Patent Grant
11318197
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety and forms part of the specification. Said ASCII copy, created on Jun. 26, 2020, is named 1234300 00321US3 SL.txt and is 1,224,754 bytes in size. The Sequence Listing contains sequences depicted in
The present invention relates, in general, to human immunodeficiency virus (HIV), and, in particular, to HIV-1 immunogenic compositions their methods of making and their use in vaccination regimens.
Development of an effective vaccine for prevention of HIV-1 infection is a global priority. To provide protection, an HIV-1 vaccine should induce broadly neutralizing antibodies (bnAbs). One class of bnAbs among antibodies isolated from infected individuals targets the glycan-polypeptide at the base of the envelope third variable loop (V3). However, BnAbs have not been successfully induced by vaccine constructs thus far.
In certain aspects the invention provides an HIV-1 envelope sequence comprising non-glycosylatable amino acids in the V1 loop, at positions corresponding to N133 and/or N138 in the CH848.3.D0949.10.17 envelope sequence, wherein the envelope protomer sequence is based on the amino acid, comprises amino acids from the CH848.3.D0949.10.17 envelope sequence, and wherein the protomer is deglycosylated in the V1 loop (partially or completely in the V1 loop). In certain embodiments the envelope comprises amino acids substitutions within the CH848.3.D0949.10.17 sequence such that the envelope promoter forms a trimer. Any suitable envelope design or form is contemplated, so long as the envelope is based on CH848.3.D0949.10.17 sequence and the V1 loop is deglycosylated. In some embodiments short V1 loops of various length could be incorporated.
The invention provides amino acid or nucleic acids sequences encoding such deglycosylated proteins. Provided are also nucleic acids, including modified mRNAs which are stable and could be used as immunogens. Provided also are nucleic acids optionally designed as vectors, for example for recombinant expression and/or stable integration, e.g. but not limited, gp160 DNA encoding trimer for stable expression, or VLP incorporation.
In certain embodiments, the deglycosylated envelope is designed as a chimeric trimer chimeric (e.g incorporates amino acids and/or portions of envelope BG505). In certain embodiments, the deglycosylated envelopes are not chimeric, i.e. based on the sequence of envelope CH848.3.D0949.10.17 and comprising amino acids which help trimer formation. In certain embodiments, the envelope is designed as any suitable trimer, such as but not limited to various SOSIP desings, UFO trimers, or any other trimers. In certain embodiments, the envelopes of the invention comprising deglycosylated V1 positions binds and/or neutralizes DH270UCA3 and/or DH270UCA4. The envelope protomer, wherein the envelope is gp120, gp140, gp145, gp150 or gp160. In another aspect the invention provides a method of inducing an immune response in a subject comprising administering a combination of immunogens comprising V3-peptide and/or glycopeptide, wherein the peptide binds to a UCA of a V3 glycan antibody, HIV-1 envelope CH848.0949.10.17; CH848.0836.10.31; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02 in any suitable form or any combination thereof as a prime and/or boost in an amount sufficient to induce an immune response, wherein the envelope is administered as a polypeptide or a nucleic acid encoding the same.
In certain embodiments, the compositions contemplate nucleic acid, as DNA and/or RNA, or proteins immunogens either alone or in any combination. In certain embodiments, the methods contemplate genetic, as DNA and/or RNA, immunization either alone or in combination with envelope protein(s).
In certain embodiments the nucleic acid encoding an envelope is operably linked to a promoter inserted an expression vector. In certain aspects the compositions comprise a suitable carrier. In certain aspects the compositions comprise a suitable adjuvant.
In certain embodiments the induced immune response includes induction of antibodies, including but not limited to autologous and/or cross-reactive (broadly) neutralizing antibodies against HIV-1 envelope. Various assays that analyze whether an immunogenic composition induces an immune response, and the type of antibodies induced are known in the art and are also described herein.
In certain aspects the invention provides an expression vector comprising any of the nucleic acid sequences of the invention, wherein the nucleic acid is operably linked to a promoter. In certain aspects the invention provides an expression vector comprising a nucleic acid sequence encoding any of the polypeptides of the invention, wherein the nucleic acid is operably linked to a promoter. In certain embodiments, the nucleic acids are codon optimized for expression in a mammalian cell, in vivo or in vitro. In certain aspects the invention provides nucleic acids comprising any one of the nucleic acid sequences of invention. In certain aspects the invention provides nucleic acids consisting essentially of any one of the nucleic acid sequences of invention. In certain aspects the invention provides nucleic acids consisting of any one of the nucleic acid sequences of invention. In certain embodiments the nucleic acid of the invention, is operably linked to a promoter and is inserted in an expression vector. In certain aspects the invention provides an immunogenic composition comprising the expression vector.
In certain aspects the invention provides a composition comprising at least one of the nucleic acid sequences of the invention. In certain aspects the invention provides a composition comprising any one of the nucleic acid sequences of invention. In certain aspects the invention provides a composition comprising at least one nucleic acid sequence encoding any one of the polypeptides of the invention.
The envelope used in the compositions and methods of the invention can be in any suitable form: a gp160, gp150, gp145, any suitable form of a trimer, for example but not limited to SOSIP trimers, gp140 (including but not limited to gp140C, gp140CF, gp140CFI), gp120, gp41, N-terminal deletion variants (e.g. delta 11 deletions) as described herein, cleavage resistant variants, or codon optimized sequences thereof.
The polypeptide contemplated by the invention can be a polypeptide comprising any one of the polypeptides described herein. The polypeptide contemplated by the invention can be a polypeptide consisting essentially of any one of the polypeptides described herein. The polypeptide contemplated by the invention can be a polypeptide consisting of any one of the polypeptides described herein. In certain embodiments, the polypeptide is recombinantly produced. In certain embodiments, the polypeptides and nucleic acids of the invention are suitable for use as an immunogen, for example to be administered in a human subject.
In certain embodiments the envelope is any of the forms of HIV-1 envelope. In certain embodiments the envelope is gp120, gp140, gp145 (i.e. with a transmembrane), gp150, optionally as a trimer. In certain embodiments the trimer is a chimeric SOSIP trimer. See WO2016/037154 incorporated by reference in its entirety. In certain embodiments, envelope trimers are purified from cellular recombinant fractions by antibody binding and reconstituted in lipid comprising formulations. See for example WO2015/127108 titled “Trimeric HIV-1 envelopes and uses thereof” which content is herein incorporated by reference in its entirety. In certain embodiments, the envelope is in a liposome and transmembrane with a cytoplasmic tail in a liposome. In certain embodiments, the nucleic acid comprises a nucleic acid sequence which encode a gp120, gp140 (including but not limited to gp140C, gp140CF, gp140CFI), gp145, gp150 or gp160.
The envelope used in the compositions and methods of the invention can be a gp160, gp150, gp145, gp140, gp120, gp41, N-terminal deletion variants as described herein, cleavage resistant variants as described herein, or codon optimized sequences thereof. In certain embodiments the composition comprises envelopes as trimers. In certain embodiments, envelope proteins are multimerized, for example trimers are attached to a particle such that multiple copies of the trimer are attached and the multimerized envelope is prepared and formulated for immunization in a human. In certain embodiments, the compositions comprise envelopes, including but not limited to trimers as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles. In some embodiments, the trimers are in a well ordered, near native like or closed conformation. In some embodiments the trimer compositions comprise a homogenous mix of native like trimers. In some embodiments the trimer compositions comprise at least 85%, 90%, 95% native like trimers.
In certain embodiments, where the nucleic acids are operably linked to a promoter and inserted in a vector, the vectors is any suitable vector. Non-limiting examples, include, the VSV, replicating rAdenovirus type 4, MVA, Chimp adenovirus vectors, pox vectors, and the like. In certain embodiments, the nucleic acids are administered in NanoTaxi block polymer nanospheres. In certain embodiments, the composition and methods comprise an adjuvant. Non-limiting examples include, AS01 B, AS01 E, Gla/SE, alum, Poly I poly C (in any form, including but not limited to PolyIC/long chain (LC)), TLR agonists, TLR7/8 and 9 agonists, or a combination of TLR7/8 and TLR9 agonists (see Moody et al. (2014) J. Virol. March 2014 vol. 88 no. 6 3329-3339), or any other adjuvant. Non-limiting examples of TLR7/8 agonist include TLR7/8 ligands, Gardiquimod, Imiquimod and R848 (resiquimod). A non-limiting embodiment of a combination of TLR7/8 and TLR9 agonist comprises R848 and oCpG in STS (see Moody et al. (2014) J. Virol. March 2014 vol. 88 no. 6 3329-3339).
In certain aspects, the invention provides a kit comprising a combination/selection of immunogens, for example but not limited to immunogens in
In certain aspects the invention provides a recombinant HIV-1 envelope polypeptide, wherein the polypeptide comprises the amino acid sequence of any one of the envelopes designs in Table 1, Table 3, Example 3, Example 5. In certain embodiments the envelope is engineered with modifications so as to improve its binding to the DH270UCA antibody. In certain embodiments, the engineered envelope is based on the sequence of HIV-1 envelope CH848.0949.10.17. In certain embodiments, the protein does not include the signal peptide. In certain aspects the invention provides a recombinant HIV-1 envelope polypeptide from Table 1, Table 3, Example 3, Example 5 wherein the polypeptide is non-naturally occurring and designed to form a soluble trimer. In certain embodiments, the protein does not include the signal peptide. In certain aspects the invention provides a nucleic acid encoding any one of the polypeptides of the invention. In certain embodiments, the nucleic acids could be formulated in any suitable way for immunogenic delivery of nucleic acids.
In certain aspects the invention provides an immunogenic composition comprising the recombinant HIV-1 envelope polypeptides of the invention and a carrier. In certain aspects the invention provides an immunogenic composition comprising the nucleic acid of the invention and a carrier. The compositions could comprise an adjuvant.
A method of inducing an immune response in a subject comprising administering a composition comprising an HIV-1 envelope polypeptide(s) in an amount sufficient to induce an immune response from one or more of the following groups:
In certain aspects the invention provides methods of inducing an immune response in a subject comprising administering a composition comprising an HIV-1 envelope polypeptide(s) in an amount sufficient to induce an immune response from one or more of the following groups:
(a) deglycosylated envelope polypeptide form(s) of CH848.0949.10.17 designed to bind DH270UCA (Table 1, Table 3, Table 4, Ex. 3, Ex. 5), or any combination thereof as a prime;
(b) envelope polypeptide(s) CH848.0949.10.17, CH848.0836.10.31, CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02 (
(c) envelope polypeptide CH0848.3.d1651.10.07;
and wherein the administration step can alternatively, or in addition, comprise administering any suitable form of a nucleic acid(s) encoding an HIV-1 envelope polypeptide(s) in an amount sufficient to induce an immune response from one or more of the following groups:
(a) deglycosylated envelope polypeptide form(s) of CH848.0949.10.17 designed to bind DH270UCA (Table 1, Table 3, Table 4, Ex. 3, Ex. 5), or any combination thereof as a prime;
(b) envelope polypeptide(s) CH848.0949.10.17, CH848.0836.10.31, CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02 (
(c) envelope polypeptide CH0848.3.d1651.10.07.
In certain embodiments, the first boost administered after the prime comprises HIV-1 envelope polypeptide CH848.0949.10.17 in any suitable form. In certain embodiments the boos could comprise any of the envelopes of the invention. In certain embodiments the boost is any of the envelopes of Table 1, Table 3 or Table 4. Non-limiting embodiment include any of the envelopes in
In certain embodiments, the nucleic acid encodes a gp120 envelope, gp120D11 envelope, a gp140 envelope (gp140C, gp140CF, gp140CFI) as soluble or stabilized protomer of a SOSIP trimer, a gp145 envelope, a gp150 envelope, or a transmembrane bound envelope. In certain embodiments, the polypeptide is gp120 envelope, gp120D11 envelope, a gp140 envelope (gp140C, gp140CF, gp140CFI) as soluble or stabilized protomer of a SOSIP trimer, a gp145 envelope, a gp150 envelope, or a transmembrane bound envelope. In certain embodiments, the methods further comprise administering an agent which modulates host immune tolerance. In certain embodiments, the immunogen of the invention is multimerized in a liposome or nanoparticle. In certain embodiment, the methods further comprise administering one or more additional HIV-1 immunogens to induce a T cell response.
In certain aspects the invention provides a kit comprising a combination/selection of immunogens of Selection I (V3 peptide in any suitable form such aglycone, glycosylated, multimerized, carrying T cell epitopes, etc.); recombinant HIV-1 envelopes CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02), and optionally envelope polypeptide CH0848.3.d1651.10.0, and/or a nucleic acid encoding the same in any suitable form. A kit comprising a combination/selection of immunogens comprising any suitable envelope design which binds to the DH270UCA; recombinant HIV-1 envelopes CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02), and optionally envelope polypeptide CH0848.3.d1651.10.0, and/or a nucleic acid encoding the same in any suitable form. The envelope and/or nucleic acid in the kits of the invention could be in any suitable form. The V3 peptide in the kits of the invention could be of SEQ ID NO: 1. In some embodiments the peptide is glycosylated. In some embodiments, the peptide is not glycosylated. In some embodiments the kit comprises an adjuvant. In some embodiment the kit comprises instructions on how to carry out the immunization regiment: the immunogen could be administered sequentially or additively.
In certain aspects the invention provides a recombinant CH848 envelope protein designed to form a soluble trimer, wherein the CH848 envelope protein comprises the sequence of any one of the envelopes or designs in Tables 1, 3, 4 and Ex, 3. Ex. 5,
In certain aspects the invention provides an immunogenic composition comprising the recombinant HIV-1 envelope CH848.0949.10.17, CH848.0836.10.31, CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02 in any suitable form or a nucleic acid encoding the same. In certain embodiments the recombinant envelope comprises the sequence of the CHIM.6R.SOSIP.664V4.1 design, or any other suitable trimer design, or multimerized timer. In certain embodiments the recombinant envelope comprises the sequence any other envelope form (See e.g.
In certain aspects the invention provides a kit comprising a combination/selection of immunogens described in Tables 1, 3 and Ex, 3, and instructions for which immunogen are administered as a prime and which immunogens are administered as a boost. In some embodiments the kit of Selection I (V3 peptide in any suitable form such aglycone, glycosylated, multimerized, carrying T cell epitopes, etc.; recombinant HIV-1 envelopes CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02) and/or a nucleic acid encoding the same. The envelope and/or nucleic acid in the kits of the invention could be in any suitable form. The V3 peptide in the kits of the invention could be of SEQ ID NO: 1. In some embodiments the peptide is glycosylated. In some embodiments, the peptide is not glycosylated. In some embodiments the kit comprises an adjuvant. In some embodiment the kit comprises instructions on how to carry out the immunization regiment: the immunogen could be administered sequentially or additively.
In some aspects the invention provides a recombinant cell, a clonal population of cells, or a pool of cells comprising a nucleic acid encoding any one of the envelope proteins or immunogens of the invention.
A recombinant HIV-1 Envelope ectodomain trimer, comprising three gp120-gp41 protomers comprising a gp120 polypeptide and a gp41 ectodomain, wherein each protomer is the same and comprises portions from envelope BG505 HIV-1 strain and gp120 polypeptide portions from a CH0848 HIV-1 strain and stabilizing mutations A316W and E64K, wherein the trimer is stabilized in a prefusion mature closed conformation, and wherein the trimer does not comprise non-natural disulfide bond between cysteine substitutions at positions 201 and 433 of the HXB2 reference sequence. In some embodiments, the amino acid sequence of one monomer of trimer. In some embodiments, the trimer is immunogenic. In some embodiments the trimer binds to any one of the antibodies PGT145, PGT151, CH103UCA, CH103, VRC01, PGT128, or any combination thereof. In some embodiments the trimer does not bind to antibody 19B and/or 17B.
In certain embodiments the compositions comprising trimers are immunogenic. In certain aspects, the invention provides a pharmaceutical composition comprising any one of the recombinant trimers of the invention. In certain embodiments the compositions comprising trimers are immunogenic. The percent trimer in such immunogenic compositions could vary. In some embodiments the composition comprises 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% stabilized trimer.
In certain aspects the invention is directed to recombinant HIV-1 envelope which comprises changes in the amino acid sequence such that the envelope is partially deglycosylated. In certain embodiments, the partially deglycosylated envelopes binds to specific UCA antibodies, including but not limited to the DH270 UCA. The contemplated changes are with respect to a reference envelope sequence, which may or may not be naturally occurring. In certain embodiments deglycosylation is in the V1 loop of the HIV-1 envelope. In certain embodiments these changes are at positions N133, N138, N156, N301, N332, or any combination thereof. In certain non-limiting embodiments where the envelope is deglycosylated at positions N133 and/or N138, the envelope is glycosylated at positions N301 and N332 (See Example 5,
Any suitable amino acid change is contemplated so long as glycosylation at that position is abolished. Non-limiting embodiments include amino acids which are naturally occurring at the respective position in other envelopes such that the modified envelopes are deglycosylated. Non-limiting amino acid changes include change to alanine, or any of the following: N133D, N138T, N301A, N301S, N332A, N332T. Any envelope form, e.g. but not limited to stabilized SOSIP trimer designs, gp140s, etc. could be designed to comprise deglycosylation mutations. In some embodiments, the envelope is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1 N133DN138T. In other embodiments, the envelope is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T and further comprises N301mut.
In certain aspects, he invention provides compositions comprising these deglycosylated envelopes. In certain embodiments, these deglycosylated envelopes are used as immunogens. In certain embodiments, these deglycosylated envelopes are comprised in immunogenic compositions with suitable carriers and/or adjuvants.
The invention also contemplates multimerized forms of any of the recombinant envelopes of the invention. In certain aspects the invention provides immunogenic compositions and their use to induce immune responses, wherein the envelope immunogen structure is stabilized by the addition of small molecules. A non-limiting example of such compound is BMS-626529.
In certain aspects, the invention provides methods of inducing immune response in a subject comprising administering compositions comprising deglycosylated envelopes. In some embodiments these deglycosylated envelopes are administered as a prime. In some embodiments, the prime could be a nucleic acid encoding a deglycosylaed The glycosylated envelopes could also be administered as a boost.
The invention provides compositions comprising V3 antibody immunogens and methods for inducing antibodies to the V3 HIV-1 envelope region. In one aspect the invention provides selection of immunogens which are used to induce V3 antibodies. In some embodiments, the immunogens include a homogeneous minimal immunogen with high mannose glycans reflective of a native Env V3-glycan bnAb epitope, (Man9-V3). In some embodiments, the immunogens include a homogeneous minimal immunogen without glycans.
V3-glycan bnAbs bound to Man9-V3 glycopeptide and native-like gp140 trimers with similar affinities. Both fluorophore-labeled Man9-V3 or native-like trimers similarly bound to bnAb memory B cells, and by flow sorting isolated members of a bnAb clonal lineage from an HIV-1-infected individual. The glycopeptide of
In some embodiments the compositions comprise immunologically and pharmaceutically acceptable carriers and/or excipients.
To conform to the requirements for PCT patent applications, many of the figures presented herein are black and white representations of images originally created in color.
B.JRFL gp120core_mini_V3_v2/Kif/293F EndoH treated/Denatured 01.31.2017=“A”
B.JRFL gp120core_mini_V3_v2/Kif/293F EndoH treated/Native 01.31.2017=“B”
CH0848.3.D0949.10.17 gp140c/5 uM-Kif/293F Lot: 170131D=“C”
CH0848.3.D0836.10.31 gp140c/293F Lot: 170131B=“D”
CH0848.3.D0949.10.17 gp140c/25 uM-Kif/293F Lot: 170131A=“E”
CH0848.3.D0949.10.17 gp140c/293F Lot: 170131C=“F”
BG5015_MUT11B D11 gp120_avi/293F/Mon Lot: 170130B=“G”
CON-S gp140 CFI_avi V1_4Q/293F Lot: 160809C=“H”
JRFL mini V3 gp120 Core GNTI−/− Lot: 539HC=“I”
CH848.3.D0949.10.17chim.6R.DS. SOSIP.664.avi_N301A/293F Lot: 20JAJ=“J”
CH848.3.D0949.10.17 CHIM.6R.SOSIP.664V4.1/293F Lot: 225ESD=“K”
CH848.3.D0949.10.17 GT1 D11gp120_avi/293F/MON Lot: 170130C=“L”
BG505_MUT11B D11 gp120_avi/Kif/293F/Mon Lot: 170130A=“M”
B.JRFL gp120 Core_mini-V3_v2/Kif/293F/Mon Lot: 170130D=“N”
CH848.3.D0949.10.17chim.6R.DS.SOSIP.664/293F Lot: 226ESD=“0”
CH0848.3.D0358.80.06CHIM.6R.SOSIP.664v4.1/293F Lot: 558HC=“P”
B.JRFLgp140CF_aviV1 3Q/293F Lot: 160908B=“Q”
The third variable region, V3, of the envelope glycoprotein, gp120 of HIV-1 is a target for virus broad neutralizing antibodies. Several V3 glycan dependent broad neutralizing antibodies (bnAbs) have been isolated that neutralize diverse strains of difficult to neutralize viruses. A questions remains as to what form of Env could bind and initiate V3-glycan bnAb lineages. Soluble Env gp120 or cell surface Env trimers do not bind V3-glycan bnAb UCAs (20) (See Example 1). In some aspects the invention provides that the Man9-V3glycopeptide (Example 2) as well as its aglycone (Example 2) form binds the UCA of the DH270V3-glycan bnAb lineage. Moreover, Man9-V3/aglycone binds to the UCA of gp140-induced V3-glycan neutralizing mAb, DH501. With affinity maturation in both the DH270 bnAb and the DH501 lineages, binding to the aglycone-V3 diminished and binding to Man9-V3 was dramatically enhanced. These observations raise the hypothesis that initiating immunogens for V3-glycan lineages may be denatured or Env fragments (Example 1 Bonsignori, M. et al. submitted).
The invention provides various methods to choose a subset of viral variants, including but not limited to envelopes, to investigate the role of antigenic diversity in serial samples. In other aspects, the invention provides compositions comprising viral variants, for example but not limited to envelopes, selected based on various criteria as described herein to be used as immunogens. In some embodiments, the immunogens are selected based on the envelope and/or peptide binding to the UCA, and/or intermediate antibodies. In some embodiments, the immunogens are selected based on UCA and/or intermediate antibodies neutralizing properties against viruses. In some embodiments the immunogens are selected based on their chronological appearance and/or sequence diversity during infection.
In other aspects, the invention provides immunization strategies using the selections of immunogens to induce cross-reactive neutralizing antibodies.
In certain aspects the invention provides an HIV-1 envelope sequence comprising non-glycosylatable amino acids in the V1 loop, at positions corresponding to N133 and/or N138 in the CH848.3.D0949.10.17 envelope sequence, wherein the envelope protomer sequence is based on the amino acid sequence of CH848.3.D0949.10.17 envelope; comprises amino acids from the CH848.3.D0949.10.17 envelope sequence, consists essentially of amino acids from CH848.3.D0949.10.17 envelope sequence and wherein the protomer is deglycosylated in the V1 loop (partially or completely in the V1 loop). In some embodiments, a deglycosylated envelope consists essentially of amino acids from CH848.3.D0949.10.17 envelope sequence when the deglycosylated envelopes has all amino acids from CH848.3.D0949.10.17 envelope sequence except for the amino acids at positions N133 and/or N138. In some embodiments, it further comprises amino acid changes for trimer formation.
Using sequence alignment algorithms, a skilled artisan can readily determine whether a V1 loop deglycosylated envelope is based on CH848.3.D0949.10.17 envelope sequence.
Comparing the sequences of envelopes, a skilled artisan can readily determine sequence identity, compare sequence length and determine the % sequence identity and/or changes, including % sequence identity and/or changes in the sequences, as well as the specific positions and types of substitutions which can be tolerated while the V1 loop deglycosylated envelope sequence is based on CH848.3.D0949.10.17.
Various algorithms for sequence alignment are known in the art. The similarity between amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989; Corpet et al., Nucleic Acids Research 16:10881, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988. Altschul et al., Nature Genet. 6:119, 1994, presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
In some embodiments a deglycosylated envelope is based on CH848.3.D0949.10.17 envelope if it is characterized by possession of at least about 65%, 70%, 75%, for example at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity counted over the full length alignment with the amino acid sequence of interest. When less than the entire sequence is being compared for sequence identity, a deglycosylated envelope could have at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
In some embodiments a deglycosylated envelope is based on CH848.3.D0949.10.17 envelope if it is characterized as having 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75.
In certain embodiments the envelope comprises amino acids substitutions within the CH848.3.D0949.10.17 sequence such that the envelope promoter forms a trimer. Any suitable envelope design or form is contemplated, so long as the envelope is based on CH848.3.D0949.10.17 sequence and the V1 loop is deglycosylated. In some embodiments short V1 loops of various length could be incorporated.
The invention provides amino acid or nucleic acids sequences encoding such deglycosylated proteins. Provided are also nucleic acids, including modified mRNAs which are stable and could be used as immunogens. Provided also are nucleic acids optionally designed as vectors, for example for recombinant expression and/or stable integration, e.g. but not limited, gp160 DNA encoding trimer for stable expression, or VLP incorporation.
In certain embodiments, the deglycosylated envelope is designed as a chimeric trimer chimeric (e.g incorporates amino acids and/or portions of envelope BG505). In certain embodiments, the deglycosylated envelopes are not chimeric, i.e. based on the sequence of envelope CH848.3.D0949.10.17 and comprising amino acids which help trimer formation. In certain embodiments, the envelope is designed as any suitable trimer, such as but not limited to various SOSIP designs, UFO trimers, or any other trimers. In certain embodiments, the envelopes of the invention comprising deglycosylated V1 positions binds and/or neutralizes DH270UCA3 and/or DH270UCA4. The envelope protomer, wherein the envelope is gp120, gp140, gp145, gp150 or gp160.
As Example 2 shows that a synthetic homogeneous Man9-V3 glycopeptide mimics a HIV-1 Env V3-glycan bnAb epitope. Man9-V3 recognition by V3-glycan memory B cell and UCA BCR suggest that a minimal V3-glycan epitope construct may be a candidate for the induction of V3-glycan bnAb lineages. In HIV-1 infection, the DH270 V3-glycan bnAb lineage developed over ˜4 years (Bonsignori, M et al. submitted), and V3-glycan-targeted antibodies took 4 years to develop in macaques repetitively immunized with Env gp140 (Saunders, K et al. submitted). Thus, while whole Env monomers or trimers do not bind to V3-glycan bnAb UCAs, the V3-glycopeptide does bind UCAs, suggesting that minimal Env epitopes may accelerate induction of V3-glycan bnAb B cell lineages.
Described herein are both the design and selections of immunogens to elicit neutralizing antibodies directed toward the V3 glycan epitope defined by V3 binding antibodies. Minimal V3 region glycopeptides bearing two glycans of appropriate structure can mimic the antigenic nature of this epitope, and can provide an effective platform for immunogen development. This concept—based on the “two glycans and a strand” paradigm of recognition suggested by x-ray analysis.sup.6—has been successfully applied to the V1V2 region anti-glycan BnAb site. Given the likely rarity of naive B cells relevant to BnAb ontogeny in the immune repertoire, preferred immunogens include those that exclude potentially interfering immunodominant epitopes. These immunogens can be evaluated not only based on their affinities for mature BnAbs, but also their germline precursors.
In certain embodiment, the invention provides a composition comprising any one of the inventive peptides, wherein the composition comprises purified homogenously glycosylated peptides. In certain embodiments, about 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.9% of the peptides in the composition are homogenously glycosylated peptides. In certain embodiments, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.9% of the peptides in the composition are homogenously glycosylated peptides. In certain embodiments, 70%-75%, 75.1%-80%, 80.1%-85%, 85.1%-90%, 90.1%-95%, 95.1%-99%, 96%-99%, 97%-99%, 98%-99% or 99.9% of the peptides in the composition are homogenously glycosylated peptides. In certain embodiment, the glycosylation pattern is homogenous on all V3 peptides in the composition. In certain embodiment, the glycosylation pattern is substantially identical on all V3 peptides in the composition.
Various methods of determining the glycosylation pattern on a peptide are known in the art. In certain embodiments, glycosylation pattern on the peptides and % homogeneity can be determined by Liquid chromatography—mass spectrometry (LC-MS, or alternatively HPLC-MS).
As indicated in the Examples that follow, V3 glycopeptides can be synthesized with well-defined glycans at N332 and N301 using clade B and clade C sequences (derived from Envs with known antigenicity toward V3 anti-glycan BnAbs). Variations of the peptide framework include full length vs. truncated V3 loops, as well as linear vs. constrained cyclic forms (via disulfide bond formation). Antigenicity testing provides the data needed to determine the peptide design motif that is optimal for binding to HIV-1 Env anti-glycan BnAbs. Using the best peptide “scaffold”, derivatives can be synthesized bearing different glycans at N332 and N301 and the determination made as to the optimal carbohydrate design for anti-glycan BnAb binding. The constructs that exhibit the highest affinity for V3-directed anti-glycan BnAbs and their UCAs can be synthesized on larger scale and subjected to trials e.g., in non-human primates—immunogenicity can be evaluated for constructs both with and without conjugation to carrier protein.
The present invention thus relates, at least in part, to immunogens that focus the immune response to the V3 glycan epitope on gp120 that lead to BnAbs and away from epitopes that lead to non-neutralizing antibodies. Central to the present design strategy is making the immunogen as minimal in size as possible so as not to introduce diverting, non-neutralizing epitopes. Non-limiting embodiments of immunogens are described in the Examples below.
The immunogens can be formulated with appropriate carriers using standard techniques to yield compositions suitable for administration. The compositions can include an adjuvant, such as, for example, alum, poly IC, poly IC/LC, MF-59 or other squalene-based adjuvant, AS01B or other liposomal based adjuvant suitable for protein immunization. Suitable vaccine strategies include, e.g., those described, for in the Examples that follow.
Nucleic acid sequences (e.g., DNA sequences) encoding the immunogens can also be administered to a subject (e.g., a human) under conditions such that the immunogen is expressed in vivo and BNAbs are produced. The DNA can be present as naked DNA with a potent promoter such as the CMV promoter as used in the pCMVr plasmid (Churchyard et al, PLoS One 6:e21225 (2011)) or as an insert in a vector, such as a rAdenoviral (Barouch, et al. Nature Med. 16: 319-23 (2010), recombinant mycobacterial (i.e., BCG or M smegmatis) (Yu et al. Clinical Vaccine Immunol. 14: 886-093 (2007); ibid 13: 1204-11 (2006), or recombinant vaccinia type of vector (Santra S. Nature Med. 16: 324-8 (2010)).
Immunogens of the invention, and nucleic acids (e.g., DNAs) encoding same, are suitable for use in generating an immune response (e.g., BNAbs) in a patient (e.g., a human patient) to HIV-1. The V3 N301, N332 peptide glycan can optimally be administered as a peptide-glycan formulated in a squalene based adjuvant such as MF59, or GLA-SE (Alving et al, Current Opinion in Immunology 24:310 (2012)). The mode of administration of the immunogen, or encoding sequence, can vary with the particular immunogen, the patient and the effect sought, similarly, the dose administered. Typically, the administration route is intramuscular or subcutaneous injection (intravenous and intraperitoneal can also be used). Additionally, the formulations can be administered via the intranasal route, or intrarectally or vaginally as a suppository-like vehicle. Optimum dosing regimens can be readily determined by one skilled in the art. The immunogens (and nucleic acids encoding same) are preferred for use prophylactically, however, their administration to infected individuals may reduce viral load.
The present invention includes the specific protein immunogens disclosed herein and nucleic acids comprising nucleotide sequences encoding same. The proteins can be expressed, for example, in 293T cells, 293F cells or CHO cells (Liao et al, Virology 353:268-82 (2006))
Peptides
The polypeptides of the present invention may be fused to or chemically linked with an appropriate carrier molecule, such as tetanus toxin, MLv gp70, cholera toxin, keyhole limpet haemocyanin or gp120. Alternatively, the polypeptides of the present invention may be inserted by genetic engineering techniques into permissible exposed loops of antigenic proteins.
Versions of the constructs that are conjugated to carrier protein will be produced for the purposes of comparison. Carrier proteins used in currently licensed vaccines include tetanus toxoid (TT), diphtheria toxoid (DT), CRM.sub. 197 (cross-reactive material of diphtheria toxin. sub.197), N. meningitidis outer membrane protein (OMP), and H. influenzae protein D.sup.64 For the initial studies, CRM.sub.197, a non-toxic mutant (G52.fwdarw.D) of diphtheria toxin, will be selected which, unlike TT and DT, does not require chemical detoxification with formaldehyde. Thus, it is a well-defined, homogeneous 63 kD protein with a complete set of free, surface-exposed lysine chains (39 total), devoid of cross-linking, which are available for conjugation with potential haptens. Keyhole limpet hemocyanin (KLH) would be a potential alternative.
Alternatively the polypeptides of the present invention may be linked to amino acids derived from a T-helper epitope to enhance their immunogenicity.
A T-helper epitope is a peptide capable of activating a T helper cell. The T-helper epitope may be a human immunodeficiency virus (HIV) T helper epitope e.g. from the C4 domain of HIV gp120. According to one embodiment, the T helper epitope comprises about 16 consecutive residues from the C4 domain (about residues 421 to 436). According to another embodiment, the T-helper sequence is a variation of the above.
Contemplated T helper epitopes from the C4 domain are described in U.S. Pat. Appl. No. 20030147888, incorporated herein by reference. Other T helper determinants from HIV or from non-HIV proteins can also be used. For example, a further T helper epitope suitable for use in the invention is from HIV gag (e.g., residues 262-278). One such sequence is designated GTH1. Variants of this sequence can also be used.
Another contemplated T helper epitope is derived from murine HSP60 458-474.
In some embodiments, a carbohydrate such as the outer membrane protein of pneumococcus, or another carbohydrate or protein with immunogenic, T helper activity can be used.
The T-helper epitope amino acids may be linked to the V3 portion of the peptides of the present invention using any method known in the art so long as it does not decrease the immunogenic and antigenic properties of the peptide.
The amino acids of the V3 domain of gp120 are preferably linked C terminal to the amino acids of the T-helper epitope.
According to one embodiment, the V3 portion of the polypeptide is linked to the T helper epitope via a covalent bond (e.g. a peptide bond). According to another embodiment, the V3 portion of the polypeptide is linked to the T helper epitope via a non-covalent linker. The linkage may be direct or via bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer.
Any suitable method for conjugating the V3 portion with the T helper epitope portion are known in the art.
Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted for synthetic non-natural acid such as Phenylglycine, TIC, naphthylelanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe or o-methyl-Tyr.
In addition to the above, the polypeptides of the present invention may also include one or more modified amino acids or one or more non-amino acid moieties (e.g. lipids, complex carbohydrates etc.). In some embodiments, these non-amino acid moieties are used to multimerize the peptides of the invention.
Amino acids incorporated in the peptides of the invention could include the 20 naturally occurring amino acids, D- and L-amino acids (stereoisomers); those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
Sequences/Clones
Described herein are nucleic and amino acids sequences of HIV-1 envelopes. The sequences for use as immunogens are in any suitable form. In certain embodiments, the described HIV-1 envelope sequences are gp160s. In certain embodiments, the described HIV-1 envelope sequences are gp120s. Other sequences, for example but not limited to stable SOSIP trimer designs, gp145s, gp140s, both cleaved and uncleaved, gp140 Envs with the deletion of the cleavage (C) site, fusion (F) and immunodominant (I) region in gp41—named as gp140ΔCFI (gp140CFI), gp140 Envs with the deletion of only the cleavage (C) site and fusion (F) domain—named as gp140ΔCF (gp140CF), gp140 Envs with the deletion of only the cleavage (C)—named gp140ΔC (gp140C) (See e.g. Liao et al. Virology 2006, 353, 268-282), gp150s, gp41s, which are readily derived from the nucleic acid and amino acid gp160 sequences. In certain embodiments the nucleic acid sequences are codon optimized for optimal expression in a host cell, for example a mammalian cell, a rBCG cell or any other suitable expression system.
An HIV-1 envelope has various structurally defined fragments/forms: gp160; gp140—including cleaved gp140 and uncleaved gp140 (gp140C), gp140CF, or gp140CFI; gp120 and gp41. A skilled artisan appreciates that these fragments/forms are defined not necessarily by their crystal structure, but by their design and bounds within the full length of the gp160 envelope. While the specific consecutive amino acid sequences of envelopes from different strains are different, the bounds and design of these forms are well known and characterized in the art.
For example, it is well known in the art that during its transport to the cell surface, the gp160 polypeptide is processed and proteolytically cleaved to gp120 and gp41 proteins. Cleavages of gp160 to gp120 and gp41 occurs at a conserved cleavage site “REKR” (SEQ ID NO: 37). See Chakrabarti et al. Journal of Virology vol. 76, pp. 5357-5368 (2002) see for example
The role of the furin cleavage site was well understood both in terms of improving cleave efficiency, see Binley et al. supra, and eliminating cleavage, see Bosch and Pawlita, Virology 64 (5):2337-2344 (1990); Guo et al. Virology 174: 217-224 (1990); McCune et al. Cell 53:55-67 (1988); Liao et al. J Virol. April; 87(8):4185-201 (2013).
Likewise, the design of gp140 envelope forms is also well known in the art, along with the various specific changes which give rise to the gp140C (uncleaved envelope), gp140CF and gp140CFI forms. Envelope gp140 forms are designed by introducing a stop codon within the gp41 sequence. See Chakrabarti et al. at
Envelope gp140C refers to a gp140 HIV-1 envelope design with a functional deletion of the cleavage (C) site, so that the gp140 envelope is not cleaved at the furin cleavage site. The specification describes cleaved and uncleaved forms, and various furin cleavage site modifications that prevent envelope cleavage are known in the art. In some embodiments of the gp140C form, two of the R residues in and near the furin cleavage site are changed to E, e.g., RRVVEREKR (SEQ ID NO: 38) is changed to ERVVEREKE (SEQ ID NO: 39), and is one example of an uncleaved gp140 form. Another example is the gp140C form which has the REKR site (SEQ ID NO: 37) changed to SEKS (SEQ ID NO: 40). See supra for references.
Envelope gp140CF refers to a gp140 HIV-1 envelope design with a deletion of the cleavage (C) site and fusion (F) region. Envelope gp140CFI refers to a gp140 HIV-1 envelope design with a deletion of the cleavage (C) site, fusion (F) and immunodominant (I) region in gp41. See Chakrabarti et al. Journal of Virology vol. 76, pp. 5357-5368 (2002) see for example
In certain embodiments, the envelope design in accordance with the present invention involves deletion of residues (e.g., 5-11, 5, 6, 7, 8, 9, 10, or 11 amino acids) at the N-terminus. For delta N-terminal design, amino acid residues ranging from 4 residues or even fewer to 14 residues or even more are deleted. These residues are between the maturation (signal peptide, usually ending with CXX, X can be any amino acid) and “VPVXXXX . . . ” In one embodiments, CH0848.3.D0949.10.17 Delta11 gp120 is shown as an example in
The general strategy of deletion of N-terminal amino acids of envelopes results in proteins, for example gp120s, expressed in mammalian cells that are primarily monomeric, as opposed to dimeric, and, therefore, solves the production and scalability problem of commercial gp120 Env vaccine production. In other embodiments, the amino acid deletions at the N-terminus result in increased immunogenicity of the envelopes.
In certain embodiments, the invention provides envelope sequences, amino acid sequences and the corresponding nucleic acids, and in which the V3 loop is substituted with the following V3 loop sequence TRPNNNTRKSIRIGPGQTFY ATGDIIGNIRQAH (SEQ ID NO: 41). This substitution of the V3 loop reduced product cleavage and improves protein yield during recombinant protein production in CHO cells.
Soluble trimers comprising CH848 envelopes are contemplated by the invention and such trimer are contemplated for use in the methods of the invention. Various ways to form soluble envelope trimers are known in the art. See e.g. US Pub. 20100041875; US Pub 20110076298; US Pub. 20110250220; WO2016/037154, de Taeye et al. Cell. 2015 Dec. 17; 163(7): 1702-15. doi: 10.1016/j.cell.2015.11.056; Kwon et al. Nat Struct Mol Biol. 2015 July; 22(7):522-31. doi: 10.1038/nsmb.3051. Epub 2015 Jun. 22; Sharma et al. Cell Rep. 2015 Apr. 28; 11(4):539-50. doi: 10.1016/j.celrep.2015.03.047. Epub 2015 Apr. 16, Kong et al. in Nat Cormmun. 2016 Jun. 28; 7:12040. doi: 10.1038/ncomms12040, all of these publications are incorporated by reference in their entirety.
The invention provides new chimeric designs, for example but not limited to CH848.3.D0949.10.17CHIM. 6R. SOSIP. 664V4.1 (
Properties of the trimer complexes of the invention can be determined by any suitable assay used to characterize trimer envelope complexes. Antigenicity of the trimers, for example binding to HIV-1 antibodies, including but not limited to antibodies described in the invention, conformational state of the trimers, i.e., “open” or “closed”, immunogenicity can be determined by any suitable assay. For discussion on open versus closed envelope confirmation see de Taeye et al. Cell. 2015 Dec. 17; 163(7):1702-15; Munro et a; Science 7 Nov. 2014: Vol. 346, Issue 6210, pp. 759-763, DOI: 10.1126/science.1254426; Guttman et al., Nature Communications 6, Article number: 6144 doi:10.1038/ncomms7144.
In certain aspects, the invention provides composition and methods which use a selection of Envs, as gp120s, gp 140s cleaved and uncleaved, gp145s, gp150s and gp160s, as proteins, as monomers or trimers, as DNAs, as RNAs, or any combination thereof, administered as primes and boosts to elicit immune response. Envelopes as proteins could be co-administered with nucleic acid vectors containing Envs to amplify antibody induction. In certain embodiments, the compositions and methods include any immunogenic HIV-1 sequences to give the best coverage for T cell help and cytotoxic T cell induction. In certain embodiments, the compositions and methods include mosaic and/or consensus HIV-1 genes to give the best coverage for T cell help and cytotoxic T cell induction. In certain embodiments, the compositions and methods include mosaic group M and/or consensus genes to give the best coverage for T cell help and cytotoxic T cell induction. In some embodiments, the mosaic genes are any suitable gene from the HIV-1 genome. In some embodiments, the mosaic genes are Env genes, Gag genes, Pol genes, Nef genes, or any combination thereof. See e.g. U.S. Pat. No. 7,951,377. In some embodiments the mosaic genes are bivalent mosaics. In some embodiments the mosaic genes are trivalent. In some embodiments, the mosaic genes are administered in a suitable vector with each immunization with Env gene inserts in a suitable vector and/or as a protein. In some embodiments, the mosaic genes, for example as bivalent mosaic Gag group M consensus genes, are administered in a suitable vector, for example but not limited to HSV2, would be administered with each immunization with Env gene inserts in a suitable vector, for example but not limited to HSV-2.
In certain aspects the invention provides compositions and methods of Env genetic immunization either alone or with Env proteins to recreate the swarms of evolved viruses that have led to bnAb induction. Nucleotide-based vaccines offer a flexible vector format to immunize against virtually any protein antigen. Currently, two types of genetic vaccination are available for testing—DNAs and mRNAs.
In certain aspects the invention contemplates using immunogenic compositions wherein immunogens are delivered as DNA. See Graham B S, Enama M E, Nason M C, Gordon I J, Peel S A, et al. (2013) DNA Vaccine Delivered by a Needle-Free Injection Device Improves Potency of Priming for Antibody and CD8+ T-Cell Responses after rAd5 Boost in a Randomized Clinical Trial. PLoS ONE 8(4): e59340, page 9. Various technologies for delivery of nucleic acids, as DNA and/or RNA, so as to elicit immune response, both T-cell and humoral responses, are known in the art and are under developments. In certain embodiments, DNA can be delivered as naked DNA. In certain embodiments, DNA is formulated for delivery by a gene gun. In certain embodiments, DNA is administered by electroporation, or by a needle-free injection technologies, for example but not limited to Biojector® device. In certain embodiments, the DNA is inserted in vectors. The DNA is delivered using a suitable vector for expression in mammalian cells. In certain embodiments the nucleic acids encoding the envelopes are optimized for expression. In certain embodiments DNA is optimized, e.g. codon optimized, for expression. In certain embodiments the nucleic acids are optimized for expression in vectors and/or in mammalian cells. In non-limiting embodiments these are bacterially derived vectors, adenovirus based vectors, rAdenovirus (e.g. Barouch D H, et al. Nature Med. 16: 319-23, 2010), recombinant mycobacteria (e.g. rBCG or M smegmatis) (Yu, J S et al. Clinical Vaccine Immunol. 14: 886-093, 2007; ibid 13: 1204-11, 2006), and recombinant vaccinia type of vectors (Santra S. Nature Med. 16: 324-8, 2010), for example but not limited to ALVAC, replicating (Kibler K V et al., PLoS One 6: e25674, 2011 Nov. 9.) and non-replicating (Perreau M et al. J. virology 85: 9854-62, 2011) NYVAC, modified vaccinia Ankara (MVA)), adeno-associated virus, Venezuelan equine encephalitis (VEE) replicons, Herpes Simplex Virus vectors, and other suitable vectors.
In certain aspects the invention contemplates using immunogenic compositions wherein immunogens are delivered as DNA or RNA in suitable formulations. Various technologies which contemplate using DNA or RNA, or may use complexes of nucleic acid molecules and other entities to be used in immunization. In certain embodiments, DNA or RNA is administered as nanoparticles consisting of low dose antigen-encoding DNA formulated with a block copolymer (amphiphilic block copolymer 704). See Cany et al., Journal of Hepatology 2011 vol. 54 j 115-121; Amaoty et al., Chapter 17 in Yves Bigot (ed.), Mobile Genetic Elements: Protocols and Genomic Applications, Methods in Molecular Biology, vol. 859, pp 293-305 (2012); Arnaoty et al. (2013) Mol Genet Genomics. 2013 August; 288(7-8): 347-63. Nanocarrier technologies called Nanotaxi® for immunogenic macromolecules (DNA, RNA, Protein) delivery are under development. See for example technologies developed by Incellart. In certain embodiments, the nucleic acids, for e.g. mRNAs encoding immunogens of the invention, are delivered by a lipid nanoparticle (LNP) technology. In non-limiting embodiments, the LNPs could comprise four different lipids that could self assemble to 80-100 nm size particles.
In certain aspects the invention contemplates using immunogenic compositions wherein immunogens are delivered as recombinant proteins. Various methods for production and purification of recombinant proteins suitable for use in immunization are known in the art. In certain embodiments recombinant proteins are produced in CHO cells.
The immunogenic envelopes can also be administered as a protein boost in combination with a variety of nucleic acid envelope primes (e.g., HIV-1 Envs delivered as DNA expressed in viral or bacterial vectors).
Dosing of proteins and nucleic acids can be readily determined by a skilled artisan. A single dose of nucleic acid can range from a few nanograms (ng) to a few micrograms (g) or milligram of a single immunogenic nucleic acid. Recombinant protein dose can range from a few μg micrograms to a few hundred micrograms, or milligrams of a single immunogenic polypeptide.
Administration: The compositions can be formulated with appropriate carriers using known techniques to yield compositions suitable for various routes of administration. In certain embodiments the compositions are delivered via intramascular (IM), via subcutaneous, via intravenous, via nasal, via mucosal routes, or any other suitable route of immunization.
The compositions can be formulated with appropriate carriers and adjuvants using techniques to yield compositions suitable for immunization. The compositions can include an adjuvant, such as, for example but not limited to, alum, poly IC, MF-59 or other squalene-based adjuvant, ASO1B, or other liposomal based adjuvant suitable for protein or nucleic acid immunization. In certain embodiments, the adjuvant is GSK AS01E adjuvant containing MPL and QS21. This adjuvant has been shown by GSK to be as potent as the similar adjuvant AS01B but to be less reactogenic using HBsAg as vaccine antigen [Leroux-Roels et al., IABS Conference, April 2013, 9]. In certain embodiments, TLR agonists are used as adjuvants. In other embodiment, adjuvants which break immune tolerance are included in the immunogenic compositions.
In certain embodiments, the compositions are formulated such that the immunoges are comprises in nanoparticles. In some embodiments, these are lipid nanoparticle immunogens. In some embodiments, these are liposomes comprising immunogens. In some embodiments these are lipid nanodiscs. The immunogens could be arranged as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles. In non-limiting embodiment, the liposome comprises cholesterol, PC, PE, PA, or any combination thereof. See Alam et al. J Immunol. 2007 Apr. 1; 178(7):4424-35; Alam et al. J Virol. 2008 January; 82(1):115-25; Alam et al. Proc Natl Acad Sci USA. 2009 Dec. 1; 106(48):20234-9. doi: 10.1073/pnas.0908713106; Dennison et al. J Virol. 2009 October; 83(19):10211-23. doi: 10.1128/JVI.00571-09; Dennison et al. PLoS One. 2011; 6(11):e27824. doi: 10.1371/journal.pone. 0027824. In some embodiments, the lipid composition of lipid nanoparticle comprises cholesterol, POPC, sphingomyelin, or any combination thereof. In some embodiments, the lipids could comprise POPC, POPE, DMPA, cholesterol, or any combination thereof. In some embodiments, the ratio is POPC:POPE:DMPA:Cholesterol 45:25:20:1.33. In some embodiments, the protein to lipid ratio is about 1:3000. In some embodiments, the peptide to lipid ratio used provides 50-100 mer V3 peptide units per 100-200 nm lipid nanoparticle. In some embodiments the peptide:lipid ratio is 1:100. A skilled artisan can readily determine conditions and lipids to achieve different desired ratios.
In certain embodiments, the compositions and methods comprise any suitable agent or immune modulation which could modulate mechanisms of host immune tolerance and release of the induced antibodies. In non-limiting embodiments modulation includes PD-1 blockade; T regulatory cell depletion; anti-CD25 antibodies; CD40L hyperstimulation; anti-CTLA4 antibodies; soluble antigen administration, wherein the soluble antigen is designed such that the soluble agent eliminates B cells targeting dominant epitopes, or a combination thereof. In certain embodiments, an immunomodulatory agent is administered in at time and in an amount sufficient for transient modulation of the subject's immune response so as to induce an immune response which comprises broad neutralizing antibodies against HIV-1 envelope. Non-limiting examples of such agents is any one of the agents described herein: e.g. chloroquine (CQ), PTP1B Inhibitor—CAS 765317-72-4—Calbiochem or MSI 1436 clodronate or any other bisphosphonate; a Foxo1 inhibitor, e.g. 344355|Foxo1 Inhibitor, AS1842856—Calbiochem; Gleevac, anti-CD25 antibody, anti-CCR4 Ab, an agent which binds to a B cell receptor for a dominant HIV-1 envelope epitope, or any combination thereof. In non-limiting embodiments, the modulation includes administering an anti-CTLA4 antibody. Non-limiting examples are ipilimumab and tremelimumab. In certain embodiments, the methods comprise administering a second immunomodulatory agent, wherein the second and first immunomodulatory agents are different.
It is readily understood that the envelope glycoproteins referenced in various examples and figures comprise a signal/leader sequence. It is well known in the art that HIV-1 envelope glycoprotein is a secretory protein with a signal or leader peptide sequence that is removed during processing and recombinant expression (without removal of the signal peptide, the protein is not secreted). See for example Li et al. Control of expression, glycosylation, and secretion of HIV-1 gp120 by homologous and heterologous signal sequences. Virology 204(1):266-78 (1994) (“Li et al. 1994”), at first paragraph, and Li et al. Effects of inefficient cleavage of the signal sequence of HIV-1 gp120 on its association with calnexin, folding, and intracellular transport. PNAS 93:9606-9611 (1996) (“Li et al. 1996”), at 9609. Any suitable signal sequence could be used. In some embodiments the leader sequence is the endogenous leader sequence. Most of the gp120 and gp160 amino acid sequences include the endogenous leader sequence. In other non-limiting examples the leaders sequence is human Tissue Plasminogen Activator (TPA) sequence, human CD5 leader sequence (e.g. MPMGSLQPLATLYLLGMLVASVLA (SEQ ID NO: 42)). Most of the chimeric designs include CD5 leader sequence. A skilled artisan appreciates that when used as immunogens, and for example when recombinantly produced, the amino acid sequences of these proteins do not comprise the leader peptide sequences.
The invention is directed to HIV-1 envelope immunogens which comprises changes in the amino acid sequence of glycosylation sites such that the envelope is partially deglycosylated. In certain embodiments deglycosylation is in the V1 loop of the HIV-1 envelope. In certain embodiments these changes are at positions N133, N138, N156, N301, N332, or any combination thereof. In certain embodiments where the envelope is deglycosylated at positions N133 and/or N138, the envelope is not glycosylated at positions N301 and N332. Position number given with respect to HXB2. Any suitable amino acid change is contemplated so longs as glycosylation at that position is abolished. Non-limiting embodiments include amino acids which are naturally occurring at the respective position in other envelopes and the envelopes are deglycosylated. Non-limiting amino acid changes include change to alanine, or any of the following: N133D, N138T, N301A, N301S, N332A, N332T. Any envelope form, e.g. but not limited to stabilized SOSIP trimer designs, gp140s, etc. could be designed to comprise deglycosylation mutations. In some embodiments, the envelope is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T. In other embodiments, the envelope is CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T and further comprises N301mut.
The invention provides compositions comprising these deglycosylated envelopes. The invention provides methods of inducing immune response in a subject comprising administering compositions comprising deglycosylated envelopes. In some embodiments these deglycosylated envelopes are administered as a prime. In some embodiments, the prime could be a nucleic acid encoding a deglycosylated The glycosylated envelopes could also be administered as a boost.
The invention is described in the following non-limiting examples.
Nomenclature for trimers: chim.6R.DS.SOSIP.664 is SOSIP.I CHIM.6R.SOSIP.664 is SOSIP.II; CHIM.6R.SOSIP.664V4.1 is SOSIP.III. Additional designs of envelopes deglycosylated in the V1 loop are also contemplated and covered by the invention. Using the sequence information, annotations and listing of amino acid positions and changes, a skilled artisan can envision additional envelopes based on the sequence of CH848.3.D0949.10.17.
Non-limiting embodiments include chimeric trimer designs, which could comprise portions of BG505 envelope.
The following specific examples are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. Without further elaboration, it is believed that one skilled in the art can, based on the description herein, utilize the present invention to its fullest extent.
Stages of V3-glycan neutralizing antibody maturation are identified that explain the long duration required for their development.
Abstract
A preventive HIV-1 vaccine should induce HIV-1 specific broadly neutralizing antibodies (bnAbs). However, bnAbs generally require high levels of somatic hypermutation (SHM) to acquire breadth and current vaccine strategies have not been successful in inducing bnAbs. Since bnAbs directed against a glycosylated site adjacent to the third variable loop (V3) of the HIV-1 envelope protein require limited SHM, the V3 glycan epitope is a desirable vaccine target. By studying the cooperation among multiple V3-glycan B-cell lineages and their co-evolution with autologous virus throughout 5 years of infection, we identify here key events in the ontogeny of a V3-glycan bnAb. Two autologous neutralizing antibody lineages selected for virus escape mutations and consequently allowed initiation and affinity maturation of a V3-glycan bnAb lineage. The nucleotide substitution required to initiate the bnAb lineage occurred at a low probability site for activation-induced cytidine deaminase activity. Cooperation of B-cell lineages and an improbable mutation critical for bnAb activity define the necessary events leading to V3-glycan bnAb development, explain why initiation of V3-glycan bnAbs is rare, and suggest an immunization strategy for inducing V3-glycan bnAbs.
Introduction
A vaccine to prevent HIV-1 infection should include immunogens that can induce broadly neutralizing antibodies (bnAbs) (1, 2). Of the five major targets for bnAbs, the glycan-rich apex of the HIV-1 envelope (Env) trimer and the base of the third variable loop (V3) are distinguished by the potency of antibodies directed against them (3-8). Although these antibodies have less breadth than those directed against the CD4 binding site (CD4bs) or the gp41 membrane-proximal region (MPER), one current goal of vaccine development is to elicit them in combination with other bnAb specificities to achieve broad coverage of transmitted/founder (TF) viruses to prevent HIV-1 integration upon exposure (1, 2).
Mapping the co-evolution of virus and antibody lineages over time informs vaccine design by defining the succession of HIV-1 Env variants that evolve in vivo during the course of bnAb development (9-11). Antibody lineages with overlapping specificities can influence each other's affinity maturation by selecting for synergistic or antagonistic escape mutations: an example of such “cooperating” lineages is provided by two CD4bs-directed bnAbs that we characterized previously (11, 12). Thus, cooperating antibody lineages and their viral escape mutants allow identification of the specific Envs, among the diverse repertoire of mutated Envs that develop within the autologous quasi-species in the infected individual, that stimulate bnAb development and that we wish to mimic in a vaccine.
Here we describe the co-evolution of an HIV-1 Env quasispecies and a memory B-cell lineage of gp120 V3-glycan directed bnAbs in an acutely infected individual followed over time as broadly neutralizing plasma activity developed. To follow virus evolution, we sequenced ˜1,200 HIV-1 env genes sampled over a 5 year period; to follow the antibody response, we identified natural heavy- and light-chain pairs of six antibodies from a bnAb lineage, designated DH270, and augmented this lineage by next generation sequencing (NGS). Structural studies defined the position of the DH270 Fab on gp140 Env. We also found two B-cell lineages (DH272 and DH475) with neutralization patterns that likely selected for observed viral escape variants, which in turn stimulated the DH270 lineage to potent neutralization breadth. We found a mutation in the DH270 heavy chain that occurred early in affinity maturation at a disfavored activation-induced cytidine deaminase (AID) site and that was necessary for bnAb lineage initiation. This improbable mutation can explain the long period of antigenic stimulation needed for initial expansion of the bnAb B-cell lineage in this individual.
Results
Three N332 V3-Glycan Dependent Antibody Lineages
We studied an African male from Malawi (CH848) followed from the time of infection to 5 years post-transmission. He was infected with a clade C virus, developed plasma neutralization breadth 3.5 years post-transmission and did not receive antiretroviral therapy during this time as per country treatment guidelines. Reduced plasma neutralization of N332A Env-mutated HIV-1 pseudoviruses and plasma neutralization fingerprinting demonstrated the presence of N332-sensitive broadly neutralizing antibodies (bnAbs) (
DH270 antibodies were recovered from memory B cells at all three sampling times (weeks 205, 232, and 234) and expansion of the clone did not occur until week 186 (
The DH475 mAb was recovered from memory B cells at week 232 post-transmission by antigen-specific sorting using the fluorophore-labeled Man9-V3 glycopeptide (16). The earliest DH475 lineage VHDJH rearrangements were identified with NGS at week 64 post-transmission (
The DH272 mAb came from cultured memory B cells obtained at week 205 post-transmission. DH272 lineage VHDJH rearrangements were detected as early as 19 weeks post-transmission by NGS (
For both DH272 and DH475 lineages, binding to CH848 TF Env gp120 depended on the N332 potential N-linked glycosylation (PNG) site (
Evolution of the CH848 Virus Quasispecies
We sequenced 1,223 HIV-1 3′-half single-genomes from virus in plasma collected at 26 time points over 246 weeks. Analysis of sequences from the earliest plasma sample indicated that CH848 had been infected with a single, subtype clade C founder virus, ˜17 (CI 14-19) days prior to screening (
Simultaneously with the first detection of DH270 lineage antibodies at week 186, four autologous virus clades emerged that defined distinct immunological resistance profiles of the CH848 autologous quasispecies (
Ontogeny of DH270 Lineage and Acquisition of Neutralization Breadth
As with other V3-glycan bnAbs, viral neutralization clade specificity and intra-clade breadth of DH270 depended primarily on the frequency of the N332 glycosylation site within the relevant clade (
Heterologous breadth and potency of DH270 lineage antibodies increased with accumulation of VH mutations and although DH270.UCA did not neutralize heterologous HIV-1, five amino-acid substitutions in DH270.IA.4 (four in the heavy chain, one in the light chain) were sufficient to initiate the bnAb lineage and confer heterologous neutralization (
The capacity of the early DH270 lineage members to neutralize heterologous viruses correlated with the presence of short V1 loops (
Mutations in the DH270 Antibody Lineage that Initiated Heterologous Neutralization
The likelihood of AID-generated somatic mutation in immunoglobulin genes has strong nucleotide-sequence dependence (20)(21). Moreover, we have recently shown for CD4bs bnAbs that VH sites of high intrinsic mutability indeed determine many sites of somatic hypermutation (11). Like the VRC01-class CD4bs bnAbs, both DH270 and DH272 used VH1-2*02 although unlike the CD4bs bnAbs, V3 glycan bnAbs in general can use quite disparate VH gene segments (3, 17, 22-25), and antibodies in both lineages have mutations at the same amino acid positions that correspond to sites of intrinsic mutability that we identified in the VH1-2*02 CD4bs bnAbs (11) (
Presence of the canonical VH1-2*02 allele in individual CH848 was confirmed by genomic DNA sequencing (
The G31D and M31I substitutions that occurred in AID hotspots became fixed in both lineages and S55T eventually became prevalent also in the DH272 lineage (
Since the rare G169C nucleotide mutation in DH270.IA4 introduced a cold spot and simultaneously disrupted the overlapping AID hotspot, it had a high probability once it occurred of being maintained, and indeed it was present in 523/758 (68%) DH270 lineage VH sequences identified with NGS at week 186 post-transmission (
Reversion of Arg57 to Gly abrogated DH270.IA4 neutralization of autologous and heterologous HIV-1 isolates (
A search for an Env that might select for the critical G57R mutation in DH270 UCA or IA4-like antibodies yielded Env 10.17 from week 135 of infection (
Autologous Neutralizing Antibody Lineages that Cooperated with DH270
Evidence for functional interaction among the three N332-dependent lineages came from the respective neutralization profiles against a panel of 90 autologous viruses from transmitted/founder to week 240 post-transmission (
The identification of specific mutations implicated in the switch of virus sensitivity was complicated by the high levels of mutations accumulated by virus Env over time (
The large V1 deletion was critical for DH270.1 neutralization, with smaller contributions from the other changes; the V1 deletion increased virus resistance to DH475 (3.5-fold increase). V1-loop-mediated resistance to DH475 neutralization increased further when combined with the Δ463-464 V5 deletion (5-fold increase) (
The V1 loop of the transmitted/founder virus (34 residues) was longer than the average V1 length of 28 residues (range 11 to 64) of HIV-1 Env sequences found in the Los Alamos Sequence Database (26). As we found for heterologous neutralization, DH270 lineage antibodies acquired the ability to neutralize larger fractions of autologous viruses as maturation progressed by gaining activity for viruses with longer V1 loops, although at the expense of lower potency (
For DH272, the viral variants that we made did not implicate a specific cooperating escape mutation. The Δ134-143 (V1 deletion) mutated virus remained sensitive to DH272 neutralization; both combinations of the V1 deletion in our panel that were resistant to DH272 and sensitive to DH270.1 included D185N, which on its own also caused DH272 resistance but did not lead to DH270.1 sensitivity (
Structure of DH270 Lineage Members
We determined crystal structures for the single-chain variable fragment of DH270.1 and the Fabs of DH270.UCA3, DH270.3, DH270.5 and DH270.6, as well as for DH272 (
We also compared the structures of DH270 lineage members with those of other N332-dependent bnAbs. All appear to have one long CDR loop that can extend through the network of glycans on the surface of the gp120 subunit and contact the “shielded” protein surface. The lateral surfaces of the Fab variable module can then interact with the reconfigured or displaced glycans to either side. PGT128 has a long CDRH2 (
Structure of the DH270—HIV Env Complex
We determined a three-dimensional (3D) image reconstruction, from negative-stain electron microscopy (EM), of the DH270.1 Fab bound with a gp140 trimer (92Br SOSIP.664) (
DH270 UCA Binding
The DH270 UCA did not bind to any of the 120 CH848 autologous gp120 Env glycoproteins isolated from time of infection to 245 weeks post-infection, including the TF Env (
We can reconstruct from the data presented here a plausible series of events during the development of a V3-glycan bnAb in a natural infection. The DH272 and DH475 lineages neutralized the autologous TF and early viruses, and the resulting escape viruses were neutralized by the DH270 lineage. In particular, V1 deletions were necessary for neutralization of all but the most mature DH270 lineage antibodies. DH475 (and possibly DH272) escape variants stimulated DH270 affinity maturation, including both somatic mutations at sites of intrinsic mutability (11) and a crucial, improbable mutation at an AID cold spot within CDRH2 (G57R). The G57R mutation initiated expansion of the DH270 bnAb lineage. The low probability of this heterologous neutralization-conferring mutation and the complex lineage interactions that occurred is one explanation for why it took 4.5 years for the DH270 lineage to expand.
The CH848 viral population underwent a transition from a long V1 loop in the TF (34 residues) to short loops (16-17 residues) when escaping DH272/DH475 and facilitating expansion of DH270, to restoration of longer V1 loops later in infection as resistance to DH270 intermediates developed. Later DH270 antibodies adapted to viruses with longer V1 loops, allowing recognition of a broader spectrum of Envs and enhancing breadth. DH270.6 could neutralize heterologous viruses regardless of V1 loop length, but viruses with long loops tended to be less sensitive to it. Association of long V1 loops with reduced sensitivity was evident for three other V3 glycan bnAbs isolated from other individuals and may be a general feature of this class.
The V1 loop deletions in CH848 autologous virus removed the PNG site at position 137. While the hypervariable nature of the V1 loop (which evolves by insertion and deletion, resulting in extreme length heterogeneity, as well as extreme variation in number of PNG sites) complicates the interpretation of direct comparisons among unrelated HIV-1 strains, it is worth noting that a PNG in this region specified as N137 was shown to be important for regulating affinity maturation of the PGT121 V3 glycan bnAb family, with some members of the lineage evolving to bind (PGT121-123) and others (PGT124) to accommodate or avoid this glycan (29).
Since we cannot foresee the susceptibility to a particular bnAb lineage of each specific potential transmitted/founder virus to which vaccine recipients will be exposed, it will be important for a vaccine to induce bnAbs against multiple epitopes on the HIV-1 Env to minimize transmitted/founder virus escape (30, 31). In particular, induction of bnAb specificities beyond the HIV-1 V3 glycan epitope is critical for use in Asian populations where CRF01 strains, which lack for the most part the N332 PNG required for efficient neutralization by V3 glycan bnAbs, is frequently observed.
Regarding what might have stimulated the UCA of the DH270 bnAb lineage, the absence of detectable binding to the CH848 TF Env raised at least two possibilities. One is that the lineage arose at the end of year 1, either from a primary response to viruses present at that time (e.g., with deletions in V1-V2) or from subversion of an antibody lineage initially elicited by some other antigen. The other is that some altered form of the CH848 TF envelope protein (e.g. shed gp120, or a fragment of it) exposed the V3 loop and the N301 and N332 glycans in a way that bound and stimulated the germline BCR, even though the native CH848 TF Env did not. Our findings suggest that a denatured, fragmented or otherwise modified form of Env may have initiated the DH270 lineage. We cannot exclude that the DH270 UCA could not bind to autologous Env as an IgG but could potentially be triggered as an IgM B cell receptor (BCR) on a cell surface.
It will be important to define how often an improbable mutation such as G57R determines the time it takes for a bnAb lineage in an HIV-1 infected individual to develop, and how many of the accompanying mutations are necessary for potency or breadth rather than being non-essential mutations at AID mutational hotspots (11, 32). Mutations of the latter type might condition the outcome or modulate the impact of a key, improbable mutation, without contributing directly to affinity. Should the occurrence of an unlikely mutation be rate-limiting for breadth or potency in many other cases, a program of rational immunogen design will need to focus on modified envelopes most likely to select very strongly for improbable yet critical antibody nucleotide changes
The following proposal for a strategy to induce V3 glycan bnAbs recreates the events that led to bnAb induction in CH848: start by priming with a ligand that binds the bnAb UCA, such as the synthetic glycopeptide mimic of the V3-glycan bnAb gp120 epitope, then boost with an Env that can select G57R CDR H2 mutants, followed by Envs with progressive V1 lengths (
A limitation of this approach is that the selection of immunogens was based on the analysis of a single lineage from a single individual and how frequently DH270-like lineages are present in the general population is unknown. Finally, our study describes a general strategy for the design of vaccine immunogens that can select specific antibody mutations thereby directing antibody lineage maturation pathways.
Material and Methods
Study Design. The CH848 donor, from which the DH270, DH272 and DH475 antibody lineages were isolated, is an African male enrolled in the CHAVI001 acute HIV-1 infection cohort (33) and followed for 5 years, after which he started antiretroviral therapy. During this time viral load ranged from 8,927 to 442,749 copies/ml (median=61,064 copies/ml), and CD4 counts ranged from 288 to 624 cells/mm3 (median=350 cells/mm3). The time of infection was estimated by analyzing the sequence diversity in the first available sample using the Poisson Fitter tool as described in (10). Results were consistent with a single founder virus establishing the infection (34).
MAbs DH270.1 and DH270.3 were isolated from cultured memory B cells isolated 205 weeks post-transmission (14). DH270.6 and DH475 mAbs were isolated from Man9-V3 glycopeptide-specific memory B cells collected 232 and 234 weeks post-transmission, respectively, using direct sorting. DH270.2, DH270.4 and DH270.5 mAbs were isolated from memory B cells collected 232 weeks post-transmission that bound to Consensus C gp120 Env but not to Consensus C N332A gp120 Env using direct sorting
Statistical Analyses. Statistical analysis was performed using R. The specific tests used to determine significance are reported for each instance in the text.
Flow Cytometry, Memory B Cell Cultures and mAb Isolation
A total of 30,700 memory B cells from individual CH848 were isolated from PBMC collected 205 weeks post-transmission using magnetic-activated cell sorting as described in (14). Memory B cells were cultured at limiting dilution at a calculated concentration of 2 cells/well for 2 weeks as described in (11) using irradiated CD40L L cells (7,500 cGy) as feeder cells at a concentration of 5,000 cells/well; culture medium was refreshed 7 days after plating. Cell culture supernatants were screened for neutralization of autologous CH848.TF virus using the tzm-bl neutralization assay (14) and for binding to CH848.TF gp120 Env, CH848.TF gp140 Env, Consensus C gp120 Env and consensus C N332A gp120 Env. Concurrently, cells from each culture were transferred in RNAlater (Qiagen) and stored at −80° C. until functional assays were completed.
MAbs DH270.1 and DH270.3 were isolated from cultures that bound to CH848.TF gp120 Env and Consensus C gp120 but did not bind to C N332A gp120 Env. DH272 was isolated from a culture that neutralized 99% CH848.TF virus infectivity. DH272 dependency to N332-linked glycans was first detected on the transiently transfected recombinant antibody tested at higher concentration and confirmed in the purified recombinant antibody. From the stored RNAlater samples, mRNA of cells from these cultures was extracted and retrotranscribed as previously described (14).
DH270.6 and DH475 mAbs were isolated from Man9-V3 glycopeptide-specific memory B cells collected 232 and 234 weeks post-transmission, respectively, using direct sorting (16). Briefly, biotinylated Man9-V3 peptides were tetramerized via streptavidin that was conjugated with either AlexaFluor 647 (AF647; ThermoScientific) or Brilliant Violet 421 (BV421) (Biolegend) dyes. Peptide tetramer quality following conjugation was assessed by flow cytometry to a panel of well-characterized HIV-1 V3 glycan antibodies (PGT128, and 2G12) and linear V3 antibodies (F39F) attached to polymer beads. PBMCs from donor CH848 were stained with LIVE/DEAD Fixable Aqua Stain (ThermoScientific), anti-human IgM (FITC), CD3 (PE-Cy5), CD235a (PE-Cy5), CD19 (APC-Cy7), and CD27 (PE-Cy7) (BD Biosciences); anti-human antibodies against IgD (PE); anti-human antibodies against CD10 (ECD), CD38 (APC-AF700), CD19 (APC-Cy7), CD16 (BV570), CD14 (BV605) (Biolegend); and Man9GlcNac2 V3 tetramer in both AF647 and BV421. PBMCs that were Aqua Stain−, CD14−, CD16−, CD3−, CD235a−, positive for CD19+, and negative for surface IgD were defined as memory B cells; these cells were then gated for Man9-V3+ positivity in both AF647 and BV421, and were single-cell sorted using a BD FACS Aria II into 96-well plates containing 20l of reverse transcriptase buffer (RT).
DH270.2, DH270.4 and DH270.5 mAbs were isolated from memory B cells collected 232 weeks post-transmission that bound to Consensus C gp120 Env but not to Consensus C N332A gp120 Env using direct sorting. Reagents were made using biotinylated Consensus C gp120 Env and Consensus C N332A gp120 Env by reaction with streptavidin that was conjugated with either AlexaFluor 647 (AF647; ThermoScientific) or Brilliant Violet 421 (BV421) (Biolegend) dyes, respectively. Env tetramer quality following conjugation was assessed by flow cytometry to a panel of well-characterized HIV-1 V3 glycan antibodies (PGT128, and 2G12) and linear V3 antibodies (F39F) attached to polymer beads. PBMCs were stained as outlined for DH475 and DH270.6, however these cells were then gated for Consensus C gp120 positivity and Consensus C N332A gp120 negativity in AF647 and BV421, respectively, and were single cell sorted and processed as outlined for DH475 and DH270.6.
For all antibodies, cDNA synthesis, PCR amplification, sequencing and V(D)J rearrangement analysis were conducted as previously described (11). Reported mutation frequency is calculated as frequency of nucleotide mutations in the V gene region of antibody sequence. CDRH3 lengths reported are defined as the number of residues after the invariant Cys in FR3 and before the invariant Trp in FR4.
Antibody Production
Immunoglobulin genes of mAbs DH270.1 through DH270.6, DH272 and DH475 were amplified from RNA from isolated cells, expression cassettes made, and mAbs expressed as described (12, 14). Inference of unmutated common ancestor (UCA) and intermediate antibodies DH270.IA1 through DH270.IA4 was conducted using methods previously described (36).
Heavy chain plasmids were co-transfected with appropriate light chain plasmids at an equal ratio in Expi 293 cells using ExpiFectamine 293 transfection reagents (Thermo Fisher Scientific) according to the manufacturer's protocols. We used the enhancer provided with the kit, transfected cultures were incubated at 37° C. 8% C02 for 2-6 days, harvested, concentrated and incubated overnight with Protein A beads at 4° C. on a rotating shaker before loading the bead mixture in columns for purification; following PBS/NaCl wash, eluate was neutralized with trizma hydrochloride and antibody concentration was determined by Nanodrop. Purified antibodies were tested in SDS-Page Coomassie and western blots, and stored at 4° C.
Next-Generation Sequencing
PBMC-extracted RNA from weeks 11, 19, 64, 111, 160, 186, and 240 post-infection were used to generate cDNA amplicons for next-generation sequencing (Illumina Miseq) as described previously (35). Briefly, RNA isolated from PBMCs was separated into two equal aliquots before cDNA production; cDNA amplification and NGS were performed on both aliquots as independent samples (denoted A and B). Reverse transcription (RT) was carried out using human IgG, IgA, IgM, IgK and IgX primers as previously described (12). After cDNA synthesis, IgG isotype IGHV1 and IGHV3 genes were amplified separately from weeks 11, 19, 64, 111, 160, and 186. IGHV1-IGHV6 genes were amplified at week 240. A second PCR step was performed to add Nextera index sequencing adapters (Illumina) and libraries were purified by gel extraction (Qiagen) and quantified by quantitative PCR using the KAPA SYBR FAST qPCR kit (KAPA Biosystems). Each replicate library was sequencing using the Illumina Miseq V3 2×300 bp kit.
NGS reads were computationally processed and analyzed as previously described (35). Briefly, forward and reverse reads were merged with FLASH with average read length and fragment read length parameters set to 450 and 300, respectively. Reads were quality filtered using FASTX (hannonlab.cshl.edu/fastx toolkit/) for sequences with a minimum of 50 percent of bases with a Phred quality score of 20 or greater (corresponding to 99% base call accuracy). Primer sequences were discarded and only unique nucleotide sequences were retained. To mitigate errors introduced during PCR amplification, reads detected in sample A and B with identical nucleotide VHDJH rearrangement sequences were delineated as replicated sequences. The total number of unique reads per sample and total number of replicated sequences (“Overlap”) across samples for each time point is listed in
We identified clonally-related sequences to DH270, DH272 and DH475 from the longitudinal NGS datasets by the following procedure. First, the CDR H3 of the probe-identified clonal parent sequence was BLASTed (E-value cutoff=0.01) against the pooled sample A and B sequence sets at each time point to get a candidate set of putative clonal members (“candidate set”). Next we identified replicated sequences across samples A and B in the candidate set. We then performed a clonal kinship test with the Cloanalyst software package (computationalimmunology/research/software/) as previously described (35) on replicated sequences. Clonally-related sequences within Sample A and B (including non-replicated sequences) were identified by performing the same clonal kinship test with Cloanalyst on the candidate set prior to identifying replicated sequences.
Clonal lineage reconstruction was performed on the NGS replicated sequences and probe-identified sequences of each clone using the Cloanalyst software package. A maximum of 100 sequences were used as input for inferring phylogenetic trees of clonal lineages. Clonal sequence sets were sub-sampled down to 100 sequences by collapsing to one sequence within a 2 or 9 base pair difference radius for the DH272 and DH270 clones, respectively.
The pre-vaccination NGS samples that were analyzed in
Sequence Analysis of Antibody Clonal Lineages
Unmutated common ancestors (UCA) and ancestral intermediate sequences were computationally inferred with the Cloanalyst software package. Cloanalyst uses Bayesian inference methods to infer the full unmutated V(D)J rearrangement thereby including a predicted unmutated CDR3 sequence. For lineage reconstructions when only cultured or sorted sequences were used as input, the heavy and light chain pairing relationship was retained during the inference of ancestral sequences. UCA inferences were performed each time a new member of the DH270 clonal lineage was experimentally isolated and thus several versions of the DH270 UCA were produced and tested. UCA1 and UCA3 were used for structural determination. UCA4 (referred to as DH270.UCA throughout the text), which was inferred using the most observed DH270 clonal members and had the lowest uncertainty of UCAs inferred (as quantified by the sum of the error probability over all base positions in the sequence), was used for binding and neutralization studies. Subsequently, the DH270 UCA was also re-inferred when NGS data became available. We applied a bootstrapping procedure to infer the UCA with the NGS data included, resampling clonal lineage trees 10 times with 100 input NGS sequences each. The UCA4 amino acid sequence was recapitulated by 7 out of 10 UCA inferences of the resampled NGS trees confirming support for UCA4.
Each inference of V(D)J calls is associated with a probability. The probability of the DH270 lineage to use the VH1-2 family gene was 99.99% and that of using allele 02 (VH1-2*02) was 98.26%. Therefore, there was a 0.01% probability that the family was incorrectly identified and a 1.74% probability that the allele was incorrectly identified. Therefore, we sequenced genomic DNA of individual CH848. As previously reported, positional conformity is defined as sharing a mutation at the same position in the V gene segment and identity conformity as sharing the same amino acid substitution at the same position (11).
We refer to the widely established AID hot and cold spots (respectively WRCY and SYC and their reverse-complements) as “canonical” and to other hot and cold spots defined by Yaari et al. as “non-canonical” (20, 37-39).
Sequencing of Germline Variable Region from Genomic DNA
Genomic DNA was isolated from donor CH848 from PBMCs 3 weeks after infection (QIAmp DNA Blood mini kit; Qiagen). IGVH1-2 and IGVL2-23 sequences were amplified using 2 independent primer sets by PCR. To ensure amplification of non-rearranged variable sequences, both primer sets reverse primers aligned to sequences present in the non-coding genomic DNA downstream the V-recombination site. The forward primer for set 1 resided in the IGVH1-2 and IGVL2-23 leader sequences and upstream of the leader in set 2. The PCR fragments were cloned into a pcDNA2.1 (TOPO-TA kit; Life technologies) and transformed into bacteria for sequencing of individual colonies. The following primers were used: VH1-2_1_S: tcctcttcttggtggcagcag (SEQ ID NO: 43); VH1-2_2_S: tacagatctgtcctgtgccct (SEQ ID NO: 44); VH1-2_1_tmAS: ttctcagccccagcacagctg (SEQ ID NO: 45); VH1-2_2_TmAS: gggtggcagagtgagactctgtcaca (SEQ ID NO: 46); VL2-23_2_S: agaggagcccaggatgctgat (SEQ ID NO: 47); VL2-23_1_S: actctcctcactcaggacaca (SEQ ID NO: 48); VL2-23_1_AS: tctcaaggccgcgctgcagca (SEQ ID NO: 49); VL2-23_2_AS: agctgtccctgtcctggatgg (SEQ ID NO: 50).
We identified two variants of VH1-2*02: the canonical sequence and a variant that encoded a VH that differed by 9 amino acids. Of these 9 amino acids, only 1 was shared among DH270 antibodies whereas 8 amino acids were not represented in DH270 lineage antibodies (
Direct Binding ELISA
Direct-binding ELISAs were performed as described (11). Briefly, 384-well plates were blocked for 1 h at room temperature (RT) or overnight at 4° C. (both procedures were previously validated); primary purified antibodies were tested at a starting concentrations of 100 g/ml, serially three-fold diluted and incubated for 1 h at RT; HRP-conjugated human IgG antibody was added at optimized concentration of 1:30,000 in assay diluent for 1 hour and developed using TMB substrate; plates were read at 450 nm in a SpectraMax 384 PLUS reader (Molecular Devices, Sunnyvale, Calif.); results are reported as logarithm area under the curve (Log AUC) unless otherwise noted.
For biotinylated avi-tagged antigens, plates were coated with streptavidin (2 g/ml); blocked plates were stored at −20° C. until used and biotinylated avi-tagged antigens were added at 2 μg/ml for 30 minutes at RT.
Competition ELISAs were performed using 10 μl of primary purified monoclonal antibody, starting at 100 μg/ml and diluted in a two-fold concentration, incubated for 1 h at RT. Ten μl of biotinylated target Mab was added at the EC50 determined by a direct binding of biotinylated-Mab for one hour at RT. After background subtractions, percent inhibition was calculated as follows: 100-(test Ab triplicate mean/no inhibition control mean)*100.
Assessment of Virus Neutralization
Antibody and plasma neutralization was measured in TZM-bl cell-based assays. Neutralization breadth of DH270.1, DH270.5 and DH270.6 was assessed using the 384-well plate declination of the assay using an updated panel of 207 geographically and genetically diverse Env-pseudoviruses representing the major circulating genetic subtypes and recombinant forms as described (40). The data were calculated as a reduction in luminescence units compared with control wells, and reported as IC50 in μg/ml.
Single Genome Sequencing and Pseudovirus Production
3′ half genome single genome sequencing of HIV-1 from longitudinally collected plasma was performed as previously described (41, 42). Sequence alignment was performed using ClustalW (version 2.11) and was adjusted manually using Geneious 8 (version 8.1.6). Env amino acid sequences were then aligned and evaluated for sites under selection using code derived from the Longitudinal Antigenic Sequences and Sites from Intra-host Evolution (LASSIE) tool (43). Using both LASSIE-based analysis and visual inspection, 100 representative env genes were selected for pseudovirus production. CMV promoter-ligated env genes were prepared and used to generate pseudotyped viruses as previously described (44).
Generation of Cell Surface-Expressed CH848 Env Trimer CHO Cell Line
The membrane-anchored CH848 TF Env trimer was expressed in CHO—S cells. Briefly, the CH848 env sequence was codon-optimized and cloned into an HIV-1-based lentiviral vector. A heterologous signal sequence from CD5 was inserted replacing that of the HIV-1 Env. The proteolytic cleavage site between gp120 and gp41 was altered, substituting serine residues for Arg508 and Arg511, the tyrosine at residues 712 was changed to alanine (Y712A), and the cytoplasmic tail was truncated by replacing the Lys808 codon with a sequence encoding (Gly)3 (His)6 (SEQ ID NO: 51) followed immediately by a TAA stop codon. This env-containing sequences was inserted into the vector immediately downstream of the tetracycline (tet)-responsive element (TRE), and upstream of an internal ribosome entry site (IRES) and a contiguous puromycin (puro)-T2A-EGFP open reading frame (generating K4831), as described previously for the JRFL and CH505 Envs (45).
CHO—S cells (Invitrogen) modified to constitutively express the reverse tet transactivator (rtTA) were transduced with packaged vesicular stomatitis virus (VSV) G glycoprotein-pseudotyped CH848 Env expression vector. Transduced cells were incubated in culture medium containing 1 μg/ml of doxycycline (dox) and selected for 7 days in medium supplemented with 25 μg/ml of puromycin, generating the Env expressor-population cell line termed D831. From D831, a stable, high-expressor clonal cell line was derived, termed D835. The integrity of the recombinant env sequence in the clonal cell lines was confirmed by direct (without cloning) sequence analysis of PCR amplicons.
Cell Surface-Expressed Trimeric CH848 Env Binding
D831 Selected TRE2.CH848.JF-8.IRS6A Chinese Hamster Ovary Cells were cultured in DMEM/F-12 supplemented with HEPES and L-glutamine (Thermo Fischer, Cat #11330057) 10% heat inactivated fetal bovine serum [FBS] (Thermo Fischer, Cat #10082147) and 1% Penicillin-Streptomycin (Thermo Fischer, Cat #15140163) and harvested when 70-80% confluent by trypsinization. A total 75,000 viable cells/well were transferred in 24-well tissue culture plates. After a 24-to-30-hour incubation at 37° C./5% CO2 in humidified atmosphere, CH848 Envs expression was induced with 1 g/mL doxycycline (Sigma-Aldrich, Cat # D9891) treatment for 16-20 hours. Cells were then washed in Stain buffer [PBS/2% FBS] and incubated at 4° C. for 30 minutes. Stain buffer was removed from cells and 0.2 ml/well of DH270 lineage antibodies, palivizumab (negative control) or PGT128 (positive control) were added at optimal concentration of 5 μg/mL for 30 minutes at 4° C. After a 2× wash, cells were stained with 40 ul of APC-conjugated mouse anti-Human IgG (BD Pharmigen, Cat #562025) per well (final volume 0.2 ml/well) for 30 minutes at 4° C. Unstained cells were used as further negative control. Cells were washed 3× and gently dissociated with 0.3 ml/well PBS/5 mM EDTA for 30 minutes at 4° C., transferred into 5 mL Polystyrene Round-Bottom Tubes (Falcon, Cat #352054), fixed with 0.1 mL of BD Cytofix/Cytoperm Fixation solution (BD Biosciences, Cat #554722) and kept on ice until analyzed using a BD LSRFortessa Cell Analyzer. Live cells were gated through Forward/Side Scatter exclusion, and then gated upon GFP+ and APC.
Oligomannose Arrays
Oligomannose arrays were printed with glycans at 100, 33, and 10 μM (Z Biotech). Arrays were blocked for 1 h in Hydrazide glycan blocking buffer. Monoclonal antibodies were diluted to 50 μg/mL in Hydrazide Glycan Assay Buffer, incubated on an individual subarray for 1 h, and then washed 5 times with PBS supplemented with 0.05% tween-20 (PBS-T). Subarrays that received biotinylated Concanavalin A were incubated with streptavidin-Cy3 (Sigma), whereas all other wells were incubated with anti-IgG-Cy3 (Sigma) for 1 h while rotating at 40 rpm covered from light. The arrays were washed 5 times with 70 μL of PBS-T and then washed once with 0.01×PBS. The washed arrays were spun dry and scanned with a GenePix 4000B (Molecular Devices) scanner at wavelength 532 nm using GenePix Pro7 software. The fluorescence within each feature was background subtracted using the local method in GenePix Pro7 software (Molecular Devices). To determine glycan specific binding, the local background corrected fluorescence of the print buffer alone was subtracted from each feature containing a glycan.
Synthesis of Man9-V3 Glycopeptide
A 30-amino acid V3 glycopeptide with oligomannose glycans (Man9-V3), based on the clade B JRFL mini-V3 construct (16), was chemically synthesized as described earlier (18). Briefly, after the synthesis of the oligomannose glycans in solution phase (18), two partially protected peptide fragments were obtained by Fmoc-based solid phase peptide synthesis, each featuring a single unprotected aspartate residue. The Man9GlcNAc2 anomeric amine was conjugated to each fragment (D301 or D332) using our one-flask aspartylation/deprotection protocol yielding the desired N-linked glycopeptide. These two peptide fragments were then joined by native chemical ligation immediately followed by cyclization via disulfide formation to afford Man9-V3-biotin. The control peptide, aglycone V3-biotin, had identical amino acid sequence as its glycosylated counterpart.
Affinity Measurements
Antibody binding kinetic rate constants (ka, kd) of the Man9-V3 glycopeptide and its aglycone form (16) were measured by Bio-layer Interferometry (BLI, ForteBio Octet Red96) measurements. The BLI assay was performed using streptavidin coated sensors (ForteBio) to capture either biotin-tagged Man9-V3 glycopeptide or Aglycone-V3 peptide. The V3 peptide immobilized sensors were dipped into varying concentrations of antibodies following blocking of sensors in BSA (0.1%). Antibody concentrations ranged from 0.5 to 150 μg/mL and non-specific binding interactions were subtracted using the control anti-RSV Palivizumab (Synagis) mAb. Rate constants were calculated by global curve fitting analyses to the Bivalent Avidity model of binding responses with a 10 min association and 15 min dissociation interaction time. The dissociation constant (Kd) values without avidity contribution were derived using the initial components of the association and dissociation rates (ka1 and kd1) respectively. Steady-state binding Kd values for binding to Man9-V3 glycopeptide with avidity contribution were derived using near steady-state binding responses at varying antibody concentrations (0.5-80 g/mL) and using a non-linear 4-parameter curve fitting analysis.
HIV-1 Env Site-Directed Mutagenesis
Deletion Mutant of CH0848.d0274.30.07 env gene was constructed using In Fusion HD EcoDry Cloning kit (Clontech) as per manufacturer instructions. Quick Change II Site-Directed Mutagenesis kit (Agilent Technologies) was used to introduce point mutations. All final env mutants were confirmed by sequencing.
Antibody Site-Directed Mutagenesis
Site-directed mutagenesis of antibody genes was performed using the Quikchange II lightening multi-site-directed mutagenesis kit following manufacturer's protocol (Agilent). Mutant plasmid products were confirmed by single-colony sequencing. Primers used for introducing mutations were: DH270_IA4_D31G: cccagtgtatatagtagccggtgaaggtgtatcca (SEQ ID NO: 52); DH270.IA4 I34M: tcgcacccagtgcatatagtagtcggtgaaggtgt (SEQ ID NO: 53); DH270.IA4 T55S: gatggatcaaccctaactctggtcgcacaaactat (SEQ ID NO: 54); DH270.IA4 R57G: tgtgcatagtttgtgccaccagtgttagggttgat (SEQ ID NO: 55); DH270.IA4 R57V: cttctgtgcatagtttgtgacaccagtgttagggttgatc (SEQ ID NO: 56); DH270.UCA G57R: atcaaccctaacagtggtcgcacaaactatgcaca (SEQ ID NO: 57).
Env Glycoprotein Expression
The codon-optimized CH848-derived env genes were generated by de novo synthesis (GeneScript, Piscataway, N.J.) or site-directed mutagenesis in mammalian expression plasmid pcDNA3.1/hygromycin (Invitrogen) as described (10), and stored at −80° C. until use.
Expression and Purification of DH270 Lineage Members for Crystallization Studies
The heavy- and light-chain variable and constant domains of the DH270 lineage Fabs were cloned into the pVRC-8400 expression vector using Not1 and Nhe1 restriction sites and the tissue plasminogen activator signal sequence. The DH270.1 single chain variable fragment (scFv) was cloned into the same expression vector. The C terminus of the heavy-chain constructs and scFv contained a noncleavable 6× histidine tag (SEQ ID NO: 58). Site-directed mutagenesis was carried out, using manufacturer's protocols (Stratagene), to introduce mutations into the CDR regions of DH270.1. Fabs were expressed and purified as described previously (46). The DH270.1 scFv was purified the same way as the Fabs.
Crystallization, Structure Determination, and Refinement
All His-tagged Fabs and scFv were crystallized at 20-25 mg/mL. Crystals were grown in 96-well format using hanging drop vapor diffusion and appeared after 24-48 h at 20° C. Crystals were obtained in the following conditions: 2.5M ammonium sulfate and 100 mM sodium acetate, pH 5.0 for DH272; 1.5M ammonium sulfate and 100 mM sodium acetate pH 4.0 for UCA1; 20% PEG 4K, 100 mM sodium acetate, pH 5 and 100 mM magnesium sulfate for UCA3; 100 mM sodium acetate, pH 4.5, 200 mM lithium sulfate, and 2.5M NaCl for DH270.1; 1.4M lithium sulfate and 100 mM sodium acetate, pH 4.5 for DH270.3; 40% PEG 400 and 100 mM sodium citrate, pH 4.0 for DH270.5; and 30% PEG 4K, 100 mM PIPES pH 6, 1M NaCl for DH270.6. All crystals were harvested and cryoprotected by the addition of 20-25% glycerol to the reservoir solution and then flash-cooled in liquid nitrogen.
Diffraction data were obtained at 100 K from beam lines 24-ID-C and 24-ID-E at the Advanced Photon Source using a single wavelength. Datasets from individual crystals (multiple crystals for UCA1, DH270.1 and DH270.5) were processed with HKL2000. Molecular replacement calculations for the free Fabs were carried out with PHASER, using 13.2 from the CH103 lineage [Protein Data Bank (PDB) ID 4QHL] (46) or VRC01 from the VRC01/gp120 complex [Protein Data Bank (PDB) ID 4LST] (47) as the starting models. Subsequent structure determinations were performed using DH270 lineage members as search models. The Fab models were separated into their variable and constant domains for molecular replacement.
Refinement was carried out with PHENIX, and all model modifications were carried out with Coot. During refinement, maps were generated from combinations of positional, group B-factor, and TLS (translation/libration/screw) refinement algorithms. Secondary-structure restraints were included at all stages for all Fabs; noncrystallographic symmetry restraints were applied to the DH270.1 scFv and UCA3 Fab throughout refinement. The resulting electron density map for DH270.1 was further improved by solvent flattening, histogram matching, and non-crystallographic symmetry averaging using the program PARROT. Phase combination was disabled in these calculations. After density modification, restrained refinement was performed using Refmac in Coot. Structure validations were performed periodically during refinement using the MolProbity server. The final refinement statistics are summarized in
Design of the 92BR SOSIP.664 Construct
To generate the clade B HIV-1 92BR SOSIP.664 expression construct we followed established SOSIP design parameters (48). Briefly, the 92BR SOSIP.664 trimer was engineered with a disulfide linkage between gp120 and gp41 by introducing A501C and T605C mutations (HxB2 numbering system) to covalently link the two subunits of the heterodimer (48). The I559P mutation was included in the heptad repeat region 1 (HR1) of gp41 for trimer stabilization, and part of the hydrophobic membrane proximal external region (MPER), in this case residues 664-681 of the Env ectodomain, was deleted (48). The furin cleavage site between gp120 and gp41 (508REKR511 (SEQ ID NO: 37)) was altered to 506RRRRRR511 (SEQ ID NO: 59) to enhance cleavage (48). The resulting, codon-optimized 92BR SOSIP.664 env gene was obtained from GenScript (Piscataway, N.J.) and cloned into pVRC-8400 as described above for Fabs using Nhe1 and NotI.
Purification of Envs for Analysis by Biolayer Interferometry and Negative Stain EM
SOSIP.664 constructs were transfected along with a plasmid encoding the cellular protease furin at a 4:1 Env:furin ratio in HEK 293F cells. Site-directed mutagenesis was performed using manufacturer's protocols (Stratagene) for mutations in the V3 region and glycosylation sites. The cells were allowed to express soluble SOSIP.664 trimers for 5-7 days. Culture supernatants were collected and cells were removed by centrifugation at 3,800×g for 20 min, and filtered with a 0.2 μm pore size filter. SOSIP.664 proteins were purified by flowing the supernatant over a lectin (Galanthus nivalis) affinity chromatography column overnight at 4° C. The lectin column was washed with 1×PBS and proteins were eluted with 0.5M methyl-α-D-mannopyranoside and 0.5M NaCl. The eluate was concentrated and loaded onto a Superdex 200 10/300 GL column (GE Life Sciences) prequilibrated in a buffer of 10 mM Hepes, pH 8.0, 150 mM NaCl and 0.02% sodium azide for EM, or in 2.5 mM Tris, pH 7.5, 350 mM NaCl, 0.02% sodium azide for binding analysis, to separate the trimer-size oligomers from aggregates and gp140 monomers.
Electron Microscopy
Purified 92BR SOSIP.664 trimer was incubated with a five molar excess of DH270.1 Fab at 4° C. for 1 hour. A 3 μL aliquot containing ˜0.01 mg/ml of the Fab—92BR SOSIP.664 complex was applied for 15 s onto a carbon coated 400 Cu mesh grid that had been glow discharged at 20 mA for 30s, followed by negative staining with 2% uranyl formate for 30 s. Samples were imaged using a FEI Tecnai T12 microscope operating at 120 kV, at a magnification of 52,000× that resulted in a pixel size of 2.13 Å at the specimen plane. Images were acquired with a Gatan 2K CCD camera using a nominal defocus of 1,500 nm at 100 tilt increments, up to 500. The tilts provided additional particle orientations to improve the image reconstructions.
Negative Stain Image Processing and 3D Reconstruction
Particles were picked semi-automatically using EMAN2 and put into a particle stack. Initial, reference-free, two-dimensional (2D) class averages were calculated and particles corresponding to complexes (with three Fabs bound) were selected into a substack for determination of an initial model. The initial model was calculated in EMAN2 using 3-fold symmetry and EMAN2 was used for subsequent refinement using 3-fold symmetry. In total, 5,419 particles were included in the final reconstruction for the 3D average of 92BR SOSIP.664 trimer complex with DH270.1. The resolution of the final model was determined using a Fourier Shell Correlation (FSC) cut-off of 0.5.
Model Fitting into the EM Reconstructions
The cryo-EM structure of PGT128-liganded BG505 SOSIP.664 (PDB ID: 5ACO) (28) and crystal structure of DH270.1 were manually fitted into the EM density and refined by using the UCSF Chimera ‘Fit in map’ function.
Biolayer Interferometry
Kinetic measurements of Fab binding to Envs were carried out using the Octet QKe system (ForteBio); 0.2 mg/mL of each His-tagged Fab was immobilized onto an anti-Human Fab-CH1 biosensor until it reached saturation. The SOSIP.664 trimers were tested at concentrations of 200 nM and 600 nM in duplicate. A reference sample of buffer alone was used to account for any signal drift that was observed during the experiment. Association and dissociation were each monitored for 5 min. All experiments were conducted in the Octet instrument at 30° C. in a buffer of 2.5 mM Tris, pH 7.5, 350 mM NaCl and 0.02% sodium azide with agitation at 1,000 rpm. Analyses were performed using nonlinear regression curve fitting using the Graphpad Prism software, version 6.
Protein Structure Analysis and Graphical Representations
The Fabs and their complexes analyzed in this study were superposed by least squares fitting in Coot. All graphical representations with protein crystal structures were made using PyMol.
Definition of Immunological Virus Phenotypes and Virus Signature Analysis
The maximum likelihood trees depicting the heterologous virus panel and the full set of Env sequences for the subject CH848 were created using the Los Alamos HIV database PhyML interface. HIV substitution models (49) were used and the proportion of invariable sites and the gamma parameters were estimated from the data. Illustrations were made using the Rainbow Tree interface that utilizes Ape. The analysis that coupled neutralization data with the within-subject phylogeny based on Envs that were evaluated for neutralization sensitivity was performed using LASSIE (43). Signature analysis was performed using the methods fully described in (50, 51).
Heat Maps and Logo Plots
Heat maps and logo plots were generated using the Los Alamos HIV database web interfaces (www.hiv.lanl.gov, version December 2015, HEATMAP and Analyze Align).
Selection of CH848 Env Signatures for Antibody Lineage Cooperation Studies.
We previously studied cooperation between lineages that occurred soon after infection, at a time when diversity in the autologous quasispecies was limited (12). In contrast, in CH848 the earliest autologous quasispecies transition in sensitivity to DH272/DH475 neutralization to DH270 lineage members occurred between week 39 and week 51, when multiple virus variants were circulating. Viral diversity made it impractical to test all the possible permutations or mutations from the transmitted founder virus. To select a smaller pool of candidate mutations, we sought the two most similar CH848 Env sequences at the amino acid level with opposite sensitivity to DH272/DH475 and DH270.1 neutralization around week 51 and identified clones CH0848.3.d0274.30.07 and CH0848.3.d0358.80.06 being the most similar (sim: 0.98713). Among the differences in amino acid sequences between these two clones, the four that we selected (Δ134-143 in V1); D185N in V2; N413Y in V4; Δ463-464 in V5) were the only ones consistently different among all clones with differential sensitivity to DH272 and DH270.1. We elected to use DH270.1 for these cooperating studies as the least mutated representative of DH270 antibodies that gained autologous neutralization at week 51. The D185N and N413Y mutations were also identified by the signature analysis shown in
Data and Materials Availability.
The V(D)J rearrangement sequences of DH272, DH475 and the DH270 lineage antibodies (DH270.UCA, DH270.IA1 through IA4, and DH270.1 through 6) have been deposited in GenBank with accession numbers KY354938 through KY354963. NGS sequence data for clones DH270, DH272 and DH475 have been deposited in GenBank with accession numbers KY347498 through KY347701. Coordinates and structure factors for UCA1, UCA3, DH270.1, DH270.3, DH270.5, DH270.6, and DH272 have been deposited in the Protein Data Bank with accession code 5U0R, 5U15, 5U0U, 5TPL, 5TPP, 5TQA, and 5TRP, respectively. The EM map of the 92BR SOSIP.664 trimer in complex with DH270.1 has been deposited in the EM Data Bank with accession code EMD-8507.
This example provides non-limiting embodiments of V3 peptides which can be used in the immunogenic compositions and methods.
The crystal structure of the HIV-1 V3 bnAb PGT128 in complex with gp120 outer domain containing a truncated V3 loop revealed the key antibody contacts with its glycosylated epitope (R. Pejchal et al., Science (New York, N.Y.) 334, 1097 (2011)). We constructed a glycosylated peptide (Man9-V3) that is comprised of the discontinuous epitope of PGT128 with deletion of residues 305-320, retention of P321, and stabilization by a disulfide bridge between C296 and C331 (
V3-Glycan bnAb DH270 Unmutated Common Ancestor Binding to the Peptide Component of Man9-V3 Glycopeptide
The unmutated common ancestor (UCA) and the earlier intermediates in the DH270 lineage showed no detectable binding to either soluble or to cell surface Env. However, the DH270 bnAb UCA did bind to Man9V3 (
Additional V3 peptides contemplated by the invention are listed in Table 2. Table 2 below includes non-limiting examples of V3 peptides
Peptide sequences above in order of appearance in Table 2 are SEQ ID Nos: 2 to 13. Peptides sequence from Table 2 without N- or C-terminal biotinylation lysine are SEQ ID NOs: 14 to 25.
Any of the peptides could be biotinylated. In some embodiments, the peptides are biotinylated on the C terminus, except CH848.TF V3 biotin-315-340 and CH848.0949.10.17 V3 biotin-315-340, which are biotinylated on the N terminus.
The peptides of the invention can be synthesized by any known method. V3 aglycone of and Man9V3 and their synthesis are provided in
In some embodiments, the peptides are:
It is readily understood that peptides which are not biotinylated do not include an N- or C-terminal lysine (or other specific functional groups or residues) for targeting with biotynalation reagents.
V3 (+the base containing N332 NGS) of CH848 transmitted founder and CH0848.0949.10.17 are shown below:
Non-limiting embodiments of V3 peptides variants include:
The peptides of the invention could be glycosylated at either or both positions N301 and N332. In some embodiments the glycan is Man9GlcNAc2.
It is readily understood that peptides which are not biotinylated do not include an N- or C-terminal lysine (or other specific functional groups or residues) for targeting with biotynaltion reagents.
The invention also contemplates peptides which comprise T-cell helper epitope. One non-limiting embodiment includes GTH1 helper epitope. The helper epitope(s) could be at the N- or C-terminus of the peptide.
The peptides of the invention could be multimerized. In some embodiments, the peptides are biotinylated or multimerized. In some embodiments, the multimeric peptides comprise a T-helper epitope, e.g. but not limited to GTH1 epitope. The helper epitope(s) could be at the N- or C-terminus of the peptide. In some embodiments, the peptides are conjugated to a lipid and then multimerized. The lipids could be pegylated. A non-limiting example is V3 (SEQ ID NO: 1) Peg-GTH1-DPPE peptide.
The following example provides non-limiting embodiments of immunogens and combination of immunogens for use in various immunization schedules.
All selections need a prime which engages the UCA. Non-limiting examples are Some of the general considerations in choosing immunogens for boost in induction of V3 glycan antibodies are as follows: (i)—activate IA4, select for rare mutation; (ii)—select for antibodies that favor the trimer, expand the variation in the autologous signature residue to potentially expand recognition of diversity in the population; (iii)—expose the maturing antibodies to longer loops, even though these viruses are not bound or neutralized as well as viruses with shooter loops, as this is the main constrain on heterologous population breadth and that is what is needed. In some embodiments, immunogens are selected which can do (i) and (iii). In other embodiments, the selection includes immunogens which can do (ii).
Any suitable form of the envelope could be used for prime and/or boost. The envelope used in the compositions and methods of the invention can be a gp160, gp150, gp145, gp140, gp120, gp41, N-terminal deletion variants as described herein, cleavage resistant variants as described herein, or codon optimized sequences thereof. In certain embodiments the composition comprises envelopes as trimers. In certain embodiments, envelope proteins are multimerized, for example trimers are attached to a particle such that multiple copies of the trimer are attached and the multimerized envelope is prepared and formulated for immunization in a human. In certain embodiments, the compositions comprise envelopes, including but not limited to trimers as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles. In some embodiments, the trimers are in a well ordered, near native like or closed conformation. In some embodiments the trimer compositions comprise a homogenous mix of native like trimers.
Near-native soluble trimers using the 6R. SOSIP.664 design are capable of generating autologous tier 2 neutralizing plasma antibodies in the plasma (Sanders et al. 2015), which provides a starting point for designing immunogens to elicit broadly neutralizing antibodies. While these trimers are preferentially antigenic for neutralizing antibodies they still possess the ability to expose the V3 loop, which generally results in strain-specific binding and neutralizing antibodies after vaccination. Using the unliganded structure the BG505.6R.SOSIP.664 has been stabilized by adding cysteines at position 201 and 433 to constrain the conformational flexibility such that the V3 loop is maintained unexposed (Kwon et al. 2015).
Stabilized Trimer Immunogen Design. Several SOSIP trimer designs have been generated: 6R.SOSIP.664, disulfide stabilized (DS) 6R.SOSIP.664 (Kwon et al Nature Struc Mol Biol 2015), 6R.SOSIP.664v4.1 (DeTaeye et al. Cell 2016), and 6R.SOSIP.664v4.2 (DeTaeye et al. Cell 2016). The CH848 SOSIP is made as a chimera of C.CH848 and A.BG505. Sequences of various CH848 envelope trimer designs are illustrated in
In some embodiments the CHIM.6R.SOSIP.664V4.1 and/or CHIM.6R. SOSIP.664V4.1design is expected to be in closed stabilized conformation. This design is expected to show preferential binding to broad neutralizing antibodies compared to binding to non-neutralizing antibodies. This design is expected to bind to antibodies from the V3 antibodies of Example 1.
The gp120 of C.CH848 envelope was fused with the BG505 inner domain gp120 sequence within the alpha helix 5 (alpha5) to result in a chimeric protein. The chimeric gp120 is disulfide linked to the A.BG505 gp41 as outlined by Sanders et al. (PLOS Path 2013). In some embodiments the immunogens were designed as chimeric proteins that possess the BG505 gp41 connected to the CH848 gp120, since the BG505 strain is particularly adept at forming well-folded, closed state trimers (See
Provided are non-limiting examples of selections of envelopes for immunization to induce neutralizing HIV-1 antibodies, including but not limited to broadly neutralizing antibodies with the specificity of antibodies from the DH270 lineage. One non-limiting embodiment of the V3 peptide used as a prime is: EINCTRPNNNTRPGEIIGDIRQAHCNISRA (SEQ ID NO: 1) as aglycone or as Man9GlcNAc2 glycosylated at both N301 and N332.
The envelopes could be administered in any suitable form, as nucleic acids, amino acids and/or combination. a gp160, gp150, gp145, any suitable form of a trimer, for example but not limited to SOSIP trimers, preferably in a closed conformation, gp140 (including but not limited to gp140C, gp140CF, gp140CFI), gp120, gp41, N-terminal deletion variants (e.g. delta 11 deletions) as described herein, cleavage resistant variants, or codon optimized sequences thereof. Non-limiting examples of sequences are provided in
Selection I:
V3 glycopeptide and/or aglycone peptide (SEQ ID NO: 1) as a prime; Boost: CH848.0949.10.17; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02. See
Selection II:
V3 glycopeptide and/or aglycone peptide as a prime; Boost: CH848.0949.10.17; CH848.0836.10.31; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02. See
Selection III:
V3 glycopeptide and/or aglycone peptide as a prime; Boost: CH848.0949.10.17; CH848.d1120.10.21; CH848.d1432.05.27. See
Selection IV:
V3 glycopeptide and/or aglycone peptide as a prime; Boost: CH848.0949.10.17; CH848.d1120.10.21; CH848d0949.10.18; CH848.d1432.05.27. See
Selection V:
V3 glycopeptide and/or aglycone peptide as a prime; Boost: CH848.0949.10.17; CH848.0794.05.14; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.09; CH848.0526.25.02.
Selection VI:
CH848.0949.10.17 trimer as a prime, boost: CH848.0949.10.17; optionally CH848.0836.10.31; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02.
Selection VII:
CH848.0949.10.17 trimer as a prime; could be a V1 loop deglycosylated envelope, boost: CH848.0949.10.17; optionally CH848.0836.10.31; CH848.0358.80.06; CH848.1432.5.41; CH848.0526.25.02; CH0848.3.d1651.10.07.
In any of the above selections the prime could be selected from any of the contemplated envelope designs that show binding to the DH270UCA.
In any one of the above selections, the boost could include CH848.d1305.10.13 and CH0848.3.d1651.10.07 envelope designs to increase the breadth of antibodies.
This example describes additional considerations for selecting CH848 envelopes and modifications of such envelopes for use as immunogens.
CRF02_AG.T250 is an envelope which is very sensitive to V2glycan and V3glycan antibodies, and resistant to CD4bs antibodies. Short positively charged V1 V2's are highly associated with sensitivity, and T250 has among the shortest V1 V2 regions—So do CH848.d0949.10.17 envelope. T250's V1 V2 region could be introduced in any of the envelopes describe herein, e.g. in CH0848.d0949.021.10.17.
The best antibody from the DH270 lineage is DH270.6. Like most V3 antibodies, it requires the N332 PNGS. In addition, D325N is highly associated with resistance, and is a common circulating mutation. Other V3glycan bNAbs can tolerate the mutation, and it arose in CH848 after DH270 lineage antibodies were isolated, likely possibly as an escape from our DH270 lineage. An N325 CH848 envelope isolate could be included in the vaccine to potentially extend breadth when DH270-like linages is started. There are several candidates, but only two had any binding or neutralizing activity CH848.d1305.10.13 and CH0848.3.d1651.10.07.
Table 3 provides a listing of reagents for use as prime(s)/DH270 lineage germline binders and/or boosts (Amino acid sequences of these envelopes are provided in
Provided and contemplated are envelopes and modified version thereof for use as DH270 lineage germline binders:
Envelope (HV1301265)_JRFL gp140_3QN301SN332T—
Envelope CH848 703010848.3.d0949.10.17_signature_opt_filled_rare_holes_a_CD5ss gp140C. Contemplated is also a SOSIP design of the envelope CH848 703010848.3.d0949.10.17_signature_opt_filled_rare_holes_a.
Envelope CH0848.3.d1651.10.07_CD5ss gp140C
Envelope CH848 703010848.3.d0949.10.17_signature_opt_b_T250.4_V1V2_CD5ss gp140C. Envelope CH848 703010848.3.d0949.10.17_signature_opt_b_CD5ss gp140C. Contemplated is also a SOSIP design of this envelope.
Envelope T250-4 gp140C
Envelope T250-4chim. 6R. SOSIP.664v4.1
Envelope CH848 703010848.3.d0949.10.17_signature optbCD5ss gp140C. Contemplated is also a SOSIP design of this envelope.
Envelope CH848 703010848.3.d0949.10.17_signature_opt_filled_rare_holes_a_CD5ss gp140C
Envelope CH8448 703010848.3.d0949.10.17_signature_opt_filled_rare_holes_a_CD5ss N133AN138A
Envelope T250-4 gp140C_N133AN138A—
Envelope JRFL Core with miniV3 (293F produced/KIF treated/EndoH treated). Signature_opt_filled_rare_holes_a designs are also referred to as SOFA design. Additional designs are also contemplated and covered by the invention. Non-limiting embodiments include chimeric trimer designs, which could comprise portions of BG505 envelope (See
The example describes CH848 envelopes, trimers and additional envelopes, modifications and designs. This example shows that stabilized HIV-1 Env trimer immunogens show enhanced antigenicity. See
Elicitation of neutralizing antibodies is one goal for antibody-based vaccines. Neutralizing antibodies target the native trimeric HIV-1 Env on the surface virions. The trimeric HIV-1 envelope protein consists of three protomers each containing a gp120 and gp41 heterodimer. Recent immunogen design efforts have generated soluble near-native mimics of the Env trimer that bind to neutralizing antibodies but not non-neutralizing antibodies. The recapitulation of the native trimer could be a key component of vaccine induction of neutralizing antibodies. Neutralizing Abs target the native trimeric HIV-1 Env on the surface of viruses (Poignard et al. J Virol. 2003 January; 77(1):353-65; Parren et al. J Virol. 1998 December; 72(12): 10270-4; Yang et al. J Virol. 2006 November; 80(22):11404-8.). The HIV-1 Env protein consists of three protomers of gp120 and gp41 heterodimers that are noncovalently linked together (Center et al. J Virol. 2002 August; 76(15):7863-7.). Soluble near-native trimers preferentially bind neutralizing antibodies as opposed to non-neutralizing antibodies (Sanders et al. PLoS Pathog. 2013 September; 9(9): e1003618).
Provided here are non-limiting embodiments of well-folded trimers or other engineered forms of envelopes, which bind to the DH270UCA, and/or other DH270 lineage antibodies and are useful for Env immunizations as prime(s) and/or boosts.
Near-native soluble trimers using the 6R. SOSIP.664 design are capable of generating autologous tier 2 neutralizing plasma antibodies in the plasma (Sanders et al. 2015), which provides a starting point for designing immunogens to elicit broadly neutralizing antibodies. While these trimers are preferentially antigenic for neutralizing antibodies they still possess the ability to expose the V3 loop, which generally results in strain-specific binding and neutralizing antibodies after vaccination. Using the unliganded structure the BG505.6R.SOSIP.664 has been stabilized by adding cysteines at position 201 and 433 to constrain the conformational flexibility such that the V3 loop is maintained unexposed (Kwon et al. Nat Struct Mol Biol. 2015 July; 22(7): 522-531.).
Immunogen Design.
Provided are engineered trimeric envelopes, for use as immunogens, wherein the envelopes are based on multiple viruses from CH848, and other viruses with suitable characteristics, e.g. V1 loop length, as described.
We generated chimeric 6R.SOSIP.664, chimeric disulfide stabilized (DS) 6R.SOSIP.664 (Kwon et al Nat Struct Mol Biol. 2015 July; 22(7): 522-531.), chimeric 6R.SOSIP.664v4.1 (DeTaeye et al. Cell. 2015 Dec. 17; 163(7):1702-15. doi: 10.1016/j.cell.2015.11.056), and chimeric 6R.SOSIP.664v4.2 (DeTaeye et al. Cell. 2015 Dec. 17; 163(7):1702-15. doi: 10.1016/j.cell.2015.11.056). The 6R.SOSIP.664 is the basis for all of these designs and is made as a chimera of C.CH0505 and A.BG505. The gp120 of C.CH848 was fused with the BG505 inner domain gp120 sequence within the alpha helix 5 (α5) to result in the chimeric protein. The chimeric gp120 is disulfide linked to the A.BG505 gp41 as outlined by Sanders et al. (PLoS Pathog. 2013 September; 9(9): e1003618). These immunogens were designed as chimeric proteins that possess the BG505 gp41 connected to the CH848 gp120, since the BG505 strain is particularly adept at forming well-folded, closed trimers. This envelope design are expected to retain and expose features of the envelopes recognized by DH270 by broadly neutralizing antibody lineages that were isolated from CH848.
Recombinant envelopes as trimers could be produced and purified by any suitable method. For a non-limiting example of purification methods see Ringe R P, Yasmeen A, Ozorowski G, Go E P, Pritchard L K, Guttman M, Ketas T A, Cottrell C A, Wilson I A, Sanders R W, Cupo A, Crispin M, Lee K K, Desaire H, Ward A B, Klasse P J, Moore J P. 2015. Influences on the design and purification of soluble, recombinant native-like HIV-1 envelope glycoprotein trimers. J Virol 89:12189-12210. doi: 10.1128/JVI.01768-15.
Multimeric Envelopes
Presentation of antigens as particulates reduces the B cell receptor affinity necessary for signal transduction and expansion (See Baptista et al. EMBO J. 2000 Feb. 15; 19(4): 513-520). Displaying multiple copies of the antigen on a particle provides an avidity effect that can overcome the low affinity between the antigen and B cell receptor. The initial B cell receptor specific for pathogens can be low affinity, which precludes vaccines from being able to stimulate and expand B cells of interest. In particular, very few naïve B cells from which HIV-1 broadly neutralizing antibodies arise can bind to soluble HIV-1 Envelope. Provided are envelopes, including but not limited to trimers as particulate, high-density array on liposomes or other particles, for example but not limited to nanoparticles. See e.g. He et al. Nature Communications 7, Article number: 12041 (2016), doi:10.1038/ncomms12041; Bamrungsap et al. Nanomedicine, 2012, 7 (8), 1253-1271.
To improve the interaction between the naïve B cell receptor and CH848 SOSIP trimer protein we created to two constructs that can be presented on particles. The first construct was made by fusing HIV-1 Envelope trimer CH848 to ferritin. Ferritin protein self assembles into a small nanoparticle with three fold axis of symmetry. At these axis CH848 envelope protein was fused. Therefore the assembly of the three-fold axis also clusters three HIV-1 envelope protomers together to form an envelope trimer. Each ferritin particle has 6 axis which equates to 6 CH848 trimers being displayed per particle. See e.g. Sliepen et al. Retrovirology 201512:82, DOI: 10.1186/s12977-015-0210-4.
Another approach to multimerize expression constructs uses staphylococcus Sortase A transpeptidase ligation to conjugate CH848 envelope trimers to cholesterol. The CH848 trimers can then be embedded into liposomes via the conjugated cholesterol. To conjugate the CH848 trimer to cholesterol either a C-teminal LPXTG tag (SEQ ID NO: 60) or a N-terminal pentaglycine repeat tag (SEQ ID NO: 61) was added to the CH505 envelope trimer gene. Cholesterol was also synthesized with these two tags. Sortase A was then used to covalently bond the tagged CH505 envelope to the cholesterol. The sortase A-tagged trimer protein can also be used to conjugate the trimer to other peptides, proteins, or fluorescent labels.
The invention provides design of envelopes and trimer designs wherein the envelope comprises a linker which permits addition of a lipid, such as but not limited to cholesterol, via a Sortase A reaction. See e.g. Tsukiji, S. and Nagamune, T. (2009), Sortase-Mediated Ligation: A Gift from Gram-Positive Bacteria to Protein Engineering. ChemBioChem, 10: 787-798. doi:10.1002/cbic.200800724; Proft, T. Sortase-mediated protein ligation: an emerging biotechnology tool for protein modification and immobilisation. Biotechnol Lett (2010) 32: 1. doi:10.1007/s10529-009-0116-0; Lena Schmohl, Dirk Schwarzer, Sortase-mediated ligations for the site-specific modification of proteins, Current Opinion in Chemical Biology, Volume 22, October 2014, Pages 122-128, ISSN 1367-5931, dx.doi.org/10.1016/j.cbpa.2014.09.020; Tabata et al. Anticancer Res. 2015 August; 35(8):4411-7.
The lipid modified envelopes and trimers could be formulated as liposomes. Any suitable liposome composition is contemplated.
Non-limiting embodiments of envelope designs for use in Sortase A reaction are shown in
Design of Trimers with Readthrough Codons
The development of clonal cell lines that highly express trimeric HIV-1 Envelope will facilitate manufacturing of high quality proteins for clinical and research purposes. However, it is challenging to identify the cells that express trimeric protein among the many cells making various forms of HIV-1 Envelope with in the cell population. To identify cells expressing trimeric HIV-1 Envelope protein, we designed an expression construct that simultaneously produces both secreted Envelope protein as well as membrane anchored Envelope protein. The secreted Envelope protein can be purified using standard methods and results in unaltered soluble envelope. The membrane-anchored Envelope protein serves to mark the cells within a population of cells that expresses trimeric Envelope. More specifically, the trimeric Envelope expressing cells are sorted by fluorescence-activated cell sorting using a HIV-1 trimer specific antibody. The sorted cells can then be used to initiate clonal populations of cells that have been phenotypically shown to express the protein of interest.
The expression construct is designed by taking advantage of the amber stop codon UAG in messenger RNA. The codon UAG usually signifies the end of the polypeptide sequence, but at a low rate the ribosome can readthrough this stop codon and continue to elongate the polypeptide chain. We incorporated this stop codon into our protein construct followed by the natural BG505 gp41 transmembrane and cytoplasmic tail sequence ended with two stop codons. Therefore, when the stop codon is readthrough a membrane-anchored gp120/gp41 heterodimer is formed. Loughran et al. (Nucleic Acids Res. 2014 August; 42(14): 8928-38. doi: 10.1093/nar/gku608) identified that the efficiency of readthrough could be increased by flanking the amber stop codon with the nucleotides CTA. Readthrough could be even further augmented with the addition of CTAG nucleotides after the amber stop codon. We engineered expression constructs with both modifications to ensure an optimal ratio of membrane-anchored and secreted trimeric Envelope protein. Since the CTAG creates a shift in reading frame we added GC nucleotides after the CTAG motif to preserve the original reading frame. The addition of CTAGGC results in the membrane anchored protein having a leucine and glycine residue expressed before the transmembrane domain. Any one of the envelopes of the invention could be designed and expressed as readthrough envelopes.
Various selections of immunogens will be tested in animal models. Any suitable animal model will be used. Such animal models include mouse models, including humanized mice carrying human immunoglobulin locus, guinea pigs, rabbits, non-human primates, or any other model. Adults and neonates could be used in the studies.
Mouse study: prime with Man9 V3 (SEQ ID NO: 1) glycan monomer with adjuvant LASTS. Boost at least twice with CH848 d0949.10.17Δ11 gp120 with adjuvant, e.g. LASTS.
Mouse study: prime with V3 (SEQ ID NO: 1) aglycan monomer with adjuvant LASTS. Boost at least twice with CH848 d0949.10.17Δ11 gp120 with adjuvant LASTS.
In the immunogenic methods of the invention, the first boost after the prime comprises CH848 d0949.10.17 envelope either as a protein or nucleic acid in any suitable form.
The adjuvant in the above studies could be any suitable adjuvant, for example but no limited to polyIC or polyIC/LC.
Modification of HIV Env glycosylation augments binding to unmutated common ancestor and intermediate antibodies of V3-glycan broadly neutralizing antibody lineages. This example investigates whether envelope designs with a short V1 loop and no glycans near N137 engage the DH270 UCA.
Example 5 shows data for one non-limited embodiment of a deglycosylated envelope. These data include antigenic and immunogenic characterization of the envelope, and characterization of immunogenic responses in animals immunized with the deglycosylated envelope CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T.
Additional trimer designs based on CH848.3.D0949.10.17 envelope are also contemplated as deglycosylated immunogens.
The recombinant envelopes in this example are expressed in mammalian cells and purified by methods known in the art.
In a study described in Example 1 (Bonsignori et al. Sci. Transl. Med. 9, eaai7514 (2017)), we described the antibody lineage called DH270 that was isolated from an HIV-infected individual called CH0848. We isolated this lineage using memory B cell cultures and single B cell sorting followed by RT-PCR. In total we isolated 6 natural antibody heavy chain and light chain pairs. The most potent and broad neutralizing antibody of the lineage neutralized 71% of viruses tested. Using these antibodies, we inferred a unmutated common ancestor or UCA antibody using the Cloanalyst program. The UCA lacks any somatic mutation and is our best approximation of the germline starting point for the DH270 lineage. In this study, autologous Envs were isolated from CH0848 covering 4.5 years of infection. A subset of these Envs were used to identify Envs that were engaged by various members of the DH270 lineage throughout its developmental pathway. The identified Envs are being used to design B cell lineage sequential vaccines. However, no Env was identified that bound the DH270 UCA antibody. Antibody DH270 binding and neutralization inversely correlates with HIV-1 Env V1 loop length. V1 glycans inhibit V3-glycan bnAb inter-PGT122 lineages and the N137 glycan in the V1 loop needs to be accommodated for early lineage member binding to BG505 SOSIP. Garces F. et al. Immunity 43, 1053-1063 (2015); Garces et al. Cell 159, 69-78 (2014); Steichen et al. Immunity 45, 483-496 (2016).
An autologous Env from the CH0848 individual was identified—this envelope called CH0848.D0949.10.17, which possessed a 17 amino acid V1 loop. It had glycosylation sites within the V1 loop at positions 133, 138 and N156. We removed the N133 and N138 glycans by substituting in amino acids that naturally occur at those sites. We made a SOSIP trimer derived from the CH0848.10.17 sequence (see for example
This example investigated whether soluble, recombinant Env proteins derived from CH0848.D0949.10.17 engage the DH270 UCA.
We also investigated whether DH270 UCA binding to CH0848.D0949.10.17 SOSIP could be limited by the V1 glycans at N133 and N138.
We investigated the structural basis for N133 and N138 glycan inhibition of DH270 UCA binding to trimer.
We investigated whether CH0848 N133D N138T trimer stimulate B cells encoding the DH270 UCA.
We investigated whether vaccine-induced antibodies possess autologous neutralizing activity.
Experiments in this example show that DH270 UCA preferentially bound autologous SOSIP trimers, but not gp120 or uncleaved gp140 versions of the same Env; that the glycans in the V1 loop are not only inhibitory for PGT121, but also are inhibitory for other V3 glycan antibodies such as DH270; that the CH0848 10.17N133DN138T SOSIP elicited binding and neutralizing antibodies against the unmodified, WT CH0848 10.17 virus in rearranged DH270 UCA knock in mice.
We investigated whether N133/N138 lacking viruses are found in circulation in CH0848 individual envelope sampling. Natural Envs with 17 aa V1 loops lacking N133/N138 glycans are present during in CH0848 infection.
NHP 144: CH0848 10.17N133DN138T SOSIP was used as an immunogen in a non-human primate study. Regimen was as follows: week 0-all groups CH848.d949.10.17_N301A_SOSIP (100 ug), IM injection in GLA-LSQ; week 4—Group 1: CH65 IgG (α-HA) 10 mg/kg IV infusion, Group 2: Ipilimumab (α-CTLA-4) 10 mg/kg IV infusion, Group 3: RH anti-tac 1 mg IV infusion, Group 4: Ipilimumab (α-CTLA-4) 10 mg/kg IV infusion+RH anti-tac 1 mg IV infusion)+CH848.d949.10.17_N301A_SOSIP (100 ug), IM injection in GLA-LSQ; week 10—Group 1: CH65 IgG (α-HA) 10 mg/kg IV infusion, Group 2:Ipilimumab (α-CTLA-4) 10 mg/kg IV infusion, Group 3: RH anti-tac 1 mg IV infusion, Group 4: Ipilimumab (α-CTLA-4) 10 mg/kg IV infusion+RH anti-tac 1 mg IV infusion)+CH848.3.D0949.10.17CHIM.6R.SOSIP.664V4.1_N133DN138T (100 ug) IM injection in GLA-LSQ; week 16—Group 1: CH65 IgG (α-HA) 10 mg/kg IV infusion+CH848.d949.10.17 SOSIP (100 ug) IM injection in GLA-LSQ, Group 2: Ipilimumab (α-CTLA-4) 10 mg/kg IV infusion+CH848.d949.10.17 SOSIP (100 ug) IM injection in GLA-LSQ, Group 3-4: CH848.d949.10.17 SOSIP (100 ug) IM injection in GLA-LSQ; week 22-all groups CH848.d8369.10.31 SOSIP (100 ug) IM injection in GLA-LSQ.
Following two immunizations with CH848.d949.10.17_N301A_SOSIP and a third immunization with CH848.d949.10.17 N133DN138T SOSIP that have been demonstrated to bind to the germline precursor of the V3-glycan bnAb DH270 lineage as a priming immunization regimen, then boosting with the CH848.d949.10.17 with all glycan sites intact we can detect serum antibody neutralization (
SOFA deglycosylated envelopes (See Example 3 and
Table 4 is summary of various designs of V1 deglycosylated envelopes
CH848.3.D0949.10.17 SOSIP trimers were also analyzed for their antigenicity in the presence of BMS compound(s) which inhibit binding of CD4 to the envelope. See e.g. Langley et al. Proteins 2015; 83:331-350. Trimer antigenicity in the presence of the inhibitor was not affected—see
Animal studies comparing immunogenicity of envelopes in the presence and absence of BMS-626529 CD4 binding inhibitors will be conducted.
This application is a U.S. National Stage application under 35 U.S.C. § 371 of International Patent Application No. PCT/US2018/020788, filed on Mar. 2, 2018, which claims the benefit of and priority to U.S. Provisional Application No. 62/624,620 filed Jan. 31, 2018. International Patent Application No. PCT/US2018/020788 is also a Continuation-In-Part of International Application PCT/US2017/020823 filed Mar. 3, 2017. International Patent Application No. PCT/US2017/020823 claims the benefit of and priority to U.S. Provisional Patent Application No. 62/403,649, filed Oct. 3, 2016, and U.S. Provisional Patent Application No. 62/303,273, filed Mar. 3, 2016. The entire contents of these applications are incorporated herein by reference in their entirety.
This invention was made with government support under Grant No. UM1-AI1006445 awarded by the National Institutes of Health, Division of AIDS, Bethesda, Md. The government has certain rights in this invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2018/020788 | 3/2/2018 | WO | 00 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2018/161049 | 9/7/2018 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5792459 | Haigwood | Aug 1998 | A |
| 7951377 | Korber et al. | May 2011 | B2 |
| 8071107 | Haynes et al. | Dec 2011 | B2 |
| 9872900 | Ciaramella et al. | Jan 2018 | B2 |
| 20030147888 | Haynes et al. | Aug 2003 | A1 |
| 20060051373 | Olson et al. | Mar 2006 | A1 |
| 20090286852 | Kariko et al. | Nov 2009 | A1 |
| 20100015218 | Jadhav et al. | Jan 2010 | A1 |
| 20100041875 | Dey et al. | Feb 2010 | A1 |
| 20110076298 | Olson et al. | Mar 2011 | A1 |
| 20110250220 | Dey et al. | Oct 2011 | A1 |
| 20110262488 | Phogat et al. | Oct 2011 | A1 |
| 20120052090 | Tamamura et al. | Mar 2012 | A1 |
| 20130111615 | Kariko et al. | May 2013 | A1 |
| 20130197068 | Kariko et al. | Aug 2013 | A1 |
| 20130261172 | Kariko et al. | Oct 2013 | A1 |
| 20140328862 | Scheid et al. | Nov 2014 | A1 |
| 20150038558 | Kariko et al. | Feb 2015 | A1 |
| 20160032316 | Weissman et al. | Feb 2016 | A1 |
| 20160271244 | Haynes et al. | Sep 2016 | A1 |
| 20170043037 | Kariko et al. | Feb 2017 | A1 |
| 20170233441 | Kwong et al. | Aug 2017 | A1 |
| 20170327842 | Weissman et al. | Nov 2017 | A1 |
| 20170369532 | Carfi et al. | Dec 2017 | A1 |
| 20180028645 | Ciaramella et al. | Feb 2018 | A1 |
| 20180072777 | Rutten et al. | Mar 2018 | A1 |
| Number | Date | Country |
|---|---|---|
| 2944068 | Oct 2015 | CA |
| 0272858 | Jun 1988 | EP |
| 1466924 | Oct 2004 | EP |
| 1738764 | Jan 2007 | EP |
| WO-07149491 | Dec 2007 | WO |
| WO-10031113 | Mar 2010 | WO |
| WO-2013006688 | Jan 2013 | WO |
| WO-1442669 | Mar 2014 | WO |
| WO-14043386 | Mar 2014 | WO |
| WO-2014172366 | Oct 2014 | WO |
| WO-2015127108 | Aug 2015 | WO |
| WO-2015153638 | Oct 2015 | WO |
| WO-16037154 | Mar 2016 | WO |
| WO-2016149695 | Sep 2016 | WO |
| WO-17151801 | Sep 2017 | WO |
| WO-170152146 | Sep 2017 | WO |
| WO-18067580 | Apr 2018 | WO |
| WO-18161049 | Sep 2018 | WO |
| WO-19169356 | Sep 2019 | WO |
| WO-2072162 | Apr 2020 | WO |
| WO-2072169 | Apr 2020 | WO |
| Entry |
|---|
| “FASTX-Toolkit”, downloaded from http://hannonlab.cshl.edu/fastx_toolkit, last retrieved Nov. 4, 2020 (2 total pages). |
| “Models of SHM Targeting and Substitution—SF5 Mutability Model dataset” last downloaded Feb. 2, 2021 from; http://clip.med.yale.edu/shm/download.php (2 total pages). |
| Alam, S. M., et al., “Antigenicity and Immunogenicity of RV144 Vaccine AIDSVAX Clade E Envelope Immunogen Is Enhanced by a gp120 N-Terminal Deletion,” Journal of Virology, vol. 87, No. 3, pp. 1554-1568 (Feb. 2013). |
| Alam, S.M., et al., “Human Immunodeficiency Virus Type 1 gp41 Antibodies That Mask Membrane Proximal Region Epitopes: Antibody Binding Kinetics, Induction, and Potential for Regulation in Acute Infection,” J. Virol., vol. 82, No. 1, pp. 115-125 (Jan. 2008). |
| Alam, S.M., et al., “Mimicry of an HIV broadly neutralizing antibody epitope with a synthetic glycopeptide,” Sci. Transl. Med., vol. 9, No. 381, eaai7521 Mar. 15, 2017 (Author Manuscript—20 total pages—available in PMC Aug. 18, 2017). |
| Alam, S.M., et al., “Recognition of synthetic glycopeptides by HIV-1 broadly neutralizing antibodies and their unmutated ancestors,” PNAS, vol. 110, No. 45, pp. 18214-18219 (Nov. 5, 2013)—last downloaded Oct. 6, 2020 from https://www.pnas.org/content/110/45/18214 (24 total pages). |
| Alam, S.M., et al., “The Role of Antibody Polyspecificity and Lipid Reactivity in Binding of Broadly Neutralizing Anti-HIV-1 Envelope Human Monoclonal Antibodies 2F5 and 4E10 to Glycoprotein 41 Membrane Proximal Envelope Epitopes,” J. Immunol., vol. 178, pp. 4424-4435 (accepted for publication Jan. 12, 2007) (13 total pages). |
| Alam, S. M., et al., “Role of HIV membrane in neutralization by two broadly neutralizing antibodies”, PNAS, vol. 106, No. 48, pp. 20234-20239 (Dec. 1, 2009). |
| Alving, C.R., et al., “Adjuvants for human vaccines,” Current Opinion in Immunology, vol. 24, No. 3, pp. 310-315 (Jun. 2012), Author Manuscript available in PMC Jun. 1, 2013—12 total pages. |
| Andrabi, R., et al., “Identification of Common Features in Prototype Broadly Neutralizing Antibodies to HIV Envelope V2 Apex to Facilitate Vaccine Design,” Immunity, vol. 43, No. 5, pp. 959-973 (Nov. 2015)—Author Manuscript available in PMC Nov. 17, 2016 (25 total pages). |
| Arnaoty, A., et al., “Novel Approach for the Development of New Antibodies Directed Against Transposase-Derived Proteins Encoded by Human Neogenes,” Yves Bigot (ed.), Mobile Genetic Elements: Protocols and Genomic Applications, Methods in Molecular Biology, vol. 859, Chapter 17, pp. 293-305 (2012). |
| Arnaoty, Ahmed, et al., “Reliability of the nanopheres-DNA immunization technology to produce polyclonal antibodies directed against human neogenic proteins,” Mol. Genet. Genomics, vol. 288, pp. 347-363 (2013). |
| Aussedat, B., et al., “Chemical synthesis of highly congested gp120 V1V2 N-glycopeptide antigens for potential HIV-1-directed vaccines,” J. Am. Chem. Soc., vol. 135, No. 35, Sep. 2013 (Author Manuscript—16 total pages—available in PMC Sep. 4, 2014). |
| Bamrungsap, S. et al., “Nanotechnology in therapeutics: a focus on nanoparticles as a drug delivery system,” Nanomedicine, vol. 7, No. 8, pp. 1253-1271 (2012). |
| Barouch, D. H., et al., “Mosaic HIV-1 Vaccines Expand the Breadth and Depth of Cellular Immune Responses in Rhesus Monkeys,” Nature Medicine, vol. 16, No. 3, pp. 319-323, Mar. 2010 (Author Manuscript—15 total pages—available in PMC Sep. 1, 2010). |
| Batista, F.D., et al., “B cells extract and present immobilized antigen: implications for affinity discrimination,” The EMBO Journal, vol. 19, No. 4, pp. 513-520 (2000). |
| Behrens, A.J., et al. “Composition and Antigenic Effects of Individual Glycan Sites of a Trimeric HIV-1 Envelope Glycoprotein,” Cell Rep. vol. 14, pp. 2695-2706 with cover page—13 total pages (Mar. 22, 2016). |
| Betz, A G., “Passenger transgenes reveal intrinsic specificity of the antibody hypermutation mechanism: Clustering, polarity, and specific hot spots,” Proceedings of the National Academy of Sciences of the United States of America, vol. 90, pp. 2385-2388 (Mar. 1993). |
| Bhattacharya, T., et al., “Founder Effects in the Assessment of HIV Polymorphisms and HLA Allele Associations,” Science, vol. 315, No. 5818, pp. 1583-1586, Apr. 2007 (last downloaded Oct. 6, 2020 from https://www.researchgate.net/publication/6442933_Founder_Effects_in_the_Assessment_of_HIV _Polymorphisms_and_HLA_Allele_Associations—10 total pages). |
| Binley, J.M., et al., “Enhancing the Proteolytic Maturation of Human Immunodeficiency Virus Type 1 Envelope Glycoproteins,” Journal of Virology, vol. 76, No. 6, pp. 2606-2616 (Mar. 2002). |
| Bonsignori, M., et al. “Staged induction of HIV-1 glycan-dependent broadly neutralizing antibodies” Sci Transl Med., vol. 9, No. 381, Mar. 15, 2017—(Author Manuscript available in PMC Aug. 18, 2017—26 total pages). |
| Bonsignori, M., et al., “Analysis of a Clonal Lineage of HIV-1 Envelope V2/V3 Conformational Epitope-Specific Broadly Neutralizing Antibodies and Their Inferred Unmutated Common Ancestors,” Journal of Virology, vol. 85, No. 19, pp. 9998-10009 (Oct. 2011). |
| Bonsignori, M., et al., “Maturation Pathway from Germline to Broad HIV-1 Neutralizer of a CD4-Mimic Antibody,” Cell, vol. 165, pp. 449-463 with cover page—16 total pages (Apr. 7, 2016). |
| Bonsignori, M., et al., “Two distinct broadly neutralizing antibody specificities of different clonal lineages in a single HIV-1-infected donor: implications for vaccine design,” Journal of Virology, vol. 86, No. 8, pp. 4688-4692 (published online Feb. 1, 2012). |
| Bosch, V., et al., “Mutational Analysis of the Human Immunodeficiency Virus Type 1 env Gene Product Proteolytic Cleavage Site,” Journal of Virology, vol. 64, No. 5, pp. 2337-2344 (May 1990). |
| Bransteitter, R., et al., “Biochemical analysis of Hypermutational Targeting by Wild Type and Mutant Activation-induced Cytidine Deaminase,” The Journal of Biological Chemistry, vol. 279, No. 49, pp. 51612-51621 (with cover page—11 pages total (Sep. 14, 2004). |
| Burton D. R. , “Antibody responses to envelope glycoproteins in HIV-1 infection,” Nature immunology, vol. 16, No. 6, pp. 571-576, Jun. 2015 (Author Manuscript—17 total pages—available in PMC Apr. 18, 2016). |
| Burton, D.R., et al. “Broadly Neutralizing Antibodies to HIV and Their Role in Vaccine Design,” Annu Rev Immunol, vol. 34, pp. 635-659, May 2016 (Author Manuscript—31 total pages—available in PMC Jul. 6, 2018). |
| Cany, J., et al., “AFP-specific immunotherapy impairs growth of autochthonous hepatocellular carcinoma in mice,” Journal of Hepatology, vol. 54, pp. 115-121 (2011). |
| Center, R.J., et al., “Oligomeric structure of the human immunodeficiency virus type 1 envelope protein on the virion surface,” Journal of Virology, vol. 76, No. 15, pp. 7863-7867 (Aug. 2002). |
| Chakrabarti, B.K., et al., “Modifications of the Human Immunodeficiency Virus Envelope Glycoprotein Enhance Immunogenicity for Genetic Immunization,” Journal of Virology, vol. 76, No. 11, pp. 5357-5368 (Jun. 2002). |
| Churchyard, G.J., et al, A Phase IIA Randomized Clinical Trial of a Multiclade HIV-1 DNA Prime Followed by a Multiclade rAd5 HIV-1 Vaccine Boost in Healthy Adults (HVTN204), PLoS One, vol. 6, No. 8, e21225, Aug. 2011 (last downloaded on Jan. 19, 2021 from https://journals.plos.org/plosone/article?id=10.1371 /journal.pone.0021225—10 total pages). |
| Cloanalyst Software, Boston University—Microbiology, Laboratory of Computational Immunology, downloaded from http://www.bu.edu/computationalimmunology/research/software (3 total pages) last retrieved Oct. 5, 2020. |
| Cowell, L. G. and Kepler, T.B., “The nucleotide-replacement spectrum under somatic hypermutation exhibits microsequence dependence that is strand-symmetric and distinct from that under germline mutation,” Journal of Immunology, vol. 164, pp. 1971-1976 (2000). |
| De Taeye, S. W., et al., “Immunogenicity of stabilized HIV-1 envelope trimers with reduced exposure of non-neutralizing epitopes,” Cell., vol. 163, No. 7, pp. 1702-1715, Dec. 17, 2015 (Author Manuscript—25 total pages—available in PMC Jan. 29, 2016). |
| DeCamp, A., et al. “Global panel of HIV-1 Env reference strains for standardized assessments of vaccine-elicited neutralizing antibodies,” J Virol, vol. 88, No. 5,pp. 2489-2507 (Mar. 2014). |
| Dennison, S.M., et al., “Induction of Antibodies in Rhesus Macaques That Recognize a Fusion-Intermediate Conformation of HIV-1 gp41,” Public Library of Science ONE, vol. 6, No. 11, e27824, pp. 1-14 (Nov. 30, 2011). |
| Dennison, S.M., et al., “Nonneutralizing HIV-1 gp4 I envelope cluster II human monoclonal antibodies show polyreactivity for binding to phospholipids and protein autoantigens,” J. Virol. vol. 85, No. 3, pp. 1340-1347 (Feb. 2011). |
| Dennison, S.M., et al., “Stable Docking of Neutralizing Human Immunodeficiency Virus Type 1 gp41 Membrane-Proximal External Region Monoclonal Antibodies 2F5 and 4E10 Is Dependent on the Membrane Immersion Depth of Their Epitope Regions,” Journal of Virology, vol. 83, No. 19, pp. 10211-10223 (Oct. 2009). |
| Di Noia, J.M.,et al., “Molecular mechanisms of antibody somatic hypermutation,” Annu Rev Biochem, vol. 76, pp. 1-22 including TOC—25 total pages (published online Feb. 28, 2007). |
| Doores, K. J., et al., “Two Classes of Broadly Neutralizing Antibodies within a Single Lineage Directed to the High-Mannose Patch of HIV Envelope,” Journal of Virology, vol. 89, No. 2, pp. 1105-1118 (Jan. 2015) with Author Correction, Journal of Virology, vol. 89, No. 12, p. 6525, Jun. 2015). |
| Doria-Rose, N.A., et al., “Developmental pathway for potent V1V2-directed HIV-neutralizing antibodies,” Nature, vol. 509, No. 7498, pp. 55-62 (published online Mar. 2, 2014)—Author Manuscript—33 total pages (available in PMC Apr. 13, 2015). |
| Easterhoff, D., et al. “Boosting of HIV envelope CD4 binding site antibodies with long variable heavy third complementarity determining region in the randomized double blind RV305 HIV-1 vaccine trial,” PLoS Pathogens, vol. 13, No. 2, e1006182, pp. 1-21 (Feb. 24, 2017). |
| Eroshkin, A.M., et al., “bNAber: database of broadly neutralizing HIV antibodies,” Nucleic Acids Res, vol. 42, pp. D1133-D1139 (published online Nov. 7, 2013). |
| Fera, D. and Harrison, S.C., “92BR SOSIP.664 trimer in complex with DH270.1 Fab,” EM Data Bank Accession No. EMD-8507 downloaded from EMDataResource https://www.emdataresource.org/EMD-8507 (6 total pages) last retrieved Nov. 3, 2020. |
| Fera, D., et al., “Affinity maturation in an HIV broadly neutralizing B-cell lineage through reorientation of variable domains,” Proceedings of the National Academy of Sciences of the United States of America, vol. 111, No. 28, pp. 10275-10280 (Jul. 15, 2014). |
| Gao, F. et al., “Antigenicity and Immunogenicity of a Synthetic Human Immunodeficiency Virus Type 1 Group M Consensus Envelope Glycoprotein,” Journal of Virology, vol. 79, No. 2, pp. 1154-1163 (Jan. 2005). |
| Gao, F., et al., “Cooperation of B Cell Lineages in Induction of HIV-1-Broadly Neutralizing Antibodies,” Cell, vol. 158, pp. 481-491 (Jul. 31, 2014). |
| Garces, F., et al., “Affinity maturation of a potent family of HIV antibodies is primarily focused on accommodating or avoiding glycans,” Immunity, vol. 43, No. 6, pp. 1053-1063, Dec. 2015 (Author Manuscript—22 total pages—available in PMC Dec. 15, 2016). |
| Garces, F., et al., “Structural evolution of glycan recognition by a family of potent HIV antibodies,” Cell, vol. 159, No. 1, pp. 69-79, Sep. 2014 (Author Manuscript—23 total pages—available in PMC Sep. 25, 2015). |
| GenBank with accession Nos. KY347498 through KY347701 downloaded from https://www.ncbi.nlm.nih.gov/ last retrieved on Nov. 4, 2020 (22 total pages). |
| GenBank with accession Nos. KY354938 through KY354963 downloaded from https://www.ncbi.nlm.nih.gov/ last retrieved on Nov. 4, 2020 (3 total pages). |
| Georgiev, I.S., et al., “Antibodies VRC01 and 10E8 neutralize HIV-1 with high breadth and potency even with Ig-framework regions substantially reverted to germline,” Journal of Immunology, vol. 192, pp. 1100-1106 with cover page—8 total pages (published online Jan. 3, 2014). |
| Gnanakaran, S., et al., “Genetic Signatures in the Envelope Glycoproteins of HIV-1 that Associate with Broadly Neutralizing Antibodies,” PLoS Computational Biology, vol. 6, No. 10, e1000955, 24 total pages (published Oct. 7, 2010). |
| Go, E.P., et al., “Comparative Analysis of the Glycosylation Profiles of Membrane-Anchored HIV-1 Envelope Glycoprotein Trimers and Soluble gp140,” Journal of Virology, vol. 89, No. 16, pp. 8245-8257 (Aug. 2015). |
| Goo, L., et al., “Early development of broadly neutralizing antibodies in HIV-I-infected infants,” Nature Medicine, vol. 20, No. 6, pp. 655-658, (Jun. 2014), Author Manuscript—available in PMC Dec. 1, 2014 (14 total pages). |
| Gorman, J., et al., “Structures of HIV-1 Env V1V2 with broadly neutralizing antibodies reveal commonalities that enable vaccine design,” Nature Structural and Molecular Biology, vol. 23, No. 1, pp. 81-90 (Jan. 2016)—Author Manuscript (34 total pages)—available in PMC Jun. 21, 2016). |
| Graham, B.S., et al., “DNA Vaccine Delivered by a Needle-Free Injection Device Improves Potency of Priming for Antibody and CD8+ T-Cell Responses after rAd5 Boost in a Randomized Clinical Trial,” Public Library of Science ONE, vol. 8, No. 4, e59340, pp. 1-11 (Apr. 8, 2013). |
| Gray, E.S., et al. “Isolation of a Monoclonal Antibody That Targets the Alpha-2 Helix of gp120 and Represents the Initial Autologous Neutralizing-Antibody Response in an HIV-1 Subtype C-Infected Individual,” Journal of Virology, vol. 85, No. 15, pp. 7719-7729 (Aug. 2011). |
| Gray, E. S., et al., “The Neutralization Breadth of HIV-1 Develops Incrementally over Four Years and Is Associated with CD4+ T Cell Decline and High Viral Load during Acute Infection,” Journal of Virology, vol. 85, No. 10, pp. 4828-4840 (May 2011). |
| Guo, H.-G., et al., “Characterization of an HIV-1 Point Mutant Blocked in Envelope Glycoprotein Cleavage,” Virology, vol. 174, pp. 217-224 (1990). |
| Guttman, M., et al., “Antibody potency relates to the ability to recognize the closed, pre-fusion form of HIV Env,” Nature Communications, vol. 6, No. 6144, pp. 1-11 (Feb. 5, 2015). |
| Haynes, B. F., et al., “B-cell-lineage immunogen design in vaccine development with HIV-1 as a case study,” Nat. Biotechnol., vol. 30, No. 5, pp. 423-433 (2012)—Author Manuscript available in PMC May 7, 2013 (30 total pages). |
| Haynes, B.F., et al., “Developing an HIV vaccine,” Science, vol. 355, No. 6330, pp. 1129-1130, (Mar. 17, 2017)—Author Manuscript available in PMC Mar. 17, 2018—(5 total pages). |
| He, L., et al., “Presenting native-like trimeric HIV-1 antigens with self-assembling nanoparticles,” Nature Communications, vol. 7, No. 12041, pp. 1-15 (Jun. 28, 2016). |
| Hraber, P., et al., “Prevalence of broadly neutralizing antibody responses during chronic HIV-1 infection,” AIDS, vol. 28, No. 2, pp. 163-169 (Jan. 14, 2014), Author Manuscript available in PMC Jan. 14, 2015 (13 total pages). |
| Hraber, P., et al., “Longitudinal Antigenic Sequences and Sites from Intra-Host Evolution (LASSIE) Identifies Immune-Selected HIV Variants,” Viruses, vol. 7, pp. 5443-5475 (Oct. 21, 2015). |
| Hwang, J.K., et al., “Sequence Intrinsic Somatic Mutation Mechanisms Contribute to Affinity Maturation of VRC01-class HIV-1 Broadly Neutralizing Antibodies,” Proceedings of the National Academy of Sciences of the United States of America, vol. 114, No. 32, pp. 8614-8619 (Aug. 8, 2017). |
| International Search Report and Written Opinion dated Aug. 23, 2017 by U.S. Patent and Trademark Office as International Searching Authority for International Patent Application No. PCT/US2017/020823 (15 total pages). |
| International Search Report and Written Opinion dated Feb. 1, 2018 by U.S. Patent and Trademark Office as International Searching Authority for International Patent Application No. PCT/US2017/054956 (14 total pages). |
| Jardine, J.G., et al., “Minimally Mutated HIV-1 Broadly Neutralizing Antibodies to Guide Reductionist Vaccine Design,” PLOS Pathogens, vol. 12, No. 8, e1005815, pp. 1-33 (Aug. 25, 2016). |
| Julien, J.-P., et al., “Broadly Neutralizing Antibody PGT121 Allosterically Modulates CD4 Binding via Recognition of the HIV-1 gp120 V3 Base and Multiple Surrounding Glycans,” Public Library of Science Pathogens, vol. 9, No. 5: e1003342, pp. 1-15 (May 2, 2013). |
| Keele, B. F., et al., “Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection,” Proceedings of the National Academy of Sciences of the United States of America, vol. 105, No. 21, pp. 7552-7557 (May 27, 2008). |
| Kelsoe, G., et al., “Host controls of HIV broadly neutralizing antibody development,” Immunology Review, vol. 275, No. 1, pp. 79-88 (Jan. 2017), Author Manuscript—19 total pages—available in PMC Jun. 21, 2017. |
| Kepler, T.B., “Reconstructing a B-cell clonal lineage. I. Statistical inference of unobserved ancestors,” F1000 Research 2013, vol. 2, No. 103, 12 total pages (last updated Jan. 22, 2014). |
| Kepler, T.B., et al., “Immunoglobulin gene insertions and deletions in the affinity maturation of HIV-1 broadly reactive neutralizing antibodies,” Cell Host & Microbe, vol. 16, pp. 304-313 (Sep. 10, 2014). |
| Kepler, T.B., et al., “Reconstructing a B-Cell Clonal Lineage. II. Mutation, Selection, and Affinity Maturation,” Frontiers in Immunology, vol. 5, Article 170, pp. 1-10 (Apr. 2014). |
| Kibler, K. V., et al., “Improved NYVAC-based vaccine vectors,” Public Library of Science ONE, vol. 6, No. 11: e25674, pp. 1-13, (Nov. 9, 2011). |
| Kirchherr, J. L., et al., “High throughput functional analysis of HIV-1 env genes without cloning,” Journal of Virological Methods, vol. 143, No. 1, pp. 104-111, Jul. 2007 (Author Manuscript—18 total pages—available in PMC Jul. 1, 2008). |
| Klein, F., et al., “Somatic Mutations of the Immunoglobulin Framework Are Generally Required for Broad and Potent HIV-1 Neutralization”, Cell, vol. 153, pp. 126-138 (Mar. 28, 2013). |
| Kong, L., et al., “Complete epitopes for vaccine design derived from a crystal structure of the broadly neutralizing antibodies PGT128 and 8ANC195 in complex with an HIV-1 Env trimer,” Acta Crystallographica, Section D, Biological Crystallography, vol. D71, pp. 2099-2108 (2015). |
| Kong, L., et al., “Supersite of immune vulnerability on the glycosylated face of HIV-1 envelope glycoprotein gp120,” Nature Structural Molecular Biology, vol. 20, No. 7, pp. 796-803, Jul. 2013 (Author Manuscript—22 total pages—available in PMC Jan. 1, 2014). |
| Kwon, Y.-D., et al., “Crystal structure, conformational fixation, and entry-related interactions of mature ligand-free HIV-1 Env,” Nature Structural Molecular Biology, vol. 22, No. 7, pp. 522-531, Jul. 2015 (Author Manuscript—30 total pages—available in PMC Jan. 8, 2016). |
| Lee, J. H., et al., “Model Building and Refinement of a Natively Glycosylated HIV-1 Env Protein by High-Resolution Cryoelectron Microscopy,” Structure, vol. 23, pp. 1943-1951 with cover page 10 total pages—(Oct. 6, 2015). |
| Li, M., et al., “Human Immunodeficiency Virus Type 1 env Clones from Acute and Early Subtype B Infections for Standardized Assessments of Vaccine-Elicited Neutralizing Antibodies,” J. Virol., vol. 79, No. 16, pp. 10108-10125 (Aug. 2005). |
| Li, Y., et al., “Control of expression, glycosylation, and secretion of HIV-1 gp120 by homologous and heterologous signal sequences,” Virology, vol. 204, pp. 266-278 (accepted Jun. 23, 1994). |
| Li, Y., et al., “Effects of inefficient cleavage of the signal sequence of HIV-1 gp120 on its association with calnexin, folding, and intracellular transport,” Proceedings of the National Academy of Sciences of the United States of America, vol. 93, pp. 9606-9611 (Sep. 1996). |
| Liao, H.-X., et al., “A group M consensus envelope glycoprotein induces antibodies that neutralize subsets of subtype B and C HIV-1 primary viruses,” Virology, vol. 353, pp. 268-282 (available online Jul. 7, 2006). |
| Liao, H.X., et al., “Antigenicity and Immunogenicity of Transmitted/Founder, Consensus, and Chronic Envelope Glycoproteins of Human Immunodeficiency Virus Type 1,” Journal of Virology, vol. 87, No. 8, pp. 4185-4201 with Supplementary Materials—34 total pages (Apr. 2013). |
| Liao, H.X., et al., “Co-evolution of a broadly neutralizing HIV-1 antibody and founder virus,” Nature, vol. 496, No. 7446, pp. 469-476, Apr. 25, 2013 (Author Manuscript—25 total pages—available in PMC Oct. 25, 2013). |
| Liao, H.X., et al., “Vaccine induction of antibodies against a structurally heterogeneous site of immune pressure within HIV-1 envelope protein variable regions 1 and 2,” Immunity, vol. 38, No. 1, pp. 176-186, Jan. 24, 2013 (Author Manuscript—21 total pages—available in PMC Jan. 24, 2014). |
| Loughran, G., et al., “Evidence of efficient stop codon readthrough in four mammalian genes,” Nucleic Acids Research, vol. 42, No. 14, pp. 8928-8938 (published online Jul. 10, 2014). |
| Mascola, J. R. and Haynes, B.F., “HIV-1 neutralizing antibodies: understanding nature's pathways,” Immunological Reviews, vol. 254, No. 1, pp. 225-244 Jul. 2013 (Author Manuscript—29 pages—available in PMC Jul. 1, 2014). |
| McCune, J.M., et al., “Endoproteolytic Cleavage of gp160 Is Required for the Activation of Human Immunodeficiency Virus,” Cell, vol. 53, pp. 55-67 (Apr. 8, 1988). |
| McGuire, A.T., et al., “Engineering HIV envelope protein to activate germline B cell receptors of broadly neutralizing anti-CD4 binding site antibodies”, The Journal of Experimental Medicine, vol. 210, No. 4, pp. 655-663 (Mar. 25, 2013). |
| Moody, M.A., et al., “Toll-Like Receptor 7 /8 (TLR7/8) and TLR9 Agonists Cooperate to Enhance HIV-1 Envelope Antibody Responses in Rhesus Macaques,” J. Virol., vol. 88, No. 6, pp. 3329-3339 (Mar. 2014). |
| Moore, P. L. et al., “Evolution of an HIV glycan-dependent broadly neutralizing antibody epitope through immune escape,” Nat. Med. vol. 18, No. 11, pp. 1688-1692 (Nov. 2012)—Author Manuscript—12 total pages—available in PMC Nov. 9, 2012. |
| Mouquet, H., et al., “Complex-type N-glycan recognition by potent broadly neutralizing HIV antibodies,” Proceedings of the National Academy of Sciences of the United States of America, pp. E3268-E3277, https://www.pnas.org/content/109/47/E3268 (published online Oct. 30, 2012). |
| Muenchhoff, M., et al., “Non-progressing HIV-infected children share fundamental immunological features of non-pathogenic SIV infection,” Sci Transl Med, vol. 8, No. 358: ra125 (published Sep. 28, 2016), Author Manuscript—25 total pages (available Aug. 12, 2018). |
| Munro, J.B., et al., “Conformational dynamics of single HIV-1 envelope trimers on the surface of native virions,” Science, vol. 346, Issue 6210, pp. 759-763, Nov. 7, 2014, with Supplementary Materials, pp. 1-27 and cover pages (34 total pages). |
| Neuberger, M.S., et al., “Monitoring and interpreting the intrinsic features of somatic hypermutation,” Immunol. Rev., vol. 162, pp. 107-116 (1998). |
| Nickle D. C., et al., “HIV-Specific Probabilistic Models of Protein Evolution,” PloS One, Issue 6, e503, pp. 1-11 (Jun. 2007). |
| Pancera, M., et al. “Structure and immune recognition of trimeric prefusion HIV-1 Env”, Nature, vol. 514, No. 7523, pp. 455-461, Oct. 2014 (Author Manuscript—43 total pages—available in PMC Apr. 23, 2015). |
| Pancera, M., et al., “N332-Directed Broadly Neutralizing Antibodies Use Diverse Modes of HIV-1 recognition: Inferences from Heavy-Light Chain Complementation of Function,” PloS One, vol. 8, No. 2, e55701, 11 total pages (published Feb. 19, 2013). |
| Parren, P.W.H.I., et al., “Antibody Neutralization-Resistant Primary Isolates of Human Immunodeficiency Virus Type 1,” Journal of Virology, vol. 72, No. 12, pp. 10270-10274 (Dec. 1998). |
| Pejchal, R., et al., “A potent and broad neutralizing antibody recognizes and penetrates the HIV glycan shield,” Science, vol. 334, No. 6059, pp. 1097-1103, Oct. 2011 (Author Manuscript—13 total pages—available in PMC Nov. 25, 2012). |
| Perreau, M., et al., “DNA/NYVAC Vaccine Regimen Induces HIV-Specific CD4 and CD8 T-Cell Responses in Intestinal Mucosa,” Journal of Virology, vol. 85, No. 19, pp. 9854-9862 (Oct. 2011). |
| Poignard, P., et al., “Heterogeneity of envelope molecules expressed on primary human immunodeficiency virus type 1 particles as probed by the binding of neutralizing and nonneutralizing antibodies.,” Journal of Virology, vol. 77, No. 1, pp. 353-365 (Jan. 2003). |
| Proft, T., , “Sortase-mediated protein ligation: an emerging biotechnology tool for protein modification and immobilisation,” Biotechnol. Lett., vol. 32, pp. 1-10 (published online Sep. 1, 2009). |
| Protein Data Bank (PDB) ID 4LST, downloaded from https://www.rcsb.org/structure/4LST, last retrieved Nov. 4, 2020 (7 total pages). |
| Protein Data Bank (PDB) ID 4QHL, downloaded from https://www.rcsb.org/structure/4QHL, last retrieved Nov. 4, 2020 (4 total pages). |
| Protein Data Bank Accession Code 5TPL, downloaded from https://www.rcsb.org/structure/5TPL, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5TPP, downloaded from https://www.rcsb.org/structure/5TPP, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5TQA, downloaded from https://www.rcsb.org/structure/5TQA, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5TRP, downloaded from https://www.rcsb.org/structure/5TRP, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5U0R, downloaded from https://www.rcsb.org/structure/5U0R, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5U0U, downloaded from https://www.rcsb.org/structure/5U0U, last retrieved Feb. 2, 2021 (4 total pages). |
| Protein Data Bank Accession Code 5U15, downloaded from https://www.rcsb.org/structure/5U15, last retrieved Feb. 2, 2021 (4 total pages). |
| Rerks-Ngam, S., et al., “Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand,” The New England Journal of Medicine, vol. 361, pp. 2209-2220, Dec. 3, 2009, last retrieved Oct. 6, 2020 from https://www.nejm.org/doi/10.1056/NEJMoa0908492?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub Owww.ncbi.nlm.nih.gov (22 total pages). |
| Ringe, R.P., et al., “Influences on the Design and Purification of Soluble, Recombinant Native-Like HIV-1 Envelope Glycoprotein Trimers,” Journal of Virology, vol. 89, No. 23, pp. 12189-12210 (Dec. 2015). |
| Salazar-Gonzalez, J F., et al., “Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection,” The Journal of Experimental Medicine, vol. 206, No. 6, pp. 1273-1289 (Jun. 8, 2009). |
| Sanders, R.W., et al., “A Next-Generation Cleaved, Soluble HIV-1 Env Trimer, BG505 SOSIP.664 gp140, Expresses Multiple Epitopes for Broadly Neutralizing but Not Non-Neutralizing Antibodies,” PLOS—Pathogens, vol. 9, Issue 9, e1003618, pp. 1-20 (published Sep. 19, 2013). |
| Santra, S., et al., “Mosaic Vaccines Elicit CD8+ T lymphocyte Responses in Monkeys that Confer Enhanced Immune Coverage of Diverse HIV Strains,” Nat. Med., vol. 16, No. 3, pp. 324-328, Mar. 2010 (Author Manuscript—13 total pages—available in PMC Sep. 1, 2010). |
| Sarzotti-Kelsoe, M., et al., “Optimization and validation of the TZM-bl assay for standardized assessments of neutralizing antibodies against HIV-1,” J Immunol Methods, pp. 131-146, doi:10.1016/j.jim.2013.11.022 (Jul. 2014), Author Manuscript—37 total pages (available in PMC Jul. 1, 2015). |
| Saunders, K.O., “Vaccine Elicitation of High Mannose-Dependent Neutralizing Antibodies against the V3-Glycan Broadly Neutralizing Epitope in Nonhuman Primates,” Cell Rep. vol. 18, No. 9, pp. 2175-2188 (Feb. 28, 2017), Author Manuscript—25 total pages (available in PMC Apr. 28, 2017). |
| Scheid, J.F., et al., “Sequence and structural convergence of broad and potent HIV antibodies that mimic CD4 binding,” Science, vol. 333, No. 6049, pp. 1633-1637 (Sep. 16, 2011)—Author Manuscript available in PMC May 15, 2012 (11 total pages). |
| Schmohl, L., and Schwarzer, D., “Sortase-mediated ligations for the site-specific modification of proteins,” Current Opinion in Chemical Biology, vol. 22, pp. 122-128 (available online Oct. 6, 2014). |
| Seaman, M. S., et al., “Tiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies,” Journal of Virology, vol. 84, No. 3, pp. 1439-1452 (Feb. 2010). |
| Sharma, S., et al., “Cleavage-Independent HIV-1 Env Trimers Engineered as Soluble Native Spike Mimetics for Vaccine Design,” Cell Reports, vol. 11, pp. 539-550 with cover pages—13 total pages, (Apr. 28, 2015). |
| Shaw, G.M. and Hunter, Eric, “HIV transmission,” Cold Spring Harbor Perspectives in Medicine, vol. 2, a006965, pp. 1-23 (2012). |
| Sheng, Z., et al., “Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation,” Front. Immunol., vol. 8, No. 537, published online May 10, 2017, last downloaded Oct. 7, 2020 from <https://www.ncbi.nim.nih.gov/pmc/articles/PMC5424261/>—27 total pages. |
| Simonich, C.A., et al., “HIV-1 Neutralizing Antibodies with Limited Hypermutation from an Infant,” Cell, vol. 166, No. 1, pp. 77-87 (Jun. 30, 2016), Author Manuscript—16 total pages (available in PMC Jun. 30, 2017). |
| Sliepen, K., et al., “Presenting native-like HIV-1 envelope trimers on ferritin nanoparticles improves their immunogenicity,” Retrovirology, vol. 12, No. 82, 5 total pages (2015). |
| Sok, D., “Promiscuous glycan site recognition by antibodies to the high-mannose patch of gp120 broadens neutralization of HIV,” Science Translational Medicine, vol. 6, No. 236, 236ra63, May 14, 2014 (Author Manuscript—26 total pages—available in PMC Nov. 14, 2014). |
| Sok, D., “The effects of somatic hypermutation on neutralization and binding in the PGT121 family of broadly neutralizing HIV antibodies,” PLoS—Pathogens, vol. 9, No. 11, e1003754, pp. 1-20 (published Nov. 21, 2013). |
| Steichen, J.M, et al., “HIV Vaccine Design to Target Germline Precursors of Glycan-Dependent Broadly Neutralizing Antibodies,” Immunity, vol. 45, pp. 483-496 with cover page—15 total pages (Sep. 20, 2016). |
| Stewart-Jones, G.B., “Trimeric HIV-1-Env Structures Define Glycan Shields from Clades A, B, and G,” Cell, vol. 165, pp. 813-826 (May 5, 2016) with cover page, pp. S1-S10, and Supplemental Information (cover page with pp. 1-23)—49 total pages. |
| Tabata, A., et al., “Development of a Sortase A-mediated Peptide-labeled Liposome Applicable to Drug-delivery Systems,” Anticancer Research, vol. 35, pp. 4411-4417 (accepted May 12, 2015). |
| Teng, G., et al., “Immunoglobulin somatic hypermutation,” Annu Rev Genet, vol. 41, pp. 107-120 (Jun. 4, 2007). |
| Tomaras, G.D., et al., “Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia,” Journal of Virology, vol. 82, No. 24, pp. 12449-12463 (Dec. 2008). |
| Tsukiji, S., et al., “Sortase-Mediated Ligation: A Gift from Gram-Positive Bacteria to Protein Engineering,” ChemBioChem, vol. 10, pp. 787-798 (published online Feb. 6, 2009). |
| Wagh, K., et al., “Optimal Combinations of Broadly Neutralizing Antibodies for Prevention and Treatment of HIV-1 Clade C Infection,” Public Library of Science Pathogens, vol. 12, No. 3: e1005520, pp. 1-27 (Mar. 30, 2016). |
| Walker, L.M., et al., “Broad and potent neutralizing antibodies from an African donor reveal a new HIV-1 vaccine target,” Science, vol. 326, pp. 285-289 (Oct. 9, 2009) with correction dated Feb. 19, 2010. |
| Walker, L.M., et al., “Broad neutralization coverage of HIV by multiple highly potent antibodies,” Nature, vol. 477, No. 7365, pp. 466-470, Sep. 22, 2011 (Author Manuscript—14 total pages—available in PMC Jul. 10, 2012). |
| West, Jr., A.P., et al., “Structural basis for germ-line gene usage of a potent class of antibodies targeting the CD4-binding site of HIV-1 gp120”, Proceedings of the National Academy of Sciences, vol. 109, No. 30, pp. E2083-E2090 (published online Jun. 27, 2012). |
| Williams, W. B., et al., “Diversion of HIV-1 vaccine-induced immunity by gp41-microbiota cross-reactive antibodies,” Science, vol. 349, No. 6249, aab1253, Aug. 14, 2015 (Author Manuscript—23 total pages—available in PMC Aug. 14, 2016). |
| Wu, X., et al., “Maturation and Diversity of the VRC01-Antibody Lineage over 15 Years of Chronic HIV-1 Infection,” Cell, vol. 161, No. 3, pp. 470-485 (Apr. 23, 2015)—Author Manuscript available in PMC Apr. 23, 2016 (31 total pages). |
| Yaari, G. et al., “Models of Somatic Hypermutation Targeting and Substitution Based on Synonymous Mutations from High-Throughput Immunoglobulin Sequencing Data,” Frontiers in Immunology, vol. 4, No. 358, pp. 1-19 (published online Nov. 15, 2013). |
| Yang. X., et al., “Antibody binding is a dominant determinant of the efficiency of human immunodeficiency virus type 1 neutralization,” Journal of Virology, vol. 80, No. 22, pp. 11404-11408 (Nov. 2006). |
| Yeap, L.-S., et al., “Sequence-intrinsic mechanisms that target AID mutational outcomes on antibody genes,” Cell, vol. 163, No. 5, pp. 1124-1137, Nov. 12, 2015 (Author Manuscript—26 total pages—available in PMC Nov. 19, 2016). |
| Yoon, H., et al., “CATNAP: a tool to compile, analyze and tally neutralizing antibody panels,” Nucleic Acids Res., vol. 43 (Web Server issue), pp. W213-W219—10 total pages (Jun./Jul. 2015). |
| Yu, J.-S., et al., “Generation of Mucosal Anti-Human Immunodeficiency Virus Type 1 T-Cell Responses by Recombinant Mycobacterium smegmatis,” Clinical and Vaccine Immunology, vol. 13, No. 11, pp. 1204-1211 (Nov. 2006). |
| Yu, J.-S., et al., “Recombinant Mycobacterium bovis Bacillus Calmette-Guerin Elicits Human Immunodeficiency Virus Type 1 Envelope-Specific T Lymphocytes at Mucosal Sites,” Clinical and Vaccine Immunology, vol. 14, No. 7, pp. 886-893 (Jul. 2007). |
| Yu, L., et al., “Immunologic Basis for Long HCDR3s in Broadly Neutralizing Antibodies Against HIV-1,” Front Immunol., vol. 5, No. 250, pp. 1-15 (published online Jun. 2, 2014). |
| Zhou, T, et al., “Multi-donor analysis reveals structural elements, genetic determinants, and maturation pathway for HIV-1 neutralization by VRCO1-class antibodies,” Immunity, vol. 39, No. 2, pp. 245-258, published online Aug. 1, 2013 (Author Manuscript—17 total pages—available in PMC Apr. 14, 2014). |
| Zhou, T., et al., “Structural basis for broad and potent neutralization of HIV-1 by antibody VRC01,” Science, vol. 329, No. 5993, pp. 811-817 (Aug. 13, 2010)—Author Manuscript available in PMC Aug. 13, 2011 (19 total pages). |
| Sanders, R.W., et al., “HIV-1 neutralizing antibodies induced by native-like envelope trimers,” Science, vol. 349, Issue 6244, p. 154 with aac4223-1-aac4223-10 and cover pages—13 total pages (Jul. 10, 2015). |
| Afonine, P.V., et al., “Real-space refinement in PHENIX for cryo-EM and crystallography,” Acta Crystallographica Section D, Structural Biology, vol. 74, pp. 531-544 (accepted Apr. 27, 2018). |
| Altschul, Stephen F., et al., “Basic Local Alignment Search Tool,” J. Mol. Biol., vol. 215, pp. 403-410 (1990). |
| Altschul, Stephen F., et al., “Issues in searching molecular sequence databases”, Nature Genetics, vol. 6, pp. 119-129 (Feb. 1994). |
| Barad, B.A., et al., “EMRinger: side chain-directed model and map validation for 3D Electron Cryomicroscopy,” Nature Methods, vol. 12, No. 10. pp. 943-946 (Oct. 12, 2015)—Author Manuscript available in PMC Apr. 1, 2016 (13 total pages). |
| Barnes, C.O., et al., “Structural characterization of a highly-potent V3-glycan broadly neutralizing antibody bound to natively-glycosylated HIV-1 envelope,” Nature Communications, vol. 9, No. 1251, pp. 1-12 (2018). |
| Bartesaghi, A., et al., “Atomic Resolution Cryo-EM Structure of β-Galactosidase,” Structure, vol. 26, pp. 848-856 with pp. e1-e3 (Jun. 5, 2018). |
| Cao, J., et al., “Effects of amino acid changes in the extracellular domain of the human immunodeficiency virus type 1 gp41 envelope glycoprotein,” Journal of virology, vol. 67, No. 5, 2747-2755 (May 1993). |
| Cao, L., et al., “Differential processing of HIV envelope glycans on the virus and soluble recombinant trimer,” Nature Communications, vol. 9, No. 3693, pp. 1-14 (2018). |
| Chan, D.C., et al., “HIV Entry and Its Inhibition,” Cell, vol. 93, pp. 681-684 (May 29, 1998). |
| Chen, V.B., et al., “MolProbity: all-atom structure validation for macromolecular crystallography,” Acta Crystallographica Section D, Biological Crystallography, vol. 66, pp. 12-21 (2010). |
| Chuang, G.-Y., et al., “Structure-Based Design of a Soluble Prefusion-Closed HIV-1 Env Trimer with Reduced CD4 Affinity and Improved Immunogenicity,” Journal of Virology, vol. 91, No. 10, e02268-16, pp. 1-18 (May 2017). |
| Corpet, Florence, “Multiple sequence alignment with hierarchical clustering,” Nucleic Acids Research, vol. 16, No. 22, pp. 10881-10890 (1988). |
| Cowell, L.G., et al., “The Nucleotide-Replacement Spectrum Under Somatic Hypermutation Exhibits Microsequence Dependence That Is Strand-Symmetric and Distinct from That Under Germline Mutation,” Journal of Immunology, vol. 164, pp. 1971-1976 with cover page—7 total pages (2000). |
| Crooks, E.T., et al., “Vaccine-Elicited Tier 2 HIV-1 Neutralizing Antibodies Bind to Quaternary Epitopes Involving Glycan-Deficient Patches Proximal to the CD4 Binding Site,” Public Library of Science Pathogens, vol. 11, No. 5, e1004932, pp. 1-34 (May 29, 2015). |
| De Taeye, SW et al., HIV-1 envelope trimer design and immunization strategies to induce broadly neutrailizing antibodies, Trends in Immunology, vol. 37, No. 3, pp. 221-232 (Mar. 2016)—Author Manuscript available in PMC Jun. 2, 2017 (19 total pages). |
| Ding, S., et al., “A Highly Conserved gp120 Inner Domain Residue Modulates Env Conformation and Trimer Stability,” Journal of Virology, vol. 90, No. 19, pp. 8395-8409 (Oct. 2016). |
| Dingens, A.S., et al., “Complete functional mapping of infection- and vaccine-elicited antibodies against the fusion peptide of HIV,” Public Library of Science Pathogens, vol. 14, No. 7, e1007159, pp. 1-16 (Jul. 5, 2018). |
| Doran, R.C., et al., “Characterization of a monoclonal antibody to a novel glycan-dependent epitope in the V1/V2 domain of the HIV-1 envelope protein, gp120,” Molecular Immunology, vol. 62, pp. 219-226 (available online Jul. 11, 2014). |
| Doria-Rose, N.A., “A short segment of the HIV-1 gp120 V1/V2 region is a major determinant of resistance to V1/V2 neutralizing antibodies,” Journal of Virology, vol. 86, No. 15, pp. 8319-8323 (Aug. 2012). |
| Emsley, P., et al., “Features and development of Coot,” Acta Crystallographica Section D, Biological Crystallography, vol. D66, pp. 486-501 (accepted Feb. 26, 2010). |
| Finzi, A., et al., “Topological Layers in the HIV-1 gp120 Inner Domain Regulate gp41 Interaction and CD4-Triggered Conformational Transitions,” Molecular Cell, vol. 37, pp. 656-667 (Mar. 12, 2010). |
| Gardner, M.R., et al., “AAV-expressed eCD4-Ig provides durable protection from multiple SHIV challenges,” Nature, vol. 519, No. 7541, pp. 87-91 (Mar. 5, 2015)—Author Manuscript available in PMC Sep. 5, 2015 (30 total pages). |
| Grant, T., et al., “Measuring the optimal exposure for single particle cryo-EM using a 2.6 Å reconstruction of rotavirus VP6,” eLife, vol. 4, No. e06980, pp. 1-19 (May 29, 2015). |
| Grant, T., et al., “cisTEM, user-friendly software for single-particle image processing,” eLife, vol. 7, No. e35383, pp. 1-24 (Mar. 7, 2018). |
| Gristick, H.B., et al., “Natively glycosylated HIV-1 Env structure reveals new mode for antibody recognition of the CD4-binding site,” Nature Structural & Molecular Biology, vol. 23, No. 10, pp. 906-915 (Oct. 2016)—Author Manuscript available in PMC Apr. 1, 2017 (24 total pages). |
| Grupping, K., et al., “MiniCD4 protein resistance mutations affect binding to the HIV-1 gp120 CD4 binding site and decrease entry efficiency,” Retrovirology, vol. 9, No. 36, pp. 1-16 (2012). |
| Harrison, S.C., “Viral membrane fusion,” Nature Structural & Molecular Biology, vol. 15, No. 7, pp. 690-698 (Jul. 2008). |
| He, L., et al., “HIV-1 vaccine design through minimizing envelope metastability,” Science Advances, vol. 4, eaau6769, pp. 1-19 with cover page—20 total pages (Nov. 21, 2018). |
| Herschhorn, A., et al., “The β20-β21 of gp120 is a regulatory switch for HIV-1 Env conformational transitions,” Nature Communications, vol. 8, No. 1049, pp. 1-12 (2017). |
| Higgins, D.G. and Sharp, P.M., “CLUSTAL: a package for performing multiple sequence alignment on a microcomputer,” Gene, vol. 73, pp. 237-244 (1988). |
| Higgins, D.G., et al., “Fast and sensitive multiple sequence alignments on a microcomputer,” CABIOS Communications, vol. 5, No. 2, pp. 151-153 (1989). |
| Huang, J., et al., “Identification of a CD4-Binding-Site Antibody to HIV that Evolved Near-Pan Neutralization Breadth,” Immunity, vol. 45, pp. 1108-1121 with cover page—15 total pages (Nov. 15, 2016). |
| Humphrey, W., et al., “VMD: Visual molecular dynamics,” Journal of Molecular Graphics, vol. 14, pp. 33-38 (Feb. 1996). |
| Ingale, J., et al., “High-Density Array of Well-Ordered HIV-1 Spikes on Synthetic Liposomal Nanoparticles Efficiently Activate B Cells,” Cell Reports, vol. 15, pp. 1986-1999 with cover pages—15 total pages (May 31, 2016). |
| International Search Report and Written Opinion issued by U.S. Patent and Trademark Office as International Application No. PCT/US18/20788 dated Jul. 2, 2018 (14 total pages). |
| International Search Report and Written Opinion issued by U.S. Patent and Trademark Office as International Application No. PCT/US2019/049431 dated Feb. 4, 2020 (11 total pages). |
| International Search Report and Written Opinion issued by U.S. Patent and Trademark Office as International Application No. PCT/US2019/049662 dated Feb. 11, 2020 (17 total pages). |
| International Search Report and Written Opinion issued by U.S. Patent and Trademark Office as International Application No. PCT/US2019/020436 dated Jul. 22, 2019 (12 total pages). |
| Juette, M.F., et al., “Single-molecule imaging of non-equilibrium molecular ensembles on the millisecond timescale,” Nature Methods, vol. 13, No. 4, pp. 341-344 (Apr. 2016)—Author Manuscript available in PMC Aug. 15, 2016 (14 total pages). |
| Kong, L., et al., “Uncleaved prefusion-optimized gp140 trimers derived from analysis of HIV-1 envelope metastability,” Nature Communications, vol. 7, No. 12040, pp. 1-15 (Jun. 28, 2016). |
| Korber, B., et al., “Polyvalent vaccine approaches to combat HIV-1 diversity,” Immunological Reviews, vol. 275, pp. 230-244 (2017). |
| Kulp, D.W., et al., “Structure-based design of native-like HIV-1 envelope trimers to silence non-neutralizing epitopes and eliminate CD4 binding,” Nature Communications, vol. 8, No. 1655, pp. 1-14 (2017). |
| Kwong, P.D., et al., “Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody,” Nature, vol. 393, No. 6686, pp. 648-659 (Jun. 18, 1998)—Author Manuscript available in PMC Oct. 6, 2017 (29 total pages). |
| Langley, D.R., et al., “Homology Models of the HIV-1 Attachment Inhibitor BMS 626529 Bound to gp120 Suggest a Unique Mechanism of Action,” Proteins, vol. 83, pp. 331-350 (2015). |
| Lee, J.H., et al., “A Broadly Neutralizing Antibody Targets the Dynamic HIV Envelope Trimer Apex via a Long, Rigidified, and Anionic β-Hairpin Structure,” Immunity, vol. 46, pp. 690-702, with cover page—14 total pages (Apr. 18, 2017). |
| Lee, J.H., et al., “Cryo-EM structure of a native, fully glycosylated, cleaved HIV-1 envelope trimer,” Science, vol. 351, No. 6277, pp. 1043-1048 with cover page—7 total pages (Mar. 4, 2016). |
| Lemmin, T., et al., “Microsecond Dynamics and Network Analysis of the HIV-1 SOSIP Env Trimer Reveal Collective Behavior and Conserved Microdomains of the Glycan Shield,” Structure, vol. 25, pp. 1631-1639 with pp. e1-e2 and cover page—12 pages (Oct. 3, 2017). |
| Liu, J., et al., “Molecular architecture of native HIV-1 gp120 trimers,” Nature, vol. 455, pp. 109-113 with “Methods” (6 total pages) Sep. 4, 2008. |
| Liu, Q., et al., “Quaternary contact in the initial interaction of CD4 with the HIV-1 envelope trimer,” Nature Structural & Molecular Biology, vol. 24, No. 4, Apr. 2017, pp. 370-378 with “Online Methods” and “Corrigendum: Quaternary contact in the initial interaction of CD4 with the HIV-1 envelope trimer,” published online Feb. 20, 2017; corrected after print Apr. 27, 2017 (13 total pages). |
| Lu, M., et al., “Associating HIV-1 envelope glycoprotein structures with states on the virus observed by smFRET,” Nature, vol. 568, No. 7752, pp. 415-419 (Apr. 2019) available in PMC Oct. 10, 2019 (36 total pages). |
| Ma, B.J., et al., “Envelope Deglycosylation Enhances Antigenicity of HIV1 gp41 Epitopes for Both Broad Neutralizing Antibodies and Their Unmutated Ancestor Antibodies,” Public Library of Science Pathogens, vol. 7, No. 9, e1002200, pp. 1-16 (Sep. 1, 2011). |
| Ma, X., et al., “HIV-1 Envtrimer opens through an asymmetric intermediate in which individual protomers adopt distinct conformations,” eLife, vol. 7, No. e34271, pp. 1-18 (Mar. 21, 2018). |
| Martinez-Murillo, P., et al., “Particulate Array of Well-Ordered HIV Clade C Env Trimers Elicits Neutralizing Antibodies that Display a Unique V2 Cap Approach,” Immunity, vol. 46, pp. 804-817 with pp. e1-e7 (May 16, 2017). |
| McLellan, J.S., et al., “Structure of HIV-1 gp120 V1/V2 domain with broadly neutralizing antibody PG9,” Nature, vol. 480, pp. 336-343 with “Methods” (10 total pages) Dec. 15, 2011. |
| Meanwell, N.A., et al., “Inhibitors of HIV-1 Attachment: The Discovery and Development of Temsavir and its Prodrug Fostemsavir,” Journal of Medicinal Chemistry, vol. 61, pp. 62-80 (Dec. 22, 2017). |
| Mo, H., et al., “Conserved residues in the coiled-coil pocket of human immunodeficiency virus type 1 gp41 are essential for viral replication and interhelical interaction,” Virology, vol. 329, pp. 319-327 (available online Sep. 25, 2004). |
| Munro, J.B., et al., “Structure and Dynamics of the Native HIV-1 Env Trimer,” Journal of Virology, vol. 89, No. 11, pp. 5752-5755 (Jun. 2015). |
| Munro, S. et al. “Use of peptide tagging to detect proteins expressed from cloned genes: deletion mapping functional domains of Drosophila hsp70”, The EMBO Journal, vol. 3, No. 13, pp. 3087-3093 (1984). |
| Needleman, S.B., et al. “A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins” J. Mol. Biol., vol. 48, pp. 443-453 (1970). |
| Ozorowski, G., et al., “Open and closed structures reveal allostery and pliability in the HIV-1 envelope spike,” Nature, vol. 547, pp. 360-363 with “Methods” (16 total pages), Jul. 20, 2017. |
| Pancera, M., et al., “Crystal structures of trimeric HIV envelope with entry inhibitors BMS-378806 and BMS-626529,” Nature Chemical Biology, vol. 13, No. 10, pp. 1115-1122 (Oct. 2017)—Author Manuscript available in PMC Feb. 21, 2018 (24 total pages). |
| Pancera, M., et al., “Structure of HIV-1 gp 120 with gp41-interactive region reveals layered envelope architecture and basis of conformational mobility,” Proceedings of the National Academy of Sciences of the United States of America, vol. 107, No. 3, pp. 1166-1171 (Jan. 19, 2010). |
| Pancera, M., et.al., “Structure and immune recognition of trimeric pre-fusion HIV-1 Env,” Nature, vol. 514, No. 7523, pp. 455-461 (Oct. 23, 2014)—Author Manuscript available in PMC Apr. 23, 2015 pp. 1-42 with cover page 43 total pages. |
| Pearson, W. R., et al., “Improved tools for biological sequence comparison,” Proc. Natl. Acad. Sci. U.S.A., vol. 85, pp. 2444-2448 (Apr. 1988). |
| Pettersen, E.F., et al., “UCSF Chimera—A Visualization System for Exploratory Research and Analysis,” Journal of Computational Chemistry, vol. 25, No. 13, pp. 1605-1612 (2004). |
| Powell, R.L.R., et al., “Plasticity and Epitope Exposure of the HIV-1 Envelope Trimer,” Journal of Virology, vol. 91, No. 17, e00410-00417, pp. 1-17 (Sep. 2017). |
| Pritz, S., et al., “Synthesis of Biologically Active Peptide Nucleic Acid-Peptide Conjugates by Sortase-Mediated Ligation,” Journal of Organic Chemistry, vol. 72, pp. 3909-3912 (Published on Web Apr. 14, 2007). |
| Pugach, P., et al., “A Native-Like SOSIP.664 Trimer Based on an HIV-1 Subtype B env Gene,” Journal of Virology, vol. 89, No. 6, pp. 3380-3395 (Mar. 2015). |
| Punjani, A., et al., “cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination,” Nature Methods, vol. 14, No. 3, pp. 290-296 with “Online Methods” (8 total pages), Mar. 2017. |
| Rantalainen, K., et al., “Co-evolution of HIV Envelope and Apex-Targeting Neutralizing Antibody Lineage Provides Benchmarks for Vaccine Design,” Cell Reports, vol. 23, pp. 3249-3261 with cover page—14 total pages (Jun. 12, 2018). |
| Rohou, A., et al., “CTFFIND4: Fast and accurate defocus estimation from electron micrographs,” Journal of Structural Biology, vol. 192, No. 2, pp. 216-221, (Nov. 2015)—Author Manuscript available in PMC Sep. 25, 2019 (18 total pages). |
| Saunders, K.O., et al., “Vaccine Induction of Heterologous Tier 2 HIV-1 Neutralizing Antibodies in Animal Models,” Cell Reports, vol. 21, pp. 3681-3690 (Dec. 26, 2017). |
| Scharf, L., et al., “Broadly Neutralizing Antibody 8ANC195 Recognizes Closed and Open States of HIV-1 Env,” Cell, vol. 162, pp. 1379-1390 with cover page—13 total pages (Sep. 10, 2015). |
| Shaik, M.M., et al., “Structural basis of coreceptor recognition by HIV-1 envelope spike,” Nature, vol. 565, No. 7739, pp. 318-323 (Jan. 2019)—Author Manuscript available in PMC Jun. 12, 2019 (34 total pages). |
| Smith, T. F., et al., “Comparison of Biosequences,” Adv. Appl. Math., vol. 2, pp. 482-489 (1981). |
| Stamatatos, L., et al., “An Envelope Modification That Renders a Primary, Neutralization-Resistant Clade B Human Immunodeficiency Virus Type 1 Isolate Highly Susceptible to Neutralization by Sera from Other Clades,” Journal of Virology, vol. 72, No. 10, pp. 7840-7845 (Oct. 1998). |
| Tang, G., et al., “EMAN2: An Extensible Image Processing Suite for Electron Microscopy,” Journal of Structural Biology, Article in Press: 2006 (accepted May 31, 2006), doi:10.1016/j.jsb.2006.05.009, pp. 1-9. |
| Torrents de la Peña, A., et al., “Improving the Immunogenicity of Native-like HIV-1 Envelope Trimers by Hyperstabilization,” Cell Reports, vol. 20, pp. 1805-1817 with cover page—14 total pages (Aug. 22, 2017). |
| Tran, E.E.H., et al., “Structural Mechanism of Trimeric HIV-1 Envelope Glycoprotein Activation,” Public Library of Science Pathogens, vol. 8, Issue 7, e1002797, pp. 1-18 (Jul. 12, 2012). |
| Tria, G., et al., “Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering,” International Union of Crystallography Journal, vol. 2, pp. 207-217 (accepted Jan. 30, 2015). |
| Voss, J.E., et al., “Elicitation of Neutralizing Antibodies Targeting the V2 Apex of the HIV Envelope Trimer in a Wild-Type Animal Model,” Cell Reports, vol. 21, pp. 222-235 with cover page—15 total pages (Oct. 3, 2017). |
| Wagh, K., et al., “Completeness of HIV-1 Envelope Glycan Shield at Transmission Determines Neutralization Breadth,” Cell Reports, vol. 25, pp. 893-908 with pp. e1-e7 and cover page—24 total pages (Oct. 23, 2018). |
| Wang, H., et al., “Cryo-EM structure of a CD4-bound open HIV-1 envelope trimer reveals structural rearrangements of the gp120 V1V2 loop,” Proceedings of the National Academy of Sciences of the United States of America, pp. E7151-E7158 https://doi.org/10.1073/pnas.1615939113 (published online Oct. 31, 2016). |
| Wang, H., et al., “Partially Open HIV-1 Envelope Structures Exhibit Conformational Changes Relevant for Coreceptor Binding and Fusion,” Cell Host & Microbe, vol. 24, pp. 579-592 with pp. e1-e4 and cover page—19 total pages (Oct. 10, 2018). |
| Wang, R.Y.-R., et al., “Automated structure refinement of macromolecular assemblies from cryo-EM maps using Rosetta,” eLife, vol. 5, No. e17219, pp. 1-22 (Sep. 26, 2016). |
| Wang, W., et al., “A systematic study of the N-glycosylation sites of HIV-1 envelope protein on infectivity and antibody-mediated neutralization,” Retrovirology, vol. 10, No. 14, pp. 1-14 (2013). |
| Ward, A.B., et al., “Insights Into the Trimeric HIV-1 Envelope Glycoprotein Structure,” Trends in Biochemical Sciences, vol. 40, No. 2, pp. 101-107 (Feb. 2015)—Author Manuscript available in PMC Feb. 1, 2016 (16 total pages). |
| Ward, A.B., et al., “The HIV-1 envelope glycoprotein structure: nailing down a moving target,” Immunological Reviews, vol. 275, pp. 21-32 (2017). |
| Weissenhorn, W., et al., “Atomic structure of the ectodomain from HIV-1 gp41,” Nature, 387, pp. 426-430 (May 22, 1997). |
| Xu, K., et al., “Epitope-based vaccine design yields fusion peptide-directed antibodies that neutralize diverse strains of HIV-1,” Nature Medicine, vol. 24, Jun. 2018, pp. 857-867 with “Methods” and “Nature Research: Life Sciences Reporting Summary—Jun. 2017” (19 total pages). |
| Zhang, P., et al., “Interdomain Stabilization Impairs CD4 Binding and Improves Immunogenicity of the HIV-1 Envelope Trimer,” Cell Host & Microbe, vol. 23, No. pp. 832-844 with cover page and pp. e1-e6—20 total pages (Jun. 13, 2018). |
| Zhou, T., et al., “Quantification of the Impact of the HIV-1-Glycan Shield on Antibody Elicitation,” Cell Reports, vol. 19, pp. 719-732 with cover page—15 total pages (Apr. 25, 2017). |
| Zolla-Pazner, S., et al., “Structure/Function Studies Involving the V3 Region of the HIV-1 Envelope Delineate Multiple Factors That Affect Neutralization Sensitivity,” Journal of Virology, vol. 90, No. 2, pp. 636-649 (Jan. 2016). |
| Number | Date | Country | |
|---|---|---|---|
| 20200113997 A1 | Apr 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62624620 | Jan 2018 | US | |
| 62403649 | Oct 2016 | US | |
| 62303273 | Mar 2016 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2017/020823 | Mar 2017 | US |
| Child | 16489245 | US |
