Patent Application
20240167002
The instant application contains a Sequence Listing that has been submitted electronically in XML, format and is hereby incorporated by reference in its entirety. The electronic copy of the Sequence Listing, created on Jun. 4, 2023, is named 025297.D1004.xml and is 65,796 bytes in size.
Adeno-associated virus (AAV) is a small non-enveloped virus belonging to the family Parvoviridae and the genus Dependoparvovirus. AAV is composed of a single-stranded DNA genome packaged into capsids assembled from three capsid proteins—viral protein (VP) 1, VP2, and VP3—at an approximate molar ratio of 1:1:10 (Kondratov et al., Mol Ther. 25(12):2661-75 (2017)). The capsid proteins are encoded by a single capsid (cap) gene and are generated by alternative splicing and differential codon usage (id.). VP1 is the largest capsid protein (81.6 kD). VP2 (66.6 kD) is an N-terminal truncated form of VP1. VP3 (59.9 kD) is an N-terminal truncated form of VP2. See, e.g., Cecchini et al., Hum Gene Ther. 22:1021-30 (2011).
Recombinant AAV (rAAV) has been intensively explored as a vector for gene therapy and DNA vaccines in humans. For rAAV production in mammalian cells, a helper virus (e.g., adenovirus, vaccinia, or herpesvirus) is needed. Over the years, several modifications have been made to facilitate the production of rAAV, including (1) identifying and cloning the minimal set of helper proteins (adenovirus E1, E2A, E4, and VA), (2) providing the AAV Rep (Rep78, Rep68, Rep52, and Rep40) and capsid proteins in trans, and (3) developing a transgene system that allows packaging of DNA sequences flanked by the AAV Inverted Terminal Repeats (ITRs) (Samulski et al., J Virol. 63(9):3822-8 (1989)). When these three components are introduced into mammalian cells, rAAV containing a transgene of interest can be readily purified. Recombinant AAV so produced has been used in clinical trials (Clement and Grieger, Mol Ther Methods Clin Dev. 3:16002 (2016)).
The need for scaled-up rAAV production for larger clinical trials and commercialization has led to the development of insect cell-based production systems that utilize baculoviral vectors to express the Rep and capsid proteins and to carry the coding sequence for a transgene-containing AAV vector genome, which is packaged into rAAV capsids. Such systems do not require adenovirus helper functions (see, e.g., Urabe et al., Hum Gene Ther. 13:1935-43 (2002); Urabe et al., J Vir. 80(4):1874-85 (2006); Chen et al., Mol Ther. 16(5):924-30 (2008); Smith et al., Mol Ther. 17(11):1888-96 (2009); and Mietzsch et al., Hum Gene Ther Methods 28(1):15-22 (2017)). While the baculovirus-insect cell system has been successfully utilized for rAAV production at multiple scales, it has been observed that rAAV generated in insect cells has reduced VP1 content (e.g., with a VP1:VP2:VP3 ratio of approximately 1:1:30 to 1:1:60) and consequently reduced potency, as compared to rAAV produced in mammalian cells (see, e.g., Urabe et al., 2002, supra; Kohlbrenner et al., Mol Ther. 12(6):1217-25 (2005); Urabe et al., 2006, supra; Aslanidi et al., Proc Natl Acad Sci USA 106(13):5059-64 (2009); Kondratov et al., supra; and Mietzsch et al., supra).
Thus, there remains a need for an improved baculovirus-insect cell system for producing rAAV at industrial scales.
The present disclosure describes modifications made to the AAV cap gene in the baculoviral helper construct that improve the capsid protein ratio, potency, and yield of rAAV produced in a baculovirus-insect cell system.
In one aspect, the present disclosure provides a nucleic acid construct comprising a nucleotide sequence encoding AAV VP1, VP2, and VP3 proteins, wherein the VP1 protein and the VP2 protein comprise two or more mutations at residues 157, 162, 164, 179, 188, 194, 196, 197, 200, and 201 (numbering according to SEQ ID NO:1) relative to wildtype VP1 and VP2 proteins, respectively. As used herein, “numbering according to SEQ ID NO:1” means amino acid residue positions in SEQ ID NO:1, or the corresponding amino acid residue positions in a different VP1 sequence (e.g., VP1 sequence from a serotype other than AAV6). In some embodiments, the VP1 protein and the VP2 protein comprise two or more mutations selected from the group consisting of S157A, T162S, Q164A, S179T, L188I, T194A, A196S, A197G, P200S, and T201L (numbering according to SEQ ID NO:1). In further embodiments, the VP1 protein and the VP2 protein comprise all of these ten mutations.
In some embodiments, the VP1 protein further comprises one or more mutations at residues 67, 81, 84, 85, and 92 relative to wildtype VP1 protein (numbering according to SEQ ID NO:1). In certain embodiments, the VP1 protein comprises one or more mutations selected from the group consisting of A67E, Q81R, K84D, A85S, and R92K. In further embodiments, the VP1 protein comprises all of these five mutations.
In some embodiments, the VP1 protein and the VP2 protein disclosed herein are identical to the VP1 protein and the VP2 protein, respectively, of AAV6 but for the mutations. In particular embodiments, the VP1 protein and the VP2 protein are derived from AAV6 and comprise mutations S157A, T162S, Q164A, S179T, L188I, T194A, A196S, A197G, P200S, and T201L relative to wildtype AAV6 VP1 and VP2 proteins, respectively.
In some embodiments of the nucleic acid construct, the nucleotide sequence also comprises an open reading frame coding for assembly-activating protein (AAP), wherein the AAP comprises one or more mutations at residues 8, 10, 12, 17, 21, and 22 (numbering according to SEQ ID NO:10) relative to wildtype AAP protein. As used herein, “numbering according to SEQ ID NO:10” means amino acid residue positions in SEQ ID NO:10, or the corresponding amino acid residue positions in a different AAP sequence (e.g., AAP sequence from a serotype other than AAV6). In certain embodiments, the AAP comprises one or more (e.g., all) mutations selected from the group consisting of P8Q, H10L, L12Q, Q17P, L21Q, and L22V. In particular embodiments, the AAP is identical to wildtype AAP of AAV6 but for the AAP mutations.
In particular embodiments, the nucleic acid construct of the present disclosure comprises a coding sequence for SEQ ID NO:7, with or without the first amino acid. In further embodiments, the nucleic acid construct comprises nucleotides 18-151 of SEQ ID NO:14. In further embodiments, the nucleic acid construct comprises 10 or more (e.g., 20 or more, 30 or more, 40 or more, 50 or more, 75 or more, 100 or more, 125 or more, or 150 or more) contiguous nucleotides, or the entire nucleotide sequence, of SEQ ID NO:14.
In one aspect, the present disclosure provides a nucleic acid construct comprising a nucleotide sequence encoding AAV VP1, VP2, and VP3 proteins, wherein the VP1 protein comprises one or more mutations at residues 81, 84, 85, and 92 relative to wildtype VP1 protein (numbering according to SEQ ID NO:1). In some embodiments, the VP1 protein comprises one or more mutations selected from the group consisting of Q81R, K84D, A85S, and R92K. In further embodiments, the VP1 protein comprises all of these four mutations. In particular embodiments, the VP1 protein further comprises a mutation at residue 67, e.g., an A67E mutation. In some embodiments, the VP1 protein is identical to the VP1 protein of AAV6 but for the mutation(s). In certain embodiments, the VP1 protein comprises mutations A67E, Q81R, K84D, A85S, and R92K relative to wildtype AAV6 VP1.
In one aspect, the present disclosure provides a nucleic acid construct comprising a nucleotide sequence encoding AAP, wherein the AAP comprises one or more mutations at residues 8, 10, 12, 17, 21, and 22 (numbering according to SEQ ID NO:10) relative to wildtype AAP protein. In some embodiments, the AAP comprises one or more (e.g., all) mutations selected from the group consisting of P8Q, H10L, L12Q, Q17P, L21Q, and L22V.
In some embodiments, the nucleic acid construct of the present disclosure further comprises an AAV rep gene.
In some embodiments, the nucleic acid construct of the present disclosure is a baculoviral vector, wherein the capsid nucleotide sequence is operably linked to a promoter that is active in insect cells.
The present disclosure also provides an insect cell comprising a presently described nucleic acid construct and a recombinant AAV virion produced in the insect cell.
The present disclosure also provides a recombinant AAV virion comprising (i) a genome having a transgene of interest flanked by a pair of AAV Inverted Terminal Repeats (ITR), and (ii) a capsid assembled from the VP1, or both VP1 and VP2 proteins, expressed from a presently described nucleic acid construct.
In yet another aspect, the present disclosure provides a method of producing a recombinant AAV virion, comprising: providing the insect cell described herein, wherein the insect cell also expresses AAV Rep proteins and comprises the coding sequence for an AAV vector comprising a transgene of interest flanked by a pair of AAV ITRs; culturing the insect cell under conditions to allow expression of the VP1, VP2, VP3 proteins, replication of the AAV vector, and packaging of the AAV vector into a capsid assembled from the expressed VP1, VP2, and VP3 proteins, and recovering the packaged capsid. In some embodiments, the gene(s) encoding the AAV Rep, VP1, VP2 and VP3 proteins reside on one or more nucleic acid constructs. In some embodiments, the gene(s) encoding the AAV Rep proteins reside on one or more nucleic acid constructs that are not the nucleic acid construct(s) expressing the VP1, VP2, and VP3 proteins. In some embodiments, the gene(s) encoding the AAV VP1, VP2 and VP3 proteins reside on one or more nucleic acid constructs that are not the nucleic acid construct(s) expressing the Rep proteins. In some embodiments, the gene(s) encoding the Rep proteins and the gene(s) encoding the VP1, VP2, and VP3 proteins are incorporated into the genome of the insect cell.
Also provided in the present disclosure are pharmaceutical compositions comprising the present rAAV and a pharmaceutically acceptable carrier.
Other features, objectives, and advantages of the invention are apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments and aspects of the invention, is given by way of illustration only, not limitation. Various changes and modification within the scope of the invention will become apparent to those skilled in the art from the detailed description.
The present disclosure provides improved baculovirus-insect cell systems and related compositions for producing potent rAAV capsids at high yield. In the systems, the cap gene in the baculoviral helper construct is mutated in two or more codons such that the VP1 and VP2 proteins encoded by the gene are resistant to proteolytic degradation during the production process. Because the cap gene also contains the open reading frame for AAP, these codon changes may also cause mutations in the AAP. The inventors have made the unexpected discovery that the mutations in VP1/VP2 and/or AAP improve the rAAV's infectivity, i.e., potency. Without being bound by theory, the inventors contemplate that the increase in potency may be attributed to the improved integrity of the capsid proteins in insect cells and the improved abilities of the mutated AAP to facilitate capsid assembly.
Additionally or alternatively, the cap gene in the baculoviral helper construct is mutated in one or more codons in the region coding for the VP1 PLA2 domain such that the engineered PLA2 domain acquires higher enzymatic activity. The inventors have made the unexpected discovery that higher PLA2 enzymatic activity may lead to a higher yield of rAAV in the insect cell production system.
As used herein, when a particular AAV serotype is referred to, it refers to the prototype for the serotype as well as various isolates within the same Glade of this prototype. For AAV Glade categorization, see, e.g., Gao et al., J Virol. (2004) 78(12):6381-8, the disclosure of which is incorporated herein by reference in its entirety.
In some embodiments, the present improved baculovirus-insect cell systems can be used to produce any AAV serotype that is susceptible to proteolysis in insect cells. Such AAV serotypes may include, for example, AAV1, AAV6, AAV8, or variants thereof, or any pseudotyped or chimeric rAAV whose VP1/VP2 proteins are susceptible to proteolysis in insect cells.
By “pseudotyped” or “cross-packaged” rAAV is meant a recombinant AAV whose capsid is replaced with the capsid of another AAV serotype, to, for example, alter transduction efficacy or tropism profiles of the virus (e.g., Balaji et al., J Surg Res. 184(1):691-8 (2013)). By “chimeric” or “hybrid” rAAV is meant a recombinant AAV whose capsid is assembled from capsid proteins derived from different serotypes and/or whose capsid proteins are chimeric proteins with sequences derived from different serotypes (e.g., serotypes 1 and 2; see, e.g., Hauck et al., Mol Ther. 7(3):419-25 (2003)).
In an improved AAV production system of the present disclosure, two or more point mutations are introduced to AAV VP1/VP2 proteins derived from, e.g., AAV1, AAV4, AAV6, AAV7, AAV8, or AAV11, to remove the sites susceptible to proteolysis in insect cells. The introduced point mutations may be residues identical to those at the corresponding positions in AAV2, AAV3, AAV5, AAV9, or AAV10.
By “corresponding” amino acid residue or region is meant an amino acid residue or region that aligns with (though not necessarily identical to) the reference residue or region, when the subject sequence and the reference sequence containing the residues or regions are aligned to achieve maximum homology (allowing gaps that are recognized in the art). For example, amino acid residue 189 (L) of AAV8 VP1 corresponds to amino acid residue 188 of AAV6 VP1.
In some embodiments, the baculoviral helper construct of the present disclosure provides helper functions for the production of rAAV6, and the helper construct includes a modified AAV6 cap gene (cap6) encoding a mutated VP1 protein. The complete amino acid sequence of an AAV6 VP1 protein is shown below, where the start sites of VP2 (T) and VP3 (M) are boldfaced and underlined:
In the sequence above, X in position 1 may be M (wildtype; source: GenBank AAB95450.1), T, L, or V. In other embodiments, the VP1 start residue may be another amino acid encoded by a non-canonical start codon such as a suboptimal start codon. See, e.g., Kearse et al., Genes Dev. 31:1717-31 (2017).
In some embodiments, the above AAV6 VP1/VP2 proteins comprise mutations relative to the wildtype at two or more residues in a region corresponding to residues 138-203 (e.g., residues 151-201 or residues 157-201) of SEQ ID NO:1, where the mutated residues are selected from a group consisting of residues 157, 162, 164, 179, 188, 194, 196, 197, 200, and 201. In some embodiments, the AAV6 VP1/VP2 proteins comprise two or more mutations selected from the group consisting of S157A, T162S, Q164A, S179T, L188I, T194A, A196S, A197G, P200S, and T201L (numbering according to SEQ ID NO:1). For example, an AAV6 VP1/VP2 protein may have the mutations (i) S179T, L188I, T194A, A196S, A197G, P200S, and T201L (“Variant 1”); (ii) S179T, L188I, T194A, A196S, and A197G (“Variant 2”); (iii) T194A, A196S, A197G, P200S, and T201L (“Variant 3”); (iv) S157A, T162S, and Q164A (“Variant 4”); or (v) P200S and T201L. For convenience, only the residue numbers in VP1 are referred to herein. The numbers of the corresponding residues in VP2 can be readily discerned from SEQ ID NO:1 above. For example, residue S157 in VP1 is residue S20 in VP2.
In particular embodiments, the AAV6 VP1/VP2 proteins comprise the mutation L188I and one or more other mutations in the group. For example, the AAV6 VP1/VP2 proteins may have the mutations L188I, P200S, and T201L.
In some embodiments, the AAV6 VP1/VP2 proteins comprise all ten mutations of S157A, T162S, Q164A, S179T, L188I, T194A, A196S, A197G, P200S, and T201L, such that their sequence in the region corresponding to residues 157-201 in SEQ ID NO:1 is as follows.
This sequence is identical to the sequence in the corresponding region in AAV9 VP1/VP2.
Thus, to generate a modified cap6 gene in a baculoviral AAV6 helper construct, one can replace the coding sequence for residues 157-201 of VP1 (i.e., residues 20-64 of VP2; SEQ ID NO:3) with the coding sequence for the corresponding amino acid sequence (SEQ ID NO:4) of AAV9, using well known molecular clone techniques; the resultant modified baculoviral AAV6 helper construct is referred to herein as “AAV9 Transplant” and the resultant VP1/VP2 proteins are referred to herein as “AAV6/9 VP1/VP2.” In some embodiments, the portion of the AAV6 cap gene sequence that is replaced comprises the underlined sequence shown below (see also
CCGCTAAAAAGAGACTCAATTTTGGTCAGACTGGCGACTCAGAGT
CAGTCCCCGACCCACAACCTCTCGGAGAACCTCCAGCAACCCCCG
CTGCTGTGGGACCTACTACAATGGCTTCAGGCGGTGGCGCACCAA
In certain embodiments, the underlined portion in SEQ ID NO: 13 is replaced by a corresponding cap gene sequence from AAV9 to generate an AAV9 Transplant disclosed herein. In particular embodiments, the AAV9 cap sequence transplanted to the AAV6 cap gene in an AAV9 Transplant comprises the underlined sequence shown below (see also
CCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGT
CAGTCCCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCT
CAGGTGTGGGATCTCTTACAATGGCTTCAGGCGGTGGCGCACCAA
In other embodiments, a modified cap6 gene in the baculoviral AAV6 helper construct can be generated by replacing the coding sequence for residues 157-201 of VP1 in SEQ ID NO:1 (i.e., residues 20-64 of VP2; SEQ ID NO:3) with the coding sequence for the corresponding amino acid sequence from a serotype whose VP1/VP2 proteins are resistant to proteolytic cleavage in insect cells, e.g., AAV2, AAV3, AAV3B, AAV5, or AAV10.
In other embodiments, the VP1/VP2 proteins of AAV serotypes, such as AAV1, AAV4, AAV7, AAV8, or AAV11, can be mutated such that they contain one or more mutations shown in
In some embodiments, the VP1/VP2 proteins from an AAV serotype susceptible to proteolysis in insect cells are mutated to contain one or more mutations at the following amino acid residues (consensus numbering in
In some embodiments, the VP1/VP2 proteins from an AAV serotype susceptible to proteolysis in insect cells are mutated to contain one or more mutations: S158T/A, I160T/V, K/T163S/A/T, Q165K/A, K169R, K171R, V173N, E175G, D176Q/E, D/E177T, T178G, G179D/E, S180A/T, G181D/E, D182S, G183V, L189E/I, Q/S191E, T/D192P, S/T193P, G/S194A, T/G195A, M196P, A197S/T, A198G/S, V199L, S200G, D/P201S/T, T/S202N/L, and E203T (consensus numbering in
In some embodiments, the engineered VP1/VP2 proteins may contain one or more of the following mutations: S158A, T163S, Q165A, S180T, L189I, T195A, A197S, A198G, P201S, and T202L (consensus number in
The mutations described herein remove sites in the AAV capsid proteins susceptible to proteolytic cleavage in insect cells. Thus, a helper construct containing the modified cap gene will give rise to rAAV products of higher purity and uniformity, as well as improved capsid protein.
Surprisingly, we have found that the point mutations introduced herein to the AAV VP1/VP2 unique region (i.e., region common to VP1 and VP2 but absent in VP3) can also significantly improve the rAAV's potency through a mechanism that does not rely on solely on the prevention of proteolytic cleavage.
The present disclosure also provides a baculovirus-insect system in which the cap gene in the baculoviral helper construct is altered in the VP1 unique region (i.e., region present in VP1 but not in VP2 or VP3) to improve the production yield of the rAAV in insect cells. The VP1 unique region (corresponding to residues 1-137 of SEQ ID NO:1) contains the PLA2 domain, and the mutations in the region may increase the enzymatic activity of the PLA2 domain in the resultant VP1 protein.
In some embodiments, the baculoviral helper construct of the present disclosure provides helper functions for the production of rAAV6 or rAAV9 and the helper construct includes a modified AAV6 or AAV9 cap gene (cap6 or cap9, respectively) with a mutated PLA2 domain. The mutated PLA2 domain may comprise mutations relative to the wildtype at one or more positions in a region corresponding to residues 1-137 (e.g., 52-97 or 67-92) of SEQ ID NO:1, where the positions are selected from a group consisting of residues 67, 81, 84, 85, and 92 (numbering of SEQ ID NO:1). In some embodiments, the AAV6 VP1 protein comprises one or more mutations selected from the group consisting of A67E, Q81R, K84D, A85S, and R92K (numbering according to SEQ ID NO:1). In particular embodiments, the AAV6 VP1 protein comprises all of the five mutations, such that its sequence in the region corresponding to residues 52-97 (SEQ ID NO:5) in SEQ ID NO:1 is as follows.
This sequence is identical to the sequence in the corresponding region in AAV2 VP1. Thus, to generate a modified cap6 gene in the baculoviral AAV6 helper construct, one can replace the coding sequence for residues 52-97 or 67-92 of VP1 with the coding sequence for the corresponding amino acid sequence of AAV2, using well known molecular cloning techniques.
Surprisingly, we have found that the point mutations introduced herein to the AAV VP1 unique region can significantly improve the VP1 PLA2 domain's enzymatic activity and also lead to significant improvement (e.g., two or more fold, three or more fold, four or more fold, or five or more fold) in the yield of the rAAV produced in insect cells.
In particular embodiments, the engineered cap gene encodes an AAV6 VP1 protein containing both the aforementioned mutations in the PLA2 domain and the aforementioned mutations that remove the proteolytic sites. One exemplary modified AAV6 VP1 protein (“AAV6/2/9 VP1”) has the following sequence:
Other exemplary modified AAV6 VP1 protein has the same sequence as SEQ ID NO:7 except that the start residue in position is not present or is T, L, V, or another amino acid encoded by a non-canonical start codon such as a suboptimal start codon. A baculoviral helper construct encoding one of these modified AAV6 VP1 proteins can be used to produce rAAV6 or a pseudotyped or chimeric rAAV with improved potency and yield in insect cells.
In another aspect, the present disclosure provides an AAV helper construct encoding an engineered AAP that has improved abilities to stabilize capsid protein and to facilitate capsid assembly. The inventors have discovered that when residues 1-30 of AAV6 AAP (“AAP6”) are changed to residues 1-30 AAV9 AAP (“AAP9”), the potency of the rAAV produced with the engineered helper construct is significantly increased. Residues 1-30 of AAP6 and AAP9 are shown below, where the six amino acid differences in wildtype AAP9 relative to wildtype AAP6 are indicated by boldface and boxes:
The complete AAV6 AAP wild-type sequence is shown below:
In some embodiments, the engineered AAP protein comprises one or more mutations at residues 8, 10, 12, 17, 21, and 22 (numbering based on consensus sequence in
To generate engineered AAP protein, one can perform point mutations. Because the open reading frame encoding AAP is embedded in the cap gene and is translated merely by a frameshift, one may also transplant from another serotype a portion of the cap gene containing the coding sequence for an N terminal portion of AAP (e.g., residues 1-30, residues 1-28, residues 2-30, residues 2-28, etc.). In some embodiments, an AAV9 cap gene portion coding for an AAV9 VP1/VP2 unique region (i.e., region common to VP1 and VP2 but absent in VP3), for example, a cap9 sequence comprising nucleotides 18-151 of SEQ ID NO:14 is substituted for the corresponding region of cap6, to generate an engineered baculoviral helper construct expressing an engineered AAV6 VP1/VP2 with a portion of AAV9 VP1/VP2 (e.g., so as to remove the proteolytic site(s) as discussed above), as well as an engineered AAP6 whose N-terminal 1-30 amino acid residues are now identical to those of AAPS. In some embodiments, the AAP mutations are generated by the same method as described above for the AAV9 cap gene transplant and as further described in Example 1 below.
Production of rAAV in insect cells can be performed as described previously. See, e.g., Urabe et al., 2002 and 2006, supra; Chen et al., supra; Smith et al., supra; Mietzsch et al., supra; WO 2007/046703, WO 2007/148971, WO 2009/104964, WO 2013/036118, and WO 2008/024998, all of which are incorporated herein by reference in their entirety.
The insect cells in the production methods of the present disclosure comprise a baculoviral helper construct having an expression cassette encoding a modified cap gene described herein. The insect cells may be, without limitation, a cultured cell line such as BTI-TN-5B1-4 derived from Trichoplusia ni (High Five™, ThermoFisher Scientific, Carlsbad, CA), Sf9 cells or Sf21 cells (both of which are derived from Spodoptera frugiperda), Sf9 or TN368 cells with mammalian-type glycan profiles (GlycoBac), or Sf-RVN cells (MilliporeSigma). The insect cells additionally comprise, on the same helper construct or on an additional helper construct, an expression cassette comprising an AAV rep gene. The helper construct(s) in the insect cells comprise transcription regulatory elements that direct and regulate the expression of the Rep proteins and the capsid proteins. These elements include, without limitation: constitutive or inducible promoters that are active in insect cells (e.g., a p5 promoter, a p10 promoter, a p19 promoter, a p40 promoter, a polh promoter, an E1 promoter, and a ΔE1 promoter); Kozak sequences; transcription initiation and termination sites (either modified or unmodified); mRNA splice sites (either modified or unmodified, within or adjacent to the polypeptide coding sequence; and viral, eukaryotic, or prokaryotic RNA elements that control splicing, nuclear export, localization, stabilization, or translation of mRNAs (e.g., Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (Zufferey et al., J Virol. 73(4):2886-92 (1999)), MMLV/MPMV, eukaryotic constitutive transport element (CTE) (Li et al., Nature 443(7108):234-7 (2006)), RNA zipcodes (Jambhekar and DeRisi, RNA 13(5):625-42 (2007)), and omega or other 5′-UTR RNA elements that increase translational efficiency). The rep and/or cap gene on the helper construct(s) may be codon-optimized, for example, to modulate expression levels of the polypeptide products, to remove potential undesired transcription/translation initiation sites, to remove cryptic promoter activity, and/or to remove destabilizing elements (e.g., Smith et al., supra).
The rAAV may comprise within its capsid an AAV vector containing a transgene of interest. The transgene may encode a reporter protein for detection using biochemical (luciferase, SEAP) or imaging (GFP, Venus, dTomato) techniques. The transgene may encode a therapeutic protein, including, without limitation, a chimeric antigen receptor (CAR), a C-peptide or insulin, collagen VII, IGF-I, lipoprotein lipase, fibrinogen, prothrombin, Factor V, Factor VIII, Factor IX, Factor XI, Factor XII, Factor XIII, von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha 2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, and plasminogen activator inhibitor-2. The transgene may encode a sequence-specific nuclease (ZFN, TALEN or Cas9) or sequence-specific binding protein (ZFP, TALE or dCas9). The transgene may carry a sequence that can be incorporated into a specific site in the host genome (donor) by homologous recombination to express a therapeutic protein (as described above). The transgene may encode an immunogenic protein for vaccination (e.g., a tumor antigen).
The AAV vector may comprise transcription regulatory elements (e.g., promoter and enhancer) that can direct and regulate expression of the transgene in human cells. The AAV vector may also comprise an AAV complete or partial inverted terminal repeat (ITR) on one or both ends of the transgene expression cassette. ITRs are required for packaging and viral integration into the host (human) genome.
The rAAV capsids produced by the present methods can be formulated with a pharmaceutically acceptable carrier as a pharmaceutical composition. Formulations include, without limitation, suspensions in liquid or emulsified liquids. Pharmaceutically acceptable carriers include, for example, water, saline, dextrose, glycerol, sucrose, or the like, and combinations thereof. In addition, the composition may contain auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents, or other reagents that enhance the effectiveness of the rAAV pharmaceutical composition.
The rAAV pharmaceutical composition may be delivered in vivo by administration to the patient, for example, by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, intrathecal, or intracranial infusion) or local injections. Alternatively, the rAAV can be delivered to cells ex vivo, such as cells explanted from a patient (e.g., lymphocytes, bone marrow aspirates, or tissue biopsy) or allogeneic cells (e.g., universal donor cells such as universal CAR T cells), followed by introduction of the treated cells into the patient, usually after selection for cells that have incorporated the rAAV vector.
Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the invention in any manner.
For the following Working Examples, AAV with a transgene comprising a Factor IX (FIX) expression cassette was produced in HEK293 (mammalian) cells using the triple transfection method, or in Sf9 (insect) cells by infecting naive Sf9 cells with baculovirus-infected insect cells (BIICs) expressing either Rep/Cap protein or providing the AAV genome; the produced AAV was purified using discontinuous cesium chloride density gradients (reviewed in Clement and Grieger, supra). Following purification, AAV samples were analyzed by Taqman qPCR using transgene-specific primer probes to quantify viral particle (vg) content. AAV samples (˜2×1011 vg total) were combined with loading dye and reducing agent, incubated at 95° C. for 5 min, loaded on 4-12% NuPAGE™ gels (ThermoFisher Scientific) and electrophoresed for 80 min at 150 V. Gels were stained with SimplyBlue SafeStain (ThermoFisher Scientific) and de-stained according to the manufacturer's instructions. De-stained gels were scanned using the Li-Cor Odyssey CLx (Li-Cor Biosciences), and bands were quantitated using the Li-Cor Odyssey software. Capsid ratios were calculated relative to VP1 and normalized to the protein molecular weight. To test the potency of AAV, HepG2 cells were transduced with an MOI (multiplicity of infection) of 1×106 vg/cell and incubated for 5 days. After 5 days, tissue culture supernatant was collected and FIX protein expression was quantitated using a FIX ELISA kit (Affinity Biologicals, Inc). FIX content in each sample was quantitated based on the standard curve and calculated as relative potency compared to 293 AAV (AAV produced in HEK293 cells).
We produced several AAV serotypes in the insect cell system as described above and found that an extra protein fragment was co-purified on cesium chloride density gradient with the expected VP1, VP2, and VP3 proteins for serotypes 6 and 8. This extra protein fragment was seen as an extra band slightly above the VP3 band in Coomassie Blue-stained SDS-PAGE gel, indicating that it was a proteolytic cleavage product of VP1/VP2. This cleavage product was not observed for serotype 3B (Rutledge et al., J Virol. 72(1):309-19 (1998)), 5, or 9 produced in insect cells. This cleavage product also was not observed for serotype 6 produced in HEK293 cells. These data suggest that the VP1/VP2 proteins of certain AAV serotypes, e.g., serotypes 6 and 8, are susceptible to proteolytic cleavage in insect cells.
We performed Edman degradation sequencing on the extra protein fragment from AAV6 and determined that its N-terminal sequence was EPPAT (SEQ ID NO:15), consistent with a proteolytic cleavage site in the sequence PQPLG↓EPPAT (SEQ ID NO:2; “↓” denotes the cleavage point). Sequence alignment of the VP1/VP2 leader sequences of multiple AAV serotypes just before the start of the VP3 protein revealed that this sequence in AAV6 was divergent from serotypes 3B, 5, 8 and 9 (
To test whether the proteolytic cleavage could be prevented by altering the sequence around the AAV6 cleavage site, we transferred the nucleotide sequence from AAV9 corresponding to 45 amino acids prior to the VP3 start codon into the AAV6 cap (cap6) gene in the baculo-helper vector for AAV6 (
This transfer resulted in ten amino acid changes in total in the resultant AAV6 VP1/VP2 unique region. When rAAV6 was produced using a baculovirus helper construct encoding the engineered VP1/VP2 proteins (“AAV9 Transplant” or “AAV6/9 VP1/VP2”), we found that the proteolytic cleavage was abolished (
To dissect the elements in the transferred AAV9 sequence responsible for the improvement, we made a single L188I mutation in the AAV6 VP1/VP2 proteins. While the proteolytic cleavage between residues G189 and E190 appeared to decrease (
To determine whether the L188I mutation impacted the potency of the rAAV6 produced from the helper, we produced rAAV containing the FIX cDNA and compared FIX expression levels from cells transduced with rAAV produced in 293 cells (293 AAV) or in Sf9 cells using the standard helper, AAV9 Transplant helper (expressing VP1/VP2 containing the 10 amino acid changes relative to the standard helper), or the L188I mutant helper. Relative potency was calculated with respect to 293 AAV. As shown in
Previous studies suggested that increasing the VP1 content of AAV capsids would lead to increased AAV potency, but most studies attempted to accomplish this by manipulating the start codon or the Kozak sequence near the start codon (Kohlbrenner et al., supra); Urabe et al., 2006, supra; and Kondratov et al., supra). Our work suggests that preventing proteolytic cleavage of VP1 is another viable approach to improving rAAV potency.
We generated variants (Variants 1-4) of the AAV9 Transplant that contained subsets of the 10 amino acid changes in the AAV9 Transplant (
We noted that the AAV9 Transplant not only had mutated residues in VP1/VP2 relative to native AAV6 VP1/VP2, the engineered construct also had an altered open reading frame for AAP, resulting in the following point mutations relative to native AAP6: P8Q, H10L, L12Q, Q17P, L21Q and L22V (
Groups working with AAV5 and AAV8 production in the baculovirus-insect cell system reported that rAAV produced in insect cells transduced cells poorly compared to rAAV produced in 293 cells (Kohlbrenner et al., supra; and Urabe et al., supra). These groups transplanted the 134 or 142 amino acid N-terminal portion of the VP1 sequence from AAV2 into the AAV5 or AAV8 VP1 leader sequence and demonstrated that rAAV produced from these chimeric helpers had improved capsid protein ratios and potency with respect to rAAV produced in 293 cells. Id. Unfortunately, these studies did not identify the elements in the transplanted sequence that were responsible for the improvement.
The AAV VP1 leader sequence contains a phospholipase A2-like (PLA2) enzymatic domain, which is required for infection (see, e.g., Zadori et al., Developmental Cell, 1:291-302 (2001); and Girod et al., J of General Virology, 83:973-8 (2002)). To investigate the role of the PLA2 domain in rAAV's capsid protein ratio, potency, and yield, we transferred an amino acid sequence from AAV2 VP1's PLA2 domain (SEQ ID NO:6) to the baculoviral AAV6 helper, replacing the native AAV6 sequence (SEQ ID NO:5). The wildtype AAV6 and AAV2 sequences in this region (residues 52-97 of SEQ ID NO:1) are shown below, where the five amino acid changes relative to wildtype AAV6 after the AAV2 sequence transplant are boldfaced and boxed:
We observed that there was no significant change in the capsid protein ratios between the Standard helper, which contained the cap gene sequence derived entirely from AAV6, and the chimeric baculovirus helper that contained the AAV2 PLA2 transplant (“AAV6/2 VP1”) (
We did, however, observe a significant and reproducible four-fold increase in the yield of rAAV6 produced with the chimeric AAV6/2 helper, as compared to the Standard helper, as shown in Table 1 below, where average yield was calculated based on the yield derived the Standard helper, and N indicates the number of independent production samples. We have found that this result was independent of the sequence being packaged into the rAAV.
Unexpectedly, rAAV6 production using the chimeric AAV6/2 helper resulted in a significant increase in yield compared to the Standard helper.
We applied the same strategy to a baculovirus AAV9 helper for producing rAAV9 capsid. We replaced the AAV9 VP1 PLA2 domain with that from AAV2 VP1 to generate AAV9/2 VP1. The wildtype AAV9 VP1 sequence (UniProtKB-Q6JC40 (Q6JC40_9VIRU)) is shown below, where the five amino acid residues differing from the corresponding ones in the AAV9/2 VP1 in the PLA2 domain are indicated with boldface and boxes:
The wildtype AAV9 and AAV2 sequences in this region (residues 52-97 of SEQ ID NO:11) are shown below, where the five amino acid changes relative to wildtype AAV9 after the AAV2 sequence transplant are boldfaced and boxed:
We found that a chimeric helper construct expressing the AAV9/2 VP1 led to a three-fold increase in rAAV9 yield, as compared to the original AAV9 helper containing the native PLA2 domain (Table 2).
We also evaluated the PLA2 enzymatic activity of the AAV6/2 VP1. To do so, we used the ThermoFisher ENZCHEK® Phospholipase A2 Assay Kit (E10217). We dissociated the AAV capsids by incubating the viral preparation for 10 min at room temperature in 50 mM NaOH, neutralizing the sample with 100 mM HCl, and then assaying the sample for PLA2 activity according to manufacturer's instructions. Fluorescence emission of the enzyme substrate at 515 nm was recorded. The data show that compared to rAAV6 generated using the standard helper (with and without dissociation), rAAV6 generated with the AAV6/2 helper (helper containing the AAV2 PLA2 domain) had significantly higher PLA2 activity (
These results suggest that the PLA2 domain possesses additional and previously unknown functions in AAV production, and these functions directly impact the yield in rAAV manufacturing. A helper virus that provides a more enzymatically active PLA2 can help improve rAAV yield in insect cells.
This application is a divisional application of U.S. patent application Ser. No. 16/790,841, filed Feb. 14, 2020, which claims priority from U.S. Provisional Application 62/806,317, filed Feb. 15, 2019. The contents of the aforementioned priority applications are incorporated herein by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| 62806317 | Feb 2019 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16790841 | Feb 2020 | US |
| Child | 18337861 | US |
