cell. Tritiated thymidine incorporation can be used as an overall measurement of the effect of a fusion protein of this invention such as BA-07 on cell growth, cell division, cell stasis, and cell death. Cell lines in which BA-07 induces a decrease in 3H-thymidin comprise: human endometrial cancer cell line HEC 1B, human colorectal cancer cell line CaCo2, human melanoma cancer cell line SK-MEL-2, and human CNS cancer cell line A-172.
Data in Table 2 illustrate the effects of changes in dosage amounts of a composition comprising a fusion protein of this invention, BA-07, administered to each of eight representative human cancer cell lines on tritiated thymidine incorporation into the eight human cancer cell lines: HEC 1B, Caco-2, SK-MEL-1, HT1080, MCF7, SW480, 293S, and A172. The dose of fusion protein BA-07 administered ranged 50-fold from about 1 micrograms per milliliter to about 10 micrograms per milliliter to about 50 micrograms per milliliter (ug/mL).
The formation of new blood vessels is studied in a cell culture model by growing endothelial cells in the presence of a matrix of basement membrane (Matigel). Human umbilical vein endothelial cells (HUVEC) are harvested from stock cultures by trypinization, and are resuspended in growth medial consisting of EBM-2 (Clonetics), FBS, hydrocortisone, hFGF, VEGF, R3-IGF-1, ascorbic acid, hEGF, GA-1000, heparin. Matrigel (12.5 mg/mL) is thawed at 4° C., and 50 mL of Matrigel is added to each well of a 96 well plate, and allowed to solidify for 10 min. at 37° C. Cells in growth medium at a concentration of 15,000 cells/well are added to each well, and are allowed to adhere for 6 hours. The fusion protein, BA-07, is added to the well at about 10 mg/ml, and in other wells PBS is added as control. The cultures are allowed to grow for a further 6 to 8 hours. The growth of tubes can be visualized by microscopy at a magnification of 50×, and the mean length of the capillary network is quantified using Northern Eclipse software. Treatment of the cells in the Matrigel assay with fusion protein BA-07 reduces tube formation (see
A sulforhodamine B (SRB, available from Molecular Probes) protein staining assay for the in vitro measurement of cellular protein content was developed and subsequently adopted for routine use in the NCI in vitro antitumor screening (Skehan et al., 1990). The SRB binds to basic amino acids of cellular protein and colorimetric evaluation provides an estimate of total protein mass which is related to cell number. This assay is based on the assumption that dead cells either lyse and are removed during the procedure, or otherwise do not contribute to the colorimetric end point. The SRB assay might overestimate the surviving fraction of cells.
These tests are conducted on a NCI 60 cell line panel. Cells are grown in RMPI-L 640 media supplemented with 5% fetal bovine serum and L-glutamine according to ATCC recommendations for each cell line. Cells in logarithmic growth are trypsinized and counted. Cells are inoculated in a 96-well microplate depending on the doubling time of individual cell lines in 100 μL of growth media. The microplates are incubated at 37° C., 5% CO2 and 100% relative humidity for 24 h to resume exponential growth. After 24 h, two plates of each cell line are fixed in situ with TCA to represent a measurement of the cell population for each cell line at the time of test article addition (T0). The TCA is removed and the plates are incubated at room temperature for at least 24 h to dry.
A fusion protein of this invention is prepared and stored frozen as a lyophilized powder. It can be reconstituted with sterile water to form a pharmaceutical composition at about 4.42 microgram of fusion protein per microliter in 10 mM sodium phosphate, buffer pH 7.4. For each dose point, serial dilutions of the stock solution are prepared with complete medium containing 50 μg/mL gentamicin to provide fusion protein at 200 μg/mL, 20 μg/mL, 2 μg/mL, 0.2 μg/mL, and 0.02 μg/mL. Aliquots of 100 μL of those test article dilutions are added to the appropriate well already containing 100 μL of medium to achieve the final log dilution series doses for the fusion protein.
After fusion protein (i.e., drug) addition, the microplates are incubated for an additional period at 37° C., 5% CO2 and 100% relative humidity. The assay is terminated by fixing the protein in the cells to the bottom of the wells using trichloroacetic acid (TCA). The plates are dried, and then 100 μL of SRB solution at 0.4% (w/v) in 1% acetic acid is added to each well. The plates are incubated with the protein-binding stain for 10 min at room temperature.
After staining, unbound dye is removed by washing 1% acetic acid, and the plates are dried. Bound stain is solubilized by adding 200 μL of 10 mM Trizma base while the plates are gently mixed. The amount of dye is measured by reading the optical density with a microplate reader at a wavelength of 515 nm.
Data is analyzed in an Excel spreadsheet.
A percentage growth is calculated for each of the test article concentrations:
for concentrations where Ti>T0
for concentrations where Ti<T0.
The % growth inhibition can be used to prepare a chart to compare the effect at different doses. The percentage growth plots are plotted, and the points where the dose response curves crossed the PG values of +50, 0, and −50 are used to calculate the GI50, TGI and LC50. GI50, or concentration required to inhibit growth 50% is the relevant parameter for the fusion protein.
One fusion protein of this invention, BA—0_, has an effect on 4 of 6 human tumor cell lines tested with 3H-thymidine and an effect on about 10% of the cell lines of the NCI screen. In the SRB test, it appears to have cytostatic properties; growth is inhibited compared to controls but the overall amount of protein does not decrease compared to the amount measured at time zero (Tz). These results agree with in vivo data showing that C3 transferase is not highly toxic to animals. The observed GI50 values are in the nanomolar to micromolar range, given a molecular weight of about 27 kDa for the fusion protein.
NG108 cells are grown in cell culture in the presence of 5% fetal bovine serum (FBS), 1% penicillin-streptomycin (P/S). After the cells settle (3-6 hours at 37° C.), BA-05 is added to the cultures. To lyse the cells, they are washed with ice cold Tris buffered saline (TBS) and are lysed in modified RIPA buffer (50 mM Tris pH 7.2, 1% Triton X-100; 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, 10 mM MgCl2, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 mM phenylmethyl-sulfonyl fluoride (PMSF)). Cell lysates are clarified by centrifugation at 13,000 g for 10 minutes at 4° C. and kept at minus 80° C. (−80° C.).
Purification of GST-Rho Binding Domain (GST-RBD) is performed with the cell lysates, which are thawed and resuspended in 500 uL of RIPA buffer per 1 million cells. To make the GST-Rho Binding Domain (GST-RBD), bacteria expressing GST-RBD in a PGEX vector are grown in L-broth (LB) with 100 μl/ml amplicillin. Overnight cultures are diluted 1:10 into 3600 ml LB and incubated in a shaking bacterial incubator at 37° C. for 2 hours. Isopropyl-β-D-thiogalactopyranoside (0.5 mM) is then added to the incubating cultures for 2 hours. Bacteria are then collected by centrifugation at 5,000 g for 15 minutes. The pellets are then resuspended in 40 ml lysis buffer (50 mM Tris pH 7.5, 1% Triton-X, 150 mM NaCl, 5 mM MgCl2, 1 mM DTT, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 mM PMSF). After sonication, the lysates are spun at 14,000 rpm for 30 minutes at 4° C.
Frozen cell culture is homogenized in RIPA buffer (50 mM Tris pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, 10 mM MgCl2, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 mM PMSF). The homogenates and cell lysates are clarified by two 10-minute centrifugations at 13,000 g at 4° C. They are then incubated for 50 minutes at 4° C. with GST-RBD coupled to glutathion agarose beads (Sigma, Oakville, Canada). The beads are then washed 4 times and eluted in sample buffer. GTP-bound Rho and total Rho present in tissue homogenates are detected by western blot. The proteins are transferred to nitrocellulose and are probed using a monoclonal RhoA antibody (Santa Cruz, Santa Cruz, Calif.). Bands are visualized with peroxidase-linked secondary antibodies (Promega, Madison, Wyo.) and an HRP based chemiluminescence reaction (Pierce, Rockford, Ill.). Densitometry analysis is performed to quantitate the signal in each band.
Biopsy samples of tumours are taken by surgical removal from a tissue in a mammal (e.g., a human patient) to leave residual tissue in the margin of the excised tumor when all of a tumor is removed. The samples are frozen on dry ice or in liquid nitrogen. Samples of excised tissue of approximately 5 mm2 are homogenized in 500 uL RIPA buffer (50 mM Tris pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, 10 mM MgCl2, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 1 mM PMSF). The homogenates are clarified by two 10-minute centrifugations at 13,000 g at 4° C. to provide samples for further analysis. The samples are then incubated for 50 minutes at 4° C. with GST-RBD coupled to glutathion agarose beads, prepared as described in example 8. GTP-bound Rho and total Rho present in the tissue homogenates are detected by western blot.
To detect which cells in the biopsy sample have activated Rho, cryostat sections can be prepared. Bacterial lysates of RBD-GST are clarified by centrifugation at 14,000 rpm for 30 minutes at 4° C. Activated Rho is detected by incubating the section with bacterial lysate containing RBD-GST. Rat spinal cord cryosections (about 16 μm thickness) are incubated, after post fixation with 4% PFA, with the bacterial lysate overnight at 4° C. The sections are then washed 3 times is TBS, blocked in 3% BSA for 1 hr at room temperature and incubated with anti-GST antibody (Cell signalling, New England Biolabs, Mississauga, Canada) and with cell-type specific antibodies. In the case of a brain tumour neuron-specific antibody (NeuN) or astrocyte-specific antibody (GFAP) can be used to detect the cell type with activated Rho to aid in tumour diagnosis. Sections are washed in TBS and incubated for 2 hr at room temperature with FITC, Texas Red or Rhodamine conjugated secondary antibodies (Jackson ImmunoResearch, Mississauga, Canada).
Metalloproteinase activity is detected by zymography whereby proteolytic activity of enzymes is separated in polyacrylamide gels under non-reducing conditions. To detect metalloproteinase activity the glatinolytic activity in culture media from growth of Caki-1 colon carcinoma cells is detected by gelatin zymography. The Caki-1 cells are incubated with BA-07 at 0.1, 1.0 or 10 μg/ml or buffer as control for 24 hr. An aliquot (25 μL) of the culture media is subjected to SDS/PAGE with 7.5% polyacrylamide containing 1 mg/ml gelatin, and the polypeptides are separated under non-reducing conditions. To assess MMP activity, SDS is removed by incubation for 30 min at room temperature in 2.5% (v/v) Triton X-100. This step is repeated, followed by five rinses with ddH20. Next, the gel is incubated for 20 h at 37° C. in a buffer containing 50 mM Tris-HCl, pH 7.6, 0.2 M NaCl, 5 mM CaCl2, and 0.02% (v/v) Brij-35. The gel is stained with Coomassie Brilliant Blue R-250, and destained. Enzyme activity on the gelatin substrate is detectable as transparent bands in a blue background. The identity of the MMP enzyme with gelatinase activity is assessed with a positive control such as, in these experiments, HT-1080.
The method of example 10 is employed using the fusion protein BA-07. A reduction in metalloproteinase activity is observed.
A therapeutically effective unit dosage amount of a fusion protein of this invention such as BA-07 is dissolved in a unit dosage volume of a sterile isotonic solution such as sterile isotonic PBS to form a unit dosage amount of solution, which is filtered through a 0.2 micron filter under aseptic conditions. The filtrate is collected into a sterile vial under an inert atmosphere (e.g., nitrogen or argon). The vial is then sealed with a sterile septum and crimp cap, and stored at room temperature. The unit dosage amount of solution in the vial containing the fusion protein such as fusion protein BA-07 can be administered to a patient by injection such as by intravenous delivery, infusion, or by injection directly into a tumor site in a mammal such as tumor in a human patient, or by injection into the margins of the site of excision of a tumor in the tissue of a mammal such as a tissue in a human patient.
Two or more vials each containing a unit dosage amount can be prepared in similar fashion, and the unit dosage amounts can be administered by injection over a therapeutically effective time of treatment to a patient in need of treatment. In such fashion, a sequence of unit dosage amount administrations can be made to the tissue of a patient or systemically to a patient. For example, a unit dosage amount of a fusion protein composition can be administered once a day to a patient, or once every two days to a patient, or once a week to a patient. In addition, a therapeutically effective unit dosage amount of a pharmaceutical composition comprising a fusion protein can be administered to a patient having a tumor in a tissue of the patient systemically on one or more occasions before the tumor is excised and/or into the diagnostically identified margins of a tumor in the patient on one or more occasions before the tumor is excised such as by surgical excision, and/or directly into the tumor tissue on one or more occasions before the tumor is excised, and/or systemically on one or more occasions after the tumor is excised, and/or directly into the residual margins of the tumor after the tumor is excised. The number of such repeated unit dosage administrations and the amount of fusion protein per unit dosage form can vary from patient to patient and from tumor type to tumor type and tumor size in order to prevent growth of a second tumor in the presence of a first tumor or after removal of a first tumor.
A solution comprising unit dosage amount of a composition of this invention comprising a fusion protein such as BA-07 dissolved in an pharmaceutically acceptable isotonic aqueous medium comprising a pharmaceutically acceptable buffer salt and/or a readily water-soluble pharmaceutically acceptable carbohydrate (preferably a pharmaceutically acceptable non-reducting sugar or a cyclodextrin) is sterile-filtered (e.g. through a 0.2 micron filter) under aseptic conditions, the filtrate is placed in a sterilized vial, the filtrate is frozen, the frozen aqueous solution is lyophilized aseptically at reduced pressure in a pharmaceutically acceptable lyophilizer to leave a dried matrix comprising the fusion protein in the vial, the vial is returned to atmospheric pressure under a sterile inert atmosphere, the vial is sealed with a sterile stopper (e.g. together with a crimp cap). The sealed vial is labeled with its contents and dosage amount and placed in a kit together with a second sealed sterile vial which contains sterilized water for injection in an amount useful to transfer into the first vial containing the lyophilized fusion protein in order to reconstitute the fusion protein matrix to a solution as a unit dosage form. In another embodiment, the fusion protein can be dissolved in a starting volume of aqueous medium which comprises a hypertonic aqueous medium, the solution sterile filtered, the filtrate filled into a vial, and lyophilized to form a dried matrix. This dried matrix can be dissolved or reconstituted in a larger-than-original volume of sterile water, the larger volume sufficient to form an isotonic solution for injection. Alternatively, a hypertonic solution can be used for administration by infusion into a drip bag containing a larger volume of isotonic aqueous medium such that the hypertonic solution is substantially diluted. Optionally, a vial containing a volume of sterile water in an amount suitable to reconstitute the matrix to a unit dosage form is distributed as a kit with the lyophilized protein. Preferably the reconstituted composition comprises an isotonic solution. The fusion protein can be used for intravenous delivery, and/or infusion, and/or direct injection into a tumor with this formulation in a manner similar to that in the previous example.
A composition of this invention comprising a fusion protein, such as BA-07, is formulated by blending into a co-polymer of polyglycolic acid (PGA) and polylactic acid (PLA). PGA/PLA co-polymers can degrade 2-6 months after implantation, depending on the ratio of PGA to PLA. In one formulation, PGA/PLA are used and dissolved in a non-denaturing organic solvent at concentrations of 0.5-50%, preferably 1.0-3.0%. The polymer solution can then be spread with a drawdown knife or cast on the surface of a polysaccharide-based film or foam or applied by spray or dip coating or other useful means, and then dried by removal of solvent. Composite mesh such as a mesh comprising a pharmaceutically acceptable dissolvable and/or degradable polymer can be made to incorporate a fusion protein such as BA-07, which will be released as the mesh degrades. The mesh can be implanted in the site of surgical resection of a tumor, and the fusion protein will be released to prevent metastasis and growth of any remaining tumor cells.
A composition of this invention comprising a fusion protein, such as BA-07, formulated in a pharmaceutically acceptable cream can be used to treat an excision site from the skin. An example is the treatment of malignant melanoma, where such a cream is put on the skin surrounding the excision site of the tumor. In one aspect, such a formulation of a cream containing the fusion protein such as BA-07 can be administered to the skin prior to excision of the tumor and used to treat the tumor between the period of first biopsy and before positive histological diagnosis. The cream when applied to the tumor site can prevent the spread and metastasis of the tumor.
A composition of this invention comprising a fusion protein, such as BA-07, for example such as an aqueous solution as described above or such as formulated in a surgical adhesive gel, such as a fibrin adhesive or a hydrogel, can be used to treat the area of a surgical resection of a tumor. An example is the treatment of a healthy colon after colonectomy for a colon cancer. The healthy colon tissue that otherwise surrounded the tumor region prior to excision of the tumor can be treated with a fusion protein composition such as BA-07, after removal of the tumor and associated tissue, in a surgical gel such as a fibrin sealant, and will be useful to prevent formation of additional lesions in the residual tissue.
A melanoma cell line is implanted subcutaneously in a first group of nude mice (Charles River Laboratories). Tumors are grown mice of the first group of mice, harvested, and transplanted individually into each mouse (one tumor per mouse) of a second group of mice. A daily injection of a pharmaceutical composition of this invention comprising an effective dose of a fusion protein such as BA-07, which is estimated to be in the range of 10-100 ug/mL of tumor volume, in a pharmaceutically acceptable vehicle is administered to each mouse in the second group of mice. Control animals are injected with vehicle as a control. Tumor growth is measured, and histology performed to measure markers from malignant keratinocytes such as gamma immuno protein 10 (IP10). The composition comprising the fusion protein prevents or substantially inhibits the growth of tumors in the second mice.
A therapeutically effective amount of a pharmaceutical composition of this invention comprising a fusion protein is coated onto the surface of a pharmaceutically acceptable breast implant. A tumor is excised from the tissue of a breast in a patient, optionally with co-administration (pre and/or post operative) of a pharmaceutical composition of this invention as described hereinabove. The void created by the excision of the tumor is filled at least in part with the breast implant coated with a pharmaceutical composition comprising a fusion protein, and the wound created by the excision and/or implantation is closed. Growth of a second tumor in the residual tumor margin tissue is substantially inhibited or prevented.
DNA Sequence of a representative fusion protein, BA-14
To demonstrate the method for making a fusion protein of this invention, an example of an antennapedia sequence added to the C-terminus of the C3 polypeptide is useful. A DNA sequence to be added to the C-terminus can be any DNA sequence that will result in addition of at least one amino acid to the C-terminus of a peptide comprising a C3 polypeptide.
First, pGEX2T-C3 plasmid DNA (N. Lamarche, McGill University) is prepared using standard methods. The stop codon at the 3′ end of the DNA can be replaced with an EcoR1 site by polymerase chain reaction (PCR) using the primers. 5′GAA TTC TTT AGG ATT GAT AGC TGT GCC 3′ (SEQ ID NO: 1) and 5′GGT GGC GAC CAT CCT CCA AAA 3′ (SEQ D NO: 2). The PCR product can be subcloned into a pSTBlue-1 vector (Novagen, Madison, Wis.), then cloned into a pGEX-4T (Amersham Biosciences, Baie d'Urfe, Quebec) vector using BamH I and Not I restriction site. This vector can be called pGEX-4T/C3 and provides a general method to prepare a fusion protein of this invention. An antennapedia sequence useful to add to the 3′ end of C3 in pGEX-4T/C3 can be created by PCR from the pET-3a vector containing the antennapedia sequence (Bloch-Gallego (1993) 120: 485-492; and Derossi (1994) 269: 10444-10450), subcloned into a pSTBlue-1 blunt vector, then cloned into the pGEX-4T/C3, using the restriction sites EcoR I and Sal I, creating pGEX-4T/BA-14.
The fusion proteins of the present invention may be prepared from bacterial cell extracts, or through the use of recombinant techniques by transformation, transfection, or infection of a host cell with all or part of a fusion protein-encoding DNA fragment such as a BA-05-encoding -DNA fragment) with an antennapedia-derived transport sequence in a suitable expression vehicle.
An example of a C3-like fusion protein is denoted pGEX-4T/BA-05 (Seq ID NO: 4).
BA-05 is the name given herein to a protein made by ligating a cDNA encoding C3 to a cDNA encoding a fusogenic 19-mer peptide.
The method of example 19 can be used to prepare a fusion protein, BA-05, which contains the following amino acid sequence:
This C3-like fusion protein is prepared by the method described to manipulate an antennapedia DNA into the pGEX4T/C3 DNA, producing pGEX4T/BA-14. A clone with a frameshift mutation is selected, and the protein is made and tested. When cultures test positive despite the presence of a mutation, the plasmid DNA is resequenced to confirm the mutation. The new clone is herein called BA-05. To confirm the sequence of C3APLT, the coding sequence from both strands are sequenced. The sequence for this clone is given in Examples herein (nucleotide sequence of BA-05; SEQ ID NO:3, amino acid sequence of BA-05; SEQ ID NO:4).
Another method useful to make BA-05 is to prepare pGEX-4T/BA-14, then use the technique of site-directed mutagenesis using two complementatry oligonucleotide primers such as (SEQ ID NO:58) 5′ CCTAAAGAAT TCGTGATGAA TCCCGCAAAC GCGCA 3′ and SEQ ID NO:59 5′ TGCGCGTTTG CGGGATTCAT CACGAATTCT TTAGG 3′) containing a 1 basepair deletion in the pGEX4T-BA14 DNA. A QuikChange kit (Statragene, LaJolla, Calif.) is used to incorporate the deletion using extension of the primers in the presence of nucleotides. The following cycle of temperatures is useful for preparation of BA-05: 1 cycle for 30 s at 95C, then 18 cycles of 95C for 30 s, 55 C for 1 min, and 68C for 10.5 min. The DNA is then treated with the restriction enzyme DpnI as described by the manufacturer. A portion of the reaction is then transformed into E. coli DH5alpha or XL1-Blue. Individual colonies of E. coli are isolated on agar plates containing selective antibiotic, and grown in LB medium+ampicillin. DNA is isolated using a MidiPrep Kit (Qiagen). The DNA of 5 clones is sequenced and the sequence change is confirmed. Protein is expressed from the DNA and purified as described in Lehmann et al., 1999. The purified protein can be used as a Rho antagonist in biological systems.
To prepare recombinant BA-05 (SEQ ID NO:3) the plasmids containing the corresponding cDNA (pGEX4T/BA-05) are transformed into bacteria, strain XL-1 blue competent E. coli. The bacteria are grown in L-broth (10 g/L Bacto-Tryptone, 5 g/L Yeast Extract, 10 g/L NaCl) with ampicillin at 50 ug/ml (BMC-Roche), in a shaking incubator for 1 hr at 37° C. and 300 rpm. Isopropyl .beta.-D-thiogalactopyranoside (IPTG), (Gibco) is added to a final concentration of 0.5 mM to induce the production of recombinant protein and the culture is grown for a further 6 hours at 37° C. and 250 rpm. Bacteria pellets ware obtained by centrifugation in 250 ml centrifuge bottles at 7000 rpm for 6 minutes at 4.degree. C. Each pellet is re-suspended in 10 ml of Buffer A (50 mM Tris, pH 7.5, 50 mM NaCl, 5 mM MgCl.2, 1 mM DTT) plus 1 mM PMSF. All resuspended pellets are pooled and transferred to a 100 ml plastic beaker on ice. The remaining Buffer A with PMSF is added to the pooled sample. The bacteria sample is sonicated 6×20 seconds using a Branson Sonifier 450 probe sonicator. Both the bacteria and probe are cooled on ice 1 minute between sonications. The sonicate is centrifuged in a Sorvall SS-34 rotor at 16,000 rpm for 12 minutes at 4° C. to clarify the supernatant. The supernatant is transferred into fresh SS-34 tubes and re-spun at 12,000 rpm for 12 minutes at 4° C. Up to 20 ml of Glutathione-agarose beads (Sigma) are added to the cleared lysate and placed on a rotating plate for 2 to 3 hours. The beads are washed 4 times with buffer B, (Buffer A, NaCl is 150 mM, no PSMF) then 2 times with Buffer C (Buffer B+2.5 mM CaCl2). The final wash is poured out till the beads create a thick slurry. To remove the glutathione S transferase sequence from the recombinant protein, 20 U of Thrombin (Bovine, Plasminogen-free, Calbiochem) is added, the beads are left on a rotator overnight at 4° C. After cleavage with thrombin the beads are loaded into an empty 20 ml column. Approximately 20 aliquots of 1 ml are collected by elution with PBS. Samples of each aliquot of 0.5 ul are spotted on nitrocellulose and stained with Amido Black to determine the protein peak. Aliquots containing fusion proteins are pooled and 100 microliters of p-aminobenzamidine agarose beads (Sigma) are added and left mixing for 45 minutes at 4° C. This last step removes the thrombin from the recombinant protein sample. The recombinant protein is centrifuged to remove the beads and then concentrated using a centriprep-10 concentrator (Amicon). The concentrated recombinant protein is desalted with a PD-10 column (Pharmacia, containing Sephadex G-25M) and ten 0.5 ml aliquots are collected. A dot-blot is done on these samples to determine the protein peak, and the appropriate aliquots pooled, filter-sterilized, and stored at −80° C. A protein assay (DC assay, Biorad) is used to determine the concentration of recombinant protein. Purity of the sample is determined by SDS-PAGE, and bioactivity bioassay with NG-108 cells.
The products of this process can include fusion proteins such as BA-14 as described in the general example, or new fusion proteins produced by the cloning method that have properties such as molecular weight and activity in Rho inactivation bioassays different than the BA-14 molecule or control C3 protein, such as BA-05. These new fusion proteins will contain the C3 sequence and will be altered at the carboxyl terminus due to the method employed.
The method of example 1 can be used to prepare a fusion protein BA-07 which contains the following amino acid sequence:
Two PCR primers are designed to transfer one series of recombinant constructs (BA-05) into the pET-9a vector (Novagen, Madison, Wisconsin) to create BA-07 protein when expressed in an appropriate expression system: Upper primer: 5′ GGATCTGGTTCCGCGTCATATGTCTAGAGTCGACCTG 3′ (Seq ID NO: 38) Lower primer: 5′ CGCGGATCCATTAGTTCTCCTTCTTCCACTTC 3′ (SEQ ID NO: 39). A BamHI site at the 5′ end of Seq ID NO: 39 is ggatccatta; the TGA is replaced by TAAT (atta, in SEQ ID NO: 39).
A program useful to amplify the product using Pfu polymerase comprises: 95° C. 5′ 1 cycle, then 94° C. 2′→56° C. 2′→70° C. 2′ 10 cycles, then 94° C. 2′→70° C. 3′ 30 cycles and hold at 4° C. A QIAEXII kit (Qiagen) can be used to purify an agarose gel slice containing a desired DNA band. The insert and vector are digested with BamHI and NdeI following the instructions of the manufacturer (New England BioLabs, Beverly, Mass.), purified using agarose gel electrophoresis and a QIAEXII kit (Qiagen), and incubated together overnight with T4 DNA ligase following the manufacturer's directions.
E. coli (DH5alpha, or preferably, XL1-Blue) is transformed with the ligation mixture. The clones can be checked by small-scale induction and SDS-PAGE and can be assured by immunoblotting of the crude lysates with anti-C3 antibody. Plasmid DNA is purified, and can be assessed for purity. DNA sequencing can be performed (e.g., by LiCor technology in which the entire strand is sequenced for the full length of the clone).
A first construct is prepared in this fashion (pET3a-BA-07, SEQ ID NO:7) and acceptably matches the theoretical DNA sequence of construct pGEX/BA-05 with a slight change in the 5′ terminus due to the cloning strategy.
A second construct, pET9a-BA-07, can be prepared by subcloning the insert from pET3a-BA-07 into the pET9a vector by cleaving the pET3a construct with BamHI and NdeI (New England BioLabs, Beverly, Mass.) according to the manufacturers instructions. pET9a plasmid DNA can be cleaved with the same enzymes. The insert DNA and the vector DNA can be purified by agarose get electrophoresis. The insert can be ligated into the new vector using T4 DNA ligase (New England BioLabs, Beverly, Mass.). The ligated DNA can be transformed into DH5alpha cells and DNA can be prepared using QIAGEN mini and maxi kits. Clones can be characterized by restriction digestion and DNA sequencing of the insert in both directions (e.g., BioS&T, Lachine, Quebec). The construct DNA can be transformed into BL21 (DE3) cells, BL21(DE3)/pLysS cells (Novagen, Madison, Wis.) or another suitable expression system.
Cell lines are tested for mycoplasma and found to be negative prior to the initiation of the studies. Cell lines are obtained from American Type Culture Collection (ATCC) (Rockville, Md.). The line HEC-1B is cultured in Eagles Minimal Essential Medium (E-MEM) supplemented with 10% fetal bovine serum (FBS) and 1% HEPES. The line Caco-2 is cultured in E-MEM supplemented with 20% FBS, 1% HEPES, 1 mM sodium pyruvate and 0.1 mM of non-essential amino acid. The line SK-MEL-1 is cultured in Mc Coy's minimal medium supplemented with 10% FBS and 1% HEPES. Volumes of 100 μl of each 2× working solution of C3-07, positive and vehicle controls are plated in triplicate in 96-well microtiter plates containing cells (4×103/100 μl), yielding a final volume of 200 μl. The plates were placed at 37° C. incubator with 100% humidity and 5% CO2. After 54 hours of incubation, a volume of 20 μl of tritiated thymidine (3H-thymidine) (ICN, Montreal, Canada), containing 1.0 μCi, is added to each well. The 3H-thymidine is prepared in RPMI-1640 medium supplemented with 10% FBS. The cultures are incubated in the same conditions as stated above, for a further 18 hours.
At the end of the incubation, the cells are harvested with an automated cell harvester (Tomtec), and the incorporated counts per minute (cpm) of 3H-thymidine is measured with a microplate scintillation counter (TopCount NXT, Packard). Values from the wells treated with the BA-07 fusion protein are compared to values of the vehicle control. Data is graphed with counts per minute (cpm) on the y axis and the dose of fusion protein on the X axis.
| Number | Date | Country | Kind |
|---|---|---|---|
| 10902878 | Aug 2004 | US | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA04/01763 | 9/29/2004 | WO | 00 | 11/7/2006 |
| Number | Date | Country | |
|---|---|---|---|
| 60506162 | Sep 2003 | US |
