Patent Application
20180156780
The precise control of miR-17˜92 microRNA (miRNA) is essential for normal development and overexpression of certain miRNAs from this cluster is oncogenic. There remains a need for means of modulating miR-17˜92 microRNA biogenesis.
The disclosure is based, in part, on a study that shows there is a third step in biogenesis of the miR-17˜92 microRNA. A novel miRNA biogenesis intermediate, termed ‘progenitor-miRNA’ (pro-miRNA), was identified that is an efficient substrate for Microprocessor (which comprises the ribonuclease DROSHA and its co-factor, the double-stranded RNA-binding protein DGCR8). An autoinhibitory 5′ RNA fragment was found to be cleaved to generate pro-miRNA and selectively license Microprocessor-mediated production of pre-miR-17, -18a, -19a, 20a, and -19b. Using genetic, biochemical, and structural methods, two complementary cis-regulatory repression domains were found to be required for the formation of this inhibitory RNA conformation. It was determined that the endonuclease CPSF3 (CPSF73), and the Spliceosome-associated ISY1, were required for pro-miRNA biogenesis and expression of all miRNAs within the cluster except miR-92, as inhibition of either factor resulted in decreased expression of all miRNAs within the cluster except miR-92. It was further determined that SF3B1 also contributed to pro-miRNA biogenesis, as inhibition of SF3B1 also decreased expression of all miRNAs within the cluster except miR-92. Lastly it was found that an increase in the ratio of miR-17, -18a, -19a, 20a, and -19b to miR-92 from the miR-17˜92 microRNA (also known as oncomiR1), was associated with several human cancers. Accordingly, aspects of the disclosure relate to compositions and methods of modulating expression of miRNAs, e.g., modulating expression of miR-17, -18a, -19a, 20a, and/or -19b. Such compositions and methods are useful, e.g., to treat cancer and to screen for inhibitors of pro-miRNA biogenesis, such as for treatment of cancer.
In some aspects, the disclosure provides a method of treating cancer, the method comprising administering to a subject having cancer an effective amount of an inhibitor of CPSF3, ISY1, or SF3B1.
In some embodiments, the inhibitor is a small molecule, an antisense oligonucleotide, a small interfering RNA (siRNA), a microRNA (miRNA), or an antibody. In some embodiments, the inhibitor of SF3B1 is selected from the group consisting of FR901463, FR901464, FR901465, spliceostatin A (SSA), a sudemycin, a meayamycin; a pladienolide and GEX1.
In some embodiments, the cancer is a cancer associated with upregulation of oncomiR1. In some embodiments, the upregulation of oncomiR1 include upregulation of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b.
Other aspects of the disclosure relate to a method of screening for an inhibitor of microRNA (miRNA) biogenesis, the method comprising contacting a cell expressing a primary microRNA 17˜92 (pri-miR-17˜92) with a candidate substance, measuring a ratio of the level of miR-17, miR-18a, miR-19a, miR-20a, and/or miR-19b to the level of miR-92; and identifying the candidate substance as an inhibitor of miRNA biogenesis if the ratio is decreased compared to a control ratio. In some embodiments, the measuring comprises a luciferase assay. In some embodiments, the luciferase assay comprises use of a Renilla Luciferase gene, wherein a 3′UTR of the Renilla Luciferase gene contains a pri-miR-17˜92, or a fragment thereof. In some embodiments, the control ratio is the ratio in a cell that has not been contacted with the candidate substance. In some embodiments, the candidate substance is a small molecule.
Yet other aspects of the disclosure relate to a variant primary microRNA (pri-miRNA) that is incapable of forming a progenitor-microRNA (pro-miRNA). In some embodiments, the variant pri-miRNA is not processed by CPSF3. In some embodiments, the variant pri-miRNA comprises a mutation in a CPSF3 cleavage domain. In some embodiments, the variant pri-miRNA comprises a mutation in the sequence CAGUCAGAAUAAUGU. In some embodiments, the mutation is a mutation in the second A and/or the second C in the sequence CAGUCAGAAUAAUGU. In some embodiments, the variant pri-miRNA is a variant pri-miR-17˜92. Other aspects of the disclosure relate to a vector comprising a coding sequence encoding a variant pri-miRNA as described above or otherwise described herein.
In other aspects, the disclosure provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of an agent that inhibits formation of a progenitor-microRNA (pro-miRNA). In some embodiments, the agent is an inhibitor of CPSF3, ISY1, or SF3B1.
Another aspect of the disclosure relates to a method of reducing progenitor-microRNA (pro-miRNA) levels in a cell, the method comprising contacting the cell with an agent that inhibits formation of a progenitor-microRNA (pro-miRNA). In some embodiments, contacting the cell with the agent reduces the levels of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b in the cell. In some embodiments, the agent is an inhibitor of CPSF3, ISY1, or SF3B1. In some embodiments, the cell is a cancer cell.
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Aspects of the disclosure relate to compositions and methods for modulating microRNA (miRNA) biogenesis. In some aspects, the disclosure is based, in part, on a study showing a novel intermediate in miRNA biogenesis, referred to herein as a progenitor micoRNA (pro-miRNA), which was required for proper processing of primary microRNA 17˜92 (pri-miR-17˜92) into pre-miR-17, miR-18a, miR-19a, miR-20a, and miR-19b. CPSF3 (CPSF73), and the Spliceosome-associated ISY1, and SF3B1 were all shown to contribute to pro-miRNA biogenesis, as inhibition of any one of these factors decreased expression of all miRNAs within the cluster except miR-92. Further, it was found that an increase in the ratio of miR-17, -18a, -19a, 20a, and -19b to miR-92 from the miR-17˜92 microRNA (also known as oncomiR1), was associated with several human cancers. Additionally, ISY1 knockdown in human lung cancer cell lines was shown to cause the selective decreased expression of miR-17, -19a, -19b, and -20. Accordingly, it is believed that modulation of miR-17˜92 microRNA biogenesis, such as by inhibiting CPSF3, ISY1, and/or SF3B1 may be useful, e.g., in treatment of cancer.
Aspects of the disclosure relate to a method of treating cancer. In some embodiments, the method comprises administering to a subject (e.g., a subject having cancer) an effective amount of an inhibitor of CPSF3, ISY1, or SF3B1. In some embodiments, the method comprises administering to a subject (e.g., a subject having cancer) an effective amount of an agent that inhibits formation of a progenitor-microRNA (pro-miR). In some embodiments, the agent is an inhibitor of CPSF3, ISY1, or SF3B1.
CPSF3 (Cleavage and polyadenylation specificity factor subunit 3) is a component of the cleavage and polyadenylation specificity factor (CPSF) complex. An exemplary human CPSF3 protein sequence is provided below.
ISY1 (Pre-mRNA-splicing factor ISY1 homolog) is a protein was shown in a study herein to be involved in pro-miRNA biogenesis. An exemplary human ISY1 protein sequence is provided below.
SF3B1 (Splicing factor 3B subunit 1) is a subunit of the splicing factor SF3B required for A complex assembly. An exemplary human SF3B1 protein sequence is provided below.
As used herein, “treat” or “treatment” of cancer includes, but is not limited to, preventing, reducing, or halting the development of a cancer, reducing or eliminating the symptoms of cancer, suppressing or inhibiting the growth of a cancer, preventing or reducing metastasis and/or invasion of an existing cancer, promoting or inducing regression of the cancer, inhibiting or suppressing the proliferation of cancerous cells, reducing angiogenesis and/or increasing the amount of apoptotic cancer cells.
The subject may be any subject, such as a human subject having cancer. Any type of cancer is contemplated herein, including, but not limited to, leukemias, lymphomas, myelomas, carcinomas, metastatic carcinomas, sarcomas, adenomas, nervous system cancers and genitourinary cancers. Exemplary cancer types include adult and pediatric acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, anal cancer, cancer of the appendix, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, osteosarcoma, fibrous histiocytoma, brain cancer, brain stem glioma, cerebellar astrocytoma, malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, hypothalamic glioma, breast cancer, male breast cancer, bronchial adenomas, Burkitt lymphoma, carcinoid tumor, carcinoma of unknown origin, central nervous system lymphoma, cerebellar astrocytoma, malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colorectal cancer, cutaneous T-cell lymphoma, endometrial cancer, ependymoma, esophageal cancer, Ewing family tumors, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric cancer, gastrointestinal stromal tumor, extracranial germ cell tumor, extragonadal germ cell tumor, ovarian germ cell tumor, gestational trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, hepatocellular cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, islet cell tumors, Kaposi sarcoma, kidney cancer, renal cell cancer, laryngeal cancer, lip and oral cavity cancer, small cell lung cancer, non-small cell lung cancer, primary central nervous system lymphoma, Waldenstrom macroglobulinema, malignant fibrous histiocytoma, medulloblastoma, melanoma, Merkel cell carcinoma, malignant mesothelioma, squamous neck cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis fungoides, myelodysplastic syndromes, myeloproliferative disorders, chronic myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oropharyngeal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary cancer, plasma cell neoplasms, pleuropulmonary blastoma, prostate cancer, rectal cancer, rhabdomyosarcoma, salivary gland cancer, soft tissue sarcoma, uterine sarcoma, Sezary syndrome, non-melanoma skin cancer, small intestine cancer, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumors, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, trophoblastic tumors, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, or Wilms tumor. Subjects having cancer may be identified using any method known in the art (e.g., blood tests, histology, CT scan, X-ray, MRI, physical exam, cytogenitic analysis, urinalysis, or genetic testing). A subject suspected of having cancer might show one or more symptoms of the disease. Signs and symptoms for cancer are well known to those of ordinary skill in the art.
In some embodiments of any one of the methods, the subject has a cancer that is associated with upregulation of oncomiR1. In some embodiments, upregulation of oncomiR1 including upregulation of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b. As used herein, “upregulation of oncomiR1 or upregulation of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b” means that the level of oncomiR1 or of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b is above a control level, such as a pre-determined threshold or a level in a control sample. In some embodiments, the control sample is a cell, tissue or fluid obtained from a healthy subject or population of healthy subjects. As used herein, a healthy subject is a subject that is apparently free of disease and has no history of disease, such as cancer. In some embodiments, the control sample is obtained from a subject having cancer, such as a non-cancerous cell or tissue obtained from the subject having the cancer. In some embodiments, a control level is a level that is undetectable or below a background/noise level obtained using standard methods of detection (e.g., Western blot or immunohistochemistry). Upregulation includes a level that is, for example, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500% or more above a control level.
Exemplary, non-limiting sequences of pri-miR-17˜92, pro-miR, pre-miR-17, pre-18A, pre-19A, pre-20A, pre-19B, and pre-92 are provided below and in
The inhibitor of CPSF3, ISY1, or SF3B1 may be any inhibitor of CPSF3, ISY1, or SF3B1 known in the art or described herein. The inhibitor may inhibit the level and/or activity of CPSF3, ISY1, or SF3B1. Levels of CPSF3, ISY1, or SF3B1 (e.g., mRNA level or protein level) can be measured using a method known in the art or described herein, such as by Northern blot analysis, q.RT-PCR, sequencing technology, RNA in situ hybridization, in situ RT-PCR, oligonucleotide microarray, immunoassays (e.g., Western blot, immunohistochemistry and ELISA assays), Mass spectrometry, or multiplex bead-based assays. The activity of CPSF3, ISY1, or SF3B1 may also be measured using a method known in the art or described herein, e.g., by measuring a level of pro-miRNA or a level one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b.
In some embodiments, the inhibitor is a small molecule, an antisense oligonucleotide, a small interfering RNA (siRNA), a microRNA (miRNA), or an antibody. Methods of making such inhibitors are known in the art. The antibody may be a full-length antibody or an antigen-binding fragment thereof, such as a Fab, F(ab)2, Fv, single chain antibody, Fab or sFab fragment, F(ab′)2, Fd fragments, scFv, or dAb fragments. Methods for producing antibodies and antigen-binding fragments thereof are well known in the art (see, e.g., Sambrook et al, “Molecular Cloning: A Laboratory Manual” (2nd Ed.), Cold Spring Harbor Laboratory Press (1989); Lewin, “Genes IV”, Oxford University Press, New York, (1990), and Roitt et al., “Immunology” (2nd Ed.), Gower Medical Publishing, London, New York (1989), WO2006/040153, WO2006/122786, and WO2003/002609). The small molecule may be, in some embodiments, an organic compound having a molecular weight of below 900, below 800, below 700, below 600, or below 500 daltons. Methods of making such small molecules are known in the art. Antisense oligonucleotides may be modified or unmodified single-stranded DNA molecules of less than 50 nucleotides in length (e.g., 13-25 nucleotides in length). siRNAs may be double-stranded RNA molecules of about 19-25 base pairs in length with optional 3′ dinucleotide overhangs on each strand. Antisense oligonucleotides and siRNAs are generally made by chemical synthesis methods that are known in the art. MicroRNAs (miRNAs) are small non-coding RNA molecules. They may be transcribed and then processed from a primary-microRNA (pri-miRNA) to a progenitor-microRNA (pro-miRNA) to a pre-microRNA (pre-miRNA), and finally to a mature miRNA, which can act as an inhibitor. miRNAs may be produced in a subject by delivering a gene that encodes the pri-miRNA, which is then processed in the subject to a mature miRNA.
In some embodiments, the inhibitor of SF3B1 is selected from the group consisting of FR901463 (Fujisawa Pharmaceutical Co.), FR901464 (Fujisawa Pharmaceutical Co.), FR901465 (Fujisawa Pharmaceutical Co.), spliceostatin A (SSA, Sigma), a sudemycin, a meayamycin, a pladienolide (e.g., pladienolide A-G or E7107, Eisai Inc.) and GEX1 (Kyowa Hakko Kogyo Co., Ltd.). Such inhibitors are known in the art or commercially available (see, e.g., Bonnal et al. (2012) Nature Reviews: Drug Discovery. Vol 11:847-859, Fan et al. (2011) ACS Chem Biol. Vol 6(6):582-589).
An effective amount is an agent or inhibitor as described herein is an amount that is sufficient to provide a medically desirable result, such as treatment of cancer or inhibition of formation of a progenitor-microRNA. The effective amount will vary with the particular disease or disorder being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of any concurrent therapy, the specific route of administration and the like factors within the knowledge and expertise of the health practitioner. For administration to a subject such as a human, a dosage of from about 0.001, 0.01, 0.1, or 1 mg/kg up to 50, 100, 150, or 500 mg/kg or more can typically be employed.
An agent or inhibitor as described herein and compositions thereof can be formulated for a variety of modes of administration, including systemic, topical or localized administration. A variety of administration routes are available. The particular mode selected will depend upon the type of cancer or other disease being treated and the dosage required for therapeutic efficacy. The methods of the disclosure, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include, but are not limited to, oral, rectal, topical, nasal, intradermal, or parenteral routes. The term “parenteral” includes subcutaneous, intravenous, intramuscular, or infusion. The pharmaceutical compositions described herein are also suitably administered by intratumoral, peritumoral, intralesional or perilesional routes, to exert local as well as systemic effects.
Techniques and formulations generally can be found in Remington: The Science and Practice of Pharmacy, Pharmaceutical Press; 22nd edition and other similar references. When administered, an agent or inhibitor as described herein may be applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. Pharmaceutical compositions and pharmaceutically-acceptable carriers are also described herein. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the disclosure. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
Other aspects of the disclosure relate to compositions comprising an agent or inhibitor as described herein, e.g., for use in treatment of cancer. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises an agent or inhibitor as described herein and a pharmaceutically-acceptable carrier. In some embodiments, the composition is for use in treating cancer. In some embodiments, the composition is for use in modulating progenitor-microRNA (pro-miRNA) levels.
The term “pharmaceutically-acceptable carrier” as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into a subject, e.g., a human. A pharmaceutically acceptable carrier is “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the tissue of the patient (e.g., physiologically compatible, sterile, physiologic pH, etc.). The term “carrier” denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present disclosure, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the composition.
The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. The term “unit dose” when used in reference to a pharmaceutical composition of the present disclosure refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.
The formulation of the pharmaceutical composition may dependent upon the route of administration. Injectable preparations suitable for parenteral administration or intratumoral, peritumoral, intralesional or perilesional administration include, for example, sterile injectable aqueous or oleaginous suspensions and may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 propanediol or 1,3 butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
For topical administration, the pharmaceutical composition can be formulated into ointments, salves, gels, or creams, as is generally known in the art. Topical administration can utilize transdermal delivery systems well known in the art. An example is a dermal patch.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the anti-inflammatory agent. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the agent or inhibitor, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the anti-inflammatory agent is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,667,014, 4,748,034 and 5,239,660 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,832,253, and 3,854,480. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
Use of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions. Long-term release, are used herein, means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
In some embodiments, the pharmaceutical compositions used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Alternatively, preservatives can be used to prevent the growth or action of microorganisms. Various preservatives are well known and include, for example, phenol and ascorbic acid. The agent or inhibitor described herein and/or the pharmaceutical composition ordinarily will be stored in lyophilized form or as an aqueous solution if it is highly stable to thermal and oxidative denaturation. The pH of the preparations typically will be about from 6 to 8, although higher or lower pH values can also be appropriate in certain instances.
Other aspects of the disclosure relate to a method of modulating (e.g., reducing) progenitor-microRNA (pro-miRNA) levels in a cell. In some embodiments, the method comprises contacting the cell with an agent that inhibits formation of a progenitor-microRNA (pro-miRNA). In some embodiments, contacting the cell with the agent reduces the levels of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b in the cell. As used herein, “a reduced level of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b” means that the level of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b is below a control level, such as a pre-determined threshold or a level of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b in a control sample (e.g., a cell that has not been contacted with the agent). A reduced level of one or more of miR-17, miR-18a, miR-19a, miR-20a, or miR-19b includes a level that is, for example, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500% or more below a control level.
In some embodiments, the agent is an inhibitor of CPSF3, ISY1, or SF3B1. In some embodiments, the inhibitor is a small molecule, an antisense oligonucleotide, a small interfering RNA (siRNA), a microRNA (miRNA), or an antibody. Such inhibitors are described herein.
The cell may be any cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is in a subject (e.g., a cancer cell in a subject, such as a human subject). In some embodiments, the cell is ex vivo (e.g., in cell culture).
Other aspects of the disclosure relate to a method of screening for an inhibitor of microRNA (miRNA) biogenesis. In some embodiments, the method comprises contacting a cell expressing a primary microRNA 17˜92 (pri-miR-17˜92) with a candidate substance; measuring a ratio of the level of miR-17, miR-18a, miR-19a, miR-20a, and/or miR-19b to the level of miR-92; and identifying the candidate substance as an inhibitor of miRNA biogenesis if the ratio is decreased compared to a control ratio.
The measuring may be accomplished using any method known in the art or described herein. In some embodiments, the measuring comprises a luciferase assay, such as the assay described in Example 1. In some embodiments, the luciferase assay comprises use of a Renilla Luciferase gene, wherein a 3′UTR of the Renilla Luciferase gene contains a primary microRNA-17˜92 (pri-miR-17˜92), or a fragment thereof.
In some embodiments, the control ratio is the ratio in a cell that has not been contacted with the candidate substance.
In some embodiments, the candidate substance is a small molecule. In some embodiments, the candidate substance is a member of library (e.g., a library of small molecules). The library may contain, e.g., at least 20, 50, 100, 200, 500, 1000, 10,000, 100,000, 1,000,000 or more members. Some or all members of a library may be screened using a method provided herein, e.g., by high-throughput screening using assay plates or drop-based microfluidics.
Variant primary microRNAs (pri-miRNAs)
Other aspects of the disclosure relate to a variant primary microRNA (pri-miRNA), e.g., that is incapable of forming a progenitor-microRNA (pro-miRNA). In some embodiments, the variant pri-miRNA is not processed or not capable of being processed by CPSF3. In some embodiments, the variant pri-miRNA comprises a mutation in a CPSF3 cleavage domain. A CPSF3 cleavage domain is an RNA sequence that CPSF3 is capable of cleaving. An RNA sequence can be determined to be a CPSF3 cleavage domain, e.g., by contacting the RNA with CPSF3 in vitro and measuring the level of full-length and cleaved RNA produced after the contacting. In some embodiments, the variant pri-miRNA is a variant pri-miR-17˜92.
In some embodiments, the variant pri-miRNA comprises a mutation (e.g., a deletion or substitution mutation) in the sequence CAGUCAGAAUAAUGU. In some embodiments, the mutation is a mutation (e.g., a deletion or substitution mutation) in the second A and/or the second C in the sequence CAGUCAGAAUAAUGU. In some embodiments, the mutation is a substitution mutation (e.g., replacement of an A with C, G, or U and/or replacement of a C with A, G, or U).
In some embodiments, a vector is provided, comprising a coding sequence encoding a variant pri-miR as described herein. The vector may be a plasmid or viral vector (e.g., a lentiviral, retroviral, adenoviral, or adeno-associated viral vector).
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
MicroRNAs (miRNAs) represent a large family of regulatory RNAs that inhibit target gene expression by base pairing with complementary sites in the 3′ untranslated region (3′UTR) to promote messenger RNA (mRNA) decay and translational repression (Bartel, 2009). The current model of canonical miRNA biogenesis involves the two-step processing of long primary miRNA transcripts (pri-miRNAs) by the Microprocessor, comprising the ribonuclease DROSHA and its essential co-factor, the double-stranded RNA-binding protein DGCR8, to generate 50-70 nucleotide (nt) precursor miRNA (pre-miRNA) intermediates that are processed by the double-stranded ribonuclease DICER to mature ˜22 nucleotide miRNAs (Denli et al., 2004; Gregory et al., 2004; Ha and Kim, 2014). Individual pri-miRNA can be expressed from distinct miRNA loci, or from the introns or exons of protein coding genes. Furthermore some pri-miRNAs contain a single miRNA whereas other miRNAs are processed from pri-miRNAs containing clusters of several miRNAs. Regardless, Microprocessor recognizes the hairpin structures in the pri-miRNA through the stem-loop and the stem-loop-ssRNA junction and specifically cleaves both the 5′ and 3′ flanking segments to generate pre-miRNA (Ha and Kim, 2014). Pre-miRNAs are exported to the cell cytoplasm by Exportin-5 (XPO5) where they are further cleaved by a complex comprising the ribonuclease DICER and the double-stranded RNA-binding protein TRBP2, generating mature miRNA duplexes (Ha and Kim, 2014). The 5′ or 3′ miRNA is selected and loaded into the RNA-induced silencing complex (RISC) that recognizes sites in the 3′ untranslated region (UTR) of target mRNAs to repress protein expression (Bartel, 2009).
miRNAs play critical roles in normal development and their dysregulation can cause disease (Di Leva and Croce, 2010; Mendell and Olson, 2012). miRNA expression can be regulated at the level of pri-miRNA transcription but it is increasingly well appreciated that posttranscriptional mechanisms play an important role controlling miRNA expression (Siomi and Siomi, 2010). Several Microprocessor- or Dicer accessory factors, and inhibitory proteins have been identified that either facilitate or inhibit distinct subsets of miRNAs. Moreover the activity of some of these factors is linked with cell-signaling pathways to afford dynamic control of the miRNA biogenesis machinery (Mori et al., 2014; Siomi and Siomi, 2010). Perturbation of these pathways can be oncogenic. One well-characterized example of the posttranscriptional control of miRNA expression involves the RNA-binding protein LIN28 that selectively represses let-7 biogenesis embryonic stem cells (ESCs) and during early embryonic development (Heo et al., 2008; Nam et al., 2011; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008). LIN28 recruits the terminal uridylyl transferase (TUTase) ZCCHC6 and/or ZCCHC11 to promote pre-let-7 decay by DIS3L2 (Chang et al., 2013; Faehnle et al., 2014; Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012; Ustianenko et al., 2013). This pathway helps maintain an undifferentiated cell state and is often reactivated in cancer (Viswanathan et al., 2009).
To investigate how expression of other miRNAs might be posttranscriptionally regulated, the polycistronic miR-17˜92 cluster was studied. Pri-miR-17˜92 encodes six (miR-17, -18a, -19a, 20a, -19b-1, and -92a) mature miRNAs. Haploinsufficiency of this locus causes the Feingold syndrome of microcephaly, short stature, and digital abnormalities in human patients and mouse models, whereas ablation of this locus in mouse causes perinatal lethality with heart, lung, and B cell defects, thereby highlighting the importance of precise control of miRNA expression from this cluster (Concepcion et al., 2012; de Pontual et al., 2011; Mendell, 2008; Ventura et al., 2008). Conditional mouse knockout approaches underscore the importance of this miRNA cluster for kidney development and function, and neural stem cell biology (Bian et al., 2013; Marrone et al., 2014; Patel et al., 2013). Strikingly, gene amplification and increased expression of miRNAs from this cluster is observed in numerous types of cancer compared to normal tissues, and transgenic overexpression of this ‘OncomiR-1’ promotes B-cell lymphoma, T-cell acute lymphoblastic leukemia (T-ALL), and retinoblastoma in mice (Conkrite et al., 2011; He et al., 2005; Mavrakis et al., 2010; Nittner et al., 2012; Sandhu et al., 2013). Individual miRNAs within this cluster are known to promote cell proliferation, inhibit apoptosis, inhibit differentiation, and promote angiogenesis, as well as other hallmarks of cancer to drive tumorigenesis (Mendell, 2008; Mu et al., 2009; Olive et al., 2009). Moreover, while expression of miR-19 promotes lymphoma in mouse, co-expression of miR-92 suppresses this oncogenic activity(Olive et al., 2013). The miR-19:miR-92 expression ratio in Myc-induced mouse tumors appears to be dynamically regulated during lymphoma progression (Olive et al., 2013). Similarly, whereas ectopic expression of the entire miR-17˜92 cluster can result in the expansion of apparently normal multipotent hematopoietic progenitors, the imbalanced expression of miR-19 or miR-92 results in B-cell hyperplasia and erythroleukemia, respectively (Li et al., 2012). Co-expression of miR-17 suppressed the miR-92 oncogenic effects in this context. Consistent with these mouse models, elevated miR-92 and decreased miR-17 expression was observed in B-cell chronic lymphocytic leukemia patients with an aggressive clinical phenotype (Li et al., 2012). Taken together the precise regulation of this miRNA cluster, and importantly, the relative expression of individual miRNAs from within this cluster are critical for development and disease yet the mechanisms that control miR-17˜92 biogenesis remain largely unknown (Guil and Caceres, 2007; O'Donnell et al., 2005).
The expression of individual miRNAs from pri-miR-17˜92 is found to be dynamically regulated during ESC differentiation. A new paradigm for miRNA regulation in which certain sequences (repression domains) within the pri-miR-17˜92 are involved in the formation of a higher-order RNA conformation that selectively inhibits Microprocessor-mediated production of pre-miR-17, -18a, -19a, 20a, and -19b, from this cluster is described. Cleavage of pri-miR-17˜92 to remove the autoinhibitory 5′ fragment produces a new miRNA biogenesis intermediate that has been termed ‘progenitor-miRNA’ (pro-miRNA). Pro-miRNA biogenesis is dynamically regulated and specifically requires the endonuclease component of the Cleavage and Polyadenylation Specificity Factor complex, CPSF3 (also known as CPSF73 or CPSF-73) (Mandel et al., 2006), as well as the poorly characterized spliceosome factor ISY1. These factors are selectively required for the expression of all miRNAs within the cluster except for miR-92. Thus, developmentally regulated generation of pro-miRNA explains the posttranscriptional control of miR-17˜92 expression. The findings challenge the current two-step processing model for miRNA biogenesis and add an additional processing step upstream of Microprocessor that can be dynamically regulated for precise miRNA control.
Cell Culture, ESC Differentiation, and Cell Transfections. Mouse ESCs (V6.5, Dgcr8−/−, Dicer−/−, and miR-17˜92−/−) were cultured in DMEM with ESGRO (1000 units/mL), supplemented with 15% (v/v) FBS and antibiotics. Flag-DROSHA-293, and HEK293 cells were cultured in DMEM with 15%(v/v) FBS (Gregory et al., 2004). For ESC differentiation, ESGRO was removed from the media, and cells collected daily. Lipofectamine 2000 (Invitrogen) was used for both DNA and siRNA transfections according to the manufacturer's instructions.
Plasmids and Site-Directed Mutagenesis. The cDNA of mouse pri-miR-17˜92 was generated by PCR, and cloned into EcoRI and XhoI sites of pcDNA3 (Invitrogen), as well as the XhoI and NotI sites of psiCHECK™-2 (Promega). The cDNA of mouse ISY1 and CPSF3 were PCR amplified and cloned into the BamHI and SalI sites of pFlag-CMV2 (Sigma) and the cDNA of CPSF3 was also cloned into the SalI and NotI sites of pETDuet-1 Vector (Novagen). pFlag-CMV2-DGCR8 plasmid was as described before (Gregory et al., 2004). Primers used for CRISPR/Cas9 mutagenesis were designed on line (crispr.mit.edu/) and cloned into PX330 vector. Q5® Site-Directed Mutagenesis Kit (NEB) was used for both mutagenesis and for repression domain deletion following the manufacturer's instructions. All the primers used for plasmid construction are listed in Table 2.
RNA Purification and Detection of Large and Small RNAs by Northern Blot. Total RNA was extracted from each sample using Trizol reagent (Invitrogen). 200 micrograms (μg) total RNA was used for polyA(+) RNA isolation through the Dynabeads® mRNA Purification Kit (Invitrogen) following the manufacturer's instructions, while the supernatant in the step of the binding of oligo(dT) cellulose was kept and an equal volume of Isopropanol added to precipitate PolyA(−) RNA. 200 ng polyA(+), 20 μg polyA(−) and 20 μg total RNA were loaded on 15% Formaldehyde-Agarose gels for large RNA Northern blot. The cDNAs amplified by PCR corresponding to the different regions of mouse pri-miR-17˜92 were labeled by 32P-dCTP using DNA Polymerase I, Large (Klenow) Fragment (NEB) and used as probes. Small RNA Northern blot was performed as previously described (Gregory et al., 2004) using 15 μg of total RNA. Probes and primers used for amplifying the probes were all listed in Table 3.
mRNA-seq, Small RNA-seq, and Bioinformatics Analysis. 200 ng polyA(+) RNA isolated as described above was used for mRNA-seq. Sample preparation was with the TruSeq Stranded mRNA Sample Prep Kits (Illumina). Small RNA-seq sample preparation was performed as previously described (Thornton et al., 2014). Both sets of samples were subjected to Illumina high-throughput sequencing. For the analysis of mRNA-seq data, Top-hat software was used. Bowtie software was used for the alignment of small RNAs to mature miRNA sequences (www.mirbase.org/) without any mismatches permitted.
5′ RACE. 50 ng polyA(+) RNA and 5 μg PolyA(−) RNA were used for 5′ RACE through the 5′ RACE System (Invitrogen) following the manufacturer's instructions. Gene specific primers were used for reverse transcription, and then cDNAs were purified and a dC-tailadded using TDT. Two rounds of PCR were performed to amplify the PCR product, which were cloned into pGEM-T Easy vector (Promega). Different clones were picked for Sanger sequencing. Primers used for 5′ RACE were listed in Table 3.
In vitro Transcription, Microprocessor, and CPSF3 Cleavage Assays. A T7 primer and gene specific primers were used to PCR amplify pri-miR-17˜92 sequences from plasmid DNA templates. PCR products were gel-purified and used as templates for in vitro Transcription using the Riboprobe® (Promega) system together with 32P-CTP for radioactive labeling. Microprocessor purified from Flag-DROSHA-293 cells was used for Microprocessor Assays as previously described (Gregory et al., 2004). Cold RNA was produced using the same strategy without using 32P-CTP. For RNA annealing, 10 mM MgCl2 was added to 200 pmol cold RNA and incubated at 95° C. for 5 min, and then slowly cooled to RT. Annealed RNA was subjected to 5% native Polyacrylamide Gel for Ethidium bromide staining and used for Microprocessor assay followed by small RNA Northern blot analysis. His-CPSF3 complex was purified from E. coli as described previously for other proteins (Chang et al., 2013; Piskounova et al., 2011). Assays were performed using the same condition as for Microprocessor Assays described above. For RNA substrate, portions of pri-miR-17˜92 were in vitro transcribed and used as a substrate.
CRISPR/Cas9 Mutagenesis. 0.5 pmol 200 nt oligo DNA corresponding to mouse pri-miR-17˜92 sequence containing AG→CC mutation, 12 μg PX330 plasmid containing guide RNA sequence near the cleavage site and 1 μg plasmid expressing puromycin resistance gene were co-transfected into 3 million V6.5 ESCS by nucleofection using Primary Cell Nucleofector™ Kits (Lonza). After one day, puromycin was added to media to select positive ES cell clones for two days. Finally individual ESC clones were picked and screened by PCR and DNA sequencing.
Synthetic RNA Annealing. Synthetic RD and RD* RNAs were used for the annealing assay. 50 μm each RNAs were dissolved in 1× annealing buffer (10 mM Tris, pH 8.0, 20 mM NaCl). The solution was incubated for 1 min at 95° C. and cooled slowly to room temperature. Annealed RNA was subjected to 10% native Polyacrylamide Gel for SYBR® Gold staining (Invitrogen). The following synthetic RNA sequences were used (all from IDT): Repression Domain (RD), UUUGGCUUUUUCCUUUUUGUCUA; Repression Domain star (RD*), UAGAGAAGUAAGGGAAAAUCAAA.
RNase T1 Accessibility Assay. In vitro transcribed RNA was subjected to an annealing protocol as described above. RNA was incubated with RNAse T1 at 37° C. for 15 min. Phenol-chloroform was used to isolate the RNA, followed by isopropanol precipitation. Superscript III Reverse Transcriptase (Invitrogen) was used to synthesize cDNA for 15 min. Pri-miR-17˜92 specific primers was labeled by 32P-ATP using T4 Polynucleotide Kinase (NEB), and purified by Microspin™ G-50 Columns (GE Healthcare). cDNAs was finally subjected to 15% TBE-Urea Polyacrylamide Gel. Primers were listed in Table 3.
Electron Microscopy. All RNA constructs were transcribed using AmpliScribe T7 High Yield Transcription Kit. Transcribed RNAs were then gel purified with a 8% urea polyacrylamide gel and concentration was quantified using NanoDrop 1000. The purified RNA samples were supplemented with 10 mM sodium cacodylate pH 6.8, then heated up to 90 degrees C. for 30 seconds and slowly cooled down to room temperature. The annealed RNA samples were incubated with 10 mM MgCl2 for 20 min. 2 μl of 200 ng/μl RNA sample was applied to glow discharged carbon-coated grids. Grids were stained with 2% uranyl acetate. The EM micrographs were collected on a Tecnai G2 Spirit BioTWIN with Hamamatsu ORCA-HR C4742-95-12HR detector at magnification of 49000×. Image processing and particle picking was performed using EMAN2 (Tang et al., 2007). 500 particles were included for all analysis. Scikit-image was used to measure the diameter and circularity of particles. The results were then plotted using matplotlib.
Co-immunoprecipitation and Western Blots. Two days after transfection of V6.5 ESCs with pFlag-CMV2 vector expressing AGO2, ISY1, CPSF3, or DGCR8 cDNAs, each sample was collected and lysed with NETN buffer as described before (Mori et al., 2014). Anti-Flag M2 Affinity Gel (Sigma-Aldrich) was incubated with cell lysates at 4° C. for 2 h. After two washes with NETN buffer, the beads were added with sample buffer and incubated at 95° C. for 5 min. Finally, the protein samples were analyzed by western blot using α-Flag (Sigma), α-Drosha (Cell Signaling), α-ISY1 (Abcam), α-CPSF3 (Abcam), and α-CPSF2 (Abcam) antibodies.
Immunoprecipitation and q.RT-PCR. HEK293 cells were transfected with pFlag-CMV2 vectors expressing ISY1, CPSF3, or DGCR8. After UV cross-linking, lysates were collected with NETN buffer as described before (Mori et al., 2014). One tenth of each cell lysate was directly used for RNA extraction using Trizol reagent (Invitrogen), and the rest was incubated with Anti-Flag M2 Affinity Gel (Sigma-Aldrich) at 4° C. overnight. Anti-Flag M2 Affinity Gel was then washed five times using NETN buffer and before RNA extraction with Trizol reagent and analysis by q.RT-PCR.
RNA-affinity Purification and Mass Spectrometry. In vitro transcribed cold RNA was conjugated to agarose beads and incubated with whole-cell extract from V6.5 ES cells, and the affinity eluate was subjected to SDS-PAGE followed by Coomassie blue staining. Bands were excised, and subjected to mass spectrometric sequencing as described before (Chang et al., 2013).
Lucierase Reporter Assays. Dgcr8−/− ESCs were co-transfected with psiCHECK™-2 vectors containing mouse pri-miR-17˜92 with the indicated siRNA sequences (Table 1) using Lipofectamine 2000 (Invitrogen). After two days of transfection, cells were collected and Passive Lysis Buffer (Promega) added and incubated at RT for 20 min. Dual-Luciferase® Reporter Assay System (Promega) was used to measure the Renilla and Firefly activity.
mRNA and miRNA by q.RT-PCR. For mRNA analysis, 3 μg total RNA was treated with DNase (Promega) for 2 hr to remove genomic DNA. Superscript III Reverse Transcriptase (Invitrogen) and random primers were used to synthesize cDNA, and IQ SYBR Green Supermix (Bio-Rad) was used to quantify the cDNA. For miRNA analysis, 10 ng total RNA was used. Taqman probes and Universal PCR master mix (Applied Biosystems) were used for cDNA detection. All the primers used for qPCR were listed in Table 4.
miR-17˜92 Expression is Regulated Posttranscriptionally During ESC Differentiation.
To investigate possible miR-17˜92 regulatory mechanisms, miRNA expression over the course of ESC differentiation was analyzed. As a control, levels of let-7 miRNA that is repressed by Lin28 in ESCs and accumulates during the later stages of cell differentiation were monitored (Viswanathan et al., 2008). This analysis revealed that, while miR-92 expression was relatively constant throughout the differentiation time course and correlated quite well with expression of pri-miR-17˜92, the relative expression of the other miRNAs from this locus was more dynamic with a peak in miR-17, -18a, -19a, -20a, and -19b expression observed around days 2-3 of differentiation, thereby implicating posttranscriptional control mechanism(s) (
Identification of a Processed pri-miR-17˜92 Intermediate.
To confirm the sequencing results and to obtain additional experimental validation of the pri-miRNA, Northern blots with probes spanning the locus were performed (
To further explore the possibility that these RNA fragments correspond to specific cleavages of the pri-miR-17˜92 and to map with nucleotide resolution the cleavage sites, 5′ Rapid Amplification of cDNA ends (5′ RACE) was performed using the indicated primers (
The 5′ Fragment of pri-miR-17˜92 Inhibits Microprocessor Activity.
To examine whether the pro-miRNA might represent a miRNA biogenesis intermediate, different RNA substrates were tested in Microprocessor assays. The pri-miRNA sequence used in these experiments corresponds to a genomic DNA sequence beginning at the 5′ end of Exon 2 and ending at the 3′ end of Exon 6 (
Cleavage of pri-miR-17˜92 to pro-miRNA is a Key Step in miRNA Maturation.
To explore the functional impact of pri-miRNA cleavage to the pro-miRNA biogenesis intermediate, rescue experiments in mouse ESCs in which the endogenous miR-17˜92 is deleted were performed. miR-17˜92 knockout ESCs were transfected with plasmids expressing either the wild-type pri-miR-17˜92 or a mutant version in which two nucleotides (AG to CC mutation) at the potential cleavage site were mutated. q.RT-PCR analysis indicated that both plasmids produced similar levels of pri-miRNA transcript in transfected ESCs (
Since the 5′ RACE strategy employed could not accurately distinguish whether cleavage occurred after the A or the G nucleotides in the pri-miR-17˜92 (due to the dCTP 3′ tailing of the cDNA with terminal deoxynucleotidyl transferase and use of complementary oligo-G containing PCR primer), additional mutagenesis at the cleavage site was performed and the effects on miRNA expression were examined in rescue experiments. This revealed that mutation of the G nucleotide had no impact on miR-17˜92 whereas the A mutation dramatically suppressed miRNA expression comparable to the AG mutant. Furthermore mutation of the preceding C nucleotide similarly selectively inhibited miRNA biogenesis (
Identification of Two Complementary Repression Domains that Control miRNA Biogenesis.
Next, to precisely define the cis-regulatory RNA sequences present in the 5′ fragment of pri-miR-17˜92, additional genetic rescue experiments were performed using a panel of pri-miR-17˜92 expression constructs in which portions of the 5′ inhibitory fragment are deleted. q.RT-PCR analysis of transfected (pri-miR-17˜92−/−) ESCs revealed that a ˜40 nt domain located ˜80-120 nt upstream of the identified cleavage site is responsible for the selective repression of miRNA expression (
It was postulated that the RD might impact the secondary structure of this pri-miRNA cluster to suppress Microprocessor activity. The secondary structure of pri-miR-17˜92 containing the minimal RD was computationally predicted using the RNAFold algorithm (rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi). This indicated that the RD might base-pair with a highly conserved sequence that was termed repression domain* (RD*) that is located between pre-miR-19b and pre-miR-92 (
pri-miR-17˜92 Adopts an RNA Conformation that Inhibits Microprocessor.
To gain insight into the mechanism by which pri-miR-17˜92 processing might be regulated, the possible involvement of RNA conformational changes mediated by the RD and RD* were tested. The extent of selective Microprocessor inhibition was maximized by RNA annealing in the presence of MgCl2—a result that further supports that the repressive effect of the 5′ region likely involves an RNA conformational change (
The CPSF3 Endonuclease is Required for pro-miRNA Biogenesis and miRNA Expression.
To identify protein factors that might be involved in pro-miRNA biogenesis and the posttranscriptional regulation of miR-17˜92 expression, RNA affinity purifications and mass spectrometric protein identification were performed. pri-miR-17˜92 and pro-miR-17˜92 RNA sequences were in vitro transcribed, covalently coupled to agarose beads, and incubated with extracts prepared from mouse ESCs. Several RNA-binding proteins including DGCR8 were identified in both RNA purifications. However, several proteins were found exclusively in the pri-miR-17˜92 purification. The majority of the identified proteins fall into two main categories; factors involved in pre-mRNA 3′ end cleavage, and splicing regulators (
Spliceosome Subunits are Required for pro-miRNA Biogenesis and miRNA Expression.
Considering the mass spec data as well as a previous report that found that processing the 3′ end of histone pre-mRNAs by CPSF3 requires components of the U7 snRNP, whether certain spliceosome subunits might help recruit the CPSF3 endonuclease activity to pri-miR-17˜92 in vivo was next examined (Dominski et al., 2005). The role of ISY1, a poorly characterized homolog of the non-essential Isy1p protein in yeast was initially examined. Isy1p is a subunit of the NineTeen Complex, and is involved in the first step of splicing to control splicing fidelity (Dix et al., 1999; Villa and Guthrie, 2005). SF3B1, a component of the U2 small nuclear ribonucleoprotein complex (U2 snRNP) that, although not identified in the mass spectrometric analysis of pri-miR-17˜92 associated proteins, is a much more well characterized splicing factor and was subsequently added to the characterization. siRNAs were used to individually knockdown ISY1, and SF3B1 in ESCs and the effects on miRNA expression were examined (
To provide more evidence that splicing factors are selectively required for miR-17˜92 expression, rescue experiments were performed in miR-17˜92 knockout ESCs. It was found that, whereas DGCR8 was required for expression of miRNAs from both the pro-miR-17˜92 as well as the plasmid containing pro-miR-17˜92 with the upstream sequences (pro+5′F), the splicing factors ISY1, and SF3B1 were specifically required for the expression of miRNAs from pro+5′F since depletion of these factors had no effect on expression of the miRNAs expressed from the pro- plasmid (
To further confirm the role of these factors in pro-miRNA biogenesis, affinity purification of DGCR8, CPSF3, and ISY1 containing ribonucleoprotein complexes from cells was performed and the associated RNA was analyzed by q.RT-PCR. For these experiments, cells were co-transfected with plasmids expressing the indicated Flag-tagged protein together with plasmids expressing either wild-type pri-miR-17˜92, the cleavage site mutant version of pri-miR-17˜92, or the corresponding pro-miRNAs. This revealed that unlike DGCR8 that associates with all the RNAs tested, CPSF3 and ISY1 specifically associate with the cleavage site mutant pri-miR-17˜92, consistent with the specific role of these factors in pro-miRNA biogenesis (
A Luciferase reporter containing the 5′ region of pri-miR-17˜92 was generated. pri-miR-17˜92 sequences (beginning from the start of exon 2 and ending in the pre-miR-17 hairpin) were cloned into the 3′UTR of the Renilla Luciferase gene (
Pro-miRNA Biogenesis Controls miR-17˜92 Expression in Embryonic Stem Cells.
It was considered that developmentally regulated expression of some of these factors required for pri-miR-17˜92 processing might be responsible for the dynamic miRNA expression patterns observed from this cluster during ESC differentiation (
Considering the developmental requirement of ISY1 for miRNA expression and the involvement of both ISY1 and CPSF3 in pro-miRNA biogenesis, the possible physical and functional interaction between ISY1, CPSF3, and the Microprocessor was next examined. ISY1 and CPSF3 were found to specifically associate with Drosha and DGCR8 in co-immunoprecipitation experiments (
A novel paradigm for miRNA expression control has been uncovered. While proteins that inhibit or promote the biogenesis of certain miRNAs are known, the discovery that cis-acting sequences within the pri-miRNA can selectively and dynamically regulate expression of a miRNA cluster through the formation of an inhibitory RNA conformation reveals an additional posttranscriptional regulatory mechanism for the precise control of miRNA expression. This mechanism also allows the uncoupling of expression of individual miRNAs from within a single pri-miRNA cluster. In exploring the mechanism of the dynamic posttranscriptional control of pri-miR-17˜92 miRNA expression during ESC differentiation, a new miRNA biogenesis intermediate that has been termed progenitor miRNA (pro-miRNA) was discovered. Specific cleavage of an autoinhibitory 5′ RNA fragment is required to selectively license Microprocessor-mediated production of most pre-miRNAs from pri-miR-17˜92. A biochemical approach was employed to identify possible factors involved in pro-miRNA biogenesis and showed using a variety of approaches that the CPSF3 ribonuclease as well as the spicing factor ISY1 (and other U2 snRNP components) are required for pro-miRNA biogenesis and selective expression of all miRNAs within the cluster except for miR-92. Developmentally regulated ISY1 expression was found to be critical for controlling expression of miRNAs from pri-miR-17˜92 during ESC differentiation.
The identification of pro-miRNA as a novel biogenesis intermediate upstream of Microprocessor challenges the current two-step processing model for miRNA biogenesis. This adds an additional regulatory step for the posttranscriptional control of miR-17˜92 expression. It will therefore be interesting to explore the more widespread relevance of pro-miRNA intermediates in the miRNA biogenesis pathway. In this regard, large, partially processed, pri-miRNAs have been observed in mouse ESCs and it is tempting to speculate that these might also represent pro-miRNA intermediates in the miRNA biogenesis pathway (Houbaviy et al., 2005). Ongoing and future research effects will uncover the widespread relevance of this pathway. Considering that pro-miRNA genesis is the key regulatory step controlling miR-17˜92 expression, it is likely that this paradigm will apply to other miRNAs and in different cellular contexts. This also highlights the complexity of posttranscriptional control of miRNA expression that involves the coupling and coordinated action of multiple cellular machineries that might assemble as part of an integrated ‘holo-factory’ on pri-miRNAs for precise and developmental control of miRNA expression (
Several factors have been identified that either promote or suppress Microprocessor activity for different subsets of miRNAs (Siomi and Siomi, 2010). However autoregulation of miRNA biogenesis mediated by sequences present in the pri-miRNA has not so far been described. The present data implicate RNA conformation in the selective inhibition of Microprocessor cleavage of pri-miR-17˜92. In the presence of the autoinhibitory 5′ fragment the pri-miR-17˜92 adopts a restrictive conformation that blocks processing of all pre-miRNAs in the cluster except for pre-miR-92. Cleavage of the pri-miR-17˜92 to remove the 5′ inhibitory region likely permits the adoption of a less highly structured pri-miR-17˜92 conformation that favors cleavage by Microprocessor. Indeed, a role for RNA tertiary structure in regulating miR-17˜92 has been previously suggested (Chakraborty et al., 2012; Chaulk et al., 2011; Chaulk et al., 2014). However, those reports deal exclusively with the miR-17˜92 cluster without any flanking sequences (i.e., the equivalent of the pro-miRNA). Also, the proposed model whereby the miR-17˜92 cluster adopts a globular tertiary structure with pre-miR-19b and pre-miR-92 at the core does not correlate well with the relative abundance of mature miRNAs in cells since miR-19b, and/or miR-92 are often the most highly expressed members of the cluster. The physiological relevance of this work therefore remains unclear (Chaulk et al., 2011). The identification of two complementary repression domains that nucleate the formation of a repressive higher order RNA conformation to control miRNA biogenesis might also be a relevant mechanism for the control of other RNAs including protein-coding mRNAs.
The exact mechanism and full repertoire of factors responsible for the coupling of pri-miR-17˜92 transcription, recruitment of CPSF3, ISY1, and other spliceosome subunits for the precise cleavage of the autoinhibitory RNA fragment, and subsequent processing by Microprocessor remain active areas of investigation. CPSF3 is known to be required for the cleavage (and subsequent polyadenylation at the 3′-end) of mRNAs and is also involved in the generation of the 3′ end of (non-polyadenylated) histone mRNAs (Dominski et al., 2005; Mandel et al., 2006). In the latter case, CPSF3 cleavage activity is directed by the U7 small nuclear ribonucleoprotein (snRNP) (Dominski et al., 2005). Although CPSF3 protein is sufficient to specifically cleave pri-miR-17˜92 in vitro, this activity was found to be enhanced by ISY1 complex, and ISY1 is required for pro-miRNA biogenesis in cells. The physical association of CPSF3 with both the U1 SnRNP as well as the U2 snRNP has been reported (Kyburz et al., 2006; Wassarman and Steitz, 1993). Analogous to the processing of histone pre-mRNAs, a role for components of the U2 snRNP was found, and in particular, a poorly characterized protein ISY1 that likely helps recruit and direct CPSF3 activity in vivo. This activity requires the endonuclease CPSF3 but not other complex components. Furthermore, pri-miR-17˜92 cleavage does not lead to polyadenylation since the 5′ fragment is detected specifically in the polyA− RNA fraction suggesting that these activities are uncoupled in this context. Moreover, Drosha is known to physically associate with the spliceosome yet the precise functional relevance of this interaction is not completely understood and might be variable depending on the particular pri-miRNAs (Kataoka et al., 2009; Kim and Kim, 2007; Morlando et al., 2008; Pawlicki and Steitz, 2010). The present model implicates multiple protein complexes and different activities that converge to regulate pro-miRNA biogenesis in a developmentally regulated manner (
As described below, evidence was found for the widespread posttranscriptional control of pri-miR-17˜92 expression that correlated with elevated ISY1 expression in human primary tumors, and that ISY1 knockdown caused decreased expression of oncomiRs from this cluster in human cancer cells.
Human cancer data was downloaded from the TCGA database (https://tcga-data.nci.nih.gov/tcga/tcgaHome2.jsp). R language was used for the statistics analysis. H1299 and A549 cells were cultured in DMEM with 15% (v/v) FBS (Gregory et al., 2004). Lipofectamine 2000 (Invitrogen) was used for both DNA and siRNA transfections according to the manufacturer's instructions.
Posttranscriptional Control of miR-17˜92 Expression in Human Cancer
Since miRNAs from the pri-miR-17˜92 promote tumorigenesis are overexpressed in a variety of different cancer types it was next determined whether expression of these miRNAs might be regulated posttranscriptionally in human cancer. Small RNA sequencing data from The Cancer Genome Atlas (TCGA) was analyzed and it was found that the relative expression of miR-17, -18, -19, and -20 is elevated compared to miR-92 in a variety of primary human tumors relative to the corresponding normal tissue. Since these miRNAs are processed from a common pri-miRNA, these data support that posttranscriptional mechanisms might underlie the elevated oncomiR expression in human lung squamous cell carcinoma (
This analysis of primary human tumors and cancer cell lines indicate that this pathway is exploited for increased oncomiR expression in cancer. This suggests that targeting the pathway, e.g., using splicesome inhibitors, such as inhibitors of ISY1, SF3B1, or CPSF3.
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
This application claims the benefit under 35 U.S.C. § 119(e) of U.S. provisional application filed May 26, 2015, entitled “COMPOSITIONS AND METHODS FOR MODULATING ONCOGENIC MIRNA”, Ser. No. 62/166,180, the contents of which are incorporated by reference herein in their entirety.
This invention was made with government support under R01GM086386 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US16/34441 | 5/26/2016 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62166180 | May 2015 | US |
