Patent Application
20130217721
The present invention relates generally to detection, diagnosis, monitoring and treatment of cancer, such as melanoma. The invention more specifically pertains to B-RAF inhibitor-resistant cancers and selection of effective treatment strategies.
Activating B-RAF V600E kinase mutations occur in ˜7% of human malignancies and ˜60% of melanomas. Early clinical experience with a novel class I RAF-selective inhibitor, PLX4032, demonstrated an unprecedented 80% anti-tumor response rate among patients with V600EB-RAF-positive melanomas, but acquired drug resistance frequently develops after initial responses. There is thus a need to discover mechanisms of melanoma escape from B-RAF inhibition that can be demonstrated in tumors from human subjects.
There remains a need for improved tools to permit the detection, identification and prognosis of drug resistant cancers, particularly B-RAF inhibitor-resistant melanomas. There also remains a need for targets useful in the detection and treatment of cancer.
The invention meets these needs and others by describing specific, targetable molecules mediating acquired resistance of B-RAF-mutant melanomas to a specific B-RAF inhibitor (PLX4032) in both in vitro models and patient-derived tissues, thereby providing materials and methods for the treatment and detection of B-RAF inhibitor resistant cancers. In one embodiment, the invention provides a method of identifying a patient to be treated with an alternative to B-RAF inhibitor therapy. The method comprises (a) assaying a sample obtained from the patient for a measure of B-RAF inhibitor resistance, (b) selecting samples that exhibit B-RAF inhibitor resistance; and (c) identifying a patient whose sample was selected in (b) as a candidate for alternative therapy. In a typical embodiment, the measure of B-RAF inhibitor resistance is selected from: (1) an alternative splice variant or gene amplification of V600EB-RAF; (2) elevated levels of PDGFR-beta; (3) an activating mutation of N-RAS; and (4) an activating mutation of AKT1.
In one embodiment, the assaying for an alternative splice variant of V600 EB-RAF comprises amplification of V600EB RAF. Amplification of V600EB-RAF and detection of alternative splice variants of V600EB-RAF can be performed using standard techniques known to those skilled in the art. Detection of one or more alternative splice variants comprises, for example, analysis of protein expression, whereby presence of a variant of the 90 kD V600EB-RAF is indicative of B-RAF inhibitor resistance. In one specific example, the presence of a B-RAF variant of approximately 61 kD is indicative of B-RAF inhibitor resistance. In another example, detection of one or more alternative splice variants comprises polymerase chain reaction (PCR) analysis of cDNA, DNA or RNA isolated from the sample obtained from the patient, whereby presence of a transcript that differs from the single 2.3 kb transcript representing full-length B-RAF is indicative of B-RAF inhibitor resistance. In one specific example, the presence of a transcript of approximately 1.7 kb is indicative of B-RAF inhibitor resistance. In some embodiments, the PCR is quantitative PCR or Q-PCR.
In one embodiment, the assaying for PDGFR-beta comprises assaying for PDGFR-beta mRNA, protein or phospho-protein. Assays for mRNA, protein and phospho-protein can be performed using techniques well-known to those skilled in the art. For example, conventional northern blots, western blots, dot blots, and immunoblots can be used. Detection of increased levels of PDGFR-beta relative to a control is indicative of B-RAF inhibitor resistance. In one embodiment, the assaying for hyperactivity of PDGFR-beta comprises measuring phospho-tyrosine levels on PDGFR-beta hyperactivity. An increased level of phosphor-tyrosine relative to a control is indicative of B-RAF inhibitor resistance. In one embodiment, an elevated or increased level is at least 50% more than control. In another embodiment, an elevated or increased level is at least 2-fold more than control. In some embodiments, elevated or increased is at least 5-fold or 10-fold more than control.
In one embodiment, the assaying for an indicator of N-RAS mutation comprises assaying for an activating N-RAS mutation. Example of activating N-RAS mutations include missense mutations at codon 12, 13 and 61, such as Q61K or Q61 R. In some embodiments, the assaying for an indicator of N-RAS mutation comprises assaying for elevated levels of N-RAS gDNA, mRNA or protein copy number.
In one embodiment, the assaying for an indicator of AKT1 mutation comprises assaying for an activating AKT1 mutation. Examples of activating AKT1 mutations include missense mutations that result in a Q79K amino acid substitution. In one embodiment, the assaying for an activating mutation of AKT1 comprises measuring phospho-AKT1 levels.
The method can be performed prior to B-RAF inhibitor therapy, and/or after initiation of B-RAF inhibitor therapy. In one embodiment, the B-RAF inhibitor is vemurafenib. The sample obtained from the patient can be a biopsy or other clinical specimen obtained, for example, by needle aspiration or other means of extracting a specimen from the patient that contains tumor cells. The sample can also be obtained from peripheral blood, for example, by enriching a sample for circulating tumor cells.
Examples of alternative therapy include, but are not limited to, augmenting B-RAF inhibitor therapy with at least one additional drug. The additional drug can include a MAPK/ERK kinase (MEK) inhibitor, such as PD0325901,GDC0973, GSK1120212, and/or AZD6244. Another example of an additional drug is an inhibitor of the RTK-PI3K-AKT-mTOR pathway, such as BEZ235, BKM120, PX-866, and/or GSK2126458. In one embodiment, the alternative therapy comprises suspension of vemurafenib therapy.
In some embodiments, the patient has, or is suspected of having, a B-RAF-mutant cancer. In a typical embodiment, the patient has, or is suspected of having, a B-RAF-mutant melanoma.
The invention further provides a method of treating a patient having cancer, the method comprising administering to the patient a MEK inhibitor, optionally in conjunction with vemurafenib therapy, or an inhibitor of the MAPK pathway (RAF, MEK, ERK) in conjunction with an inhibitor of the RTK-PI3K-AKT-mTOR pathway. Examples of MEK inhibitors include, but are not limited to PD0325901,GDC0973, GSK1120212, and/or AZD6244. Examples of inhibitors of the RTK-PI3K-AKT-mTOR pathway include, but are not limited to BEZ235, BKM120, PX-866, and GSK2126458. In a typical embodiment, the patient has melanoma. In one embodiment, the melamona is a B-RAF-mutant melanoma. In one embodiment, the melanoma expresses a 61 kD variant of B-RAF, such as, for example, one that lacks exons 4-8.
The present invention is based on the discovery of mechanisms of acquired resistance to PLX4032/vemurafenib. This discovery enables the identification of a subset of melanoma patients treated with B-RAF-targeting agents who respond and subsequently relapse via the described mechanisms. The invention also provides for implementation of a second-line and/or combination treatment strategy via pharmacologic agents to manage a specific subset of melanoma patients relapsing on B-RAF-targeting agents, as well as patients with other types of B-RAF-related cancers who develop resistance to B-RAF-targeting agents. These mechanisms may be instructive for why other cancers with BRAF mutations may be primarily resistant to B-RAF inhibitors. These mechanisms may also arise and result in acquired (secondary) resistance in other B-RAF mutant cancers that may be primarily sensitive to B-RAF inhibitors.
The invention provides diagnostic assays tailored to detect each mechanism at the onset of clinical and radiographic evidence of acquired resistance in patients with B-RAF(V600E)-positive metastatic melanomas who are treated with B-RAF inhibitors (PLX4032/vemurafenib or other similar agents such as GSK2118436/dabrafenib) and who initially respond to B-RAF inhibitors (partial response, also referred to as RECIST). These mechanisms of acquired B-RAF inhibitor resistance are largely mutually exclusive per tumor site, but distinct foci of tumor progression may harbor distinct molecular lesions. Using clinical samples or biopsies derived from patients or short-term culture derived from such, one assay detects increased levels of PDG FR-beta transcript by quantitative RT-PCR or protein/phospho-tyrosine protein levels by immunologic assays. Another assay detects an N-RAS activating mutation (for example Q61K or Q61R, but any N-RAS activating mutation could be tested) by a gene sequencing approach. Another assay detects an approximately 61 kd splice variant of V600EB-RAF that lacks certain exons that result in deletions of variable portions of the N-terminal protein domain. Another assay detects V600EB-RAF copy number gain or amplification by methods such as FISH or quantitative PCR.
The assays can be used to stratify patients for sequential treatment strategies with B-RAF inhibitor-alternative drug(s) or combination of drugs inclusive of B-RAF inhibitors aimed at overcoming acquired B-RAF inhibitor resistance. Useful applications from this invention include, but are not limited to:
Definitions
All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.
As used herein, “B-RAF inhibitors” refers to drugs that target an acquired mutation of B-RAF that is associated with cancer, such as V600EB-RAF. Representative examples of such a B-RAF inhibitor include PLX4032/vemurafenib or other similar agents, such as GSK2118436/dabrafenib.
As used herein, V600EB-RAF″ refers to B-RAF having valine (V) substituted for by glutamate (E) at codon 600.
As used herein, “N-RAS activating mutation” refers to any mutation of N-RAS resulting in activation of N-RAS, such as activating the potential of N-RAS to transform cells. Examples of N-RAS activating mutations include, but are not limited to, those that change amino acid residues 12, 13 or 61, such as, for example, Q61K or Q61R.
As used herein, “MAPK/ERK kinase (MEK)” refers to a mitogen-activated protein kinase also known as microtubule-associated protein kinase (MAPK) or extracellular signal-regulated kinase (ERK).
As used herein, “AKT1 activating mutation” refers to any mutation of AKT1 resulting in activation of AKT1, such as activating the potential of AKT1 to transform cells. Examples of AKT1 activating mutations include, but are not limited to, Q79K.
As used herein, “pharmaceutically acceptable carrier” or “excipient” includes any material which, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline.
Compositions comprising such carriers are formulated by well known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990).
As used herein, “a” or “an” means at least one, unless clearly indicated otherwise.
Methods for Identifying Candidates for Alternate Therapies
Methods described herein are performed using clinical samples or biopsies derived from patients or short-term culture derived from same. The methods guide the clinician in stratifying patients for sequential treatment strategies with B-RAF inhibitor-alternative drug(s) or combination of drugs inclusive of B-RAF inhibitors aimed at overcoming acquired B-RAF inhibitor resistance.
In one embodiment, the invention provides a method of identifying a patient to be treated with an alternative to B-RAF inhibitor therapy. The method comprises (a) assaying a sample obtained from the patient for a measure of B-RAF inhibitor resistance, (b) selecting samples that exhibit B-RAF inhibitor resistance; and (c) identifying a patient whose sample was selected in (b) as a candidate for alternative therapy. In a typical embodiment, the measure of B-RAF inhibitor resistance is selected from: (1) an alternative splice variant or gene amplification of V600EB-RAF; (2) elevated levels of PDGFR-beta; (3) an activating mutation of N-RAS; and (4) an activating mutation of AKT1.
One can detect an approximately 61 kd splice variant of V600EB-RAF that lacks certain exons that result in deletions of variable portions of the N-terminal protein domain. Another assay detects V600EB-RAF copy number gain or amplification by using such methods as FISH or quantitative PCR. In one embodiment, the assaying for an alternative splice variant of V600EB-RAF comprises amplification of V600EB-RAF. Amplification of V600EB-RAF and detection of alternative splice variants of V600EB-RAF can be performed using standard techniques known to those skilled in the art. Detection of one or more alternative splice variants comprises, for example, analysis of protein expression, whereby presence of a variant of the 90 kD V600EB-RAF is indicative of B-RAF inhibitor resistance.
In one specific example, the presence of a B-RAF variant of approximately 61 kD is indicative of B-RAF inhibitor resistance. In another example, detection of one or more alternative splice variants comprises polymerase chain reaction (PCR) analysis of cDNA, DNA or RNA isolated from the sample obtained from the patient, whereby presence of a transcript that differs from the single 2.3 kb transcript representing full-length B-RAF is indicative of B-RAF inhibitor resistance. In one specific example, the presence of a transcript of approximately 1.7 kb is indicative of B-RAF inhibitor resistance. In some embodiments, the PCR is quantitative PCR or Q-PCR.
In one embodiment, the assaying for PDGFR-beta comprises assaying for PDGFR-beta mRNA, protein or phospho-protein. Assays for mRNA, protein and phospho-protein (e.g., phospho-tyrosine) can be performed using techniques well-known to those skilled in the art. For example, conventional northern blots, and immunologic assays, such as western blots, dot blots, and immunoblots, can be used. One can detect increased levels of PDGFR-beta transcript by quantitative RT-PCR. Detection of increased levels of PDGFR-beta relative to a control is indicative of B-RAF inhibitor resistance. In one embodiment, the assaying for hyperactivity of PDGFR-beta comprises measuring phospho-tyrosine levels on PDGFR-betahyperactivity. An increased level of phosphor-tyrosine relative to a control is indicative of B-RAF inhibitor resistance. In one embodiment, an elevated or increased level is at least 50% more than control. In another embodiment, an elevated or increased level is at least 2-fold more than control. In some embodiments, elevated or increased is at least 5-fold or 10-fold more than control.
In one embodiment, the assaying for an indicator of N-RAS mutation comprises assaying for an activating N-RAS mutation. An N-RAS activating mutation can be detected using conventional methods, such as by gene sequencing. Examples of activating N-RAS mutations include missense mutations at codon 12, 13 and 61, such as Q61K or Q61R. In some embodiments, the assaying for an indicator of N-RAS mutation comprises assaying for elevated levels of N-RAS gDNA, mRNA or protein copy number.
In one embodiment, the assaying for an indicator of AKT1 mutation comprises assaying for an activating AKT1 mutation. Examples of activating AKT1 mutations include missense mutations resulting in the Q79K substitution. In one embodiment, the assaying for an activating mutation of AKT1 comprises measuring phospho-AKT1 levels.
The method can be performed prior to B-RAF inhibitor therapy, and/or after initiation of B-RAF inhibitor therapy. In some embodiments, the method is repeated during the course of treatment to monitor the status of resistance to B-RAF inhibitor therapy. In such embodiments, the same method steps are applied to a method of monitoring a patient being treated with B-RAF inhibitor therapy. In the course of such monitoring, the patient may be identified as a candidate for treatment with an alternative to B-RAF inhibitor therapy.
In one embodiment, the B-RAF inhibitor is vemurafenib. The sample obtained from the patient can be a biopsy or other clinical specimen obtained, for example, by needle aspiration or other means of extracting a specimen from the patient that contains tumor cells. The sample can also be obtained from peripheral blood or accessible bodily fluids, for example, by enriching a sample for circulating tumor cells. Examples of other accessible bodily fluids include, but are not limited to, the accumulation of peritoneal ascites, such as those caused by tumor deposits, and cerebrospinal fluid (CSF).
In some embodiments, the patient has, or is suspected of having, a B-RAF-mutant cancer. In a typical embodiment, the patient has, or is suspected of having, a B-RAF-mutant melanoma. A representative mutant B-RAF is V600EB-RAF.
Therapeutic and Prophylactic Methods
The invention further provides a method of treating a patient having cancer, or who may be at risk of developing cancer or a recurrence of cancer. In a typical embodiment, the patient has melanoma. In one embodiment, the melanoma is a B-RAF-mutant melanoma. The cancer can be melanoma or other cancer associated with B-RAF mutation, such as, for example, V600EB-RAF. Patients can be identified as candidates for treatment using the methods described herein. Patients are identified as candidates for treatment on the basis of exhibiting one or more indicators of resistance to B-RAF inhibitor therapy. The treatment protocol can be selected or modified on the basis of which indicators of resistance to B-RAF inhibitor therapy are exhibited by the individual patient.
The patient to be treated may have been initially treated with conventional B-RAF inhibitor therapy, or may be a patient about to begin B-RAF inhibitor therapy, as well as patients who have begun or have yet to begin other cancer treatments. Patients identified as candidates for treatment with one or more alternative therapies can be monitored so that the treatment plan is modified as needed to optimize efficacy.
Examples of alternative therapy include, but are not limited to, augmenting B-RAF inhibitor therapy with at least one additional drug. The additional drug can include a MAPK/ERK kinase (MEK) inhibitor, such as PD0325901, GDC0973, GSK1120212, and/or AZD6244. In one embodiment, the alternative therapy comprises suspension of vemurafenib therapy.
In one embodiment, the alternative therapy comprises administering to the patient a MEK inhibitor, optionally in conjunction with vemurafenib therapy, or an inhibitor of the MAPK pathway (RAF, MEK, ERK) in conjunction with an inhibitor of the RTK-PI3K-AKT-mTOR pathway. Examples of MEK inhibitors include, but are not limited to PD0325901, GDC0973, GSK1120212, and/or AZD6244§. Examples of inhibitors of the RTK-PI3K-AKT-mTOR pathway include, but are not limited to BEZ235, BKM120, PX-866, and GSK2126458.
Treatment includes prophylaxis and therapy. Prophylaxis or therapy can be accomplished by a single administration or direct injection, at a single time point or multiple time points to a single or multiple sites. Administration can also be nearly simultaneous to multiple sites. Patients or subjects include mammals, such as human, bovine, equine, canine, feline, porcine, and ovine animals. The subject is preferably a human. In a typical embodiment, treatment comprises administering to a subject a pharmaceutical composition of the invention.
A cancer may be diagnosed using criteria generally accepted in the art, including the presence of a malignant tumor. Pharmaceutical compositions may be administered either prior to or following surgical removal of primary tumors and/or treatment such as administration of radiotherapy or conventional chemotherapeutic drugs.
Administration and Dosage
The compositions are administered in any suitable manner, often with pharmaceutically acceptable carriers. Suitable methods of administering treatment in the context of the present invention to a subject are available, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
The dose administered to a patient, in the context of the present invention, should be sufficient to effect a beneficial therapeutic response in the patient over time, or to inhibit disease progression. Thus, the composition is administered to a subject in an amount sufficient to elicit an effective response and/or to alleviate, reduce, cure or at least partially arrest symptoms and/or complications from the disease. An amount adequate to accomplish this is defined as a “therapeutically effective dose.”
Routes and frequency of administration of the therapeutic compositions disclosed herein, as well as dosage, will vary from individual to individual as well as with the selected drug, and may be readily established using standard techniques. In general, the pharmaceutical compositions may be administered, by injection (e.g., intracutaneous, intratumoral, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration) or orally. In one example, between 1 and 10 doses may be administered over a 52 week period. Preferably, 6 doses are administered, at intervals of 1 month, and booster treatments may be given periodically thereafter. Alternate protocols may be appropriate for individual patients. In one embodiment, 2 intradermal injections of the composition are administered 10 days apart.
A suitable dose is an amount of a compound that, when administered as described above, is capable of promoting an anti-tumor immune response, and is at least 10-50% above the basal (i.e., untreated) level. Such response can be monitored using conventional methods. In general, for pharmaceutical compositions, the amount of each drug present in a dose ranges from about 100 μg to 5 mg per kg of host, but those skilled in the art will appreciate that specific doses depend on the drug to be administered and are not necessarily limited to this general range. Likewise, suitable volumes for each administration will vary with the size of the patient.
In general, an appropriate dosage and treatment regimen provides the active compound(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit. Such a response can be monitored by establishing an improved clinical outcome (e.g., more frequent remissions, complete or partial, or longer disease-free survival) in treated patients as compared to non-treated patients.
The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.
This example demonstrates that PLX4032 acquired resistance develops by mutually exclusive PDGFRβ (also known as PDGFRB) upregulation or N-RAS (also known as NRAS) mutations but not through secondary mutations in B-RAF(V600E). We used PLX4032-resistant sub-lines artificially derived from B-RAF(V600E)-positive melanoma cell lines and validated key findings in PLX4032-resistant tumours and tumour-matched, short-term cultures from clinical trial patients. Induction of PDGFRβ RNA, protein and tyrosine phosphorylation emerged as a dominant feature of acquired PLX4032 resistance in a subset of melanoma sub-lines, patient-derived biopsies and short-term cultures. PDGFRβ-upregulated tumour cells have low activated RAS levels and, when treated with PLX4032, do not reactivate the MAPK pathway significantly. In another subset, high levels of activated N-RAS resulting from mutations lead to significant MAPK pathway reactivation upon PLX4032 treatment. Knockdown of PDGFRβ or N-RAS reduced growth of the respective PLX4032-resistant subsets. Overexpression of PDGFRβ or N-RAS(Q61 K) conferred PLX4032 resistance to PLX4032-sensitive parental cell lines. Importantly, MAPK reactivation predicts MEK inhibitor sensitivity. Thus, melanomas escape B-RAF(V600E) targeting not through secondary B-RAF(V600E) mutations but via receptor tyrosine kinase (RTK)-mediated activation of alternative survival pathway(s) or activated RAS-mediated reactivation of the MAPK pathway, suggesting additional therapeutic strategies.
We selected three B-RAF(V600E)-positive parental (P) cell lines, M229, M238 and M249, exquisitely sensitive to PLX4032-mediated growth inhibition in vitro and in vivo6, and derived PLX4032-resistant (R) sub-lines by chronic PLX4032 exposure. In cell survival assays, M229 R, M238 R and M249 R sub-lines displayed strong resistance to PLX4032 (GI50, concentration of drug that inhibits growth of cells by 50%,not reached up to 10 μM) and paradoxically enhanced growth at low PLX4032 concentrations, in contrast to parental cells. Morphologically, both M229 R and M238 R sub-lines appear flatter and more fibroblast-like compared to their parental counterparts, but this morphologic switch was not seen in the M249 P versus M249 R4 pair.
There were no secondary mutations in the drug target B-RAF observed on bi-directional Sanger sequencing of all 18 B-RAF exons in 15 M229 R (R1-R15), two M238 R (R1 and R2), and one M249 R (R4) acquired resistant sub-lines (Table 1). Based on Sanger sequencing, this lack of secondary B-RAF mutation along with retention of the original B-RAF(V600E) mutation was confirmed in 16/16 melanoma tumour biopsies (from 12 patients) with clinically acquired resistance to PLX4032 (that is, initial >30% tumour size decrease or partial response, as defined by RECIST (response evaluation criteria in solid tumours)) and subsequent progression on PLX4032 dosing; and 5/5 short-term melanoma cultures established from 5 resistant tumours obtained from 4 patients (Table 2). Given recent reports of B-RAF-selective inhibitors having a growth-promoting effect on B-RAF wild-type tumour cells7-9, retention of the original B-RAF alleles in PLX4032-resistant sub-lines, tissues and cultures indicates that PLX4032 chronic treatment did not select for the outgrowth of a pre-existing, minor B-RAF wild-type sub-population. Furthermore, immunoprecipitated B-RAF kinase activities from resistant sub-lines and short-term cultures were similarly sensitive to PLX4032 as B-RAF kinase activities immunoprecipitated from parental cell lines (Pt48 R and Pt55 R resistance to PLX4032 (ref. 10) and the pre-clinical analogue PLX4720 (ref. 11); Pt, patient). These results demonstrate that, in all tested acquired resistant cell lines and cultures, the mutated B-RAF(V600E) kinase lack secondary mutations and hence retain its ability to respond to PLX4032.
Given that minority PLX4032-resistant sub-populations in tissues may acquire B-RAF(V600E) secondary mutations not detectable by Sanger sequencing, we analysed “ultradeep” and deep sequences of B-RAF (exons 2-18) using the Illumina platform for 9/11 acquired resistant tumour samples without tumour-matched short-term cultures (one sample, Pt111-010 DP2, intentionally analysed by both methods; DP, disease progression). Ultradeep B-RAFsequencing of five PLX4032-resistant melanoma tissues resulted in every base of exons 2-18 being sequenced at a median coverage of 127×(27×−128×). The known variant, V600E, was detected in all five samples with significantly high non-reference allele frequencies (NAF). In all five tissues, exon 13, where the T529 gatekeeper residue12 is located, was independently amplified and uniquely bar-coded twice. Rare variants (none at the T529 codon) detected in these independent exon 13 analyses do not overlap and helped defined the true, signal NAF at >4.81%. Furthermore, deep B-RAF (exons 2-18) sequence analysis of PLX4032-resistant melanoma tissues from a whole exome sequencing project resulted in 2,396 base pairs of B-RAF coding regions having coverage ≧10×. After filtering, no position harboured a variant with a NAF >4.81%, except for the known V600E mutation in all five resistant samples. Together, these data strongly corroborate the lack of B-RAF(V600E) secondary mutations during the evolution of PLX4032 acquired resistance in the majority of patients and their tumours.
To begin to understand PLX4032-resistance in vitro, we used phospho-specific antibodies to probe the activation status of the RAF downstream effectors, MEK1/2 and ERK1/2 (also know as MAP2K1/2 and MAPK3/1, respectively), in parental versus resistant sub-lines, with and without PLX4032 (
Gene set enrichment analysis demonstrated an enrichment of RTK-controlled signalling in M229 R5 and M238 R1 but exclusive of M249 R4. Unsupervised clustering of the receptor tyrosine kinome gene expression profiles showed that M229 R5 and M238 R1 clustered away from M229 and M238 parental cell lines largely based on higher expression levels of KIT, MET, EGFR and PDGFRβ. RNA upregulation of these four RTKs was consistently not associated with genomic DNA (gDNA) copy number gain. Of these four candidate RTKs, EGFR and PDGFR6 protein levels were overexpressed (
We then validated our in vitro finding in vivo by studying clinical trial patient-derived samples (Table 2;
In M249 R4, we sequenced all exons of N-RAS, K-RAS (also known as KRAS) or H-RAS (also known as HRAS) (to include codons 12, 13, and 61 as well as mutational hotspots of emerging significance16) and MEK1 (ref. 17; Table 1) because we proposed a resistance mechanism reactivating MAPK despite not having a secondary B-RAF mutation. Interestingly, M249 R4 harbours a N-RAS(Q61K) activating mutation not present in the parental M249 cell line (
Knockdown of PDGFRβ or N-RAS using small interfering RNA (siRNA) pools preferentially growth-inhibited melanoma cells with upregulated PDGFRβ or N-RAS, respectively (Table 3). We then selected two resistant sub-lines or cultures to test the effects of individual PDGFRβ and N-RAS short hairpin RNAs (shRNAs;
We then asked whether N-RAS-dependent growth and reactivation of the MAPK pathway (
We show that B-RAF(V600E)-positive melanomas, instead of accumulating B-RAF(V600E) secondary mutations, can acquire PLX4032 resistance by (1) activating an RTK (PDGFRβ)-dependent survival pathway in addition to MAPK, or (2) reactivating the MAPK pathway via N-RAS upregulation. These two mechanisms account for acquired PLX4032 resistance in 5/12 patients in our study cohort, and additional mechanisms await future discovery. Some patients who relapse on PLX4032 are already being enrolled in a phase II MEK inhibitor trial (ClinicalTrials.gov identifier NCT01037127) based on the assumption of MAPK reactivation. Our findings provide a strategy to stratify patients who relapse on PLX4032 and rational combinations of targeting agents most optimal for distinct mechanisms of acquired resistance to PLX4032 as well as other B-RAF inhibitors (for example, GSK2118436) in clinical development.
Methods Summary
Cell culture, infections and compounds
Cells were maintained in Dulbecco's modified Eagle medium (DMEM) with 10 or 20% fetal bovine serum and glutamine. shRNAs were sub-cloned into the lentiviral vector pLL3.7 and infections carried out with protamine sulphate. Stocks of PLX4032 (Plexxikon) and AZD6244 (commercially available) were made in DMSO. Cells were quantified using CellTiter-GLO Luminescence (Promega).
Protein Detection
Western blots were probed with antibodies against p-MEK1/2 (S217/221), MEK1/2, p-ERK1/2 (T202N204), ERK1/2, PDGFRβ, and EGFR (Cell Signaling Technologies), and N-RAS (Santa Cruz Biotechnology), pan-RAS (Thermo Scientific) and tubulin (Sigma). p-RTK arrays were performed according to the manufacturer's recommendations (Human Phospho-RTK Array Kit, R&D Systems). For PDGFRβ immunohistochemistry, paraffin-embedded formalin-fixed tissue sections were antigen-retrieved, incubated with a PDGFRβ antibody followed by horseradish peroxidase-conjugated secondary antibody (Envision System, DakoCytomation). Immunocomplexes were visualized using the DAB (3,3′-diaminobenzidine) peroxidase method and nuclei haematoxylin-counterstained. For activated RAS pull-down, lysates were incubated with beads coupled to glutathione-S-transferase (GST)-RAF-1-RAS-binding domain of RAF1 (RBD) (Thermo) for 1 h at 4° C.
RNA Quantifications
For real-time quantitative PCR, total RNA was extracted and cDNA quantified. Data were normalized to tubulin and GAPDH levels. Relative expression is calculated using the delta-Ct method. For RNA expression profiling, total RNAs were extracted, and generated cDNAs were fragmented, labelled and hybridized to the GeneChip Human Gene 1.0 ST Arrays (Affymetrix). Expression data were normalized, background-corrected, and loge-transformed for parametric analysis. Differentially expressed genes were identified using significance analysis of microarrays (SAM) with the R package ‘samr’ (false discovery rate (FDR)<0.05; fold change>2).
Cell Cycle and Apoptosis
For cell cycle analysis, cells were fixed, permeabilized and stained with propidium iodide (BD Pharmingen). Cell cycle distribution was analysed by Cell Quest Pro and ModiFit software. For apoptosis, cells were co-stained with Annexin V-V450 and propidium iodide (BD Pharmingen). Data were analysed with the FACS Express V2 software.
Methods
Cell Culture, Lentiviral Constructs and Infections
All cell lines were maintained in DMEM with 10% or 20% (short-term cultures) heat-inactivated FBS (Omega Scientific) and 2 mmol l−1 glutamine in humidified, 5% CO2 incubator. To derive PLX4032-resistant sub-lines, M229 and M238 were seeded at low cell density and treated with PLX4032 at 1 μM every 3 days for 4-6 weeks and clonal colonies were then isolated by cylinders. M249 R was derived by successive titration of PLX4032 up to 10 μM. PLX4032-resistant sub-lines and short-term cultures were replenished with 1 μM PLX4032 every 2 to 3 days. shRNAs were sub-cloned into the lentiviral vector pLL3.7. N-RAS(Q61K) mutant overexpression construct was made by PCR-amplifying from M249 R4 cDNA and sub-cloning into the lentiviral vector (UCLA Vector Core), creating pRRLsin.cPPT.CMV.hTERT.IRES.GFP-Flag-Q61KNRAS. Wild-type PDGFRβ overexpression construct was PCR-amplified from cDNA and sub-cloned into a lentiviral vector (Clontech), creating pLVX-Tight-Puro-PDGFRβ-Myc. Lentiviral constructs were co-transfected with three packaging plasm ids into HEK293T cells. Infections were carried out with protamine sulphate.
Cellular Proliferation, Drug Treatments and siRNA Transfections
Cell proliferation experiments were performed in a 96-well format (five replicates), and baseline quantification performed at 24 h after cell seeding along with initiation of drug treatments (72 h). Stocks and dilutions of PLX4032 (Plexxikon), AZD6244 (Selleck Chemicals) and U0126 (Promega) were made in DMSO. siRNA pool (Dharmacon) transfections were carried out in 384-well format. TransIT transfection reagent (Mirus) was added to each well and incubated at 37° C. for 20 min. Subsequently, cells were reverse transfected, and the mixture was incubated for 51-61 h at 37° C. Cells were quantified using CellTiter 96 Aqueous One Solution (Promega) or CellTiter-GLO Luminescence (Promega) following the manufacturer's recommendations.
Protein Detection
Cell lysates for western blotting were made in RIPA (Sigma) with protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktails I and II (Santa Cruz Biotechnology). Western blots were probed with antibodies against p-MEK1/2 (S217/221), total MEK1/2, p-ERK1/2 (T202/Y204), total ERK1/2, PDGFRβ, and EGFR (all from Cell Signaling Technologies), B-RAF and N-RAS (Santa Cruz Biotechnology), pan-RAS (Thermo Scientific) and tubulin (Sigma). p-RTK arrays were performed according to the manufacturer's recommendations (Human Phospho-RTK Array Kit, R&D Systems). For PDGFRβ immunohistochemistry, paraffin-embedded formalin fixed tissue sections were subjected to antigen retrieval and incubated with a rabbit monoclonal anti-PDGFRβ antibody (Cell Signaling Technology) followed by labelled anti-rabbit polymer horseradish peroxidase (Envision System, Dako Cytomation). Immunocomplexes were visualized using the DAB (3,3′-diaminobenzidine) peroxidase method and nuclei haematoxylin-counterstained.
In Vitro Kinase Assay
Cells were harvested and protein lysates prepared in a NP40-based buffer before subjected to immunoprecipitation (IP). IP beads were then resuspended in ADBI buffer (with Mg/ATP cocktail) and incubated with an inactive, recombinant MEK1 or a truncated RAF-1 (positive control) (Millipore), and with DMSO or 1 μM PLX4032 for 30 min at 30° C. The beads were subsequently pelleted and the supernatant resuspended in sample buffer for western blotting to detect p-MEK and total MEK.
Activated RAS Pull-Down Assay
Melanoma lysates were incubated with glutathione agarose beads coupled to 80 μg GST-RAF-1-RBD (Thermo) for 1 h at 4° C. As controls, Pt48 R lysate was pre-incubated with either 0.1 mM GTPγS (positive control) or 1 mM GDP (negative control) in the presence of 10 mM EDTA (pH 8.0) at 30° C. for 15 min. Reactions were terminated by adding 60 mM MgCl2. After washing with Wash Buffer (Thermo), proteins bound to beads were eluted by protein sample buffer. RAS or NRAS levels were detected by immunoblotting.
Quantitative Real-Time PCR for Relative RNA Levels
Total RNA was extracted using the RiboPure Kit (Ambion), and reverse transcription reactions were performed using the SuperScript First-Strand Synthesis System (Invitrogen). Real-time PCR analyses were performed using the iCycler iQ Real Time PCR Detection System (BioRad) (Table 4). To discriminate specific from nonspecific cDNA products, a melting curve was obtained at the end of each run. Data were normalized to tubulin and/or GAPDH levels in the samples in duplicates. Relative expression is calculated using the delta-Ct method using the following equations: ΔACt(Sample)=Ct(Target)−Ct(Reference); relative quantity=2−Δα.
A single step at 95° C. for 10 min preceded 40 cycles of amplification (95° C. for 30 s, 52° C. for 30 s, and 72° C. for 30 s). Subsequently, melting curve analysis was performed as follows: 95° C. for 10 s, 52° C. for 10 s, and 95° C. for 10 s.
Quantitative Real-Time PCR for Relative DNA Copy Numbers
gDNAs were extracted using the FlexiGene DNA Kit (Qiagen) (Human Genomic DNA-Female, Promega). NRAS relative copy number was determined by quantitative PCR (cycle conditions available upon request) using the MyiQ single colour Real-Time PCR Detection System (Bio-Rad). Total DNA content was estimated by assaying β-globin for each sample (Table 4), and 20 ng of gDNA was mixed with the SYBR Green QPCR Master Mix (Bio-Rad) and 2 pmol l−1 of each primer.
Sequencing
gDNAs were isolated using the Flexi Gene DNA Kit (QIAGEN) or the QIAamp DNA FFPE Tissue Kit. B-RAF and RAS genes were amplified from genomic DNA by PCR. PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) followed by bi-directional sequencing using BigDye v1.1 (Applied Biosystems) in combination with a 3730 DNA Analyzer (Applied Biosystems). PDGFRβ was amplified from cDNA by PCR and sequenced (primers listed in Table 1).
B-RAF Ultra-Deep Sequencing
Exon-based amplicons were generated using Platinum high-fidelity Taq polymerase, and libraries were prepared following the Illumina library generation protocol version 2.3. For each sample, one library was generated with 18 exons pooled at equal molarity and another library was generated for exon 13 only for validation purpose. Each library was indexed with an unique four base long barcode within the custom made Illumina adaptor. All 10 indexed samples were pooled and sequenced on one lane of Illumina GAllx flow-cell for single-end 76 base pairs. For error rate estimation, phiX174 genome was spiked in. Base-calling was performed by Illumina RTA version 1.8.70. Alignment was performed using the Novocraft Short Read Alignment Package version 2.06 (http://www.novocraft.com/index.html). First, all reads were aligned to the phiX174 reference genome downloaded from the NCBI. The mismatch rates at each position of the reads were calculated to estimate the error rate of the sequencer (set at 1.67% or five standard deviations, SD) based on the phiX genome data (mean error rate=0.57%, s.d.=0.22%). Then, the .qseq.txt files were converted into .fastq file using a custom script (available on request) and during this process, the first 5 bases (unique 4-base barcode and the T at the fifth position) were stripped off from the reads and concatenated to the read name. The .fastq file was parsed into 10 .fastq files for each barcode and only the reads with the first 5 bases perfectly matching any of the 10 barcodes were included. Each .fastq file was aligned to chromosome 7 fasta file, generated from the Human Genome reference sequence (hg18, March 2006, build 36.1) downloaded from the Broad Institute (ftp://ftp.broadinstitute.org/pub/gsa/gatk_resources.tgz) using the Novoalign program. Base calibration option was used, and the output format was set to SAM. Using SAMtools (http://samtools.sourceforge.net/), the .sam files of each lane were converted to .bam files and sorted, followed by removal of potential PCR duplicates using Picard (http://picard.sourceforge.net/). The true background rate was inferred from analysis of independent exon 13 amplicons. None of the 14 positions within exon 13 that had non-reference allele frequency (NAF)>1.67% in all-exon-samples were validated in the exon13-only samples and vice versa for the one position in the exon 13-only sample, inferring that the true background error rate could be higher at 4.81% (5s.d., mean error rate=2.72%, s.d.=0.4%). In total, 12 positions had NAF>4.81%, and none of them recurred at the same position. We note that the four sample gDNAs extracted from formalin-fixed paraffin-embedded (FFPE) blocks had 5-6 times more variants with NAF above background than the sample extracted from frozen tissue, and the 12 positions with NAF>4.81% were scattered only across the FFPE samples. The numbers of variants within and outside the kinase domain were not significantly different.
B-RAF Deep sequence from Whole Exome Sequence Analysis
Genomic libraries were generated following the Agilent SureSelect Human All Exon Kit Illumina Paired-End Sequencing Library Prep Version 1.0.1 protocol at the UCLA Genome Center. Agilent SureSelect All Exon ICGC version was used for capturing ˜50 megabase (Mb) exome. The Genome Analyzer IIx (GAIIx) was run using standard manufacturer's recommended protocols. Base-calling was done by Illumina RTA version 1.6.47. Two lanes of Illumina single end (SE) run were generated for each of Pt111-001 normal, baseline and DP2 samples, and one lane of Illumina paired end (PE) run was generated for each of Pt111-001 DP1, DP3 as well as Pt111-010 normal, baseline, DP1 and DP2 samples. Alignment was performed using the Novocraft Short Read Alignment Package version 2.06. Human Genome reference sequence (hg18, March 2006, build 36.1), downloaded from the UCSC genome database located at http://genome.ucsc.edu and mirrored locally, was indexed using novoindex program (−k 14 −s 3). Novoalign program was used to align each lane's qseq.txt file to the reference genome. Base calibration option and adaptor stripping option for paired-end run were used and the output format was set to SAM. Using SAMtools (http://samtools.sourceforge.net/), the .sam files of each lane were converted to .bam files, sorted and merged for each sample and potential PCR duplicates were removed using Picard (http://picard.sourceforge.net/). The .bam files were filtered for SNV calling and small INDEL calling to reduce the likelihood of using spuriously mis-mapped reads to call the variants. For the .bam file to call SNVs, the last 5 bases were trimmed and only the reads lacking indels were retained. For the .bam file to call small INDELs, only the reads containing one contiguous INDEL but not positioned at the beginning or the end of the read were retained. SOAP consensus-calling model implemented in SAMtools was used to call the variants, both SNVs and indels, and generate the .pileup files for each .bam file. Coding regions ±2 by of BRAF gene were extracted from the .pileup files and the reads were manually examined for rare variants (non reference alleles).
Microarray Data Generation and Analysis
Total RNAs were extracted using the RiboPure Kit (Ambion) from cells (DMSO or PLX4032, 1 M, 6 h). cDNAs were generated, fragmented, biotinylated, and hybridized to the GeneChip Human Gene 1.0 ST Arrays (Affymetrix). The arrays were washed and stained on a GeneChip Fluidics Station 450 (Affymetrix); scanning was carried out with the GeneChip Scanner 3000 7G; and image analysis with the Affymetrix GeneChip Command Console Scan Control. Expression data were normalized, background-corrected, and summarized using the RMA algorithm implemented in the Affymetrix Expression ConsoleTM version 1.1. Data were log-transformed (base 2) for parametric analysis. Clustering was performed with MeV 4.4, using unsupervised hierarchical clustering analysis on the basis of Pearson correlation and complete/average linkage clustering. Differentially expressed genes were identified using significance analysis of microarrays (SAM) with the R package ‘samr’ (R 2.9.0; FDR<0.05; fold change greater than 2). To identify and rank pathways enriched among differentially expressed genes, P-values (Fisher's exact test) were calculated for gene sets with at least 20% differentially expressed genes. Curated gene sets of canonical pathways in the Molecular Signatures Database (MSigDB) were used.
Copy Number Variation Analysis
Illumina HumanExon510S-DUO bead arrays (Illumina) were performed following the manufacturer's protocol. Scanned array data were imported into BeadStudio software (Illumina), where signal intensities for samples were normalized against those for reference genotypes. Log2 ratios were calculated, and data smoothed using the median with window size of 10 and step size of five probes.
Cell Cycle and Apoptosis Analysis
All infected cells were replenished with PLX4032 24 h after infections (M229 R5 treated with AZD6244 to inhibit rebound p-ERK on PDGFRβ KD), fixed, permeabilized, and treated with RNase (Qiagen). Cells were stained with 50 mg ml−1 propidium iodide (BD Pharmingen) and the distribution of cell cycle phases was determined by Cell Quest Pro and ModiFit software. For apoptosis, post-infection cells were stained with Annexin V-V450 (BD Pharmingen) and propidium iodide for 15 min at room temperature. Flow cytometry data were analysed by the FACS Express V2 software.
Image Acquisition and Data Processing
Statistical analyses were performed using InStat 3 Version 3.0b (GraphPad Software), and graphical representations using DeltaGraph or Prism (Red Rock Software). An Optronics camera system was used in conjunction with Image-Pro Plus software (MediaCybernetics) and Adobe Photoshop 7.0.
1. Davies, H. et al. Nature 417, 949-954 (2002).
2. Flaherty, K. T. et al. N. Engl. J. Med. 363, 809-819 (2010).
3. Jänne, P. A., Gray, N. & Settleman, J. Nature Rev. Drug Discov. 8, 70 9-723 (2009).
4. Montagut, C. et al. Cancer Res. 68, 4853-4861 (2008).
5. Poulikakos, P. I., et al. Nature 464, 427-430 (2010).
6. Sondergaard, J. N. et al. J. Transl. Med. 8, 39-50 (2010).
7. Halaloban R. et al. Pigment Cell Melanoma Res. 23, 190-200 (2010).
8. Hatzivassiliou, G. et al. Nature 464, 431-435 (2010).
9. Heidorn, S. J. et al. Cell 140 209-221 (2010)
10. Bollag G. et al. Nature; 467, 596-599 (2010).
11. Tsai J. et al. Proc. Natl Acad. Sci. USA 105, 3041-3046 (2008).
12. Whittaker S. et al. Sci. Transl. Med. 2, 35ra41 (2010).
13. Pratilas, C. A. et al. Proc. Natl Acad. Sci. USA 106, 4519-4524 (2009).
14. Packer, L. M., et al. Pigment Cell Melanoma Res. 22, 785-798 (2009).
15. Wu, E et al. PLoS ONE 3, e3794 (2008).
16. Smith, G. et al. Br. J. Cancer 102, 693-703 (2010).
17. Emery, C. M. et al. Proc. Natl Acad. Sci. USA 106, 20411-20416 (2009).
18. Dumaz, N. et al. Cancer Res. 66, 9483-9491 (2008).
Supplementary Information is linked to the online version of the paper at www.nature.com/nature. A figure summarizing the main result of this paper is also included as SI. Gene expression and copy number data are deposited at Gene Expression Omnibus under accession numbers GSE24862 and GSE24890, respectively.
This example demonstrates a novel resistance mechanism. We find that a subset of cells resistant to PLX4032 (vemurafenib) express a 61 kd variant form of BRAF(V600E) that lacks exons 4-8, a region that encompasses the RAS-binding domain. p61 BRAF(V600E) exhibits enhanced dimerization as compared to full length BRAF(V600E) in cells with low levels of RAS activation. In cells in which p61 BRAF(V600E) is expressed endogenously or ectopically, ERK signaling is resistant to the RAF inhibitor. Moreover, a mutation that abolishes the dimerization of p61 BRAF(V600E) restores its sensitivity to PLX4032. Finally, we identified BRAF(V600E) splicing variants lacking the RAS-binding domain in the tumors of six of 19 patients with acquired resistance to PLX4032. These data support the model that inhibition of ERK signaling by RAF inhibitors is dependent on levels of RAS-GTP too low to support RAF dimerization and identifies a novel mechanism of acquired resistance in patients: expression of splicing isoforms of BRAF(V600E) that dimerize in a RAS-independent manner.
RAF inhibitors have remarkable clinical activity in mutant BRAF melanomas that is limited by acquisition of drug resistance8. In order to identify novel mechanisms of resistance, we generated cell lines resistant to PLX4032 by exposing the BRAF mutant (V600E) melanoma cell line SKMEL-239 to a high dose of drug (2 μM). At this concentration, PLX4032 effectively inhibits ERK signaling in SKMEL-239 and causes accumulation of cells in G1 and a significant induction of cell death (
Resistance of SKMEL-239 cells to PLX4032 was associated with decreased sensitivity of ERK signaling to the drug (
Analysis of both DNA and cDNA derived from the five resistant clones showed that all retained expression of BRAF(V600E). No mutations in BRAF at the gatekeeper site14, RAS mutation, upregulation of receptor tyrosine kinase activation or COT overexpression were detected. Analysis of BRAF protein expression showed that each of the resistant clones expressed a 90 kd band that co-migrated with the band observed in parental cells. In the C1, C3 and C4 clones, a new more rapidly migrating band was also identified, which ran at an approximate molecular weight of 61 kd (p61 BRAF(V600E),
PCR analysis of cDNA derived from the parental and resistant cell lines revealed the expected single transcript of 2.3 kb, representing full-length BRAF in parental cells and two transcripts of 2.3 kb and 1.7 kb respectively in C3 cells. Sequence analysis of the 1.7 kb PCR product from C3 cells revealed that it was a BRAF transcript that contained the V600E mutation and an in-frame deletion of exons 4-8 (
The 1.7 kb transcript was cloned into an expression vector and expressed in 293H cells, alone or together with full-length wild-type BRAF. As shown in
PLX4032 inhibits the kinase activity of RAF immunoprecipitated from cells, but activates intracellular RAF in BRAF wild-type cells4. This suggests that the conditions required for transactivation in vivo are not recapitulated in the in vitro assay. We tested whether p61 BRAF(V600E) is also sensitive to this inhibitor in vitro. Although the in vitro activity of p61 BRAF(V600E) was slightly higher than full-length BRAF(V600E), similar concentrations of PLX4032 cause their inhibition in vitro. These data indicate that resistance of p61 BRAF(V600E) to PLX4032 is not due to its inability to bind the inhibitor.
It has been shown that the N-terminus of RAF negatively regulates the C-terminal catalytic domain15 and that truncation of the N-terminus results in constitutive dimerization of the protein in the absence of activated RAS1. We thus asked whether deletion of exons 4-8 promotes dimerization of p61 BRAF(V600E). 293H cells contain wild-type BRAF, but RAS-GTP levels are too low to support appreciable activation of ERK signaling by RAF inhibitors. To determine levels of dimerization, we co-expressed two constructs encoding the same protein (either p61 BRAF(V600E) or full-length BRAF(V600E)) but with different tags (Flag or V5). When expressed in 293H cells, dimerization of p61 BRAF(V600E) was significantly elevated compared to that of full-length BRAF(V600E) (
Our model implies that in tumors with BRAF(V600E), elevation of RAS-GTP or alterations that cause increased RAF dimerization in the absence of RAS activation would confer resistance to RAF inhibitors4,17. To test whether resistance mediated by p61 BRAF(V600E) was the result of elevated dimer formation, we introduced the R509H dimerization-deficient mutation into p61 BRAF(V600E). In 293H cells expressing p61 BRAF(V600E), phosphorylation of ERK was elevated and was insensitive to PLX4032 (
To determine whether BRAF variants can account for clinical resistance to RAF inhibitors, we analyzed tumors from nineteen melanoma patients with acquired resistance to PLX4032. We performed PCR analysis of cDNA from these tumors and the resulting products were sequenced. Pre-treatment samples showed a single band of the expected size (2.3 kb) which was sequenced and confirmed to include both BRAF(V600E) and wild-type BRAF transcripts (
In tumors from patients that have been analyzed, resistance to PLX4032 is typically associated with inability of the drug to inhibit ERK signaling18. Our model suggests that this can be due to increased dimer formation in the cell4. This can happen in at least two likely mutually exclusive ways: increasing RAS-GTP levels and induction of RAS-independent dimerization. NRAS mutation has now been reported in resistant tumors9. Now, for the first time, we report a lesion that causes increased, RAS-independent dimerization in patient tumors. Other mechanisms of resistance to RAF inhibitors in model systems and in patients have also been reported recently and include activation of the receptor tyrosine kinases PDGFRβ and IGF1R9,11. Another MEK kinase, COT, that can bypass the requirement of BRAF(V600E) for ERK signaling has also been shown to cause resistance as has mutation of MEK110,12.
p61 BRAF(V600E) is the first resistance mechanism identified that involves a structural change in BRAF. Notably, the alternative splicing forms identified in the cell lines and patients have all been confined to the mutant BRAF allele. This suggests that generation of the splice variants is likely due to a mutation or epigenetic change that affects BRAF splicing and not to a loss of global splicing fidelity19. The identification of BRAF variants lacking the RAS-binding domain in six of nineteen patients with acquired resistance suggests that this mechanism is clinically important and suggests novel treatment strategies. As resistance to PLX4032 resulting from expression of p61 BRAF(V600E) is attributable to attenuation of the ability of the drug to inhibit RAF activation, one would predict that such tumors would retain sensitivity to inhibitors of downstream effectors of RAF such as MEK, which was indeed the case. Therefore, MEK inhibitors if used in combination with PLX4032 may delay (or prevent) the onset of this mechanism of resistance or overcome resistance once established, with both hypotheses now being tested in ongoing clinical trials.
Methods Summary
PLX40327 (vemurafenib) was obtained from Plexxikon Inc. PD0325901 was synthesized in the MSKCC Organic Synthesis Core Facility by O. Ouerfelli. Flag-tagged BRAF constructs have been described previously4. All other plasmids were created using standard cloning methods, with pcDNA3.1 (Invitrogen) as a vector. Mutations were introduced using the site-directed Mutagenesis Kit (Stratagene). The C1-5 PLX4032-resistant cells were generated by continuous exposure of parental SKMEL239 cells to 2 μM of drug until the emergence of resistant colonies. Single cell cloning was then performed prior to biological characterization.
For cDNA preparation, the Superscript III First-Strand Synthesis kit (Invitrogen) was used. Primers designed for the N- and C-termini of BRAF had the following sequences: N-terminus GGCTCTCGGTTATAAGATGGC (SEQ ID NO:108) and C-terminus: ACAGGAAACGCACCATATCC (SEQ ID NO: 109). Sanger sequencing of the products was performed by Genewiz. For qPCR analysis, cDNA synthesis was carried out with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed with the iQ SYBR Green RT-PCR Super Mix (BioRad) and the C1000 Thermal Cycler (BioRad). The comparative Ct method was employed to quantify transcripts and delta Ct was measured in triplicate. Primers for the total amount of BRAF: F-TCAATCATCCACAGAGACCTC (SEQ ID NO:110); R-GGATCCAGACAACTGTTCAAAC (SEQ ID NO:111); 3—9 Junction: F-ACAAACAGAGGACAGTGGAC (SEQ ID NO:112); R-TTAGTTAGTGAGCCAGGTAATGA (SEQ ID NO:113).
Melanoma tumor specimens from patients treated with vemurafenib (PLX4032) on an IRB-approved protocol were flash frozen immediately after resection or biopsy. To determine tumor content, 5 μm sections from frozen patient tumor specimens were cut, stained with hematoxylin and eosin, and scored by a pathologist. If the specimen had >70% tumor content (excluding necrosis), the remainder of the frozen tumor was homogenized using a Bullet Blender (Next Advance, Inc.) with 0.9-2 mm stainless steel beads for 5 min at a speed setting of 10. RNA was then extracted from the tumor homogenate using the RNeasy Mini Kit (Invitrogen) and quantified.
Methods
Compounds. PLX4032 (vemurafenib) was obtained from Plexxikon Inc. PD0325901 was synthesized in the MSKCC Organic Synthesis Core Facility by O. Ouerfelli. Drugs were dissolved in DMSO and stored at −20° C.
Cell proliferation and cell cycle analysis. All melanoma cell lines were generated by A. Houghton (MSKCC) or obtained from ATCC. 293H cells were obtained from Invitrogen. Cells were maintained in DMEM (293H and MEFs), or RPMI (all other cell lines) supplemented with 2 mM glutamine, antibiotics and 10% fetal bovine serum. We confirmed by DNA fingerprinting20 that all PLX4032-resistant, SKMEL-239 clones were derived from the same patient, thus excluding the possibility of contamination (Table 6). For proliferation assays, cells were plated in 6 well plates and 24 hours later were treated with varying concentrations of inhibitors as indicated. IC50 values were calculated using Graph Pad Prism v.5. For cell cycle and apoptosis studies, cells were seeded in 6 well dishes the day prior to drug treatment. For analysis, both adherent and floating cells were harvested and stained with ethidium bromide as described previously21.
Western blotting and receptor tyrosine kinase (RTK) arrays. Western blot analysis was performed as previously described13. The following antibodies were used: p217/p221-MEK (pMEK), p202/p204-ERK (pERK), MEK, ERK, (Cell Signaling), V5 tag (Invitrogen), BRAF, cyclin Flag tag, β-actin (Sigma). For immunoprecipitations of tagged proteins: anti-Flag M2 affinity gel (Sigma). The Human Phospho-RTK array Kit (R&D Systems) was utilized to detect kinase activation within a panel of RTKs. Briefly, cells were plated in 10 cm dishes and harvested after 24 hours. Following lysis, 500 μg of lysate was applied to a membrane-anchored RTK array and incubated at 4° C. for 24 hours. Membranes were exposed to chemiluminescent reagents and images captured using the ImageQuant LAS 4000 instrument (GE HealthCare).
Plasmids/Trasfections. Flag-tagged BRAF constructs have been described previously4. All other plasmids were created using standard cloning methods, with pcDNA3.1 (Invitrogen) as a vector. Mutations were introduced using the site-directed Mutagenesis Kit (Stratagene). For transfection studies, cells were seeded at 35 mm or 100 mm plates and transfected the following day using Lipofectamine 2000 (Invitrogen). Cells were collected 24 hours later for subsequent analysis.
Immunoprecipitations and kinase assays. Cells were lysed in lysis buffer (50 mM Tris, pH7.5, 1% NP40, 150 mM NaCl, 10% glycerol, 1 mM EDTA) supplemented with protease and phosphatase inhibitor cocktail tablets (Roche). Immunoprecipitations were performed at 4° C. for 4 h, followed by three washes with lysis buffer and, in cases of subsequent kinase assay, one final wash with kinase buffer (25 mM Tris, pH 7.5, 10 mM MgCl2). Kinase assays were conducted in the presence of 200 μM ATP at 30° C. for 20 min with inactive MEK(K97R) (Millipore) as a substrate. The kinase reaction was terminated by adding sample buffer and boiling. Kinase activity was determined by immunoblotting for pMEK.
siRNA knockdown. In order to selectively knock down p61 BRAF(V600E) or full-length BRAF, siRNA duplexes were designed to target the junction between exons 3-9 (JC-1 and JC-2) or sequences within exons 4-8 (ex[4-8]-1 and ex[4-8]-2. The sequences are the following: JC-1: GGACAGUGGACUUGAUUAGUU (SEQ ID NO:114), JC-2: AGGACAGUGGACUUGAUUAUU (SEQ ID NO:115), ex[4-8]-1: ACUGAUAUUUCCUGGCUUAUU (SEQ ID NO:116), ex[4-8]-2: CUGUCAAACAUGUGGUUAUUU (SEQ ID NO:117). To knock down ARAF and CRAF we used siRNA pools. All siRNA duplexes were from Dharmacon and transfections were carried out with Lipofectamine 2000 (Invitrogen) at a final siRNA concentration of 50nM, according to the manufacturer's instructions. 72 hours later, cells were either counted to estimate cell growth, or subjected to immunoblot analysis.
1 Weber, C. K., Slupsky, J. R., Kalmes, H. A. & Rapp, U. R. Cancer Res 61, 3595-3598 (2001).
2 Rushworth, L. K., Hindley, A. D., O'Neill, E. & Kolch, W. Mol Cell Biol 26, 2262-2272 (2006).
3 Wellbrock, C., Karasarides, M. & Marais, R. Nat Rev Mol Cell Biol 5, 875-885 (2004).
4 Poulikakos, P. I., et al. Nature 464, 427-430 (2010).
5 Heidorn, S. J. et al. Cell 140, 209-221, doi:S0092-8674 (2010).
6 Hatzivassiliou, G. et al. Nature 464, 431-435 (2010).
7 Joseph, E. W. et al. Proc Natl Acad Sci USA 107, 14903-14908 (2010).
8 Flaherty, K. T. et al. N Engl J Med 363, 809-819 (2010).
9 Nazarian, R. et al. Nature 468, 973-977 (2010).
10 Johannessen, C. M. et al. Nature 468, 968-972 (2010).
11 Villanueva, J. et al. Cancer Cell 18, 683-695 (2010).
12 Wagle, N. et al. J Clin Oncol (2011).
13 Solit, D. B. et al. Nature 439, 358-362 (2006).
14 Whittaker, S. et al. Sci Transl Med 2, 35ra41 (2010).
15 Cutler, R. E., Jr., et al. Proc Natl Acad Sci USA 95, 9214-9219 (1998).
16 Rajakulendran, T., et al. Nature 461, 542-545 (2009).
17 Poulikakos, P. I. & Rosen, N. Cancer Cell 19, 11-15 (2011).
18 McArthur, G. et al. J Clin Oncol 29, suppl; abstr 8502 (2011).
19 Luco, R. F., et al. Cell 144, 16-26 (2011).
20 Janakiraman, M. et al. Cancer Res 70, 5901-5911 (2010).
21 Nusse, M., Beisker, W., Hoffmann, C. & Tarnok, Cytometry 11, 813-821 (1990).
This example demonstrates whole exome sequencing of melanoma tissues from patients treated with vemurafenib or GSK2118436 to uncover V600EB-RAF copy number gain as a bona fide mechanism of acquired B-RAFi resistance. In 20 patients studied, V600EB-RAF copy number gain was detected in four patients (20%) and was mutually exclusive with detection of N-RAS mutations V600EB-RAF truncation, or upregulation of receptor tyrosine kinases (RTKs), which are established mechanisms of acquired B-RAFi resistance8,10,11. In isogenic drug-sensitive and -resistance cell line pairs, V600EB-RAF over-expression conferred vemurafenib resistance, whereas its knockdown sensitized the resistant sub-lines to B-RAFi. In V600EB-RAF amplification-driven B-RAFi resistance, in contrast to mutant N-RAS-driven resistance, ERK reactivation is saturable, with higher doses of vemurafenib down-regulating pERK and re-sensitizing melanoma cells to B-RAFi. These two mechanisms of ERK reactivation were differentially sensitive to the MEK1/2 inhibitor AZD6244/selumetinib or its combination with the B-RAFi vemurafenib. Finally, unlike mutant N-RAS-mediated V600 EB-RAF bypass, which is sensitive to C-RAF knockdown, V600EB-RAF amplification-mediated resistance functions largely independently of C-RAF. Thus, distinct clinical strategies may be required to overcome ERK reactivation underlying acquired resistance to B-RAFi in melanoma.
We assembled twenty sets of patient-matched baseline (prior to B-RAFi therapy) and disease progression (DP) (i.e., acquired B-RAFi resistance) melanoma tissues and analyzed them to identify the reported mechanisms of acquired B-RAFi resistance in melanoma. These reported mechanisms include N-RAS10 and MEK112 mutations, alternative-spliced V600 EB-RAF variants11, and over-expression of RTKs (PDGFRβ7,10, IGF1-R8) and COT9 (Tables 5 and 6). For DP samples negative for these mechanisms and where there is sufficient frozen and patient-matched normal tissues (from patients #4, 5, 8, 14, 16, 17 & 18), we subjected triads of genomic DNAs (gDNAs) from normal, baseline, and DP tissues to whole exome sequencing. In two available data sets, we analyzed for somatic DP-specific non-synonymous single nucleotide variants (nsSNVs) and small insertion-deletion (indels), which were exceedingly few in number or absent, respectively, using our bioinformatic workflow (Tables 9 and 10). We also analyzed for DP-specific copy number variations (CNVs) from the exome sequence data (Table 9). This identified V600 EB-RAF copy number gains in these two patients' DP tissues (2.2 and 12.8 fold in patients #5 and 8, respectively) relative to their respective baseline tissues (
V600EB-RAF amplification was validated by gDNA Q-PCR, producing highly consistent fold increases in DP-specific V600EB-RAF copy number gain (relative to baseline) (2.0 and 14 fold increase in patient #5 and 8 respectively) (
indicates data missing or illegible when filed
We have derived and analyzed vemurafenib/PLX4032-resistant (R) sub-lines derived by continuous vemurafenib exposure from seven human melanoma-derived V600EBRAF-positive parental (P) cell lines sensitive to vemurafenib-mediated growth inhibition. Four resistant sub-lines, including M229 R5 and M238 R17,10, over-expressed PDGFRβ compared to their parental counterpart. One sub-line (M249 R410) gained a mutation in N-RAS, and another (M397 R) an alternatively spliced variant of V600EB-RAF resulting in in-frame fusion of exons 1 and 11. As in our tissue analysis, these mechanisms were identified in a mutually exclusive manner. Another vemurafenib-resistant sub-line, M395 R, was derived from a V600EB-RAF-homozygous parental line, M395 P. Compared to M395 P, M395 R harbors increased copy numbers of V600EB-RAF gDNA and cDNA, consistent with a dramatic V600EB-RAF protein over-expression. M395 R displays growth highly resistant to vemurafenib treatment, and titration of M395 R with vemurafenib (1 h) after a 24 h of drug withdrawal revealed pERK levels to be highly resistant to acute V600EB-RAF inhibition. This pattern of MAPK reactivation was similar to that seen in a mutant N-RAS-driven, vemurafenib-resistant sub-line, M249 R4, and contrasted with that in the RTK-driven vemurafenib-resistant sub-line, M229 R57,10. Expectedly, the levels of p-AKT are unchanged (see
V600EB-RAF over-expression in M395 P conferred vemurafenib resistance (
We also predicted that MAPK reactivation due to V600EB-RAF over-expression would be C-RAF-independent, in contrast to mutant N-RAS-mediated MAPK reactivation where V600EB-RAF may be bypassed by the alternative use of C-RAF. Indeed, C-RAF knockdown by shRNA sensitized the mutant N-RAS sub-line, M249 R4, but not the V600EB-RAF amplified sub-line, M395 R, to vemurafenib in three-day survival assays (
Identification of V600EB-RAF amplification as a mechanism of acquired resistance in B-RAFi treated patients provides evidence for alterations in the drug target causing clinical relapse. Based on these studies, therapeutic stratification of MAPK reactivation underlying B-RAFi resistance into drug-saturable or C-RAF-dependent pathways may be translatable into the design of next-generation clinical trials aimed at preventing or overcoming B-RAFi resistance. These findings also provide pre-clinical rationale for dose escalation studies in selected patients with B-RAFi-resistant V600E/KB-RAF metastatic melanomas, particularly given the wide range of effective dosing and the fact that the maximum tolerated dose of GSK2118436 has not been determined. The combination of current B-RAF inhibitors (or next-generation RAF inhibitors that enhance B-RAF potency or feature pan-RAF inhibition) with MEK1/2 inhibitors may potentially broadly block MAPK reactivation.
Method Summary
Cell culture, infections and drug treatments. Cells were maintained in DMEM with 10 or 20% fetal bovine serum and glutamine. shRNAs for B-RAF and C-RAF were sub-cloned into the lentiviral vector pLL3.7; pBabe B-RAF (V600E) was purchase (plasmid 17544, Addgene); viral supernatants generated by co-transfection with three packaging plasm ids into HEK293T cells; and infections carried out with protamine sulfate. Stocks and dilutions of PLX4032 (Plexxikon, Berkeley, Calif.) and AZD6244 (commercially available) were made in DMSO. Cells were quantified using CellTiter-GLO Luminescence (Promega) or crystal violet staining followed by NIH Image J quantification.
Whole exome sequencing and exomeCNV15 analysis. Agilent SureSelect Human All Exon 50 mb (regular or XT) was used for exome capture and Illumina GAII and HiSeq2000 were used for sequencing following manufacturer's manual. The reads were aligned to the reference human genome (hg18 or b37) using Novoalign from Novocraft (http://www.novocraft.com) and processed with SAMtools16, Picard (http://picard.sourceforge.net/) and GATK (Genome Analysis Tool Kit)17 to have both SNVs and small indels called. SeattleSeqAnnotation was used for annotating the somatic variants and ExomeCNV15 was used for calling copy number variations.
Protein detection. Western blots were probed with antibodies against p-ERK1/2 (T202/Y204), ERK1/2, C-RAF, AKT (Ser473), AKT (Thr308), AKT (Cell Signalig Technologies), N-RAS, B-RAF (Santa Cruz Biotechnology), and tubulin (Sigma). For B-RAF immunohistochemistry, paraffin-embedded formalin-fixed tissue sections were antigen-retrieved, incubated with the primary antibody followed by HRP-conjugated secondary antibody (Envision System, DakoCytomation). Immunocomplexes were visualized using the DAB (3,3′-diaminobenzidine) peroxidase method and nuclei hematoxylin-counterstained.
Genomic DNA and RNA quantifications. For real-time quantitative PCR, total RNA was extracted and cDNA quantified by the iCycler iQ Real Time PCR Detection System (BioRad). Data were normalized to TUBULIN and GAPDH levels. Relative expression is calculated using the delta-Ct method. gDNAs were extracted using the FlexiGene DNA Kit (Qiagen) (Human Genomic DNA-Female, Promega). B-RAF relative copy number was determined by quantitative PCR (cycle conditions available upon request) using the MyiQ single color Real-Time PCR Detection System (Bio-Rad). Total DNA content was estimated by assaying -globin for each sample, and 20 ng of gDNA was mixed with the SYBR Green QPCR Master Mix (Bio-Rad) and 2 pmol/L of each primer. All primer sequences are provided in Table 11.
Methods
Whole exome sequencing. For each sample, 3 ug of high molecular weight genomic DNA was used as the starting material to generate the sequencing library. Exome captures were performed using Agilent SureSelect Human All Exon 50 mb and Agilent SureSelect Human All Exon 50 mb XT for PT #5 and Pt #8, respectively, per manufacturers' recommendation, to create a mean 200 bp insert library. For Pt #5, sequencing was performed on Illumina GenomeAnalyzerii (GAIi) as 76+76 bp paired-end run. The normal sample was run on 1 flowcell lane and the tumor samples were run on 2 flowcell lanes each. For Pt #8, sequencing was performed on Illumina HiSeq2000 as 50+50 bp paired-end run and 100+100bp paired-end run. The three samples (normal, baseline and DP) were initially mixed with 9 other samples and run across 5 flowcell lanes for the 50+50 bp run. For the 100+100 bp run, they were mixed with 3 other samples to be run across 5 flowcell lanes with barcoding of each individual genomic sample library.
For Pt #5, approximately 62 million, 137 million, 147 million reads were generated for normal tissue (skin), baseline melanoma and DP melanoma, respectively, with 75.2%, 78.1%, and 74.7% of the reads mapping to capture targets. Based on an analysis of reads that uniquely aligned to the reference genome and for which the potential PCR duplicates were removed, an average coverage of 52×, 88×, and 114× was achieved with 87%, 92% and 93% of the targeted bases being covered at 10× or greater read depth for normal, baseline and DP, respectively.
For Pt #8, approximately 198 million, 270 million, 256 million reads were generated for normal tissue (skin), baseline melanoma and DP melanoma, respectively with 43.2%, 44.1% and 42.3% of the reads mapping to capture targets. Based on an analysis of reads that uniquely aligned to the reference genome and for which the potential PCR duplicates were removed, an average read depth of 107×, 132× and 123× was achieved with 89%, 90% and 90% of the targeted bases being covered at 10× or greater for normal, baseline and DP, respectively.
Sequencing Data Analysis. For Pt #8 where the samples were indexed and pooled before the sequencing, Novobarcode from Novocraft was used to de-multiplex the data. The sequence reads were aligned to the human reference genome using Novoalign V2.07.13 from Novocraft (http://www.novocraft.com). For Pt #5, hg18 downloaded from UCSC genome database was used and for Pt #8, b37 downloaded from GATK (Genome analysis toolkit) resources website was used for the reference genome. SAMtools v.0.1.1616 was used to sort and merge the data and Picard (http://picard.sourceforge.net/) was used to mark PCR duplicates. To correct the misalignments due to the presence of indels, local realignment was performed using RealignerTargetCreator and IndelRealigner of GATK17. Indel calls in dbSNP132 were used as known indel input. Then, GATK CountCovariates and TableRecalibration were used to recalibrate the originally reported quality score by using the position of the nucleotide within the read and the preceding and current nucleotide information. Finally, to call the single nucleotide variants (SNVs), the GATK UnifiedGenotyper was used to the realigned and re-calibrated bam file while GATK IndelGenotyperV2 was used to call small insertion/deletions (Indels). To generate a list of somatic variants for DP tumor, the difference in allele distribution was calculated using one-sided Fisher's exact test using normal sample or the baseline sample. Variants with p-value<0.05 were included in the “somatic variant list”. Low coverage (<10×) SNVs and SNVs with more than one variant allele in normal tissue and baseline melanoma were filtered out during the process. These somatic variants were further annotated with SeattleSeqSNPannotation (http://gvs.gs.washington.edu/SeattleSeqAnnotation/). For DP-specific, non-synonymous SNVs that result in missense mutations , we assessed the level of amino acid conservation using PhyloP score (provided in UCSC genome database) where a score >2 implies high conservation and the nature of amino substitution using Polyphen-2 analysis18.
CNV analysis was performed using an R package, ExomeCNV15. ExomeCNV uses the ratio of read depth between two samples at each capture interval. Here, the read depth data between baseline and DP melanomas were compared. Briefly, the read depth information was extracted through the PILEUP file generated from the BAM file after removing PCR duplicates using SAMtools. The average read depth at each capture interval was calculatedand the classify.eCNV module of ExomeCNV was run with the default parameters to calculate the copy number estimate for each interval. Subsequently, another R package commonly used to segment the copy number intervals, DNAcopy19, was called through ExomeCNV multi.CNV.analyze module with default parameters to do segmentation and sequential merging. The genomic regions with copy number 1 were called deletion and any regions with copy number >2 were called amplification. Circos20 was used to visualize the CNV data.
1. Davies, H. et al. Nature 417, 949-54 (2002).
2. Bollag, G. et al. Nature 467, 596-9 (2010).
3. Chapman, P.B. et al. N Engl J Med 364, 2507-16 (2011).
4. Flaherty, K. T. et al. N Engl J Med 363, 809-19 (2010).
5. Kefford, R. et al. J Clin Oncol 28, suppl; abstr 8503 (2010).
6. Ribas, A. et al. BRIM-2: Journal of Clinical Oncology 29, suppl; abstr 8509 (2011).
7. Shi, H., Kong, X., Ribas, A. & Lo, R. S. Cancer Research 71, 5067-74 (2011).
8. Villanueva, J. et al. Cancer Cell 18, 683-95 (2010).
9. Johannessen, C. M. et al. Nature 468, 968-72 (2010).
10. Nazarian, R. et al. Nature 468, 973-7 (2010).
11. Example 2.
12. Wagle, N. et al. J Clin Oncol 29, 3085-96 (2011).
13. Dumaz, N. et al. Cancer Res 66, 9483-91 (2006).
14. Infante, J. R. et al. Journal of Clinical Oncology 29, suppl; abstr CRA8503 (2011).
15. Sathirapongsasuti, J. F. et al. Bioinformatics (2011).
16. Li, H. et al. Bioinformatics 25, 2078-9 (2009).
17. McKenna, A. et al. Genome Res 20, 1297-303 (2010).
18. Adzhubei, I. A. et al. Nat Methods 7, 248-9 (2010).
19. Olshen, A. B., Venkatraman, E. S., Lucito, R. & Wigler, M. Biostatistics 5, 557-72 (2004).
20. Krzywinski, M. et al. Genome Res 19, 1639-45 (2009).
This example demonstrates an additional mechanism of B-RAF inhibitor acquired resistance that develops with disease progression. Methods as described for Example 1 above were used to analyze melanoma cells obtained from a brain tumor biopsy to reveal a mutation in the serine-threonine protein kinase AKT1, namely Q79K. This novel mutation results in P13K-independent activation of AKT1. As indicated in
From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
This application claims the benefit of U.S. provisional patent application No. 61/415,417, filed Nov. 19, 2010, and U.S. provisional patent application No. 61/547,026, filed Oct. 13, 2010, the entire contents of each of which are incorporated herein by reference. Throughout this application various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to describe more fully the state of the art to which this invention pertains.
This invention was made with Government support of Grant No. CA151638, awarded by the National Institutes of Health. The Government has certain rights in this invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US2011/061552 | 11/18/2011 | WO | 00 | 4/12/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61415417 | Nov 2010 | US | |
| 61547026 | Oct 2011 | US |
