Patent Application
20100278837
This invention relates to the discovery of the convergence of diverse receptors and signaling pathways on the PI3gamma dependent activation of VLA4 (integrin a4b1). In particular, the invention relates to the role of myeloid cells in tumor inflammation and metastasis. The invention provides methods for inhibiting cancer in a subject comprising administering to a subject having cancer that comprises endothelial cells a therapeutically effective amount of a PI-3-kinase gamma inhibitor that reduces at least one of (a) adhesion of myeloid cells to the endothelial cells, (b) migration of myeloid cells into the cancer, (c) growth of the cancer, (d) activation of integrin a4b1 that is comprised on the myeloid cells, and (e) clustering of integrin a4b1 that is comprised on the myeloid cells.
In one embodiment, the PI-3-kinase gamma inhibitor comprises an antibody that specifically binds to PI-3-kinase gamma. In an alternative embodiment, the PI-3-kinase gamma inhibitor comprises a nucleic acid sequence selected from PI-3-kinase gamma antisense sequence and PI-3-kinase gamma ribozyme sequence.
In one embodiment, the present invention contemplates siRNA mediated knockdown of p110γ to suppressed myeloid cell adhesion in a subject, such as a patient. In another embodiment, the present invention contemplates administering selective inhibitors of PI3-kinase γ, but not of other isoforms, to suppress chemoattractant-stimulated PI3-kinase catalytic activity and inhibit myeloid cell adhesion.
4loxp/loxp mice. (n=3) *P<0.01 vs. WT. All error bars indicate s.e.m.
inhibitors. Bioorg. Med. Chem. 14, 6847-6858 (2006). 5) Jackson, S. P. et al. PI3-kinase p110®: a new target for antithrombotic therapy. Nat. Med. 11, 507-514 (2005).
inhibitor (PI3Kalpha2) and with PI3-kinase β inhibitor (TGX221). VCAM binding to CD11b+ myeloid cells from p110γ−/− mice was also assessed. (n=3) *P<0.01 vs control. (e) HUTS21 antibody binding to unstimulated or SDF-1α stimulated human CD11b+ cells in the presence of no inhibitor (Ctrl), PI3kγi-1, PI3kαi or Mn2+ (n=3), *P<0.01 vs control. (f) CD11b+ cells isolated from BM of normal mice were incubated in basal medium or 1 μM PI3 kinase γ inhibitors-1 (TG100-115), PI3-kinase α inhibitor (PI3Kalpha2) or PI3-kinase β inhibitor (TGX221) fluorescently labeled and adoptively transferred into mice bearing in LLC tumours. Fluorescent cells present in tumours were quantified 2 hours after adoptive transfer (n=3), *P<0.001 vs Control. (g) Integrin α4 immunoprecipitates from WT and p110γ−/− BM incubated with (+) or without (−) TCM were immunoblotted for integrin α4, talin, paxillin and IgG. (h-i) Ratios of paxillin (h) and talin (i) to integrin α4 were determined by densitometry. All error bars indicate s.e.m.
4Y991A and p110γ−/− mice. Quantification of F4/80, Ly6C, Ly6G, CD14, MHCII, c-kit and Tie2 expression in Gr1lo/neg CD11b+ cells in LLC tumours in WT,
4Y991A and p110γ−/− mice. No significant differences were observed in the proportion of various myeloid cell subpopulations in tumours in the three strains of mice, although significant differences were observed in the absolute numbers of Gr1lo/neg CD11b+ cells in tumours. *P<0.05.
To facilitate understanding of the invention, a number of terms are defined below.
As used in this specification and the appended claims, the singular forms “a,” “an” and “the” includes both singular and plural references unless the content clearly dictates otherwise.
As used herein, the term “or” when used in the expression “A or B,” where A and B refer to a composition, disease, product, etc., means one, or the other, or both.
The term “on” when in reference to the location of a first article with respect to a second article means that the first article is on top and/or into the second article, including, for example, where the first article permeates into the second article after initially being placed on it.
As used herein, the term “comprising” when placed before the recitation of steps in a method means that the method encompasses one or more steps that are additional to those expressly recited, and that the additional one or more steps may be performed before, between, and/or after the recited steps. For example, a method comprising steps a, b, and c encompasses a method of steps a, b, x, and c, a method of steps a, b, c, and x, as well as a method of steps x, a, b, and c. Furthermore, the term “comprising” when placed before the recitation of steps in a method does not (although it may) require sequential performance of the listed steps, unless the content clearly dictates otherwise. For example, a method comprising steps a, b, and c encompasses, for example, a method of performing steps in the order of steps a, c, and b, the order of steps c, b, and a, and the order of steps c, a, and b, etc
Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth as used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and without limiting the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters describing the broad scope of the invention are approximation, the numerical values in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains standard deviations that necessarily result from the errors found in the numerical value's testing measurements.
The term “not” when preceding, and made in reference to, any particularly named molecule (such as a protein, nucleotide sequence, etc.) or phenomenon (such as cell adhesion, cell migration, cell differentiation, angiogenesis, biological activity, biochemical activity, etc.) means that only the particularly named molecule or phenomenon is excluded.
The term “altering” and grammatical equivalents as used herein in reference to the level of any molecule (such as a protein, nucleotide sequence, etc.) or phenomenon (such as cell adhesion, cell migration, cell differentiation, angiogenesis, biological activity, biochemical activity, etc.) refers to an increase and/or decrease in the quantity of the substance and/or phenomenon, regardless of whether the quantity is determined objectively and/or subjectively.
The term “increase,” “elevate,” “raise,” and grammatical equivalents when in reference to the level of a molecule (such as a protein, nucleotide sequence, etc.) or phenomenon (such as cell adhesion, cell migration, cell differentiation, angiogenesis, biological activity, biochemical activity, etc.) in a first sample relative to a second sample, mean that the quantity of the substance and/or phenomenon in the first sample is higher than in the second sample by any amount that is statistically significant using any art-accepted statistical method of analysis such as the Student's t-test. In one embodiment, the increase may be determined subjectively, for example when a patient refers to their subjective perception of disease symptoms, such as pain, clarity of vision, etc. In another embodiment, the quantity of the substance and/or phenomenon in the first sample is at least 10% greater than, preferably at least 25% greater than, more preferably at least 50% greater than, yet more preferably at least 75% greater than, and most preferably at least 90% greater than the quantity of the same substance and/or phenomenon in a second sample.
The terms “reduce,” “inhibit,” “diminish,” “suppress,” “decrease,” and grammatical equivalents when in reference to the level of a molecule (such as a protein, nucleotide sequence, etc.) or phenomenon (such as cell adhesion, cell migration, cell differentiation, angiogenesis, biological activity, biochemical activity, etc.) in a first sample relative to a second sample, mean that the quantity of substance and/or phenomenon in the first sample is lower than in the second sample by any amount that is statistically significant using any art-accepted statistical method of analysis. In one embodiment, the reduction may be determined subjectively, for example when a patient refers to their subjective perception of disease symptoms, such as pain, clarity of vision, etc. In another embodiment, the quantity of substance and/or phenomenon in the first sample is at least 10% lower than, preferably, at least 25% lower than, more preferably at least 50% lower than, yet more preferably at least 75% lower than, and most preferably at least 90% lower than the quantity of the same substance and/or phenomenon in a second sample. A reduced level of a molecule and/or phenomenon need not, although it may, mean an absolute absence of the molecule and/or phenomenon.
Reference herein to any specifically named protein (such as “integrin α4β1,” “vascular cell adhesion molecule,” fibronectin, PI-3-kinase gamma, etc.) refers to a polypeptide having at least one of the biological activities (such as those disclosed herein and/or known in the art) of the specifically named protein, wherein the biological activity is detectably by any method. In a preferred embodiment, the amino acid sequence of the polypeptide has at least 95% homology (i.e., identity) with the amino acid sequence of the specifically named protein. Reference herein to any specifically named protein (such as “integrin α4β1,” “vascular cell adhesion molecule,” fibronectin, PI-3-kinase gamma, etc.) also includes within its scope fragments, fusion proteins, and variants of the specifically named protein that have at least 95% homology with the amino acid sequence of the specifically named protein.
The term “fragment” when in reference to a protein refers to a portion of that protein that may range in size from four (4) contiguous amino acid residues to the entire amino acid sequence minus one amino acid residue. Thus, a polypeptide sequence comprising “at least a portion of an amino acid sequence” comprises from four (4) contiguous amino acid residues of the amino acid sequence to the entire amino acid sequence.
The term “variant” of a protein as used herein is defined as an amino acid sequence which differs by insertion, deletion, and/or conservative substitution of one or more amino acids from the protein. The term “conservative substitution” of an amino acid refers to the replacement of that amino acid with another amino acid which has a similar hydrophobicity, polarity, and/or structure. For example, the following aliphatic amino acids with neutral side chains may be conservatively substituted one for the other: glycine, alanine, valine, leucine, isoleucine, serine, and threonine. Aromatic amino acids with neutral side chains which may be conservatively substituted one for the other include phenylalanine, tyrosine, and tryptophan. Cysteine and methionine are sulphur-containing amino acids which may be conservatively substituted one for the other. Also, asparagine may be conservatively substituted for glutamine, and vice versa, since both amino acids are amides of dicarboxylic amino acids. In addition, aspartic acid (aspartate) my be conservatively substituted for glutamic acid (glutamate) as both are acidic, charged (hydrophilic) amino acids. Also, lysine, arginine, and histidine my be conservatively substituted one for the other since each is a basic, charged (hydrophilic) amino acid. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing biological and/or immunological activity may be found using computer programs well known in the art, for example, DNAStar™ software. In one embodiment, the sequence of the variant has at least 95% identity, preferably at least 90% identity, more preferably at least 85% identity, yet more preferably at least 75% identity, even more preferably at least 70% identity, and also more preferably at least 65% identity with the sequence of the protein in issue.
Reference herein to any specifically named nucleotide sequence (such as a sequence encoding PI-3-kinase gamma, integrin α4β1, etc.) includes within its scope fragments, homologs, and sequences that hybridize under high and/or medium stringent conditions to the specifically named nucleotide sequence, and that have at least one of the biological activities (such as those disclosed herein and/or known in the art) of the specifically named nucleotide sequence, wherein the biological activity is detectable by any method.
The nucleotide “fragment” may range in size from an exemplary 10, 20, 50, 100 contiguous nucleotide residues to the entire nucleic acid sequence minus one nucleic acid residue. Thus, a nucleic acid sequence comprising “at least a portion of” a nucleotide sequence comprises from ten (10) contiguous nucleotide residues of the nucleotide sequence to the entire nucleotide sequence.
The term “homolog” of a specifically named nucleotide sequence refers to an oligonucleotide sequence which has at least 95% identity, more preferably at least 90% identity, yet more preferably at least 85% identity, yet more preferably at least 80% identity, also more preferably at least 75% identity, yet more preferably at least 70% identity, and most preferably at least 65% identity with the sequence of the nucleotide sequence in issue.
As used herein, the term “tissue exhibiting angiogenesis” refers to a tissue in which new blood vessels are developing from pre-existing blood vessels. The level of angiogenesis may be determined using methods well known in the art, including, without limitation, counting the number of blood vessels and/or the number of blood vessel branch points, as discussed herein. An alternative assay involves an in vitro cell adhesion assay that shows whether a compound inhibits the ability of α4β1-expressing cells (e.g. M21 melanoma cells) to adhere to VCAM or fibronectin. Another in vitro assay contemplated includes the tubular cord formation assay that shows growth of new blood vessels at the cellular level (D. S. Grant et al., Cell, 58: 933-943 (1989)). Art-accepted in vivo assays are also known, and involve the use of various test animals such as chickens, rats, mice, rabbits and the like. These in vivo assays include the chicken chorioallantoic membrane (CAM) assay, which is suitable for showing anti-angiogenic activity in both normal and neoplastic tissues (D. H. Ausprunk, Amer. J. Path., 79, No. 3: 597-610 (1975) and L. Ossonowski and E. Reich, Cancer Res., 30: 2300-2309 (1980)). Other in vivo assays include the mouse metastasis assay, which shows the ability of a compound to reduce the rate of growth of transplanted tumors in certain mice, or to inhibit the formation of tumors or pre-neoplastic cells in mice which are predisposed to cancer or which express chemically-induced cancer (M. J. Humphries et al., Science, 233: 467-470 (1986) and M. J. Humphries et al., J. Clin. Invest., 81: 782-790 (1988)).
The term “integrin α4β1” is interchangeably used with the terms “CD49d/CD29,” “very late antigen 4,” and “VLA4” to refer to a member of the family of integrins. An “integrin” is an extracellular receptor that is expressed in a wide variety of cells and binds to specific ligands in the extracellular matrix. The specific ligands bound by integrins can contain an arginine-glycine-aspartic acid tripeptide (Arg-Gly-Asp; RGD) or a leucine-aspartic acid-valine (Leu-Asp-Val) tripeptide, and include, for example, fibronectin, vitronectin, osteopontin, tenascin, and von Willebrands's factor. Integrin α4β1 is a heterodimeric cell surface adhesion receptor composed of an α4 and β1 subunits that bind to ligands which are present in the extracellular matrix (ECM) as well as on the cell surface. An exemplary α4 polypeptide sequence is shown in
The term “integrin α4β1” is contemplated also to include a portion of α4β1. The term “portion,” when used in reference to a protein (as in a “portion of α4β1”) refers to a fragment of that protein. The fragments may range in size from three (3) contiguous amino acid residues to the entire amino acid sequence minus one amino acid residue. Thus, a polypeptide sequence comprising “at least a portion of an amino acid sequence” comprises from three (3) contiguous amino acid residues of the amino acid sequence to the entire amino acid sequence.
The terms “isolated,” “purified,” and grammatical equivalents thereof when used in reference to a molecule (e.g., protein, DNA, RNA, etc.) or article (e.g., hematopoietic progenitor cell) in a sample refer to the reduction (by at least 10%, preferably by at least 25%, more preferably by at least 50%, even more preferably by at least 75%, and most preferably by at least 90%) in the amount of at least one contaminant molecule and/or article from the sample. Thus, purification results in an “enrichment,” i.e., an increase, in the amount of the desirable molecule and/or article relative to one or more other molecules and/or articles in the sample.
A “non-endothelial cell” is any cell type other than an endothelial cell (i.e., is not an endothelial cell) such as, without limitation, stem cell, lymph cell, mesenchymal cell, myeloid cell, lymphoid cell, granulocyte cell, macrophage cell, megakaryocyte cell, erythroid cell, B cell, T cell, bone marrow cell, muscle cell, neural cell, etc.
The terms “disease” and “pathological condition” are used interchangeably to refer to a state, signs, and/or symptoms that are associated with any impairment, interruption, cessation, or disorder of the normal state of a living animal or of any of its organs or tissues that interrupts or modifies the performance of normal functions, and may be a response to environmental factors (such as malnutrition, industrial hazards, or climate), to specific infective agents (such as worms, bacteria, or viruses), to inherent defect of the organism (such as various genetic anomalies, or to combinations of these and other factors. The term “disease” includes responses to injuries, especially if such responses are excessive, produce symptoms that excessively interfere with normal activities of an individual, and/or the tissue does not heal normally (where excessive is characterized as the degree of interference, or the length of the interference).
The term “adhesion” as used herein in reference to cells refers to the physical contacting of the cell to one or more components of the extracellular matrix (e.g., fibronectin, collagens I-XVIII, laminin, vitronectin, fibrinogen, osteopontin, Del 1, tenascin, von Willebrands's factor, etc.), to a ligand which is expressed on the cell surface (e.g., VCAM, ICAM, LI-CAM, VE-cadherin, integrin α2, integrin α3, etc.) and/or to another cell of the same type (e.g., adhesion of an HPC to another HPC) or of a different type (e.g., adhesion of an HPC to an endothelial cell, endothelial stem cell, stem cell expressing CD34, fibroblast cell, stromal cell, tumor cell, etc.).
The term “migration” as used herein in reference to cells refers to the translocation of a cell across one or more components of the extracellular matrix (e.g., fibronectin, collagens I-XVIII, laminin, vitronectin, fibrinogen, osteopontin, Del 1, tenascin, von Willebrands's factor, etc.), and/or along the surface of another cell of the same type (e.g., migration of an HPC along another HPC) and/or of a different cell (e.g., migration of an HPC along an endothelial cell, endothelial stem cell, stem cell expressing CD34, fibroblast cell, stromal cell, tumor cell, etc.). Thus, “trans-endothelial migration” of a cell refers to the translocation of the cell across one or more components of the extracellular matrix and/or cells of endothelial tissue.
In another embodiment, the subject has a neoplasm. The terms “neoplasm” and “tumor” refer to a tissue growth that is characterized, in part, by angiogenesis. Neoplasms may be benign and are exemplified, but not limited to, a hemangioma, glioma, teratoma, and the like. Neoplasms may alternatively be malignant, for example, a carcinoma, sarcoma, glioblastoma, astrocytoma, neuroblastoma, retinoblastoma, and the like.
The terms “malignant neoplasm” and “malignant tumor” refer to a neoplasm that contains at least one cancer cell. A “cancer cell” refers to a cell undergoing early, intermediate or advanced stages of multi-step neoplastic progression as previously described (H. C. Pitot (1978) in “Fundamentals of Oncology,” Marcel Dekker (Ed.), New York pp 15-28). The features of early, intermediate and advanced stages of neoplastic progression have been described using microscopy. Cancer cells at each of the three stages of neoplastic progression generally have abnormal karyotypes, including translocations, inversion, deletions, isochromosomes, monosomies, and extra chromosomes. A cell in the early stages of malignant progression is referred to as “hyperplastic cell” and is characterized by dividing without control and/or at a greater rate than a normal cell of the same cell type in the same tissue. Proliferation may be slow or rapid, but continues unabated. A cell in the intermediate stages of neoplastic progression is referred to as a “dysplastic cell.” A dysplastic cell resembles an immature epithelial cell, is generally spatially disorganized within the tissue and loses its specialized structures and functions. During the intermediate stages of neoplastic progression, an increasing percentage of the epithelium becomes composed of dysplastic cells. “Hyperplastic” and “dysplastic” cells are referred to as “pre-neoplastic” cells. In the advanced stages of neoplastic progression a dysplastic cell become a “neoplastic” cell. Neoplastic cells are typically invasive (i.e., they either invade adjacent tissues, or are shed from the primary site and circulate through the blood and lymph) to other locations in the body where they initiate one or more secondary cancers (i.e., “metastases”). Thus, the term “cancer” is used herein to refer to a malignant neoplasm, which may or may not be metastatic. Malignant neoplasms that can be diagnosed using a method of the invention include, for example, carcinomas such as lung cancer, breast cancer, prostate cancer, cervical cancer, pancreatic cancer, colon cancer, ovarian cancer; stomach cancer, esophageal cancer, mouth cancer, tongue cancer, gum cancer, skin cancer (e.g., melanoma, basal cell carcinoma, Kaposi's sarcoma, etc.), muscle cancer, heart cancer, liver cancer, bronchial cancer, cartilage cancer, bone cancer, testis cancer, kidney cancer, endometrium cancer, uterus cancer, bladder cancer, bone marrow cancer, lymphoma cancer, spleen cancer, thymus cancer, thyroid cancer, brain cancer, neuron cancer, mesothelioma, gall bladder cancer, ocular cancer (e.g., cancer of the cornea, cancer of uvea, cancer of the choroids, cancer of the macula, vitreous humor cancer, etc.), joint cancer (e.g., synovium cancer), glioblastoma, lymphoma, and leukemia. Malignant neoplasms are further exemplified by sarcomas (such as osteosarcoma and Kaposi's sarcoma). The invention expressly contemplates within its scope any malignant neoplasm, so long as the neoplasm is characterized, at least in part, by angiogenesis associated with α4β1 expression by the newly forming blood vessels.
The phrase “reduces at least one of a) adhesion of myeloid cells to said endothelial cells, b) migration of myeloid cells into said cancer, c) growth of said cancer, d) activation of integrin α4b1 that is comprised on said myeloid cells, and e) clustering of integrin α4b1 that is comprised on said myeloid cells” means that the amount (as measured in an assay) of a) adhesion, b) migration, c) growth, d) activation, and/or e) clustering is reduced as compared to the amount or level in the absence of treatment with the inhibitor. The effects of diminishing any one of these characteristics may be determined by methods routine to those skilled in the art including, but not limited to, angiography, ultrasonic evaluation, fluoroscopic imaging, fiber optic endoscopic examination, biopsy and histology, blood tests, imaging tests and the like which can be used to detect, by way of an example, a decrease in the growth rate or size of a neoplasm. Such clinical tests are selected based on the particular pathological condition being treated. For example, it is contemplated that the methods of the invention result in a “reduction in tumor tissue” (e.g., a decrease in the size, weight, and/or volume of the tumor tissue) as compared to a control tumor tissue (e.g., the same tumor prior to treatment with the invention's methods, or a different tumor in a control subject).
As used herein the terms “therapeutically effective amount” refers to an amount of the composition that delays, reduces, palliates, ameliorates, stabilizes, prevents and/or reverses one or more symptoms of a disease, such as cancer, compared to in the absence of the composition of interest. Examples with respect to cancer include, without limitation, tumor size, tumor number, incidence of metastases, etc. Specific “dosages” can be readily determined by clinical trials and depend, for example, on the route of administration, patient weight (e.g. milligrams of drug per kg body weight). As used herein, the actual amount, i.e., “dosage,” encompassed by the term “pharmaceutically effective amount,” “therapeutically effective amount” and “protective amount” will depend on the route of administration, the type of subject being treated, and the physical characteristics of the specific subject under consideration. These factors and their relationship to determining this amount are well known to skilled practitioners in the medical, veterinary, and other related arts. This amount and the method of administration can be tailored to achieve optimal efficacy but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the art will recognize. The dosage amount and frequency are selected to create an effective level of the compound without substantially harmful effects.
This invention relates to the discovery of the convergence of diverse receptors and signaling pathways on the PI3gamma dependent activation of VLA4 (integrin α4b1). Data herein shows the validity of the concept that tumor inflammation is a necessary precedent to angiogenesis. While specific inflammatory mediators help recruit myeloid cells to tumors and stem from structurally diverse receptors, all investigated here converge on this kinase-integrin and blocking the activation of this integrin (either directly or by antagonizing the kinase activation of it) was specific and effective.
Cancer and inflammation are linked, as chronic inflammatory diseases increase the risk of developing many tumour types1, while growing tumours induce host inflammatory responses2-4. Tumours produce a multitude of inflammatory mediators that stimulate myeloid cell extravasation, resulting in tumour angiogenesis, growth and metastasis5-11. Here, we show that a wide array of chemokines and cytokines activating structurally diverse receptors and signaling pathways in myeloid cells promote tumour inflammation, but surprisingly, each of these pathways converge on PI3kinase γ-dependent activation of VLA-4 (integrin α4β1). Chemoattractants released from tumour cells, such as SDF-1α, TNFα or VEGF, and those released from tumour-invading myeloid cells, such as IL-1β or IL-6, all stimulate PI3kinase γ-dependent integrin α4β1 activation and signaling with subsequent adhesion of myeloid cells to vascular endothelium. Mutations and inhibitors that impair activity or expression of VLA-4 or PI3kinase γ, but not β2 integrin, block myeloid cell responsiveness to chemoattractants, recruitment to tumours, tumour angiogenesis, growth and metastasis. Thus, regardless of the initiating event, VLA-4 activation by PI3kinase γ serves as a checkpoint in tumour inflammation. Antagonism of myeloid cell PI3kinase γ or activation of integrin α4β1 represents an innovative approach to control the malignant properties of tumours.
In particular, the invention relates to the role of myeloid cells in tumor inflammation and metastasis. Data herein shows the validity of the concept that tumor inflammation is a necessary precedent to angiogenesis. While specific inflammatory mediators help recruit myeloid cells to tumors and stem from structurally diverse receptors, all investigated here converge on this kinase-integrin and blocking the activation of this integrin (either directly or by antagonizing the kinase activation of it) was specific and effective. One of the advantages of the instant in invention is that PI3kinase gamma inhibitors are non-toxic, potent and have not been used previously to suppress tumor growth.
In one aspect, pharmacological and/or genetic inhibitors of PI-3-kinase gamma are used to block invasion of myeloid cells into tumors (inflammation) and thereby block tumor angiogenesis and tumor growth and metastasis. Data herein shows that PI3kinase gamma selective inhibitors block myeloid cell adhesion to endothelium in vitro and block myeloid cell invasion of tumors in vivo, with subsequent suppression of tumor growth. The data also show that PI3kinase activates integrin α4b1 function on myeloid cells, leading to increased cell adhesion and invasion of tumors. Data herein also show that 1) PI3kinase gamma inhibitors block myeloid cell adhesion to endothelium regardless of the stimulus, 2) PI3kinase gamma inhibitors block myeloid cell integrin activation and clustering, 3) These inhibitors block invasion of myeloid cells into tumors, and 4) These inhibitors block tumor growth. These data are supported by similar results in PI3kinase gamma null mice.
The following are exemplary PI-3-kinase gamma inhibitors that may be used in the invention.
1. Antibodies
In one embodiment, the PI-3-kinase gamma inhibitor is an antibody that specifically binds to PI-3-kinase gamma. The terms “antibody” and “immunoglobulin” are interchangeably used to refer to a glycoprotein or a portion thereof (including single chain antibodies), which is evoked in an animal by an immunogen and which demonstrates specificity to the immunogen, or, more specifically, to one or more epitopes contained in the immunogen. The term “antibody” expressly includes within its scope antigen binding fragments of such antibodies, including, for example, Fab, F(ab′)2, Fd or Fv fragments of an antibody. The antibodies of the invention also include chimeric and humanized antibodies. Antibodies may be polyclonal or monoclonal. The term “polyclonal antibody” refers to an immunoglobulin produced from more than a single clone of plasma cells; in contrast “monoclonal antibody” refers to an immunoglobulin produced from a single clone of plasma cells. The term “specifically binds” refers to the fact that the antibody has higher affinity for the kinase then for other proteins (e.g. serum albumin, and the like) and will therefore display a stronger signal (e.g. in an in vitro assay) over background (e.g. at least 2 to 1, preferably more than 3:1, more preferably at least 5:1, still more preferably 10:1 over background).
Antibodies contemplated to be within the scope of the invention include naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen-binding fragments thereof. Naturally occurring antibodies may be generated in any species including murine, rat, rabbit, hamster, human, and simian species using methods known in the art. Non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as previously described (Huse et al., Science 246:1275-1281 (1989)). These and other methods of making, for example, chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known to those skilled in the art (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546 (1989); Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); and Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press 1995).
As used herein, the term “antibody” when used in reference to an anti-PI-3-kinase gamma antibody, refers to an antibody which specifically binds to one or more epitopes on an PI-3-kinase gamma polypeptide or peptide portion thereof, and which may or may not include some or all of an RGD binding domain. In one embodiment, an anti-PI-3-kinase gamma antibody, or antigen binding fragment thereof, is characterized by having specific binding activity for PI-3-kinase gamma of at least about 1×105M−1, more preferably at least about 1×106M−1, and yet more preferably at least about 1×107M−1.
Those skilled in the art know how to make polyclonal and monoclonal antibodies that are specific to a desirable polypeptide. For example, monoclonal antibodies may be generated by immunizing an animal (e.g., mouse, rabbit, etc.) with a desired antigen and the spleen cells from the immunized animal are immortalized, commonly by fusion with a myeloma cell.
Immunization with antigen may be accomplished in the presence or absence of an adjuvant (e.g., Freund's adjuvant). Typically, for a mouse, 10 μg antigen in 50-200 μl adjuvant or aqueous solution is administered per mouse by subcutaneous, intraperitoneal or intra-muscular routes. Booster immunization may be given at intervals (e.g., 2-8 weeks). The final boost is given approximately 2-4 days prior to fusion and is generally given in aqueous form rather than in adjuvant.
Spleen cells from the immunized animals may be prepared by teasing the spleen through a sterile sieve into culture medium at room temperature, or by gently releasing the spleen cells into medium by pressure between the frosted ends of two sterile glass microscope slides. The cells are harvested by centrifugation (400×g for 5 min.), washed and counted.
Spleen cells are fused with myeloma cells to generate hybridoma cell lines. Several mouse myeloma cell lines which have been selected for sensitivity to hypoxanthine-aminopterin-thymidine (HAT) are commercially available and may be grown in, for example, Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL) containing 10-15% fetal calf serum. Fusion of myeloma cells and spleen cells may be accomplished using polyethylene glycol (PEG) or by electrofusion using protocols that are routine in the art. Fused cells are distributed into 96-well plates followed by selection of fused cells by culture for 1-2 weeks in 0.1 ml DMEM containing 10-15% fetal calf serum and HAT. The supernatants are screened for antibody production using methods well known in the art. Hybridoma clones from wells containing cells that produce antibody are obtained (e.g., by limiting dilution). Cloned hybridoma cells (4−5×106) are implanted intraperitoneally in recipient mice, preferably of a BALB/c genetic background. Sera and ascites fluids are typically collected from mice after 10-14 days.
The invention also contemplates humanized antibodies that are specific for at least a portion of PI-3-kinase gamma and/or its ligands. Humanized antibodies may be generated using methods known in the art, including those described in U.S. Pat. Nos. 5,545,806; 5,569,825 and 5,625,126, the entire contents of which are incorporated by reference. Such methods include, for example, generation of transgenic non-human animals which contain human immunoglobulin chain genes and which are capable of expressing these genes to produce a repertoire of antibodies of various isotypes encoded by the human immunoglobulin genes.
2. Nucleic Acid Sequences
In an alternative embodiment, the PI-3-kinase inhibitor is a nucleic acid sequence. The terms “nucleic acid sequence” and “nucleotide sequence” as used herein refer to two or more nucleotides that are covalently linked to each other. Included within this definition are oligonucleotides, polynucleotide, and fragments and/or portions thereof, DNA and/or RNA of genomic and/or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. Nucleic acid sequences that are particularly useful in the instant invention include, without limitation, antisense sequences and ribozymes. The nucleic acid sequences are contemplated to bind to genomic DNA sequences or RNA sequences that encode PI-3-kinase gamma, thereby inhibiting the activity of PI-3-kinase gamma. Antisense and ribozyme sequences may be delivered to cells by transfecting the cell with a vector that expresses the antisense nucleic acid or the ribozyme as an mRNA molecule. Alternatively, delivery may be accomplished by entrapping ribozymes and antisense sequences in liposomes.
a. Antisense Sequences
Antisense sequences have been successfully used to inhibit the expression of several genes (Markus-Sekura (1988) Anal. Biochem. 172:289-295; Hambor et al. (1988) J. Exp. Med. 168:1237-1245; and patent EP 140 308), including the gene encoding VCAM1, one of the integrin α4β1 ligands (U.S. Pat. No. 6,252,043, incorporated in its entirety by reference). The terms “antisense DNA sequence” and “antisense sequence” as used herein interchangeably refer to a deoxyribonucleotide sequence whose sequence of deoxyribonucleotide residues is in reverse 5′ to 3′ orientation in relation to the sequence of deoxyribonucleotide residues in a sense strand of a DNA duplex. A “sense strand” of a DNA duplex refers to a strand in a DNA duplex that is transcribed by a cell in its natural state into a “sense mRNA.” Sense mRNA generally is ultimately translated into a polypeptide. Thus, an “antisense DNA sequence” is a sequence which has the same sequence as the non-coding strand in a DNA duplex, and which encodes an “antisense RNA” (i.e., a ribonucleotide sequence whose sequence is complementary to a “sense mRNA” sequence). The designation (−) (i.e., “negative”) is sometimes used in reference to the antisense strand, with the designation (+) sometimes used in reference to the sense (i.e., “positive”) strand. Antisense RNA may be produced by any method, including synthesis by splicing an antisense DNA sequence to a promoter that permits the synthesis of antisense RNA. The transcribed antisense RNA strand combines with natural mRNA produced by the cell to form duplexes. These duplexes then block either the further transcription of the mRNA or its translation, or promote its degradation.
Any antisense sequence is contemplated to be within the scope of this invention if it is capable of reducing the level of expression of PI-3-kinase gamma to a quantity which is less than the quantity of PI-3-kinase gamma expression in a control tissue which is (a) not treated with the antisense PI-3-kinase gamma sequence, (b) treated with a sense PI-3-kinase gamma sequence, or (c) treated with a nonsense sequence.
Antisense PI-3-kinase gamma sequences include, for example, sequences which are capable of hybridizing with at least a portion of PI-3-kinase gamma cDNA under high stringency or medium stringency conditions. Antisense PI-3-kinase gamma sequences may be designed using approaches known in the art. In a preferred embodiment, the antisense i PI-3-kinase gamma sequences are designed to be hybridizable to PI-3-kinase gamma mRNA that is encoded by the coding region of the PI-3-kinase gamma gene. Alternatively, antisense PI-3-kinase gamma sequences may be designed to reduce transcription by hybridizing to upstream nontranslated sequences, thereby preventing promoter binding to transcription factors.
In a preferred embodiment, the antisense oligonucleotide sequences of the invention range in size from about 8 to about 100 nucleotide residues. In yet a more preferred embodiment, the oligonucleotide sequences range in size from about 8 to about 30 nucleotide residues. In a most preferred embodiment, the antisense sequences have 20 nucleotide residues.
The antisense oligonucleotide sequences that are useful in the methods of the instant invention may comprise naturally occurring nucleotide residues as well as nucleotide analogs. Nucleotide analogs may include, for example, nucleotide residues that contain altered sugar moieties, altered inter-sugar linkages (e.g., substitution of the phosphodiester bonds of the oligonucleotide with sulfur-containing bonds, phosphorothioate bonds, alkyl phosphorothioate bonds, N-alkyl phosphoramidates, phosphorodithioates, alkyl phosphonates and short chain alkyl or cycloalkyl structures), or altered base units. Oligonucleotide analogs are desirable, for example, to increase the stability of the antisense oligonucleotide compositions under biologic conditions since natural phosphodiester bonds are not resistant to nuclease hydrolysis. Oligonucleotide analogs may also be desirable to improve incorporation efficiency of the oligonucleotides into liposomes, to enhance the ability of the compositions to penetrate into the cells where the nucleic acid sequence whose activity is to be modulated is located, in order to reduce the amount of antisense oligonucleotide needed for a therapeutic effect thereby also reducing the cost and possible side effects of treatment.
Antisense oligonucleotide sequences may be synthesized using any of a number of methods known in the art, as well as using commercially available services (e.g., Genta, Inc.). Synthesis of antisense oligonucleotides may be performed, for example, using a solid support and commercially available DNA synthesizers. Alternatively, antisense oligonucleotides may also be synthesized using standard phosphoramidate chemistry techniques. For example, it is known in the art that for the generation of phosphodiester linkages, the oxidation is mediated via iodine, while for the synthesis of phosphorothioates, the oxidation is mediated with 3H-1,2-benzodithiole-3-one,1-dioxide in acetonitrile for the step-wise thioation of the phosphite linkages. The thioation step is followed by a capping step, cleavage from the solid support, and purification on HPLC, e.g., on a PRP-1 column and gradient of acetonitrile in triethylammonium acetate, pH 7.0. In one embodiment, the antisense DNA sequence is an “PI-3-kinase gamma antisense DNA sequence” (i.e., an antisense DNA sequence which is designed to bind with at least a portion of the PI-3-kinase gamma genomic sequence or with PI-3-kinase gamma mRNA).
b. Ribozyme
In some alternative embodiments, the PI-3-kinase gamma inhibitor is a ribozyme. Ribozyme sequences have been successfully used to inhibit the expression of several genes including the gene encoding VCAM1, which is one of the integrin α4β1 ligands (U.S. Pat. No. 6,252,043, incorporated in its entirety by reference).
The term “ribozyme” refers to an RNA sequence that hybridizes to a complementary sequence in a substrate RNA and cleaves the substrate RNA in a sequence specific manner at a substrate cleavage site. Typically, a ribozyme contains a “catalytic region” flanked by two “binding regions.” The ribozyme binding regions hybridize to the substrate RNA, while the catalytic region cleaves the substrate RNA at a “substrate cleavage site” to yield a “cleaved RNA product.” The nucleotide sequence of the ribozyme binding regions may be completely complementary or partially complementary to the substrate RNA sequence with which the ribozyme binding regions hybridize. Complete complementarity is preferred, in order to increase the specificity, as well as the turnover rate (i.e., the rate of release of the ribozyme from the cleaved RNA product), of the ribozyme. Partial complementarity, while less preferred, may be used to design a ribozyme binding region containing more than about 10 nucleotides. While contemplated to be within the scope of the claimed invention, partial complementarity is generally less preferred than complete complementarity since a binding region having partial complementarity to a substrate RNA exhibits reduced specificity and turnover rate of the ribozyme when compared to the specificity and turnover rate of a ribozyme which contains a binding region having complete complementarity to the substrate RNA. A ribozyme may hybridize to a partially or completely complementary DNA sequence but cannot cleave the hybridized DNA sequence since ribozyme cleavage requires a 2′-OH on the target molecule, which is not available on DNA sequences.
The ability of a ribozyme to cleave at a substrate cleavage site may readily be determined using methods known in the art. These methods include, but are not limited to, the detection (e.g., by Northern blot analysis as described herein, reverse-transcription polymerase chain reaction (RT-PCR), in situ hybridization and the like) of reduced in vitro or in vivo levels of RNA which contains a ribozyme substrate cleavage site for which the ribozyme is specific, compared to the level of RNA in controls (e.g., in the absence of ribozyme, or in the presence of a ribozyme sequence which contains a mutation in one or both unpaired nucleotide sequences which renders the ribozyme incapable of cleaving a substrate RNA).
Ribozymes contemplated to be within the scope of this invention include, but are not restricted to, hammerhead ribozymes (See e.g., Reddy et al., U.S. Pat. No. 5,246,921; Taira et al., U.S. Pat. No. 5,500,357, Goldberg et al., U.S. Pat. No. 5,225,347, the contents of each of which are herein incorporated by reference), Group I intron ribozyme (Kruger et al. (1982) Cell 31: 147-157), ribonuclease P (Guerrier-Takada et al. (1983) Cell 35: 849-857), hairpin ribozyme (Hampel et al., U.S. Pat. No. 5,527,895 incorporated by reference), and hepatitis delta virus ribozyme (Wu et al. (1989) Science 243:652-655).
A ribozyme may be designed to cleave at a substrate cleavage site in any substrate RNA so long as the substrate RNA contains one or more substrate cleavage sequences, and the sequences flanking the substrate cleavage site are known. In effect, expression in vivo of such ribozymes and the resulting cleavage of RNA transcripts of a gene of interest reduces or ablates expression of the corresponding gene.
For example, where the ribozyme is a hammerhead ribozyme, the basic principle of a hammerhead ribozyme design involves selection of a region in the substrate RNA which contains a substrate cleavage sequence, creation of two stretches of antisense oligonucleotides (i.e., the binding regions) which hybridize to sequences flanking the substrate cleavage sequence, and placing a sequence which forms a hammerhead catalytic region between the two binding regions.
In order to select a region in the substrate RNA which contains candidate substrate cleavage sites, the sequence of the substrate RNA needs to be determined. The sequence of RNA encoded by a genomic sequence of interest is readily determined using methods known in the art. For example, the sequence of an RNA transcript may be arrived at either manually, or using available computer programs (e.g., GENEWORKS, from IntelliGenetic Inc., or RNADRAW available from the internet at ole@mango.mef.ki.se), by changing the T in the DNA sequence encoding the RNA transcript to a U.
Substrate cleavage sequences in the target RNA may be located by searching the RNA sequence using available computer programs. For example, where the ribozyme is a hammerhead ribozyme, it is known in the art that the catalytic region of the hammerhead ribozyme cleaves only at a substrate cleavage site which contains a NUH, where N is any nucleotide, U is a uridine, and H is a cytosine (C), uridine (U), or adenine (A) but not a guanine (G). The U-H doublet in the NUH cleavage site does not include a U-G doublet since a G would pair with the adjacent C in the ribozyme and prevent ribozyme cleavage. Typically, N is a G and H is a C. Consequently, GUC has been found to be the most efficient substrate cleavage site for hammerhead ribozymes, although ribozyme cleavage at CUC is also efficient.
In a preferred embodiment, the substrate cleavage sequence is located in a loop structure or in an unpaired region of the substrate RNA. Computer programs for the prediction of RNA secondary structure formation are known in the art and include, for example, “RNADRAW”, “RNAFOLD” (Hofacker et al. (1994) Monatshefte F. Chemie 125:167-188; McCaskill (1990) Biopolymers 29:1105-1119). “DNASIS” (Hitachi), and “THE VIENNA PACKAGE.”
In addition to the desirability of selecting substrate cleavage sequences which are located in a loop structure or an unpaired region of the substrate RNA, it is also desirable, though not required, that the substrate cleavage sequence be located downstream (i.e., at the 3′-end) of the translation start codon (AUG or GUG) such that the translated truncated polypeptide is not biologically functional.
In a preferred embodiment, the ribozyme is an “PI-3-kinase gamma ribozyme” (i.e., a ribozyme whose substrate cleavage sequence is designed to hybridize with a portion of PI-3-kinase gamma that is involved in the biological activity of PI-3-kinase gamma).
One of skill in the art appreciates that it is not necessary that the two binding regions that flank the ribozyme catalytic region be of equal length. Binding regions that contain any number of nucleotides are contemplated to be within the scope of this invention so long as the desirable specificity of the ribozyme for the RNA substrate and the desirable cleavage rate of the RNA substrate are achieved. One of skill in the art knows that binding regions of longer nucleotide sequence, while increasing the specificity for a particular substrate RNA sequence, may reduce the ability of the ribozyme to dissociate from the substrate RNA following cleavage to bind with another substrate RNA molecule, thus reducing the rate of cleavage. On the other hand, though binding regions with shorter nucleotide sequences may have a higher rate of dissociation and cleavage, specificity for a substrate cleavage site may be compromised.
It is well within the skill of the art to determine an optimal length for the binding regions of a ribozyme such that a desirable specificity and rate of cleavage are achieved. Both the specificity of a ribozyme for a substrate RNA and the rate of cleavage of a substrate RNA by a ribozyme may be determined by, for example, kinetic studies in combination with Northern blot analysis or nuclease protection assays.
In a preferred embodiment, the complementarity between the ribozyme binding regions and the substrate RNA is complete. However, the invention is not limited to ribozyme sequences in which the binding regions show complete complementarity with the substrate RNA. Complementarity may be partial, so long as the desired specificity of the ribozyme for a substrate cleavage site and the rate of cleavage of the substrate RNA are achieved. Thus, base changes may be made in one or both of the ribozyme binding regions as long as substantial base pairing with the substrate RNA in the regions flanking the substrate cleavage sequence is maintained and base pairing with the substrate cleavage sequence is minimized. The term “substantial base pairing” means that greater than about 65%, more preferably greater than about 75%, and yet more preferably greater than about 90% of the bases of the hybridized sequences are base-paired.
It may be desirable to increase the intracellular stability of ribozymes expressed by an expression vector. This is achieved by designing the expressed ribozyme such that it contains a secondary structure (e.g., stem-loop structures) within the ribozyme molecule. Secondary structures which are suitable for stabilizing ribozymes include, but are not limited to, stem-loop structures formed by intra-strand base pairs. An alternative to the use of a stem-loop structure to protect ribozymes against ribonuclease degradation is by the insertion of a stem loop at each end of the ribozyme sequence (Sioud and Drlica (1991) Proc. Natl. Acad. Sci. USA 88:7303-7307). Other secondary structures which are useful in reducing the susceptibility of a ribozyme to ribonuclease degradation include hairpin, bulge loop, interior loop, multibranched loop, and pseudoknot structure as described in “Molecular and Cellular Biology,” Stephen L. Wolfe (Ed.), Wadsworth Publishing Company (1993) p. 575. Additionally, circularization of the ribozyme molecule protects against ribonuclease degradation since exonuclease degradation is initiated at either the 5′-end or 3′-end of the RNA. Methods of expressing a circularized RNA are known in the art (see, e.g., Puttaraju et al. (1993) Nucl. Acids Res. 21:4253-4258).
Once a ribozyme with desirable binding regions, a catalytic region and nuclease stability has been designed, the ribozyme may be produced by any known means including chemical synthesis. Chemically synthesized ribozymes may be introduced into a cell by, for example, microinjection electroporation, lipofection, etc. In a preferred embodiment, ribozymes are produced by expression from an expression vector that contains a gene encoding the designed ribozyme sequence.
3. Administering Agents
An agent that is useful in inhibiting PI-3-kinase gamma may be administered by various routes including, for example, orally, intranasally, or parenterally, including intravenously, intramuscularly, subcutaneously, intraorbitally, intracapsularly, intrasynovially, intraperitoneally, intracisternally or by passive or facilitated absorption through the skin using, for example, a skin patch or transdermal iontophoresis. Furthermore, the agent can be administered by injection, intubation, via a suppository, orally or topically, the latter of which can be passive, for example, by direct application of an ointment or powder containing the agent, or active, for example, using a nasal spray or inhalant. The agent can also be administered as a topical spray, if desired, in which case one component of the composition is an appropriate propellant. The pharmaceutical composition also can be incorporated, if desired, into liposomes, microspheres or other polymer matrices (Gregoriadis, “Liposome Technology,” Vol. 1, CRC Press, Boca Raton, Fla. 1984). Liposomes, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer. Liposomes are lipid-containing vesicles having a lipid bilayer as well as other lipid carrier particles that can entrap chemical agents. Liposomes may be made of one or more phospholipids, optionally including other materials such as sterols. Suitable phospholipids include phosphatidyl cholines, phosphatidyl serines, and many others that are well known in the art. Liposomes can be unilamellar, multilamellar or have an undefined lamellar structure. For example, in an individual suffering from a metastatic carcinoma, the agent in a pharmaceutical composition can be administered intravenously, orally or by another method that distributes the agent systemically.
Agents that are PI-3kinase gamma inhibitors may be administered in conjunction with other therapies. For example, in the case of cancer therapy, the agent may be administered in conjunction with conventional drug therapy and/or chemotherapy that is directed against solid tumors and for control of establishment of metastases. In one embodiment, the agent is administered during or after chemotherapy. In a more preferred embodiment, the agent is administered after chemotherapy, at a time when the tumor tissue will be responding to the toxic assault. In an alternative embodiment, the agent may be administered after surgery in which solid tumors have been removed as a prophylaxis against future metastases.
The “subject” to whom the agents are administered includes any animal which is capable of developing cancer in a tissue, including, without limitation, human and non-human animals such simians, rodents, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, ayes, etc. Preferred non-human animals are members of the Order Rodentia (e.g., mouse and rat). Thus, the compounds of the invention may be administered by human health professionals as well as veterinarians.
The following serves to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
LLC cells were obtained from the American Type Culture Collection (ATCC) and Panc02 pancreatic ductal carcinoma cells were obtained from the NCI DCTDC Tumour Repository. The abdominal cavities of immunocompetent C57Bl6 mice and integrin α4Y991A knockin mice30 were opened and the tails of the pancreas were exteriorized. One million Panc02 cells were injected into the pancreatic tail, the pancreas was placed back into the abdominal cavity and the incision was closed. Tumours were excised after 30 days. 5×105 LLC cells were injected subcutaneously or by intravenous tail vein injection into C57Bl6 or integrin α4Y991A mice. Tumours were excised at 7, 14 or 21 days, cryopreserved in O.C.T., lysed for RNA purification or collagenase-digested for flow cytometric analysis of CD11b and Gr1 expression. In some studies, C57Bl6 mice were subcutaneously implanted with LLC cells and treated on d3 and d5 by intraperitoneal injection with 100 μg/25 g of function-blocking anti-IL1β (rat IgG1, MAB401 from R&D Systems) (n=16) or isotype-matched control antibodies (n=14). In alternative studies, mice were treated by i.p. injection with saline (n=6) or 1.25 mg/kg AMD3100 (Sigma Aldrich) (n=7) for eight days or with 2.5 mg/kg TG115 or inert control (n=10) twice daily for ten days after LLC cell implantation. Tumours were harvested, weighed and further analyzed on day 8.
Quantification of Myeloid Cells from Tissues
To quantify myeloid cells in tissues, tumours were excised, minced and digested to single cell suspensions for 2 h at 37° C. in 10 ml of Hanks Balanced Salt Solution (HBSS, GIBCO) containing 10 mg/ml Collagenase type IV (Sigma), 1 mg/ml Hyaluronidase type V (Sigma) and 200 units/ml DNase type IV (Sigma). Cells were incubated in FC-blocking reagent (BD Bioscience), followed by CD11b-APC (M1/70, eBioscience) and Gr1-FITC (RB6-8C5, eBioscience). To exclude dead cells, 2.5 μg/ml propidium iodide (PI) was added before data acquisition by FACs Calibur (BD Bioscience). To quantify myeloid cells in murine peripheral blood, blood was collected by retro-orbital bleeding into heparin-coated Vacutainer tubes (BD Bioscience), incubation in red blood cell lysis buffer and CD11b-APC/Gr1-FITC staining.
Activation of human CD29 (integrin β1 chain) in cytokine stimulated human CD11b+ cells was quantified by flow cytometry using HUTS-21 antibodies (BD Bioscience). Total β1 integrin levels were assessed using P4C10 antibodies (Chemicon). 2.5×106 freshly isolated human myeloid cells/ml in culture medium containing 5% FBS and 0.5% NaN3 were incubated in 10 μg/ml normal human immunoglobulin (12000C, Caltag) for 45 min on ice, then in 2 μg/ml SDF-1α, IL-1β, IL-6 or 1 mM Mn2+ plus 2.5 μg HUTS21, P4C10, or IgG2 control for 10 min at 37° C. followed by Alexa 488 goat-anti mouse antibodies for 20 min on ice. Expression levels of murine integrin α4 on bone marrow derived cells were determined by flow cytometry for PE-conjugated R1/2 (rat anti-CD49d antibody, eBioscience). To induce integrin α4 activation on human myeloid cells or murine WT and α4Y991A myeloid, purified CD11b+ cells were incubated with polystyrene microspheres (9.0 μm diameter, Bangs Laboratories) coated with TCM, 2 μg/ml SDF-1α or IL-1β overnight at 4° C. cells as previously described by Grabovsky et al., 2000. Some cells were incubated in 10 μM of a pan-PI3kinase inhibitor TG020, PI3kinase γ/δ inhibitor TG115, and PI3kinase α inhibitor PI3K75 (the kind gift of Kevan Shokat, University of California, San Francisco) and an inert control. Cells were incubated with beads for 5 min at 37° C., then fixed in 1% paraformaldehyde. Cells were then incubated with 5% BSA and FC-Blocker (BD Bioscience) for 30 min at room temperature followed by FITC-conjugated anti-integrin α4 antibody (R1/2), anti-paxillin (H-114, Santa Cruz Biotechnology), anti-talin (H-300, Santa-Cruz) and TOPRO-3 (Invitrogen). Human CD11b+ cells were incubated in non-immune human IgG (10 μg/ml in 5% BSA, 30 min room temperature) and stained with the following: anti-integrin α4 (N-19, Santa Cruz), anti-CXCR4 (12G5, BD Bioscience) and TOPRO-3. Murine cells were incubated in 5% BSA for 30 min at room temperature followed by FITC-conjugated anti-integrin α4 antibody (R1/2), anti-paxillin (H-114, Santa Cruz Biotechnology) and TOPRO-3. Samples were analyzed by Nikon CS1 spectral confocal on a Nikon TE2000E inverted microscopy. Images were captured using EZ-C13.00 imaging software and analyzed using Metamorph software.
Mammary fat pads from three month-old PyMT mice bearing spontaneous mouse breast carcinomas, implanted 21 day LLC tumours and Panc02 tumours (mean mass of each=1.5 g) were cryopreserved in O.C.T., cryosectioned and immunostained for CD11b using M1/70 (BD Bioscience), for F4/80+ using BM8 (eBioscience) and for CD31 using MEC13.3 (BD Bioscience). Slides were counterstained with DAPI or TOPRO-3 (Invitrogen). Tissues were analyzed using Metamorph (Version 6.3r5, Molecular Devices). Haematoxylin and eosin staining was performed by the Moores UCSD Cancer Centre Histology Shared Resource. Metastases were quantified by immunostaining with rabbit anti-cow keratin antibody (DAKO). All experiments were performed 3 times unless otherwise indicated. Data were analyzed for statistical significance with an unpaired two-tailed Student's t-test or analysis of variance (ANOVA) coupled with posthoc Tukey's test for multiple pairwise comparisons. P<0.05 was considered to be significant.
C57Bl6 mice were from Charles River, beta-actin EGFP and Tie2Cre mice were from Jackson Laboratories, integrin α4Y991A mice were derived as described (Feral, et al., 2006), and integrin α4loxp/loxp mice were obtained from Thalia Papayannopoulou, University of Washington, Seattle. Male Tie2Cre mice were crossed with integrin α4loxp/loxp mice. BMDCs were aseptically harvested from 6-8 week-old female mice by flushing leg bones of euthanized mice with phosphate buffered saline (PBS), 0.5% BSA, 2 mM EDTA, incubating in red cell lysis buffer (155 mM NH4Cl, 10 mM NaHCO3 and 0.1 mM EDTA) and centrifuging over Histopaque 1083. Approximately 5×107 BMDC were purified by gradient centrifugation from the femurs and tibias of a single mouse. Two million cells were intravenously injected into tail veins of each lethally irradiated (1000 rad) syngeneic recipient mouse. After 4 weeks, tumour growth in C57Bl6 mice transplanted with BM from α4Y991A, WT or α4loxpCre− and α4loxpCre+ littermates was compared.
Total RNA was isolated from tissue or cells using ISOGEN (Nippon Gene). cDNA was prepared form 1 μg RNA from each sample and qPCR was performed using primers for SDF-1α, IL-1β, TNF-α, IL-8 and IL-6 from Qiagen (QuantiTect Primer Assay). qPCR for VEGF-A expression was performed using the following primers: sense: GCTGTGCAGGCTGCTCTAAC anti-sense: CGCATGATCTGCATGGTGAT. Transcript levels were normalized to GAPDH expression. Similar studies of gene expression were performed in LLC and Panc02 cells. SDF-1α and IL-1β protein levels were determined in lysates of cultured cells, whole tumours or from tumour derived CD11b+ cells using Quantikine mouse SDF-1α and IL-1β kits (R&D Systems).
TCM was prepared from serum-free media cultured on LLC cells for 18 h and filtered through 0.22 μm filters. 105 calcein-AM labelled human or murine CD11b+ cells in TCM or DMEM containing 200 ng/ml SDF-1α, IL-1β, IL-6, IL-8 or VEGF-A (R&D Systems) were incubated on HUVEC monolayers or on plastic plates coated with 5 μg/ml recombinant soluble VCAM-1 (R&D Systems). Adherent cells were quantified using a fluorescence activated plate reader (GeniosPro, TECAN). In some assays, cells were also incubated in 25 μg/ml anti-integrin α4β1 (PS2 for murine cells and HP2/1 for human cells, gifts from Biogen-Idec) and isotype control antibodies (IgG2bk for murine cells and IgG1 for human cells). In some studies, cells were incubated in 10 μM pan PI3K inhibitors LY294200 or TG020, in PI3kinase α inhibitor PI3K75, PI3kinase γ/δ inhibitor TG115 and an inert control.
BM monocytic cells from WT or α4Y991A mice were isolated as described above and treated with either DMEM or TCM for 30 min at 37° C. Cells were rinsed with cold PBS and lysed in Tris-buffered saline containing 1% CHAPS, 20 mM β-glycerophosphate, 1 mM Na3VO4, 5 mM NaF, 100 ng/ml microcystin-LR, and protease inhibitor cocktail. Clarified cell lysates were immunoprecipitated as follows: 1 mg total protein was precleared with 10 μl protein G-conjugated Dynabeads (Invitrogen) for 1 hr with rotation. Cleared lysates were incubated with 5 μg of rat anti-α4β1 (PS/2) antibody overnight, followed by adding 25 μl of protein G-conjugated Dynabeads for 3 h with rotation. Beads were washed three times with 1 ml cold PBS containing protease inhibitor cocktail. Protein precipitates were electrophoresed on 10% SDS-PAGE gels and immunoblotted with anti-integrin α4 (C-20, Santa Cruz Biotechnology), anti-talin (Clone TD77, Chemicon) or anti-paxillin (H-114, Santa Cruz Biotechnology) antibodies. Immune complexes were visualized using an enhanced chemiluminescence detection kit (Pierce).
CD11b+ cells from C57B16 mice were fluorescently-labelled with green carboxy-fluorescein diacetate, succinimidyl ester (CFDA SE, 5 μM, Invitrogen), and CD11b+ cells from α4Y991A mice were labelled with cell tracker red (5 μM CMTPX™, Invitrogen). Cell viability was tested with Trypan blue staining and in adhesion assays in vitro. Labelled cells were mixed 1:1 and 4×106 cells were injected intravenously into the tail vein of mice bearing LLC carcinomas implanted under dorsal skin-fold window chambers. Accumulated fluorescent cells were quantified after one hour. Alternatively, 107 CD11b+ cells C57Bl6 or α4Y991A mice were labelled with CFDA and were injected intravenously into mice bearing subcutaneous LLC tumours. Fluorescent cells accumulating in tumours and spleens were quantified 24 h later by excising tissues, preparing single cell suspensions and performing FACs analysis at 488 nm.
Both sides of Costar Transwell inserts (8 μm pore) were coated with 5 μg/ml VCAM-1 or vitronectin. Lower chambers were filled with TCM or DMEM. One hundred thousand purified CD11b+ cells were added to the top chambers of transwells and incubated in a humidified atmosphere at 37° C. for 4 h. Migration of CD11b+ cells was measured by counting cells on the underside of the transwell filter.
Growth Factor-depleted Matrigel (BD Bioscience) containing 400 ng SDF-1α, IL-1β (R&D Systems) or saline in 400 μl was injected subcutaneously into C57Bl6 mice (n=6) transplanted with BM from beta-Actin EGFP+ mice. One week later, Matrigel plugs were excised, cryopreserved, sectioned and immunostained for the presence of myeloid cells and blood vessels. In additional studies, 1×106 BM derived CD11b+ cells from WT or α4Y991A mice were mixed with 400 μl Matrigel and implanted in C57Bl6 mice. Cryosections from Matrigel plugs excised after 10 days in vivo were immunostained to detect CD31+ blood vessels and were counterstained with DAPI (blue) (n=6).
Purification of CD11b+ Cells
CD11b+ cells from human buffy coats or murine BM were purified by anti-CD11b magnetic bead affinity chromatography (Miltenyi Biotec). To assess the purity of the CD11b+ cell population, allophycocyanin (APC) labelled anti-CD11b antibodies were added together with the magnetic beads and flow cytometry was performed.
To explore mechanisms regulating myeloid cell trafficking to tumours, we first quantified myeloid cells in murine tumours. Similar to human tumours12-15, ten to fifteen-fold more CD11b+ cells accumulated in spontaneous murine breast, orthotopic lung, orthotopic pancreatic and subcutaneous lung carcinomas than in corresponding normal tissues (
To determine whether specific inflammatory mediators recruit myeloid cells to tumours, we quantified the expression of such factors in LLC and Panc02 pancreatic tumour cells in vitro and tumours in vivo by qPCR and ELISA. Tumour cells in vitro and tumours in vivo expressed SDF-1α, VEGF-A and TNFα, while normal tissues did not. Only tumours in vivo expressed IL-1β and IL-6 (
We found that both tumour and myeloid cell-derived inflammatory factors directly recruit myeloid cells, thereby promoting angiogenesis and tumour growth in vivo. Purified IL-1β or SDF-1α stimulated myeloid cell invasion and angiogenesis in vivo (
Immune cell extravasation from the circulation can depend on activation of α4 or β2 integrins by chemokines, with subsequent adhesion to vascular endothelium and extravasation16-18. We examined whether tumour-derived inflammatory factors promote integrin-dependent myeloid cell adhesion to endothelium. Fluorescently labelled, human and murine CD11b+ cells adhered to vascular endothelium and to recombinant VCAM, an α4 ligand expressed by endothelium in tumours and inflamed tissues, after stimulation by tumour-conditioned medium (TCM), purified SDF-1α, IL-1β, IL-6, IL-8 or VEGF-A (
We next asked which receptor-mediated effectors promote integrin α4-dependent cell adhesion. Myeloid cells from MyD88−/− mice, which are defective in TLR/IL-1β receptor signalling20-21, failed to adhere to endothelium in the presence of IL-1β but adhered normally in the presence of SDF-1α and TCM (
Chemokine signalling can promote conformational changes in integrin β chains that rapidly unfold integrin heterodimers and increase affinity for ligand25. These changes can be detected by binding of a monoclonal antibody, HUTS21, to newly revealed epitopes on the human β1 integrin subunit26. To determine whether tumour derived factors induce integrin conformational changes, we stimulated human CD11b+ cells with SDF-1α, IL-1β, IL-8, IL-6 or Mn2+ (a positive control26) and performed flow cytometry to detect binding of HUTS21 and P4C10, an antibody that recognizes 131 integrin regardless of conformation. Each inflammatory factor stimulated HUTS21 but had no effect on P4C10 binding, indicating that these factors activate myeloid cell β1 integrins without affecting integrin expression (
Integrin activation rapidly results in upregulation of integrin avidity and clustering within the plane of the lipid bilayer25. We found that inflammatory factors stimulated integrin α4 clustering in murine and human CD11b+ cells (
Activation of integrin α4β1-mediated adhesion depends on association of talin with an NPXY domain in β1 cytoplasmic tails and biological activity depends on association of paxillin with tyrosine 991 in the integrin cytoplasmic tail27-29. In mice with an integrin α4Y991A cytoplasmic tail knockin mutation (α4Y991A), paxillin fails to bind to the integrin α4 cytoplasmic tail of immune cells, thereby inhibiting immune cell extravasation in response to thioglycollate-induced intraperitoneal inflammation30. Although inflammatory mediators stimulate integrin clustering in wildtype cells, they fail to promote integrin clustering and co-clustering with paxillin or talin in cells from α4Y991A mice (
To assess the requirement for myeloid cell integrin α4 activation in myeloid cell recruitment to tumours in vivo, we adoptively transferred α4Y991A and wildtype CD11b+ cells into tumour-bearing wildtype animals. α4Y991A cells failed to infiltrate tumours, providing strong evidence for a role of integrin α4 activation in extravasation and tumour infiltration (
LLC and Panc02 tumour suppression in α4Y991A mice results from a defect in myeloid cell trafficking, rather than any significant defect in the stromal cell compartment of these animals, as recruitment of Gr1+CD11b+ cells and F4/80+ macrophages to tumours (
Decreased expression of integrin α4 on myeloid cells also suppresses tumour inflammation, as tumours grown in wildtype animals transplanted with bone marrow from TieCre+α4loxp/loxp exhibited reduced myeloid cell recruitment and growth. CD11b+ cells from TieCre+α4loxp/loxp animals express significantly reduced integrin α4β1 (54%+) than wildtype cells (100%+) (
Together, our studies indicate that myeloid cell integrin α4β1 activation by a central PI3kinase γ dependent-signalling pathway plays a critical role in tumour inflammation and growth. This takes place even though tumour cells initiate recruitment of pro-angiogenic myeloid cells by expressing factors that include SDF-1α, TNFα and VEGF-A, and infiltrating myeloid cells exacerbate recruitment by expressing IL-1β, IL-6 and other factors. Together, these studies indicate that therapeutic agents directed at inhibiting PI3Kinase γ or integrin α4 could provide substantial benefit in reducing tumour inflammation, growth and metastasis.
PI3kinase isoform selective inhibitors were evaluated for their effects on integrin α4b1 mediated myeloid cell adhesion to endothelium and to purified recombinant soluble VCAM. Data are shown in
Myeloid cells were purified from bone marrow as previously described and were labeled with calcein-AM. Labelled cells were placed in medium containing no additives, SDF1, IL-1 beta, IL-8, IL-6, VEGF or TNFa containing PI3kinase inhibitors at various concentrations and were allowed to adhere to 48 well plastic plates coated with recombinant soluble VCAM or monolayers of human umbilical vein endothelial cells for 30 minutes. Cells were well washed, then quantified in a fluorimeter. Inhibitors are: TG020, a pan-PI3kinase inhibitor and TG100-115, a PI3kinase gamma/delta inhibitor from Targegen, Inc.; AS605420 and AS604850, PI3kinase gamma inhibitors first described by Serono and purchased from Echelon, Inc.; PI-103 and PIK3alpha2, PI3kinase alpha selective inhibitors purchased from Echelon; PIK75, a PI3kinase alpha selective inhibitor obtained from Targegen; TGX115, a PI3kinase beta selective inhibitor purchased from Echelon. PI3kinase gamma−/− mice were obtained under MTA from Dr. Josef Penninger at the Molecular Biology Institute of Vienna, Austria.
Myeloid cell chemoattractants rapidly activate myeloid cell PI3kinase (
Decreased PI3kinase gamma activity in PI3 Kgamma −/− and inhibitor treated myeloid cells (
Evaluation of tumor growth in PI3kinase gamma−/− mice (
Quantification of tumor infiltrating myeloid cells (
Reduced LLC tumor growth in PI3kinase gamma −/− treated mice (
Male PyMT+ mice on an FVB background were randomly bred with FVB females lacking the PyMT transgene to obtain female mice heterozygous for the PyMT transgene. Female mice heterozygous for the PyMT transgene were compared to wild type FVB female mice. All PyMT+ females exhibit hyperplasias by 6 weeks of age and the majority exhibit adenomas/early carcinomas by 9 weeks of age and lymph node and lung metastases by 12-15 weeks of age31. Integrin α4Y991A mice in the C57BL/6 background were derived as previously described16. Integrin α4Y991A mice were backcrossed for 8 generations into the FVB lineage and then crossed with FVB PyMT males to achieve PyMT+α4Y991A/α4Y991 female mice for breast tumor development studies. Additionally, male Tie2Cre+ mice were crossed with female integrin α4loxp/loxp mice3 to generate Tie2Cre+ α4loxp/+ mice, which were then crossed to with α4loxp/loxp mice to obtain sibling Tie2Cre− α4loxp/loxp and Tie2Cre+ α4loxp/loxp mice for studies. PI3-kinase γ−/− (p110γ−/−)21 mice were obtained from Dr. Joseph Penninger of the Institute of Molecular Biotechnology, Vienna, Austria. C57BL/6 mice were obtained from Charles River, and Tie2Cre mice and CD11b−/− mice were from Jackson Laboratories.
C57BL/6 LLC cells and B16 cells were obtained from the American Type Culture Collection (ATCC) and C57BL/6 Panc02 pancreatic ductal carcinoma cells were obtained from the NCI DCTDC Tumour Repository. All cells were cultured in antibiotic- and fungicide-free DMEM media containing 10% serum and tested negative for mycoplasma using the Mycoplasma Plus PCR primer set from Stratagene (La Jolla, Calif.).
Orthotopic pancreatic tumours were initiated by implanting 1×106 Panc02 pancreatic carcinoma cells into the pancreas of syngeneic mice. The abdominal cavities of immunocompetent C57BL/6 mice and integrin α4Y991A mice were opened and the tails of the pancreata were exteriorized. One million Panc02 cells were injected into the pancreatic tail, the pancreas was placed back into the abdominal cavity, and the incision was closed. Pancreata were excised and cryopreserved after 30 days. Lymph nodes and other organs were visible metastases were also cryopreserved. Tumour weight, angiogenesis and CD11b/F4/80 content were quantified as described. Studies were performed twice with n=6.
Subcutaneous tumours were initiated as follows: 5×105 LLC cells or B16 cells were injected subcutaneously into syngeneic (C57BL/6) 6- to 8-week old wildtype (WT), integrin α4Y991A, or PI3-kinase γ−/− (p110−/−) mice. Tumours dimensions were recorded and tumours were excised at 7, 14 or 21 days. Tumour weights were obtained at each time point. Tumours were cryopreserved in O.C.T., solublized for RNA purification or collagenase-digested for flow cytometric analysis of CD11b and Gr1 expression as detailed below. Angiogenesis was measured by CD31 immunostaining. For orthotopic LLC tumors, 5×105 LLC cells were injected in the tail vein and lungs were harvested after 12 days. LLC tumour studies in WT versus α4Y991A animals were performed three times (n=6-8). B16 studies in WT versus α4Y991A animals were performed once (n=8).
Patients at the Moores UCSD Cancer Center in La Jolla, Calif., underwent planned procedures for breast surgical treatment. All surgeries were performed at the University of California, San Diego and standard techniques were used for resection of breast tissue. Normal tissue was also obtained from patients undergoing breast reduction or prophylactic mastectomy. Specimens were removed, sent to the UCSD Medical Center pathology laboratory for analysis, and reviewed by a pathologist to assess the surgical margin tissue. A sample of tissue was placed on dry ice and stored at −80° C. Tissues not needed for diagnosis were embedded in O.C.T. for cryosectioning. 10 invasive ductal carcinomas and 10 normal tissues were evaluated for the presence of CD11b+ cells by immunostaining of frozen sections.
Mammary fat pads from three month-old PyMT mice bearing spontaneous mouse breast carcinomas, LLC tumours grown orthopically in lung for 12 days or subcutaneously in skin for 21 days (with an average mass of 1.5 g), and orthotopic Panc02 tumours grown in the pancreas for 30 days (with an average mass of 1.5 g) were cryopreserved in O.C.T., cryosectioned and immunostained for CD11b using M1/70 (BD Bioscience), for F4/80+ using BM8 (eBioscience) and for CD31 using MEC13.3 (BD Bioscience). Slides were counterstained with DAPI or TOPRO-3 (Invitrogen). Tissues were analyzed using Metamorph image capture and analysis software (Version 6.3r5, Molecular Devices). Haematoxylin and eosin staining was performed by the Moores UCSD Cancer Centre Histology Shared Resource. Metastases were quantified by immunostaining with Alexa488-conjugated murine anti-pan-cytokeratin (anti-cytokeratins 5, 6, 8, 10, 13, and 18, Clone C11) from Cell Signaling Technology. All experiments were performed 3 times. Data were analyzed for statistical significance with an unpaired two-tailed Student's t-test or analysis of variance (ANOVA) coupled with posthoc Tukey's test for multiple pairwise comparisons. P<0.05 was considered to be significant. Myeloid cells were quantified by immunohistochemical methods rather than by flow cytometry when insufficient material was available for quantification by flow cytometry.
Normal human mammary gland and invasive ductal breast carcinoma (n=10), 9 week old WT FVB and 9 week PyMT+FVB mouse mammary glands (n=6), normal mouse pancreata and d30 orthotopic Panc02 pancreatic tumours (n=6), normal mouse lungs and d12 orthotopic LLC carcinoma lung tumours (n=6), and normal mouse skin and d21 subcutaneous LLC tumours (n=6) were immunostained to detect CD11b+ cells using M1/70 (BD Bioscience).
To quantify myeloid cells in tissues, tumours were excised, minced and digested to single cell suspensions for 2 h at 37° C. in 10 ml of Hanks Balanced Salt Solution (HBSS, GIBCO) containing 10 mg/ml Collagenase type IV (Sigma), 100 μg/ml Hyaluronidase type V (Sigma) and 200 units/ml DNase type IV (Sigma). Red blood cells were solublized with RBC Lysis Buffer (eBioscience) and then cells were incubated in FC-blocking reagent (BD Bioscience), followed by anti-CD11b-APC (M1/70, eBioscience) and anti-Gr1-FITC (RB6-8C5, eBioscience). To exclude dead cells, 0.5 μg/ml propidium iodide (PI) was added before data acquisition by FACs Calibur (BD Bioscience).
To quantify myeloid cells in murine peripheral blood, blood was collected from naïve or tumor-bearing mice by retro-orbital bleeding into heparin-coated Vacutainer tubes (BD Bioscience), incubated in red blood cell lysis buffer and stained with anti-CD11b-APC/Gr1-FITC.
CD11b+ Gr1+ myeloid cells from bone marrow or tumour tissue were further characterized by immunostaining to detect F4/80 (BM8-APC and -FITC), CD14 (Sa2-8-APC), cKit (ACK2-APC) and Tie2 (TEK4-PE) from eBioscience, as well as MHC-II (AF6 120.1), Ly6C (AL-21-FITC) and Ly6G (1A8-PE) both from BD Pharmingen. Data was acquired with a FACs Calibur instrument (BD Bioscience).
Total RNA was isolated from normal tissue, LLC tumours, Panc02 tumours, LLC and Panc02 cells as well as myeloid cells using ISOGEN (Nippon Gene). cDNA was prepared from 1 μg RNA from each sample and qPCR was performed using primers for Pi3ka, Pi3kb, Pi3kg, Pi3kd, Gapdh, Sdf-1α, IL-1β, TnfA, Il-6, αM (Cd11b), α4 and Cd31 from Qiagen (QuantiTect Primer Assay). qPCR for VegfA expression was performed with sense primers: 5′GCTGTGCAGGCTGCTCTAAC3′ and anti-sense primers: 5′CGCATGATCTGCATGGTGAT3′. Relative expression levels were normalized to gapdh expression according to the formula <2̂-(Ct gene of interest−Ct gapdh)>32. Values were multiplied by 100 for presentation purposes. Fold increase in expression levels were calculated by comparative Ct method <2̂-(ddCt)>32. Values for Panc02 were compared to normal pancreas and LLC to total cells isolated from subcutaneous implanted Growth Factor-depleted Matrigel. SDF-1α and IL-1β protein levels were determined in RIPA lysates of cultured tumour cells, whole tumours or CD11b+ cells purified from tumours using Quantikine mouse SDF-1α and IL-1β ELISA kits (R&D Systems).
Purification of Cells from BM or Buffy Coat
Human CD11b+ cells were purified from human buffy coats from the San Diego Blood Bank. Murine CD11b+ or Gr1+ cells were purified from murine BM by anti-CD11b or Gr1+ magnetic bead affinity chromatography according to manufacturer's directions (Miltenyi Biotec) or by fluorescence activated cell sorting. To assess the purity of the CD11b+ or Gr1+ cell population, allophycocyanin (APC) labelled anti-CD11b or Gr1 antibodies were added together with the magnetic beads and flow cytometry was performed.
1×105 calcein-AM labelled human CD11b+ cells isolated from buffy coats from the San Diego Blood Bank or murine CD11b+ cells isolated from naïve (non-tumour bearing) or tumour-bearing mice were incubated on HUVEC monolayers or on plastic plates coated with 5 μg/ml recombinant soluble VCAM-1 or ICAM-1 (R&D Systems) for 30 minutes at 37° C. with humidity in the presence of LLC Tumour Conditioned Medium (TCM) or DMEM containing 200 ng/ml SDF1α, IL1β, IL6, TNFα or VEGF-A (R&D Systems). (SDF-1α and IL-1β were initially titrated to determine the minimum dose required to achieve near maximal stimulation of adhesion). TCM was prepared by incubating LLC cells in serum-free media for 18 h and filtering through 0.22 μm filters. After washing three times with warmed medium, adherent cells were quantified using a plate fluorimeter (GeniosPro, TECAN).
In some adhesion assays, cells were also incubated in 25 μg/ml function-blocking anti-integrin α4β1 (rat anti-murine, PS2 or mouse anti-human, HP2/1, gifts from Biogen-Idec), rat-anti-αM (anti-CD11b, M1/70) and isotype control antibodies (rat IgG2κ or mouse IgG1) or with 0.1 nM-10 μM doses of the small molecule inhibitor of integrin α4, ELN476063 (IC50=10 nM), a gift from Elan14.
Additionally, labelled cells were incubated with HUVEC and rsVCAM coated plates in the presence of 200 ng/mL-1β or SDF-1α and 1-10 μM inhibitors: pan-PI3 kinase inhibitors (LY2942002, wortmannin), PI3-kinase α inhibitors (PI3K75, PIK2alpha, PI103), PI3-kinase β inhibitor (TGX221), PI3-kinase γ inhibitors (TG100-115, AS605240, AS604850), inert control, PLC inhibitor (U73122), geranylgeranyltransferase (Rap1-selective) inhibitors (GGTI-2147 and GGTI-298) or farnesyltransferase (Ras-selective) inhibitor (FTI-277), Akt inhibitors (Inhibitor X and peptide 18), mTOR inhibitor (rapamycin), ROCK inhibitor (Y27632), MEK inhibitor (PD98059), p38 inhibitor (SB202190), tyrosine kinase inhibitor (genestein) and PKA inhibitors (H89, KT5720). LY294002, wortmannin, genestein, U73122, GGTI-2147, GGTI-298, FTI-277, Y27632, PD98059, SB202190, H89 and KT5720 were from Calbiochem. PIK2alpha, PI103, AS605240, AS604850 and TGX221 were from Echelon. TG100-115 was prepared as described25-26. To titrate the effect of various signalling protein inhibitors on myeloid cell adhesion stimulated by IL-1β or SDF-1α, cells were incubated in 1 nm to 100 μM PI3-kinase inhibitors TG00020 (a pan-PI3-kinase inhibitor), PI3-kinase α inhibitor (PI3Kalpha2) PI3-kinase β inhibitor (TGX221), PI3-kinase γ inhibitors (TG100-115, AS605240), an inert chemically matched control, farnesyltrasnferase inhibitors and geranylgeranyltransferase inhibitors. IC50s for GGTI and FTI were 1 μM. IC50s for PI3K inhibitors are reported in Supp.
Additionally, CD11b+ cells from WT, α4Y991a, α4−/− (Tie2Creα4loxp/loxp), and p110γ−/− mice were stimulated with chemokines and incubated with HUVEC- or VCAM-1-coated plates. Gr1+myeloid cells from αM−/− (Cd11b−/−) and WT mice were also stimulated and incubated with HUVECs and VCAM-1 coated plates. As expected, no differences were observed in the degree of adhesion of Gr1+WT and CD11b+ WT myeloid cells.
CD11b+Gr1+ cells were isolated from bone marrow of naïve or LLC tumour bearing WT mice, stimulated with chemokines and incubated with HUVEC- or VCAM-1-coated plates.
Bone marrow derived cells were isolated from Tie2Cre+ integrin α4loxp/loxp mice were incubated with anti-CD11b-APC, anti-CD49d-FITC and 0.5 μg/ml propidium iodide. CD11b+CD49d+PI− and CD11b+CD49−PI− cells were collected using Aria FACs sorting at the Moores Cancer Center Shared Resource. Cells were used in adhesion and in vivo homing assays.
5×105 CD11b+ cells isolated from WT, α4Y991A, or PI3-kinase γ−/− mice (naïve or tumour-bearing) were incubated with 200 ng/ml IL-1β, SDF-1α, IL-6, TNFα, VEGF-A or medium together with 1 mg/ml mouseVCAM-1/humanFc fusion protein (R&D Systems) for 3 min. Cells were washed twice and incubated with donkey anti-human-FC-PE antibody (Jackson Immunoresearch) then analysed by FACs Calibur. Mean fluorescence intensity of treated cells was compared to that of unstimulated cells (basal). In other studies, cells from WT mice were untreated or were treated with 1 μM PI3-kinase α, β, or γ inhibitors for 30 min at 37° C. In some experiments GFP/RapV12 or GFP/RasV12 transfected CD11b+ cells were used. In this case, increased mean fluorescence intensity was measured for only GFP-positive cells.
Expression levels of murine integrin α4 on CD11b+ cells were determined by flow cytometry for PE-conjugated R1/2 (rat anti-CD49d antibody, eBioscience). Integrin α4 levels on human CD11b+ cells were determined by flow cytometry for HP2/1 (anti-human α4 antibody, Biogen Idec).
The activation state of β1 integrins (CD29) on human CD11b+ cells was quantified by flow cytometry using HUTS-21 (an anti-β1 integrin activation induced epitope antibody, BD Bioscience) and total β1 integrin levels were assessed using P4C10 antibodies (Chemicon) as follows. 2.5×106 freshly isolated human myeloid cells/ml were incubated in culture medium containing 10 μg/ml normal human immunoglobulin (12000C, Caltag) for 45 min on ice. These cells were then incubated in 200 ng/ml SDF-1α, IL-1β, IL-6 or 1 mM Mn2+ plus 2.5 μg HUTS21, P4C10, or IgG2 control for 10 min at 37° C., followed by Alexa 488 goat-anti mouse antibodies for 20 min on ice.
IL-1β, SDF-1α and integrin α4 inhibitor studies: C57B16 mice were subcutaneously implanted on d1 with 1×106 LLC cells and were treated on d3 and d5 with intraperitoneal injections of function-blocking anti-IL-1β antibodies (MAB401 from R&D Systems) (n=16) or isotype-matched control antibodies rat IgG1, (n=14) (100 μg/25 g body weight). Mice were sacrificed on d7. In alternative studies, mice were treated by i.p. injection with saline (n=6) or 1.25 mg/kg SDF-1α inhibitor (AMD3100, Sigma Aldrich) (n=7) daily for eight days, starting one day prior to subcutaneously implantation of 1×106 LLC cells. In further studies, mice were treated with anti-IL-1β and SDF 1α inhibitor. In other studies, C57BL/6 mice were subcutaneously implanted on d1 with 0.5×106 LLC cells and were treated every third day with subcutaneous injections of ELN476063 (3 mg/kg body weight), an integrin α4 small molecule inhibitor.
Alternatively, 6 week old PyMT+ female mice (with spontaneous breast tumours), were treated by subcutaneous injection with ELN476063 (3 mg/kg body weight), or saline every third day for three weeks (n=10). Tumours were excised, weighed and analyzed from 6 weeks at 9 weeks of age.
PI3-kinase γ inhibitor studies: C57BL/6 mice were subcutaneously implanted on d1 with 5×105 LLC or by intradermal injection with 5×105 B16 melanoma cells. Mice were treated by i.p. injection with 2.5 mg/kg of PI3-kinase γ inhibitor (TG100-115) or with a chemically similar inert control (n=10) twice daily for fourteen days for a total daily dose of 5 mg/kg. In additional studies, C57BL/6 mice were subcutaneously implanted on d1 with 5×105 LLC and were treated by i.p. injection with 2.5 mg/kg, 0.25 mg/kg, or 0.025 mg/kg of PI3-kinase γ inhibitor (TG100-115), with 2.5 mg/kg of AS605240 or with a chemically similar inert control (n=10) twice daily for twenty-one days for a total daily dose of 5 mg/kg. Tumour volumes, weights and blood vessel densities, as well as myeloid cell densities were measured. Alternatively, 6 week old PyMT+ female mice (with spontaneous breast tumours), were treated by i.p. injection with 2.5 mg/kg PI3-kinase γ inhibitor (TG100-115) or inert control twice daily for three weeks (n=10). Tumours were excised, weighed and analyzed after 3 weeks. Alternatively, 6 week old FVB PyMT+ female mice were implanted with an Alzet osmotic pump with a 0.25 μl/h release rate containing 4.6 mg in 200 μl of TG100-115 or chemically similar, inert control (n=10). Mice were sacrificed at 9 weeks of age and tumours were analyzed.
Pharmacokinetic analysis of a 5 mg/kg bolus dose TG100-115 in Balb-c mice was accomplish by evaluating TG100-115 levels in serum at 5, 15, 30, 60 minute intervals as was previously performed for rats25. In vivo activity assay of a 5 mg/kg bolus dose TG100-115 in Balb-c mice was accomplish by evaluating pAkt/Akt levels in peripheral blood cells in response to SDF-1α stimulation at 0.25, 0.5, 1, 2, 4, 6 and 12 hour intervals
Inguinal mammary glands were fixed in Carnoy's fixative, dehydrated through a graded series of ethanol solutions and defatted in xylene. Following rehydration, the mammary epithelium was stained with carmine stain (Sigma Chemical, St Louis, Mo.) for 30 min. After removing excess stain by washing in water, samples were dehydrated and stored in methyl salicylate (Sigma Chemical, St Louis, Mo.).31
Bone marrow derived cells (BMDCs) were aseptically harvested from 6-8 week-old female mice by flushing leg bones of euthanized mice with phosphate buffered saline (PBS) containing 0.5% BSA and 2 mM EDTA, incubating cells in red cell lysis buffer (155 mM NH4Cl, 10 mM NaHCO3 and 0.1 mM EDTA) and centrifuging over Histopaque 1083. Approximately 5×107 BMDC were purified by gradient centrifugation from the femurs and tibias of a single mouse. Two million cells were intravenously injected into tail veins of each lethally irradiated (1000 rad) 6 week old syngeneic recipient mouse. After 4 weeks of recovery, tumour cells were injected in BM transplanted animals. LLC (n=8, 3 experiments) and Panc02 (n=8, 2 experiments) tumour growth in C57BL/6 and α4Y991A mice transplanted with BM from α4Y991A or WT were compared as described above.
CD11b+ cells from C57BL/6 mice or PI3-kinase γ−/− mice were freshly isolated under serum free-conditions and were incubated for 30 min in serum-free media in the presence or absence of 1 μM TG100-115. CD11b+ cells were then stimulated with 200 ng/ml IL-1β or SDF-1α (R&D Systems) for 1-3 minutes and cells were solubilized with RIPA buffer. Alternatively, mice were injected intravenously with 2.5 mg/ml TG100-115 or a chemically similar inert control. Mononuclear peripheral blood leukocytes were isolated from 2 mice each at 0.5, 1, 2, 4, 6 and 12 hours after treatment. Cells were treated for 3 minutes with 200 ng/ml SDF and then solubilized with RIPA buffer. Lysates were electrophoresed and Western blotted. Akt phosphorylation was evaluated by immunoblotting with anti-phosphorylated Thr308-Akt specific antibody (C31 E5E, Cell Signalling). Blots were stripped and reprobed with anti-Akt (#9272, Cell Signaling). Films were scanned and quantified by densitometry.
Total BM was isolated from WT mice under serum free conditions. BM cells were incubated for 30 min at 37° C. in serum free media in the presence or absence of 1 μM PI3-kinase γ inhibitor (TG100-115), followed by stimulation with basal medium or medium containing 200 ng/ml IL-1β, IL-6 or SDF-1α (R&D Systems). Cells were lysed and activated Rap1 was pulled down from 1 mg cell lysate after addition of RalGDS Rap1-binding domain-GST fusion proteins and glutathione-conjugated beads. Beads were boiled in SDS sample buffer and electrophoresed on SDS gels. Activated (pulled down) Rap1 was detected by immunoblotting with anti-Rap1 antibodies (from Rap1 pulldown assay kit, Thermo Scientific, 89872).
BM cells (comprised of 80% CD11b+Gr1+ cells) from WT or α4Y991A mice were isolated as described above and treated with either DMEM or TCM for 30 min at 37° C. Cells were rinsed with cold PBS and lysed in Tris-buffered saline containing 1% CHAPS, 20 mM β-glycerophosphate, 1 mM Na3VO4, 5 mM NaF, 100 ng/ml microcystin-LR, and protease inhibitor cocktail. After centrifugation, integrin α4 in cell lysates were immunoprecipitated as follows: 1 mg total protein was precleared with 10 μl protein G-conjugated Dynabeads (Invitrogen) for 1 hr at 4° C. with rotation. Cleared lysates were incubated with 5 μg of rat anti-α4β1 (PS/2) antibody at 4° C. overnight. 25 μl of protein G-conjugated Dynabeads was then added for 3 h with rotation. Beads were washed three times with 1 ml cold PBS containing protease inhibitor cocktail. Protein precipitates were electrophoresed on 10% SDS-PAGE gels and immunoblotted with anti-integrin α4 (C-20, Santa Cruz Biotechnology), anti-talin (Clone TD77, Chemicon) or anti-paxillin (H-114, Santa Cruz Biotechnology) antibodies. Immune complexes were visualized using an enhanced chemiluminescence detection kit (Pierce).
siRNA Mediated Knockdown
Freshly isolated CD11b+ cells from mouse BM were transfected using an AMAXA Mouse Macrophage Nucleofection Kit with 100 nM of siRNA for Rap1 (Mm_Rap1a—1 & Mm_Rap1a—7), Nras (Mm_Nras—2 & Mm_Nras—3), Hras (Mn_Hras1—1 & Mm_Hras1—2), Kras (Mm_Kras2—1 & MmKras2—3), PI3Kα (Mm_pik3ca—1 and Mm_pik3ca—3), PI3Kβ (Mm_pik3cb—2 and Mm_pik3cb—4), PI3kγ (Mm_pik3cg—1 and Mm_pik3cg—2), PI3Kδ (Mm_pik3cd—1 and Mm_pik3cd—2), itga4 (Mm_itga4—1 & Mm_itga4—2) itgam ((Mm_itgam—1 & Mm_itgam—5) or non-silencing siRNA (Ctrl_AllStars—1) purchased from Qiagen. After transfection, cells were cultured for 36-48 h in media containing 20% serum. Each siRNA was tested individually for efficient knockdown of protein expression and for inhibition of adhesion. qPCR Primers used to validate mRNA levels included Mm_pik3ca—1_SG, Mm_pik3cb—1_SG, Mm_pik3cg—1_SG, Mm_pik3cd—1_SG, Mm_ita4—1_SG, and Mm_itam—1_SG from Qiagen. Antibodies used to validate protein levels included PI3K alpha (#42550), beta (#3011), gamma (#4252) from Cell Signaling. To validate integrin expression cells were analyzed by flow cytometry using anti-α4 (R1-2) and anti-αM (M1/70) antibodies from eBioscience. Similar results were achieved for each siRNA oligo listed above. Results are presented for Mm_Rap1a—1, Mm_Nras—2, Mm_Kras2—1, Mm_pik3ca—1, Mm_pik3b—2, Mm_pik3cg—1, Mm_pik3cd—1, Mm_itga4—1, and Mm_itgam—1.
Plasmids expressing constitutively active Rap (pRapV12)7 or Ras (pRasV12)8 were co-transfected with pGFP using an AMAXA Mouse Macrophage Nucleofection Kit into CD11b+ cells from WT and PI3-kinase γ−/− mice and were cultured for 36 h in media+20% serum. Transfection efficiency was around 30-40% as determined by GFP-FACs. Constructs were tested for ability to induce adhesion in the absence of stimulation and in the presence of TG100-115 (1 μM). In some studies cells were co-transfected with constitutively active Rap (pRapV12) or Ras (pRasV12) and siRNA directed against PI3Kγ or integrin α4.
CD11b+ cells from C57BL/6 mice were fluorescently labelled with carboxyfluorescein succinimidyl ester (CFSE, 5 μM, Invitrogen), and CD11b+ cells from α4Y991A mice were labelled with cell tracker red (5 μM CMTPX™, Invitrogen). Cell viability was tested with Trypan blue staining and cell functionality was tested by adhesion assays in vitro. Green- and red-labelled cells were mixed 1:1 and 4×106 cells were injected intravenously into the tail vein of mice bearing 1-week-old LLC carcinomas grown under dorsal skin-fold window chambers. Accumulated fluorescent cells were visualized with live animal confocal microscopy and were quantified one hour after injection.
Alternatively, 5×106 CFSE labelled CD11b+ cells from C57BL/6, α4Y991A, and PI3-kinase γ−/− mice were injected intravenously into mice bearing subcutaneous (5×105) d14 LLC tumours. In other studies, CD11b+ cells from WT mice were treated for 1 h with 1 μM PI3-kinase α inhibitor (PI3K75), PI3-kinase β inhibitor (TGX221), PI3-kinase γ inhibitor (TG100-115) and an inert control or with 10 μM PLC inhibitor (U73122), geranylgeranyltransferase inhibitor (GGT2147) or farnesyltransferase inhibitor (FTI-277) and then injected intravenously into mice bearing subcutaneous (5×105) d14 LLC tumours.
In other studies, K, N and H Ras, Rap1, PI3Kα, PI3Kβ, PI3Kγ, PI3Kδ, integrin α4 and integrin αM were knocked down by siRNA transfection of CD11b+ cells as described above. 48 h later, cells were labeled with CFSE and injected into mice with d14 LLC tumours (1×106 cells). Fluorescent cells accumulating in tumours and spleens were quantified 2 h and 24 h later by excising tissues, preparing single cell suspensions and performing FACs analysis at 488 nm. No differences were observed between untreated and non-silencing siRNA treated cells.
Growth Factor-depleted Matrigel (BD Bioscience) containing 400 ng SDF-1α, IL-1β (R&D Systems) or saline in 400 μl was injected subcutaneously into C57BL/6 mice (n=6) transplanted with BM from beta-Actin EGFP+ mice (from Jackson Laboratories). One week later, Matrigel plugs were excised, cryopreserved, sectioned and immunostained for the presence of myeloid cells and blood vessels. In additional studies, 400 μl Growth Factor-depleted Matrigel (BD Bioscience) containing 400 ng bFGF (R&D Systems) or saline was injected subcutaneously into C57BL/6 WT or PI3-kinase γ −/− mice. After 5 days, mice were injected intravenously with 20 μg FITC-conjugated Bandeira simplicifolia lectin-I (Vector Laboratories), Matrigel plugs were removed and homogenized. Fluorescence was quantified at 520 nm using a fluorimeter (Tecan).
Two thousand LLC or PyMT breast carcinoma cells were seeded into 96 well plate wells in the presence or absence of 0.1-10 μM Pan-PI3-kinase inhibitor (TG00020), PI3-kinase γ inhibitor (TG100-115) or inert control. Cell proliferation was measured after 24 h, 48 h, and 72 h according to the manufacturer's protocol (WST-1 cell proliferation reagent, Roche).
Statistical significance was determined by ANOVA coupled with posthoc Tukey's test for multiple pairwise comparison,
Cancer and inflammation are linked, as chronic inflammatory diseases increase the risk of developing tumours1, and growing tumours induce host inflammatory responses that stimulate tumour progression2-6. Myeloid cells, including granulocytes, monocytes, myeloid-derived suppressor cells and tumour-associated macrophages, invade the tumour microenvironment in response to a variety of chemoattractants and promote tumour angiogenesis3,5-9, immunosuppression2,4,10-11 or metastasis12. We show here that a single, common Ras-PI3-kinase γ-integrin α4β1 pathway regulates myeloid cell extravasation, tumour inflammation and tumour progression, regardless of the specific chemoattractant produced by the tumour. Chemoattractants released from tumour cells, including SDF-1α, TNFα and VEGF-A, and those released from tumour macrophages, such as IL-1β and IL-6, stimulate Ras, PI3-kinase γ and Rap1a-dependent integrin α4β1 activation and integrin α4β1-dependent recruitment of myeloid cells to the tumour microenvironment. Genetic or siRNA mediated ablation or chemical inhibition of N- and K-Ras, PI3-kinase γ, Rap1a or integrin α4 function blocks myeloid cell adhesion to vascular endothelium and recruitment to implanted or spontaneous tumours, leading to a reduction in tumour angiogenesis, growth and metastasis. These findings help to define further the role that myeloid cells play in establishing chronic inflammation in cancer and indicate for the first time that use of inhibitors of PI3-kinase γ or integrin α4β1 represents an innovative approach to control tumour malignancy. (These results are summarized in
To identify pathways that regulate tumour inflammation, we characterized myeloid cell recruitment to human and murine tumours. CD11b+ myeloid cells extensively and persistently invaded tumours but not normal tissues (FIGS. 27,32a-d). Myeloid cell invasion was proportional to angiogenesis, supporting a role for myeloid cells in tumour angiogenesis (
To determine whether specific chemoattractants recruit myeloid cells to the tumour microenvironment, we examined the expression profiles of chemoattractants in tumours. Tumours but not normal tissues expressed Sdf-1α, Vegf-A, Tnfα, IL-1β and IL-6 from the earliest stages of growth (
As immune cell extravasation can depend on integrin-mediated adhesion to endothelial cell (EC) counter-receptors VCAM-1 or ICAM-112-13, we tested the ability of chemoattractants to promote myeloid cell adhesion to endothelium. Human CD11b+ cells and murine CD11b+, Gr1hiCD11b+ and Gr1loCD11b+ cells from normal and tumour-bearing mice adhered strongly to EC and VCAM and slightly to ICAM in response to diverse chemoattractants (
Extracellular stimuli can induce integrin conformational changes that result in increased ligand-binding and cell adhesion19. Tumour-derived chemoattractants rapidly stimulated ligand-binding to WT but not integrin α4Y991A myeloid cells (
To determine whether myeloid cell recruitment to tumours depends on integrin α4 activity, we adoptively transferred fluorescently labelled WT, α4Y991A, α4−/−, αM−/−, as well as α4 and αM siRNA transfected myeloid cells, into tumour-bearing WT mice. Myeloid cells with defective or ablated integrin α4β1 failed to arrest in tumours, while cells with ablated αM infiltrated tumours normally, providing evidence that integrin α4, but not αM, is required for myeloid cell tumour infiltration in vivo (
To evaluate the contribution of myeloid cell trafficking to tumour growth in vivo, we characterized the growth of subcutaneous lung carcinoma (LLC), orthotopic pancreatic carcinoma (Panc02), orthotopic B16 melanoma and spontaneous PyMT breast carcinoma in WT and α4Y991A mice. Myeloid cell infiltration, neovascularization, tumour growth and expression of pro-angiogenic and inflammatory factors were strongly suppressed in α4Y991A animals (
To confirm that tumour suppression in α4Y991A mice results from defects in BM-derived cell trafficking, we implanted subcutaneous LLC and orthotopic pancreatic tumour cells into BM-chimeric animals. Recruitment of Gr1+CD11b+myeloid cells, angiogenesis, tumour growth, spontaneous metastases and the expression of pro-angiogenic and inflammatory factors (
We determined whether integrin α4 antagonists could also block tumour inflammation and growth. Treatment of mice with LLC and PyMT spontaneous breast tumours with the small molecule antagonist of integrin α4β1, ELN47606315, substantially suppressed tumour inflammation, angiogenesis and growth (
SDF-1α, VEGF-A, IL-1β, TNFα and IL-6 activate structurally diverse (G-protein coupled, Type III tyrosine kinase, Toll-like and type I cytokine) receptors, yet each activates integrin α4β1, suggesting a common signalling pathway. To identify such a pathway, we screened signalling inhibitors in myeloid cell adhesion assays and found that inhibitors of PI3-kinase γ but not tyrosine kinases, ROCK, ERK, p38, PLC, Akt, mTOR or PKA (not shown) suppressed myeloid cell adhesion. In fact, PI3-kinase γ has been implicated in neutrophil and thymocyte chemotaxis in vitro and in vivo.21-23 CD11b+ cells expressed 20-fold more p110γ than p110α, β or δ (
Adoptively transferred PI3-kinase γ inhibitor and siRNA treated myeloid cells, as well as p110 γ−/− myeloid cells, failed to arrest in tumours (
PI3-kinase γ inhibitors also suppressed spontaneous murine breast tumour progression. When treated with these inhibitors, PyMT breast tumour growth and progression was strongly inhibited (
As many chemoattractant receptors activate Ras and prior studies established roles for Ras and p101 in PI3-kinase γ activation28, we investigated the role of Ras in myeloid cell adhesion. siRNA-mediated knockdown of N+K-Ras but not H-Ras suppressed Ras expression and chemokine-stimulated myeloid cell adhesion (
The small GTPase Rap1 can regulate integrin activation by promoting talin binding to integrin beta chain cytoplasmic tails, thereby disrupting a salt bridge between alpha and beta chains and inducing integrin conformational changes29. Diverse chemoattractants stimulated myeloid cell Rap1a activation, which was suppressed by PI3-kinase γ inhibition (
Prior studies have shown that tumour-derived chemoattractants can promote tumour inflammation or progression1-11. Our studies reveal that a common Ras-PI3-kinase γ-integrin α4β1 signalling pathway regulates tumour inflammation and progression, regardless of the chemoattractants expressed (
Each and every publication and patent mentioned in the above specification is herein incorporated by reference in its entirety for all purposes. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention.
Although the invention has been described in connection with specific embodiments, the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art and in fields related thereto are intended to be within the scope of the following claims.
This application claims priority to co-pending U.S. provisional Application Ser. No. 61/158,482, filed Mar. 9, 2009, herein incorporated by reference in its entirety for all purposes.
This invention was made, in part, with government support under grant numbers CA045726, CA050286, CA083133, CA098048, AR27214, HL31950, and R01CA118182 awarded by the National Cancer Institute of the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61158482 | Mar 2009 | US |
