The present invention relates to the fields of molecular biology and immunology. More specifically, the invention provides compositions and methods useful for modulating and monitoring regulatory T cell (Treg) activity, particularly in patients with autoimmune disease or cancer.
Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Full citations for these publications are found at the end of the specification. Each of these citations is incorporated by reference herein as though set forth in full.
Foxp3 is a 47 kDa DNA-binding protein specific to regulatory T cells (Tregs). Mutations in Foxp3 result in IPEX syndrome. IPEX syndrome (immune dysregulation, polyendocrinopathy, enteropathy, X-linked), also known as XLAAD (X-linked autoimmunity and allergic dysregulation) syndrome, was first recognized in 1982 by Powell et al (5, 6). IPEX is a potentially lethal autoimmune disorder due to a mutation in the forkhead box P3 (Foxp3) gene located on the X-chromosome (7). Heterozygous females are healthy since the normal and mutated Foxp3 alleles are expressed equally. However, most male patients are severely affected and die early in life. Common features of IPEX are severe and chronic diarrhea, type I diabetes, failure to thrive, thyroiditis, eczema, alopecia, anemia, autoimmune hepatitis, hepatomegaly and lymphadenopathy (8). Histology shows infiltration of lymph nodes, spleen, liver, pancreas and skin by activated T cells. A natural spontaneous mutation, first described in scurfy mice in 1949, results in a phenotype which is similar to the human IPEX syndrome. The scurfy mutation was located by positional cloning to scurfin (sf), the mouse ortholog of the human Foxp3 gene (9). In male mice, signs appear shortly after birth, and like in humans, include skin rashes, diarrhea and malabsorption, with hepatosplenomegaly, lymphadenopathy, massive lymphocytic infiltrates in many organs, and death by about 3 weeks of age. In scurfy mice, the murine Foxp3 gene which normally encodes a 429 aa (48-kDa) protein was found to have a 2-bp insertion, resulting in a premature stop codon, and hence a shorter protein (9).
The Fox family has 17 subfamilies (FoxA-FoxQ), and Fox family proteins play important roles in biological processes ranging from development to speech to autoimmunity and cancer. Foxp3 is critical to the regulation of immune responses. Unlike other Fox protein family members which activate genes, some FoxP subfamily members repress transcription of genes and this property has also been shown for Foxp3, the shortest member of the FoxP sub-family (22, 23). Foxp3 lacks the glutamine rich regions present in Foxp1, -2, and -4 and has a much shorter carboxyl-terminal extension beyond the FKH domain (only 12-amino acids). The glutamine rich regions of Foxp1, -2, and -4 have been shown to be directly involved in transcriptional repression (24), however, the absence of any glutamine-rich region suggests Foxp3 represses transcription by another mechanism.
Foxp3 also has domains that are present in other members of the Foxp family, such as the zinc-finger and leucine zipper domains in the mid-portion of the molecules. Foxp1, -2, and -4 form homo- and heterodimers (25) and deletion of a single glutamic acid (residue 251; location exon7) in the leucine zipper prevents oligomerization, DNA-binding and transcriptional repression (26). By analogy with the other proteins (27), the zinc-finger domain of Foxp3 may also function in dimerization. Analysis of Foxp3-deficient and Foxp3-transgenic mice showed the important role this protein plays in the development of CD4+CD25+ Tregs. Foxp3-deficient mice lack Tregs and have increased autoreactive T cells, similar to that of Scurfy mice, while Foxp3-transgenic mice have an increased CD4+CD25+ population (21, 28). Ectopic expression of Foxp3 by non-Tregs confers suppressor function, in conjunction with repression of endogenous IL-2 and IFN-γ production and induction of CD25, GITR and CTLA-4 expression (18, 29, 30).
Work by Bettelli showed the direct interaction of Foxp3 with NF-AT and the p65 subunit of NF-κB (31). NF-κB-mediated transcriptional activation was inhibited by Foxp3, while the NF-δB DNA-binding was unaffected. Formation of a complex between NFAT and Foxp3 was recently shown to be important for Foxp3 function, with graded mutations in NFAT-interacting residues in the FKH domain resulting in progressive loss of function (29). This study also focused on the role of the N-terminal Foxp3 sequences. An N-terminal deletion mutant (remaining residues: 182-431) retained its NFAT and DNA binding abilities while losing its abilities to suppress IL-2 and upregulate CD25 and CTLA-4 expression, indicating N-terminal sequences can be involved in recruiting transcriptional corepressors and coactivators. Functional association of Foxp3 with histone deacetylases is supported by the demonstration that Foxp3 binding to the IL-2 and IFN-γ promoters result in marked histone deacetylation and conversely binding to the GITR, CD25, and CTLA-4 promoters leads to increased histone acetylation (30).
Exon2/exon7 deleted Foxp3 isoforms missing some N-terminal sequences and most of the leucine zipper sequences, or both, were found to be functional at about the same level as the wt-Foxp3 in suppressing CD28/TCR chimeric receptor-induced IL-2 production in transfected human CD4+ T cells (3) indicating either certain Foxp3 functions can be carried out in monomer form or that certain precise deletions, as in the isoforms, may lead to structural changes leading to dimerization despite critical domain loss. Foxp3 may function in certain instances as a monomer, and formation of multimeric complexes seems to be a unique property of FoxP sub-family since other Fox proteins can bind DNA as monomers (26). The zinc-finger domain of Foxp3 may assume such a role in Foxp3 isoforms since zinc-fingers have been reported to enable dimerization for several proteins (32).
Foxp3 gene expression is detected at high levels in spleen, thymus and lymph nodes. Foxp3 is mainly expressed by CD4+CD25+ Tregs but CD4+CD25− T cells also show limited Foxp3 expression (9, 18). Both CD4+CD25+ natural Tregs and “induced” Treg cells (induced by allo- or antigen-priming) express high levels of Foxp3 (19, 20). Retroviral expression of Foxp3 in CD4+CD25− cells results in their conversion to a phenotype very similar to Tregs with the ability to suppress effector T cell functions (18). Retroviral expression of Foxp3 protects host mice from CD4+CD25− cell-introduced autoimmune gastritis (21). In humans, 2 isoforms of Foxp3 (Foxp3 and Foxp3α) are described. Foxp3α is generated as a result of alternative splicing at exon 2 and encodes a shorter protein of 396 aa, lacking 35 aa from the region corresponding to aa 71-105 (20). Different sources of T cells were found to express both isoforms, but data from individual T cell clones show the two Foxp3 forms are differentially expressed with the individual clones expressing either one of the two isoforms (20). More recently, in addition to the exon2 deleted Foxp3 isoform, a exon2/exon7 deleted isoform has also been reported (3).
Targeted deletion of Foxp3 results in a scurfy-like syndrome, providing a second line of evidence to show the culprit in scurfy mice (and in IPEX patients) to be the non-functional Foxp3. The autoimmune syndrome observed in the scurfy mice is due to the absence of Treg cells; CD4+ T cells from these animals are hyper-responsive to stimuli and produce a variety of cytokines (9, 10). The scurfy phenotype resembles that of mice deficient in CTLA-4 or TGF-β, and adoptive transfer of CD4+ cells from scurfy mice into SCID or nu/nu results in the rapid onset of a wasting disease (11). The frame-shift mutation in Scurfy mice results in the loss of the C-terminal DNA-binding forkhead (FKH) domain and lethal autoimmunity by 2-3 weeks of birth (9), whereas in humans, multiple mutations can lead to disease (12). Similar to the results obtained earlier with purified CD4+CD25+ Tregs (13), transfer of TCR transgenic BDC2.5 cells retrovirally expressing Foxp3 into nonobese diabetic (NOD) mice prevents progression of diabetes (14).
Following the murine results, IPEX patients were screened for mutations in the Foxp3 gene and various mutations were found in the >20 families studied, confirming that the loss of Foxp3 function results in the IPEX syndrome. The human Foxp3 gene is located at Xp11.23 and has 11 coding exons. The structural domains of Foxp3 include a Zinc-finger, a Leucine-zipper and a forkhead domain. Sequence analysis of the Foxp3 gene in IPEX patients revealed a large portion of the patients having missense mutations (15). Most of the reported mutations are clustered in the Leucine zipper region and the Forkhead domain, highlighting the importance of these regions in the Foxp3 function (8). However, mutations corresponding to other parts of the Foxp3 gene such as a mutation in an intron (8), the polyadenylation signal sequence (AATAAA→AATGAA), and mutations at the N-terminal side of the protein (16, 17) are reported. At least two mutations at the C-terminal domain of Foxp3 (past the Forkhead domain) highlight the importance of the C-terminal sequences in the function of Foxp3 since both result in severe IPEX syndrome (7, 12). One of these mutations is not in the coding region but abolishes the stop codon and adds 25 amino acids to Foxp3. The second C-terminal mutation results in the loss of the last Foxp3 amino acid while extending the protein by 21 amino acids.
Overall, the immune system must discriminate between non-self and self in order to function properly. When this discrimination fails, the immune system destroys tissues and cells of the body (i.e., autoimmune disease). On one hand, it is the job of Tregs to suppress the activation of the immune system to prevent pathological self-reactivity. The potential for Tregs to actively regulate autoimmunity and induce long term tolerance has therapeutic potential as a strategy for inducing prolonged tolerance. In light of the critical role Tregs play in regulating the immune response, and the current lack of a reliable means to regulate and detect Treg activity, a need exists for compositions and methods to modulate and monitor Treg activity in order to ascertain whether the immune system is functioning properly. On the other hand, methods are needed to boost the immune response to cancer by specifically directing the response to target cancerous cells while avoiding deleterious effects on normal cells. It has been shown for several cancers that immunological factors affect patient outcomes, indicating the state of the immune system plays an important role in recurrence and mortality.
In ovarian cancer, Treg infiltration (and Foxp3 expression) into tumors is correlated with poor clinical prognosis. Using a cohort of 70 ovarian cancer patients, Curiel et al. has shown that levels of intratumoral Tregs inversely correlate with survival (77) and high levels of Foxp3 expression result in poor prognosis (78). Increased tumor grade in human gliomas correlate with CD4+CD25+Foxp3+ T cell levels (79) and in mice with experimental brain tumors, depletion of the CD4+CD25+ Treg population results in prolongation of survival (80). In non-small lung cancer (NSCLC), where patient relapse is high (about 50% even if diagnosis is made early) the ratio of Tregs to tumor infiltrating T cells (TIL) has recently been shown to be important in predicting recurrence. Stage I NSCLC patients with a high proportion of tumor Treg cells relative to TIL have a significantly higher risk of recurrence (81). Analysis of Foxp3 expression in pancreatic carcinoma cells showed Foxp3 is expressed by the malignant epithelial cells, in addition to the infiltrating Treg cells. Pancreatic cancer cell lines showed Foxp3 expression is inducible by TGF-β2 (82). Foxp3 expression by the pancreatic ductal adenocarcinoma cells and tumors indicate local mechanisms, in addition to the Tregs, also contribute to the immune evasion and tumor progression (82).
Since high Treg numbers are associated with the ability of tumor cells to evade the host immune response, depletion or inhibition of Tregs leads to a more robust anti-tumor immune response. (reviewed in: Zou et al. Nat, Rev. Immunol. (2006) 6:295-307). It is critical to determine how to overcome the suppressive activity of Tregs to induce effective tumor-specific immune responses capable of controlling and destroying tumors. The present invention satisfies this need and provides related advantages as well.
The present inventor has discovered that cleavage products of Foxp3 are effective modulators of Treg function and activity. Thus, in accordance with the present invention, a method for identifying agents which affect the formation of cleaved Foxp3 are provided. An exemplary method comprises administering an agent to a cell expressing Foxp3 and enzymes responsible for cleavage thereof, determining levels of Foxp3 cleavage product, if any, relative to an untreated cell, and identifying those agents which modulate the formation of said Foxp3 cleavage product. Such agents should have therapeutic value. Agents so identified can be effective to alter the expression level or function of a proprotein convertase enzyme, thereby modulating Foxp3 activity and/or Treg function. In a one embodiment, the agent is effective to increase formation of a peptide selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 20 and SEQ ID NO: 24. Alternatively, the agent may be effective to decrease formation of the above-mentioned peptides.
In another embodiment of the invention, a method of treating autoimmunity is provided. An exemplary method entails administering an effective amount of at least one peptide selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 15, and SEQ ID NO: 24, to a patient in need thereof, said peptides optionally being contained in a liposome. The method optionally includes ex vivo administration of the peptide to isolated cells for a time sufficient to stimulate Treg production, after which said cells are reinfused into the patient.
The invention also includes isolated nucleic acids encoding the Foxp3 peptides of the invention as well as the isolated peptides encoded thereby. Antibodies immunologically specific for Foxp3 or functional fragments thereof, also comprise an aspect of the invention.
In yet another embodiment, a method for assessing regulatory T cell activation in a test subject is disclosed. An exemplary method entails providing a biological sample obtained from said test subject, the sample comprising Foxp3 protein; contacting the sample with an agent having binding affinity for said Foxp3 protein or a fragment thereof, comparing the amount of said Foxp3 protein or fragment thereof from said test subject with levels of Foxp3 protein or fragment thereof obtained from a normal subject, wherein an alteration of in the amount of Foxp3 protein or fragment thereof in the sample, relative to the normal subject is indicative of altered regulatory T cell activation. The method may optionally entail the steps of assessing inflammatory cytokine levels in the sample or identifying T cell specific markers present on T cells in said sample. In one embodiment of this method, regulatory T cell activation in a test subject is assessed by comparing the expression ratio of SEQ ID NO: 15 to SEQ ID NO: 2.
In yet another aspect, the invention provides a method for the treatment of an autoimmune disease in a patient in need thereof. In one approach, Treg activity is increased via introduction of an effective amount of at least one nucleic acid encoding a peptide selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 15 and SEQ ID NO: 24 in a target cell.
In a further embodiment the invention provides kits for practicing the methods described above.
Finally, siRNA molecules contained in a pharmaceutically acceptable carrier which are effective to down regulate the expression of a proprotein convertase enzyme involved in Foxp3 cleavage are provided. Such molecules should have therapeutic value for the treatment of cancer.
Sample 2 was used as size control. (First row, SEQ ID NOs: 180, 183; Shaded oval, SEQ ID NOs: 183, 179; First column of table, top to bottom, SEQ ID NOs: 191, 193, 193, 191; Second column of table, SEQ ID NO: 179).
The generation of functional Tregs is important for suppressing aberrant activation of the immune system and maintaining immune system homeostasis and self-tolerance, as loss of this regulation is associated with autoimmune diseases, and transplant rejection (i.e., graft vs. host disease, GVHD). Elucidation of the molecular mechanism responsible for the development of functional Tregs facilitates the development of compositions and methods for manipulating the genetic program that specifies this cell fate. Additionally, such compositions and methods could be used to advantage to detect Treg activity and function. Alternatively, it is desirable to inhibit Treg formation in cancer. The present invention provides screening assays to identify agents which modulate Treg function and activity.
The present invention is based, at least in part, on the finding that certain molecules are preferentially associated with effector T cells or regulatory T cells. Accordingly, immune responses by one or the other subset of cells can be preferentially modulated. The invention pertains, e.g., to methods of modulating (e.g., up- or down-modulating), the balance between the activation of regulatory T cells and effector T cells leading to modulation of immune responses and to compositions useful in modulating those responses. The invention also pertains to methods useful in diagnosing, treating, or preventing conditions that would benefit from modulating effector T cell function relative to regulatory T cell function or from modulating regulatory T cell function relative to effector T cell function in a subject. Previous studies have defined three distinct nuclear localization signals (NLSs) in Foxp3, each of which is sufficient to mediate nuclear import of the protein. One of these NLSs is located at the N-terminal of the forkhead domain (NLS1), and another is located in the last 12 amino acids at the C-terminus of Foxp3 (NLS2). A third motif in the forkhead domain (NLS3), is a conditional NLS and only functions upon removal of the 12 amino acids at the C-terminus of the protein.
Different Foxp family members share conserved structural domains, and the amino acids 416-417 (KR) are involved in Foxp3 DNA binding (25, 29). The data contained herein demonstrates that amino acids 414-417 (RKKR) (SEQ ID NO: 179) are masked by the C-terminal end of the molecule, and that Foxp3 undergoes a conformational change which exposes this regulatory region of the protein. The conformational change can be brought about through proteolytic cleavage which releases the C-terminus and exposes NLS3. 414RKKR417 (SEQ ID NO: 179) represents an ideal recognition sequence for members of the pro-protein convertase (PC) family, which appear to be responsible for cleavage of Foxp3. Indeed, elaboration of the C-terminal cleavage product (termed “Foxpeptide”—12aa in mouse, and 14aa in human) provides an indicator of Treg activity. Also, as described hereinbelow, engineered human short-Foxp3, which is 14 amino acids shorter at the C-terminal end, mimics a proteolytically cleaved Foxp3 and has utility in the treatment of autoimmune diseases and the treatment of transplantation patients. Alternatively, reducing Treg activity or inhibiting the generation of functional Tregs could be useful for the treatment of cancer. Elaboration of the peptide also provides means to monitor Treg activity.
In one embodiment, a method for identifying agents that affect the formation of double-cleaved Foxp3 is provided. Exemplary methods entail the use of cell lines and/or whole transgenic animal models wherein Foxp3 is over or under expressed. The agents identified preferably modulate the activity of the proprotein convertase enzymes that process Foxp3 into its short form. Agents identified using the methods of the invention may be used alone for the treatment of a particular disorder, or may be combined with other agents known to have efficacy for the treatment of the particular disorder. The agents can be useful for treating patients with autoimmune disease (i.e. the agent will stimulate proprotein convertase activity) or cancer (i.e., the agent will inhibit proprotein convertase activity).
In another embodiment, isolated nucleic acids encoding the C-terminal cleaved portion of Foxp3 (Foxpeptide) and means to detect the same are provided to facilitate the detection of activated Tregs. Other nucleic acids are also provided which encode short forms of Foxp3 which can be used therapeutically.
As discussed herein, Foxp3 plays a major role in regulatory T cell development, and the gene knock-out phenotype is characterized by multi-organ inflammatory response, lack of CD4+CD25+ Treg cells, T-cells with an activated phenotype, eosinophilia, dysregulated cytokine production, hyperimmuneglobulinemia, and males dying at 3 weeks.
In yet another embodiment, a novel Foxpeptide is disclosed which can be detected in a patient. In particular, the construct consists of amino acids 418-431 of human Foxp3 (Foxpeptide) which has the sequence of SEQ ID NO: 8. See
For therapeutic use, the compositions of the invention may be administered in any conventional dosage form in any conventional manner. Routes of administration include, but are not limited to, intravenous, intramuscular, subcutaneous, intrasynovial, infusion, sublingual, transdermal, oral, topical, aerosolized, or inhalation via a nebulizer.
The following description and examples set forth the general procedures involved in practicing the present invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. Unless otherwise specified, general biochemical and molecular biological procedures, such as those set forth in Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989) (hereinafter “Sambrook et al.”) or Ausubel et al. (eds.) Current Protocols in Molecular Biology, John Wiley & Sons (1997) (hereinafter “Ausubel et al.”) are used.
The following definitions are provided to facilitate an understanding of the present invention:
As used herein, the term “regulatory T cell”, “suppressor T cell”, or “Treg” includes T cells which produce low levels of IL-2, IL-4, IL-5, and IL-1, and actsto suppress activation of the immune system. Regulatory T cells actively suppress the proliferation and cytokine production of Th1, Th2, or naive T cells which have been stimulated in culture with an activating signal (e.g., antigen and antigen presenting cells or with a signal that mimics antigen in the context of MHC, e.g., anti-CD3 antibody, plus anti-CD28 antibody).
As used herein, the term “effector T cell”, or “Teff”includes T cells which function to eliminate antigen (e.g., by producing cytokines which modulate the activation of other cells or by cytotoxic activity). The term “effector T cell” includes T helper cells (e.g., Th1 and Th2 cells) and cytotoxic T cells. Th1 cells mediate delayed type hypersensitivity responses and macrophage activation while Th2 cells provide help to B cells and are critical in the allergic response.
The phrase “Foxpeptide” as used herein refers to the C-terminal fragment that is a cleavage product from Foxp3 (12-amino acids in mouse Foxp3 coded for by SEQ ID NO: 5 and 14-amino acids in human Foxp3 coded for by SEQ ID NO: 7.
The phrase “short Foxp3” as used herein refers to amino acids 1-417 of Foxp3 which results from the enzymatic processing of the C-terminus of Foxp3. This construct is functional in preventing effector T cell proliferation and is effective to prevent endogenous IL-2 expression.
The phrase “double cleaved Foxp3” or “double cleaved short Foxp3” as used herein refers the remaining portion of Foxp3 following cleavage at both the N- and C-terminus (resulting in a polypeptide of amino acids 52-417 of the full length Foxp3). This construct has therapeutic applications when delivered to a patient.
A “proprotein convertase” includes without limitation, calcium dependent subtilisin/kexin-related serine endopeptidases. Examples are Furin, PC1/3, PC2, PC4, PACE4, PC5/6. and PC7. Proprotein convertase inhibitors have been described previously and include, for example, polybasic peptides such as L-poly-Arg (for Furin), and the short hexapeptide of the sequence LLRVKR (SEQ ID NO: 185) (for PC1). See Furgure et al. Molecular Pharmacology 71:323-332 (2007); Cameron et al. J. Biol. Chem. 275:36741-36749 (2000); Fugere et al, Curr. Pharm. Design 8:125-133 (2002). Proprotein convertase inhibitors identified using the methods of the invention do not include the peptides described above.
As used herein the phrase, “modulating regulatory T cell function” includes preferentially altering at least one regulatory T cell function (in a population of cells including both T effector cells and T regulatory cells) such that there is a shift in the balance of T effector/T regulatory cell activity as compared to the balance prior to treatment.
An “autoimmune disease” as used herein refers to a disease associated with the inability of the immune system to discriminate between self and non-self. Examples of autoimmune diseases include, without limitation, immune dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX), type 1 diabetes, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, myasthenia gravis, systemic lupus erythematosis, autoimmune thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis), psoriasis, Sjogren's Syndrome, including keratoconjunctivitis sicca secondary to Sjogren's Syndrome, alopecia areata, allergic responses due to arthropod bite reactions, Crohn's disease, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic encephalomyelitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral progressive sensorineural hearing loss, aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Crohn's disease, Graves ophthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial lung fibrosis.
The phrase “immunomonitoring” as used herein refers to detecting the presence of Foxpeptide in a biological sample as an indication of active Tregs in a system.
“Sample” or “patient sample” or “biological sample” as used herein generally refers to a sample which may be tested for the presence or absence of a particular molecule, preferably Foxpeptide, as shown in
As used herein, the phrase “treating an autoimmune disease” is intended to refer to the alleviation of a sign or symptom of an autoimmune disease. Treating an autoimmune disease is intended to encompass a reduction in the onset or magnitude of a sign or symptom of an autoimmune disease, such as effector T cell proliferation.
As used herein, “treating cancer” refers to modulating T cells to shift the balance to Teff cell function relative to Treg function.
“Nucleic acid” or a “nucleic acid molecule” as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form. In discussing nucleic acid molecules, a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5′ to 3′ direction. With reference to nucleic acids of the invention, the term “isolated nucleic acid” is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an “isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism. Alternatively, this term may refer to a DNA that has been sufficiently separated from (e.g., substantially free of) other cellular components with which it would naturally be associated. “Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification. When applied to RNA, the term “isolated nucleic acid” refers primarily to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues). An isolated nucleic acid (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
With respect to single-stranded nucleic acids, particularly oligonucleotides, the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”). In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art.
For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (see Sambrook et al. (2001) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press):
T
m=81.5° C.+16.6 Log [Na+]+0.41(% G+C)−0.63 (% formamide)−600/#bp in duplex
As an illustration of the above formula, using [Na+]=[0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57° C. Depending upon the specific sequence involved, the Tm of a DNA duplex decreases by 0.5-1.5° C. with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42° C.
The stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25° C. below the calculated Tm of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20° C. below the Tm of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 2×SSC and 0.5% SDS at 55° C. for 15 minutes. A high-stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 1×SSC and 0.5% SDS at 65° C. for 15 minutes. A very high stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 0.1×SSC and 0.5% SDS at 65° C. for 15 minutes.
The present invention also includes active portions, fragments, derivatives and functional or non-functional mimetics of the polypeptides of the invention. “Peptide” and “polypeptide” are used interchangeably herein and refer to a compound made up of a chain of amino acid residues linked by peptide bonds. An “active portion” of a polypeptide means a peptide that is less than the full length polypeptide, but which retains measurable biological activity and retains biological detection.
A “fragment” or “portion” of a polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to fifteen contiguous amino acids and, most preferably, at least about fourteen or more contiguous amino acids.
A “derivative” of a polypeptide or a fragment thereof means a polypeptide modified by varying the amino acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself Such derivatives of the natural amino acid sequence may involve insertion, addition, deletion or substitution of one or more amino acids, and may or may not alter the essential activity of original the polypeptide.
As mentioned above, a polypeptide or protein of the invention includes any analogue, fragment, derivative or mutant which is derived from a polypeptide and which retains at least one property or other characteristic of the polypeptide. Different “variants” of the polypeptide exist in nature. These variants may be alleles characterized by differences in the nucleotide sequences of the gene coding for the protein, or may involve different RNA processing or post translational modifications. The skilled person can produce variants having single or multiple amino acid substitutions, deletions, additions or replacements. These variants may include inter alia: (a) variants in which one or more amino acids residues are substituted with conservative or non conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide, (c) variants in which one or more amino acids include a substituent group, and (d) variants in which the polypeptide is fused with another peptide or polypeptide such as a fusion partner, a protein tag or other chemical moiety, that may confer useful properties to the polypeptide, such as, for example, an epitope for an antibody, a polyhistidine sequence, a biotin moiety and the like. Other polypeptides of the invention include variants in which amino acid residues from one species are substituted for the corresponding residue in another species, either at the conserved or non conserved positions. In another embodiment, amino acid residues at non conserved positions are substituted with conservative or non conservative residues. The techniques for obtaining these variants, including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques are known to the person having ordinary skill in the art.
To the extent such allelic variations, analogues, fragments, derivatives, mutants, and modifications, including alternative nucleic acid processing forms and alternative post translational modification forms result in derivatives of the polypeptide that retain any of the biological properties of the polypeptide, they are included within the scope of this invention.
The term “functional” as used herein implies that the nucleic or amino acid sequence is functional for the recited assay or purpose.
The term “tag,” “tag sequence” or “protein tag” refers to a chemical moiety, either a nucleotide, oligonucleotide,polynucleotide or an amino acid, peptide or protein or other chemical, that when added to another sequence, provides additional utility or confers useful properties, particularly in the detection or isolation, of that sequence. Thus, for example, a homopolymer nucleic acid sequence or a nucleic acid sequence complementary to a capture oligonucleotide may be added to a primer or probe sequence to facilitate the subsequent isolation of an extension product or hybridized product. In the case of protein tags, histidine residues (e.g., 4 to 8 consecutive histidine residues) may be added to either the amino- or carboxy-terminus of a protein to facilitate protein isolation by chelating metal chromatography. Alternatively, amino acid sequences, peptides, proteins or fusion partners representing epitopes or binding determinants reactive with specific antibody molecules or other molecules (e.g., flag epitope, c-myc epitope, transmembrane epitope of the influenza A virus hemaglutinin protein, protein A, cellulose binding domain, calmodulin binding protein, maltose binding protein, chitin binding domain, glutathione S-transferase, and the like) may be added to proteins to facilitate protein isolation by procedures such as affinity or immunoaffinity chromatography. Chemical tag moieties include such molecules as biotin, which may be added to either nucleic acids or proteins and facilitates isolation or detection by interaction with avidin reagents, and the like. Numerous other tag moieties are known to, and can be envisioned by the trained artisan, and are contemplated to be within the scope of this definition.
The term “oligonucleotide” as used herein refers to sequences, primers and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide.
The term “primer” as used herein refers to an oligonucleotide, either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH, the primer may be extended at its 3′ terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. The primer may vary in length depending on the particular conditions and requirement of the application. For example, in diagnostic applications, the oligonucleotide primer is typically 15-25 or more nucleotides in length. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able anneal with the desired template strand in a manner sufficient to provide the 3′ hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5′ end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
Polymerase chain reaction (PCR) has been described in U.S. Pat. Nos. 4,683,195, 4,800,195, and 4,965,188, the entire disclosures of which are incorporated by reference herein.
Many techniques are available to those skilled in the art to facilitate transformation, transfection, or transduction of the expression construct into a prokaryotic or eukaryotic organism. The terms “transform”, “transfect”, “transduce”, shall refer to any method or means by which a nucleic acid is introduced into a cell or host organism and may be used interchangeably to convey the same meaning. Such methods include, but are not limited to, transfection, electroporation, microinjection, PEG-fusion and the like.
The introduced nucleic acid may or may not be integrated (covalently linked) into nucleic acid of the recipient cell or organism. In bacterial, yeast, plant and mammalian cells, for example, the introduced nucleic acid may be maintained as an episomal element or independent replicon such as a plasmid. Alternatively, the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism and further passed on or inherited to progeny cells or organisms of the recipient cell or organism. Finally, the introduced nucleic acid may exist in the recipient cell or host organism only transiently.
The term “operably linked” means that the regulatory sequences necessary for expression of the coding sequence are placed in the DNA molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of transcription units and other transcription control elements (e.g. enhancers) in an expression vector.
The term “gene” refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences. The nucleic acid may also optionally include non coding sequences such as promoter or enhancer sequences. The term “intron” refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons.
The term “promoter” or “promoter region” generally refers to the transcriptional regulatory regions of a gene. The “promoter region” may be found at the 5′ or 3′ side of the coding region, or within the coding region, or within introns. Typically, the “promoter region” is a nucleic acid sequence which is usually found upstream (5′) to a coding sequence and which directs transcription of the nucleic acid sequence into mRNA. The “promoter region” typically provides a recognition site for RNA polymerase and the other factors necessary for proper initiation of transcription.
The term “vector” relates to a single or double stranded circular nucleic acid molecule that can be infected, transfected or transformed into cells and replicate independently or within the host cell genome. A circular double stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes. An assortment of vectors, restriction enzymes, and the knowledge of the nucleotide sequences that are targeted by restriction enzymes are readily available to those skilled in the art, and include any replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element. A nucleic acid molecule of the invention can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
The terms “recombinant organism,” or “transgenic organism” refer to organisms which have a new combination of genes or nucleic acid molecules. A new combination of genes or nucleic acid molecules can be introduced into an organism using a wide array of nucleic acid manipulation techniques available to those skilled in the art. The term “organism” relates to any living being comprised of a least one cell. An organism can be as simple as one eukaryotic cell or as complex as a mammal. Therefore, the phrase “a recombinant organism” encompasses a recombinant cell, as well as eukaryotic and prokaryotic organisms.
The alteration or genetic information may be foreign to the species of organism to which the recipient belongs, or foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene. The altered Foxp3 gene generally should not fully encode the same Foxp3 protein native to the host animal and its expression product should be altered to a minor or great degree.
The DNA used for altering a target gene may be obtained by a wide variety of techniques that include, but are not limited to, isolation from genomic sources, preparation of cDNAs from isolated mRNA templates, direct synthesis, or a combination thereof.
As used herein, the term “agent” includes compounds that modulate, e.g., up-modulate or stimulate and down-modulate or inhibit, the expression and/or activity of a molecule of the invention. As used herein the term “inhibitor” or “inhibitory agent” includes agents which inhibit the expression and/or activity of a molecule of the invention. Exemplary inhibitors include antibodies, RNAi, compounds that mediate RNAi (e.g., siRNA), antisense RNA or DNA, dominant/negative mutants of molecules of the invention, peptides, and/or peptidomimetics.
The term “stimulator” or “stimulatory agent” includes agents, e.g., agonists, which increase the expression and/or activity of molecules of the invention. Exemplary stimulating agents include active protein and nucleic acid molecules, peptides and peptidomimetics of molecules of the invention. The agents of the invention can directly modulate, i.e., increase or decrease, the expression and/or activity of a molecule of the invention. Exemplary agents are described herein or can be identified using screening assays that select for such compounds, as described in detail below.
An “siRNA” or “small interfering RNA” refers to a molecule involved in the RNA interference process for a sequence-specific post-transcriptional gene silencing or gene knockdown. SiRNAs have homology with the sequence of the targeted gene. SiRNAs can be synthesized in vitro or generated by ribonuclease III cleavage from longer dsRNA and are the mediators of sequence-specific mRNA degradation. Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Applied Biosystems (Foster City, Calif., USA), Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK). Specific siRNA constructs for inhibiting proprotein convertase enzyme mRNA, and may be between 15-35 nucleotides in length, and more typically about 21 nucleotides in length. A list of candidate siRNAs for PC1, PC7 and Furin are provided in Table I-III, and are useful for the treatment of cancer by decreasing Tregs activity in a patient, and allowing Teffs to target tumor cells.
As used herein, the term “pharmaceutically-acceptable carrier” means a chemical composition with which an appropriate siRNA, may be combined and which, following the combination, can be used to administer the siRNA to a patient. The amount of the siRNA composition administered is sufficient to prevent, diminish or alleviate the disease state. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between about 1 ng/kg and about 100 mg/kg of patient body weight. Suitable amounts of the siRNA for administration include doses which are high enough to have the desired effect without concomitant adverse effects.
As used herein, the term “administration” refers to the methods of delivery of the compounds of the invention (e.g., routes of administration such as, without limitation, intravenous, intramuscular, subcutaneous, intrasynovial, infusion, sublingual, transdermal, oral, topical, aerosolized, or inhalation via a nebulizer).
Administration of proprotein convertase siRNAs by inhalation is a means of treating an individual having cancer, particularly in the lung. One skilled in the art would recognize that siRNA can be suspended or dissolved in an appropriate pharmaceutically acceptable carrier and administered, for example, directly into the lungs using a nasal spray or inhalant. A pharmaceutical composition comprising proprotein convertase siRNA can be administered as an aerosol formulation which contains the inhibitor in dissolved, suspended or emulsified form in a propellant or a mixture of solvent and propellant. The aerosolized formulation is then administered through the respiratory system or nasal passages. Methods for pulmonary delivery are described in, for example US Patent Application No. 20040037780, and U.S. Pat. Nos. 6,592,904; 6,582,728; and 6,565,885, all incorporated by reference herein.
As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for performing a method of the invention. The instructional material of a kit of the invention can, for example, be affixed to a container which contains a kit of the invention to be shipped together with a container which contains the kit. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and kit be used cooperatively by the recipient.
According to a modulatory method of the invention, expression and/or activity of Foxp3 is stimulated in a cell by contacting the cell with a stimulatory agent. Examples of such stimulatory agents include active protein and nucleic acid molecules that are introduced into the cell to increase expression and/or activity of Foxp3 in the cell. Preferably, this stimulation facilitates increased activity of the enzymes that cleave and process Foxp3 into singly cleaved or double cleaved short Foxp3 forms. The administration of such agents should provide therapeutic benefit to patients suffering from autoimmune diseases.
Other stimulatory agents that can be used to stimulate the activity of a molecule of the invention are chemical compounds that stimulate expression or activity of a molecule of the invention in cells, such as compounds that directly stimulate the protein product of a molecule of the invention and compounds that promote the interaction between a protein product of a molecule of the invention and substrates or target DNA binding sites. Such compounds can be identified using screening assays that select for such compounds, as described herein.
Inhibitory agents of the invention can be, for example, intracellular binding molecules that act to inhibit the expression or activity of a molecule of the invention. For molecules that are expressed intracellularly, intracellular binding molecules can be used to modulate expression and/or activity. As used herein, the term “intracellular binding molecule” is intended to include molecules that act intracellularly to inhibit the expression or activity of a protein (i.e., Foxp3) by binding to the protein itself, to a nucleic acid (e.g., an mRNA molecule) that encodes the protein or to a target with which the protein normally interacts (e.g., to a DNA target sequence to which the marker binds). Examples of intracellular binding molecules include antisense marker nucleic acid molecules (e.g., siRNA against a Foxp3 processing enzyme to inhibit translation of mRNA), intracellular antibodies (e.g., to inhibit the activity of protein) and dominant negative mutants.
Several classes of compound may be used according to the invention as convertase inhibitors. These compounds include: (1) compounds that bind to convertase enzymes and inhibit its activity (e.g. competitive inhibitors or allosteric inhibitors); (2) compounds which prevent the transcription, translation or expression of convertase enzymes (e.g. ribozymes, siRNA, or antisense DNA molecules); (3) compounds which increase the rate of degradation of convertase enzymes; (4) compounds which inhibit the interaction of convertase enzymes with latent TGF-beta; (5) compounds which inhibit the proteolytic activation of the inactive Furin or other PC precursors; and (6) compounds which inhibit a potential intracellular translocation of convertase enzymes, such as Furin or PACE-4, to subcellular sites of activity.
In one embodiment of the invention, a composition containing proprotein convertase siRNA is administered to a patient in a sufficient amount to prevent, diminish or alleviate a cancerous state in the individual by affecting Foxp3 processing and Treg formation. There are several ways to administer the siRNA of the invention to in vivo to treat cancer including, but not limited to, naked siRNA delivery, siRNA conjugation and delivery, liposome carrier-mediated delivery, polymer carrier delivery, nanoparticle compositions, plasmid-based methods, and the use of viruses.
siRNA composition of the invention can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. This can be necessary to allow the siRNA to cross the cell membrane and escape degradation. Methods for the delivery of nucleic acid molecules are described in Akhtar et al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser., 752, 184-192; Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan et al., PCT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules.
As mentioned previously, one embodiment of the invention comprises delivery of the proprotein convertase siRNA to a patient in need thereof. In other embodiments, polybasic peptides can be used to inhibit Furin as described in U.S. Pat. No. 7,0337,991. Alpha-PDX can also be used as described in Anderson et al. (J. Biol. Chem. (1993) 268: 24887-24891). Candidate siRNA compositions for use in the invention are provided in Tables I-III. The sequences in Tables I-III include several siRNAs (i.e., sense strands are provided for a proprotein convertase target region). Those of skill in the art can determine the sequence of an antisense siRNA strand based on the disclosure of the sense strand, and will appreciate the difference between “U” and “T” designations in the sequences which correspond to RNA and DNA molecules, respectively.
molecules of the invention. Preferably the agent identified affects an intracellular enzyme that processes Foxp3 into the double-cleaved short form (e.g., PC1, PC7, and Furin).
Agents of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ‘one-bead one-compound’ library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).
Many autoimmune disorders are the result of inappropriate or unwanted activation of T effector cells resulting in the production of cytokines and autoantibodies which mediate the disease process. In addition, Teff cell function is associated with graft rejection. Accordingly, when a reduced effector T cell or antibody response is desired, the compositions and methods of the invention can be used to down-modulate the expression and/or activity a molecule preferentially associated with Teff cells, e.g., such that at least one Teff cell function is down-modulated relative to at least one Treg cell function. In another embodiment, such disorders can be ameliorated by up-modulating the expression and/or activity of a molecule preferentially associated with T regulatory cells, e.g., such that at least one Treg cell function is up-modulated relative to at least one Teff cell function. One way that this can be accomplished is by removing cells from a patient, stimulating Treg activity using the methods described herein (i.e., increasing the activity of proprotein convertase enzymes, or delivering cleaved Foxp3 to cells), delivering the cells back to the patient for therapy. IN cases where it is desirable to deliver the Foxp3 peptides to a cell, uptake can be facilitated via encapsulation of the peptide into a liposome for example. As such, peptides ideally possess a nuclear localization signal, following entry into the cell, the peptide should be transported to the nucleus for exertion of biological activity.
In contrast, there are conditions that would benefit from enhancing at least one activity of Teff cells and/or down-modulating at least one activity of Treg cells. For example, immune effector cells often fail to react effectively with cancer cells. Accordingly, when an enhanced effector T cell or antibody response is desired, the methods of the invention can be used to regulate the expression and/or activity a molecule preferentially associated with Teff cells, e.g., such that at least one T effector cell function is up-modulated relative to at least one Treg cell function. In another embodiment, such disorders can be ameliorated by down-modulating the expression and/or activity of a molecule preferentially associated with T regulatory cells, e.g., such that at least one T regulatory cell function is down-modulated relative to at least one T effector cell function.
In an alternative approach for therapeutic uses, it is desirable to directly increase the production of single or double cleaved Foxp3 in cells. This could be accomplished by increasing the expression or activity of the enzymes responsible for processing Foxp3 into shorter active Foxp3 fragments.
It is clear from the foregoing that the single and double cleaved forms of Foxp3 can be used as powerful therapeutic agents. Delivery of the peptide to a patient can be accomplished by any known means in the art. One skilled in the art appreciates that a pharmaceutical composition comprising a single or double cleaved short Foxp3 can be administered to a subject by various routes including, for example, orally or parenterally, such as intravenously (i.v.), intramuscularly, subcutaneously, intraorbitally, intranasally, intracapsularly, intraperitoneally (i.p.), intracisternally, intra-articularly or by passive or facilitated absorption through the skin using, for example, a skin patch or transdermal iontophoresis, respectively.
A pharmaceutical composition comprising single or double cleaved short Foxp3 also can be incorporated, if desired, into liposomes, microspheres, microbubbles, or other polymer matrices (Gregoriadis, Liposome Technology, Vols. I to III, 2nd ed., CRC Press, Boca Raton Fla. (1993)). Liposomes, for example, which consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer. Suitable pharmaceutical carriers and other agents of the compositions of the instant invention are described in “Remington's Pharmaceutical Sciences” by E. W. Martin (Mack Pub. Co., Easton, Pa.) and “Remington: The Science And Practice Of Pharmacy” by Alfonso R. Gennaro (Lippincott Williams & Wilkins, 2005). Therefore, the single or double cleaved Foxp3 can be delivered in liposomes via i.v. infusion.
The total treatment dose can be administered to a subject as a single dose or can be administered using a fractionated treatment protocol, in which multiple doses are administered over a more prolonged period of time, for example, over the period of a day to allow administration of a daily dosage or over a longer period of time to administer a dose over a desired period of time. A single or double cleaved short Foxp3 encoding nucleic acid can also be delivered in a vector selected from the group consisting of adenoviral vectors, plasmids, adeno-associated viral vectors, retroviral vectors, hybrid adeno-associated virus vectors, lentivirus vectors, pseudo-typed lentivirus vectors, herpes simplex virus vectors, and vaccinia virus vectors.
Kits are provided for practicing the methods of the instant invention. The kits comprise materials and reagents to facilitate the detection of the C-terminal Foxpeptide and native Foxp3 of the invention and instructional materials. Alternatively, the kit may comprise reagents suitable to modulate the activity of the enzymes responsible for cleaving the N- or C-terminal Foxpeptide region of Foxp3 such as the siRNA molecules disclosed herein. The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
The following materials and methods are provided to facilitate practice of the present invention:
Mice—C57BL/6 (H-2b) mice, purchased from The Jackson Laboratory, are housed under specific pathogen-free barrier conditions at the Children's Hospital of Philadelphia. Specific-pathogen free, female C57BL/6 mice (6-8 wk) (The Jackson Laboratory), and specific-pathogen free, female RAG−/− (C57BL/6) mice (Taconic Laboratories) were also used.
Antibodies—Polyclonal anti-murine Foxp3 Ab was generated by immunizing rabbits with a synthetic 11 aa peptide, QRPNKCSNPCP (SEQ ID NO: 186) (New England Peptide), corresponding to amino acids 419-429 of mouse Foxp3. This region is 75% conserved between species (3 amino acid differences between mouse and human). Foxp3 specific Ab was purified from high titer rabbit antiserum by affinity chromatography (Sigma-Genosys). Rat anti-mouse Foxp3 is purchased from ebioscience and used for flow cytometry and immunoperoxidase. “NRRF-30” mAb (ebioscience catalog #14-4771) which recognizes the N-terminus of full length Foxp3, and “FJK-16s” mAb (ebioscience catalog #14-5773) which recognizes the central domain of Foxp3 were used in
Immunohistology—Cytospins of cells retrovirally expressing the different Foxp3 mutants were permeabilized with Triton X-100, followed by immunoperoxidase staining with rat anti-mouse Foxp3 mAb (eBioscience, cat #14-5773).
Cloning of mouse Foxp3 cDNA—ProStar Ultra HF RT-PCR system was used for cDNA generation from total thymus RNA and amplification of cDNAs; 1312-bp full-length Foxp3 cDNA was amplified by forward 5′-GAACCCAATGCCCAACCCTAG-3′ (SEQ ID NO: 175) and reverse 5′-TTCTTGGTTTTGAGGTCAAGGG (SEQ ID NO: 176) primers and cloned into pPCR-Script Bluescript vector. EcoR1 restriction sites were introduced by PCR amplification using Hotstart Pfu Ultra Hotstart Turbo DNA Polymerase (Stratagene) with forward 5′-GTGACCCGAATTCATGCCC AACCCTAGGCCAGCCAAG-3′ (SEQ ID NO: 177) and reverse 5′GAGGTTGGAATTCTCACCTCTTCTTGCA AACTCAAATTC-3′ (SEQ ID NO: 178) primers followed by cloning into Bluescript vector to yield pÖ737. Foxp3 cDNA fragment was purified after restriction digestion with EcoR1 and cloned into MINR-1 vector. Mutations were introduced during amplification via the reverse primer or with the Quick-change site II directed mutagenesis kit (Stratagene, cat #200523) using forward and reverse complementary primers (Integrated DNA Technologies). Following cloning into a Bluescript vector and sequence verification, all fragments were recloned into the Minr-1 vector for retroviral expression (69). Mutant constructs were also generated with appropriate primers using pÖ737 plasmid as the initial template.
In vitro mutagenesis of Foxp3—Foxp3 mutations were introduced with the Quick-change site II directed mutagenesis kit (Stratagene, cat #200523) using forward and reverse complementary primers purchased from Integrated DNA Technologies. Amino acid changes in the C-terminal end of Foxp3 were done by amplification with appropriate mutagenesis primers, followed by cloning into the SrfI cut pPCR-Script (Stratagene) vector for sequence verification.
Foxp3 retroviral construction—Retroviral vector Minr-1 was obtained from Dr. Andrew Wells. The Foxp3 mutant cDNAs were constructed by introducing the mutations by primers (Integrated DNA Technologies, Inc.) followed by synthesis and amplification with Hotstart Pfu Turbo Polymerase. The amplified Foxp3 constructs were then cloned into a Bluescript vector that had been linearized with the Srf I enzyme. These constructs were designed to have EcoR I restriction sites at both the immediate 5′ end (before ATG) and immediate 3′ end (after the TGA stop codon) of the genes. DNA sequences were validated at the CHOP Core DNA sequencing facility and Foxp3 specific forward and reverse primers were used in this process. The Foxp3 constructs were then cut with EcoR I, cloned into the Minr-1 vector previously linearized with EcoRI, followed again by sequence verification.
Foxp3 retroviral transduction—Minr-1 is a MSCV-based bicistronic vector, originally developed by Dr. Warren Pear which consists of a 5′ long terminal repeat (5′LTR) and 3′LTR sites and features an internal ribosome entry site (IRES) downstream of the cloning region and upstream of the non-signaling human nerve growth factor receptor (NGFR) gene used as marker.
Retrovirus was generated by co-transfection of wt-Foxp3 and Foxp3-mutants (in Minr-1) with pCLeco (Invitrogen) helper plasmid into the 293T-based Phoenix ecotropic packaging cell line. Briefly, Phoenix cells were plated at a density of 10×106 cells/100 mm dish in 10 ml of RPMI medium (Invitrogen) containing 10% fetal bovine serum, 1× pen/strep, and 1× L-glutamine 24 hrs prior to transfection. Primary CD4+ T-cells isolated from spleen and lymph nodes by magnetic sorting were stimulated for 16-18 hrs in 24-well plates containing 1×106 cells/well in 2 ml media with (3 ng/ml) PMA and (1 μM) ionomycin and 5 U/ml of IL-2.
At 48 h post-transfection of Phoenix cells, retroviral supernatants were harvested and utilized for transduction into CD4+ T-cells. The T-cells were transduced twice by spinfection with 48 hr and 72 hr viral supernatants obtained from transfected Phoenix cell media. Zero time was considered to be second of the two viral transductions performed one day apart. Transduced cells were expanded for 1-3 days unless otherwise stated, and used in suppression, ELISA assays, or for nuclear and cytoplasmic protein extraction.
Transduction efficiencies were determined by FACS analysis of human nerve growth factor receptor (hNGFR), expressed from the same bicistronic mRNA as Foxp3, or by direct measurement of Foxp3 expression on permeabilized cells, to show that the different mutants of Foxp3 were expressed at comparable levels. Typically the variation in transduction efficiencies between samples was <10%.
Testing retroviral Foxp3 expression—The Minr-1 retroviral constructs contain the reporter NGFR gene. NGFR expression levels have been shown to directly correlate with the level of expression of the upstream gene of interest (69). Assaying for NGFR expression in infected NIH3T3 cells as well as primary T-cells gives an accurate picture of the Foxp3 expression levels. NGFR expression was determined by FACS using an anti-NGFR mAb conjugated to PE or biotin. Expression of Foxp3 in transfected cells is also quantified by qPCR. Cells transfected with the null virus serve as negative controls in qPCR and in FACS analyses of Foxp3 expression. We have achieved successful transduction efficiencies of CD4+CD25− T-cells utilizing the Minr-l-wt-Foxp3 and Minr-1-mutant Foxp3 constructs and have demonstrated Foxp3 expression at the RNA and protein level.
Suppression assays—CD4+CD25+ (T-reg) and CD4+CD25− (T-eff) T cell and APC are isolated with magnetic beads following the manufacturer's instructions (Miltenyi). In some cases, 5×104 CD4+CD25− T cells were labeled with CFSE and stimulated with CD3 mAb (1 μg/ml) in the presence of irradiated syngeneic APC and varying ratios of activated CD4+ cells that had been transduced with different Foxp3 constructs. Retrovirally transduced T-cells are serially diluted and co-cultured in different ratios (2:1, 1:1, 0.5:1 and 0.25:1) with CD4+CD25− T cells (1×106/ml) and γ-irradiated (1000 rad) APCs (1×106/ml) in TCM (RPMI 1640 complemented with 10% FBS, 100 μg and 100 unit of penicillin and streptomycin, respectively and 50 μM of β-mercaptoethanol), containing 0.5 μg/ml of anti-CD3. After 72 hours culture, cells were harvested and CD4+CD25− T cell proliferation was quantified by flow cytometry (Cyan) based on carboxylfluorescein diacetate succininyl ester (CFSE) profile of dividing effector T cells at 72 hr. Absolute numbers of effector T cells were determined by adding equal numbers of Dynabeads to each sample, and during FACS analysis gates were drawn on Dynabeads and collection time was based on set number of bead events for each sample. This allowed the collection of equal volume of sample from each tube and absolute numbers of cells were then based on gates designated after Flo-Jo software analysis.
RNA preparation—Total RNA is prepared from tissues using acid guanidine thiocyanate-phenol-chloroform followed by purification of RNA to remove contaminating DNA. Total RNA from cells is prepared by lysing the cells using the Qiashredder kit (Qiagen catalog #79654) followed by purification of RNA using the Qiagen RNAeasy Mini Kit (Qiagen cat #74104). All the RNA used in Q-PCR is DNAse treated during purification.
Quantitative PCR (qPCR)—Total RNA was prepared from 1-10×106 cells by lysing cells with Qiashredder (Qiagen catalog #79654) followed by purification of RNA using the RNeasy Mini Kit (Qiagen, cat #74104), or alternatively, the RNA to be used for Q-PCR analysis was purified using an RNeasy Mini Kit (Qiagen), and samples were treated on RNeasy columns with DNAse Ito remove any contaminating DNA. To prevent PCR amplification of genomic DNA, sense and antisense primers were designed to be complimentary to different exons. qPCR-reactions were performed with an ABI Prism 7000 Analyzer using a 6-carboxy-fluorescein (FAM, reporter dye) at the 5′ end and with 6′carboxy-tetramethylrhodamine (TAMARA, quencher dye) at 3′ end. The probes were obtained from Applied Biosystems and primers from Integrated DNA Technologies. Foxp3 probe/primer is available from Applied Biosystems (cat #Mm00475156). cDNA was synthesized from 200 ng RNA with Multiscribe reverse transcriptase using random hexanucleotides, in a total volume of 100 μl. cDNA was synthesized with TaqMan reverse transcription reagents (Applied Biosystems), primer/probe sets were obtained from Applied Biosystems and qPCR performed using an ABI Prism 7000 Analyzer. qPCR reactions are done in 50 μl reaction volume with 2.5 μl template cDNA, 25 μl 2× Universal Master Mixture, 300 nM of each of forward and reverse primers and 250 nM of probe. The amplification profile includes an initial incubation at 50° C. for 2 min, denaturation at 95° C. for 10 min, and 40 cycles of 95° C. for 15 s and 60° C. for 1 min. A relative standard curve was used to quantify mRNA levels and the copy number of mRNA of interest by using the standard curve generated with the copy number of 18S ribosomal RNA. Control samples were also included in which reverse transcriptase was not added during the cDNA synthesis, and these were used as negative controls since signals generated from such samples would indicate the level of genomic DNA contamination. No measurable signals from the negative controls were normally obtained since DNAse I treatment, coupled with column purification of RNA results in complete removal of any contaminating DNA.
Western blots—Cells were lysed in SDS containing proteinase inhibitors; 25-75 μg protein was loaded onto large 14% or 20% SDS-PAGE gels. Nuclear and cytoplasmic extracts were prepared using a commercial kit NE-PER (Pierce, cat #78833). For analysis of nuclear and cytoplasmic proteins, 25 μg nuclear protein extract was loaded onto gels while keeping the cytoplasmic fraction at a constant ratio so as to reflect the correct distribution of nuclear and cytoplasmic proteins. Proteins were blotted onto PVDF membranes (Perkin Elmer, cat #NEF 1000) and probed overnight with the appropriate Abs, rinsed and probed with a secondary Ab-HRP conjugate followed by reaction with the Luminol reagent (Santa Cruz, cat #sc-2048) and exposure to Kodak Biomax MR film.
DNA and protein estimation—DNA was estimated by the diphenylamine-based color reaction assay originally described by Zacharias Dische (1930) and modified by Burton (76) in 1956. Protein-estimation was done using the Bio-Rad DC Protein Assay Kit (cat #5000112).
ELISA—Murine IFN-γ was assayed using a commercial kit (eBioscience, cat #88-7314).
Nuclear and cytoplasmic fractionation—Nuclear and cytoplasmic extracts were prepared using the commercial kit Ne-Per (Pierce, cat #78833) or as described in (83, 84). For analysis of nuclear and cytoplasmic proteins, 25 μg nuclear protein extract was loaded onto gels while keeping the cytoplasmic fraction at a constant ratio so as to reflect the correct distribution of nuclear and cytoplasmic proteins. Proteins were blotted onto PVDF membranes (Perkin Elmer, cat #NEF 1000) and probed overnight with the appropriate Abs, rinsed and probed with a secondary Ab-HRP conjugate followed by reaction with the Luminol reagent (Santa Cruz, cat #sc-2048) and exposure to Kodak Biomax MR film.
To show whether the proteolytic cleavage at the C-terminal end of Foxp3 takes place prior to binding of Foxp3 to DNA, a Foxp3 construct encoding a Flag-tag at the C-terminal end of Foxp3 was made and the Foxp3-Flag protein was retrovirally expressed in T-cells. The Foxp3:Flag ratio was then determined in total cell extract and compared to the Foxp3:Flag ratio obtained from DNA-bound Foxp3. Foxp3 was isolated as follows: Total Foxp3 was extracted from transduced T-cells expressing the C-terminal Flag-tagged Foxp3 by lysis through boiling in Laemmli sample buffer (w/5% β-Mercaptoethanol). DNA-bound Foxp3 was extracted from nuclei first by lysing the cells in 10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, and 0.6% Nonidet-P40, followed by pelleting the nuclei through centrifugation. Next, the nuclei was extracted with 20 mM Hepes, pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF by incubation on ice for 1 hr with frequent vortexing. Following centrifugation, the insoluble material which represents DNA and bound material was pelleted and was extracted by boiling in the Laemmli sample buffer containing 5% β-Mercaptoethanol. Samples corresponding to Total Foxp3 and DNA-bound Foxp3 were analyzed by Western blotting on 14% SDS-Acrylamide gels. The two samples were loaded at different amounts and the lanes that gave equal Foxp3 signals in both samples were analyzed for the Flag signal, this was accomplished using duplicate membranes; one for Foxp3 detection and a different membrane for Flag detection.
Alternatively, 10×106 T cells were incubated on ice in hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF) for 15 min and lysed in the presence of 0.6% Nonidet P-40 by continued incubation on ice for another 15 min and frequent vortexing. Nuclei collected by brief centrifugation (30 sec, 14,000×g) were incubated in extraction buffer (20 mM HEPES, pH 7.9, 375 mM NaCl, 1 mM EDTA, 1 mM DTT and 1 mM PMSF) for 30 min incubation on ice with frequent vortexing. The nuclear extract and the DNA-bound material were separated by centrifugation at 4° C. for 15 min. DNA-bound material was dissolved by boiling in 1% SDS for DNA- and protein-analysis or directly boiled in Laemmli buffer for subsequent SDS-PAGE.
Adoptive transfer model of IBD—CD4+CD25− T cells were isolated from mesenteric lymph nodes using magnetic beads (Miltenyi) to >95% purity (by flow cytometry). CD4+CD25− T cells (1×106 cells) were co-injected i.p. into RAG1−/− (C57BL/6) mice along with Thy1.1+CD4+CD25− cells transduced with WT or mutated Foxp3 (1×105). Mice were monitored biweekly for clinical evidence of disease, including weight loss and stool consistency. RAG1−/− mice on the C57BL/6 background were purchased from Taconic Laboratory. Mice were housed in specific pathogen-free conditions, and used for studies approved by the institutional animal care and use committee of the Children's Hospital of Philadelphia.
Pathology—Gut samples were paraffin embedded and stained by H&E, or snap-frozen and stained by immunoperoxidase using mAbs to Foxp3 and T cell subsets (73).
Statistics—In vitro and in vivo suppression data were evaluated by ANOVA, and p<0.05.
The following examples are provided to illustrate embodiments of the invention. They are not intended to limit the scope of the invention in any way.
Foxp3 Gets Cleaved at the RKKR↓S (SEQ ID NO: 188) Site to Yield a Shorter Protein Product that is Functional
The removal of the C-terminal 12 amino acids immediately following the RKKR (SEQ ID NO: 179) renders Foxp3 functional, indicating a block of function mediated by the neighboring C-terminal domain. Since these basic residues are involved in DNA binding (29), certain structural changes in the C-terminal domain should be taking place allowing interaction with DNA. This can be accomplished either through complex formation in which factors that complex with Foxp3 displace the C-terminal domain and expose the RKKR (SEQ ID NO: 179), or allowing interaction with DNA or simply by cleavage of Foxp3 immediately following the RKKR (SEQ ID NO: 179) sequence.
The first evidence that Foxp3 gets cleaved at the C-terminus was obtained using a C-terminal Flag-tagged Foxp3 construct. The flag-tagged Foxp3 was retrovirally expressed in cells and then the protein was detected by Western blot. Total cell extracts stained strongly for both the Foxp3 and Flag antibodies, while the insoluble nuclear fraction, which represents the DNA-bound material, stained only with the Foxp3 antibody, and very weakly with the Flag antibody (
PCs are calcium dependent serine endoproteases responsible for activating a large number of substrates through cleavage. There are presently eight known members of this family. These include Furin, PC1 (also known as PC3), PC2, PACE4, PC4, PC5, PC7, SKI-1/SIP and PCSK9. Furin was identified in 1990 based on its structural similarity to the yeast Kex2 enzyme. The Furin consensus cleavage site R4-X3-(K/R)2-R1↓ (SEQ ID NO: 179) (SEQ ID NO: 180) was determined biochemically studying Furin substrates (33, 34). The sequence R4X3X2R1↓ (SEQ ID NO: 180) represents the minimal cleavage site, however, favorable residues at position 2 and position 6 (2 aa preceding R4;) were found to compensate for less favorable ones at position 1 (35).
In vitro studies indicate that the substrate specificity of different PCs overlap, but gene knock-out studies indicate that there is only partial functional redundance. Furin, PC1, and PACE4 null mice are embryonically lethal and display distinct lethality phenotypes (36-38), on the other hand, PC2 null mice are diabetic (39) and male PC4 null mice are infertile (40).
PC1, unlike Furin which is broadly expressed, is selectively expressed in neuroendocrine tissues including brain (41-43). PC1 shows a similar recognition pattern to Furin, however, it has a strong preference for K to be present at position three (44). The R—X—K—R (SEQ ID NO: 187) sequence is also a known sequence for cleavage by PC1. Cleavage preference for other members varies, however, a consensus sequence that includes all the PCs can be shown as (R/K)—(X)n—(R/K)↓, where the vertical arrow represents cleavage; X is any amino acid other than cysteine, n is number of residues (n=0, 2, 4, 6 residues) (45).
Following the discovery of OP-1 and OP-2 (BMP-7 and BMP-8), the alignment of the pro-protein sequences of several TGF-β superfamily members resulted in the identification of the RXXR (SEQ ID NO: 180) sequence as the cleavage site necessary for the maturation of this protein family (46). The proposed mechanism was validated experimentally by several groups demonstrating pro-protein convertase (PC) family members cleave TGF-β family members past RXXR (SEQ ID NO: 180) sequences (47, 48).
Furin is a type I transmembrane protein mainly localized to trans-Golgi network (TGN), however, it cycles between TGN, cell surface and early endosomes (49). Furin is also secreted possibly as a result of post-translational modification (50). The list of proteins processed by Furin is extensive; at the TGN it cleaves pro-BMP-4 (47), pro-β-NGF (51) and IGF1 and IGF1R-R (52), and at the cell surface it cleaves and activates anthrax protective antigen (PA), and ectodysplasin-I (Eda-I) (53). In the mildly acidic environment of early endosomes it can cleave the diphtheria toxin and the shiga toxin. Furin was shown to cleave the CXCR3 specific chemokine CXCL10 (IP-10) close to its C-terminal end, releasing the C-terminal 4 amino acids following cleavage (54). Recently, Furin expression was found to be upregulated in T helper 1 cells following IL-12 treatment, resulting in enhanced IFN-γ secretion, conversely, inhibition of Furin resulted in the loss of IFN-γ production (55).
The RKKR (SEQ ID NO: 179) proteolytic maturation motif found in Foxp3 is identical to that of BMP-3, TGF-β2, -β3, -β5, and very similar to other members of the TGF-β superfamily. Therefore, Foxp3 appears to be cleaved by the proprotein convertase family of enzymes, for example, PC1, with cleavage releasing the C-terminal 12-amino acid peptide (i.e., Foxpeptide).
The previous examples indicate that only the full-length Foxp3 depends on an intact 414RXXR417 (SEQ ID NO: 180) pattern for proper nuclear localization. A likely scenario that would result in the exposure of the RKKR (SEQ ID NO: 179) sequence would be through cleavage and subsequent release of the C-terminal domain by specific protease(s) mentioned above. The fact that RKKRS (SEQ ID NO: 188) is a recognition sequence for Furin, an endoprotease that is a member of the pro-protein convertase (PC) family, makes proteolytic cleavage a likely mechanism that regulates the function of the C-terminal domain. The PC family of enzymes cut immediately following an RXXR (SEQ ID NO: 180) pattern and the sequence RKKRS (SEQ ID NO: 188), conserved in both the human and mouse Foxp3s, is reportedly an ideal Furin recognition sequence (59). Cleavage at this site would result in the release of the 12-amino acid C-terminal domain from the end of Foxp3. Another enzyme that may recognize the cleavage site in Foxp3 is PC7 which shares many characteristics with Furin and PC1.
To determine whether the RXXRS (SEQ ID NO: 188) sequence gets cleaved, an antibody was raised in rabbits against a synthetic peptide consisting of the last 11 amino acids of Foxp3. This anti-peptide Ab was then used in Western blots of spleen and heart extracts to check for the presence of a cleaved C-terminal Foxp3 peptide. After separation on large, 20% SDS-PAGE gels, a fragment of approximately 1.5 kDa, consistent with the molecular weight of a 12-amino acid peptide (theoretical mol. wt. 1.33 kDa) was detected in spleen but not in heart, a non-lymphoid organ (
The synthetic peptide used in raising the polyclonal Ab was run side by side with a spleen extract, and as seen (
RXXR (SEQ ID NO: 180) motif represents a potential recognition sequence for cleavage by the enzymes of the PC family, and our identification of two such motifs in murine and human Foxp3 suggested to us that Foxp3 might be processed by this mechanism. Foxp3 is unique in that none of the other Foxp family members have an RXXR (SEQ ID NO: 180) motif; i.e. a glutamine residue (Q) is found in place of the first arginine (QKRR) (SEQ IDNO: 189). Moreover, in the cases of Foxp1 and Foxp4, QKRR (SEQ ID NO: 189) sequences are followed by a proline residue (QKRRP) (SEQ ID NO: 190) at position P1′. While serine is the most frequently reported amino acid at P1′, proline has not been reported in surveys of PC cleavage sites (34). One of the two RXXR (SEQ ID NO: 180) motifs in Foxp3, RDLR (SEQ ID NO: 183), is at the N-terminal side of Foxp3, and the other, RKKR (SEQ ID NO: 179), is very close to the C-terminal end. Proteolytic cleavage at RKKR (SEQ ID NO: 179) was demonstrated by detection of the released C-terminal peptide on Western blots using an antibody raised against the last 11-aa of Foxp3.
Quantitative PCR was used to determine expression of the seven main PC enzymes (PC1/3, PC2, PC4, PC5/6, PC7, PACE4, Furin) in resting versus activated CD4+CD25− and CD4+CD25+ cells. Levels of PC2, PC4, PC5 and PACE4 mRNA were too low to be detected, whereas Furin, PC1 and PC7 mRNA levels were readily detected. These three PC had contrasting expression patterns in CD4+CD25− vs. CD4+CD25+ cells, and in resting vs. activated cells (
Several attempts were made to resolve the cleaved and uncleaved forms of Foxp3 by SDS-PAGE, but the small size difference (12-aa) between the two forms proved challenging. To assist with resolution by SDS-PAGE, the C-terminal tail (sequences past RKKR (SEQ ID NO: 179)) was extended from 12-aa to 31-aa (
Using material from these experiments, the chromatin-associated material that remained after nuclear extraction was analyzed. The protein:DNA ratio (by weight) in this fraction was approximately 2.8:1, a characteristic ratio for chromatin (74). Two major species of Foxp3 were detected, a slow migrating species corresponding to the uncleaved (C-terminal-extended) Foxp3 and a faster migrating Foxp3 species. The fast migrating species was found to co-migrate with the engineered short form of Foxp3 that mimics a cleaved product (size control), indicating it is the proteolytically processed form of Foxp3 (
Expression of an engineered C-terminal extended Foxp3 in CD4+ T cells allowed the detection of the two forms, cleaved and uncleaved Foxp3, by SDS-PAGE. A third species, approximately 41-kDa in molecular weight, was also faintly detected in the chromatin-associated fraction (
Since the C-terminal extensions allowed the cleaved and uncleaved forms of Foxp3 to be resolved by SDS-PAGE, the C-terminal extended construct was used as a template and further mutations were introduced into the RKKR (SEQ ID NO: 179) sequence to probe the role of the RXXR (SEQ ID NO: 180) motif (
That an intact RXXR (SEQ ID NO: 180) is required for cleavage was demonstrated by introducing mutations into the RKKR (SEQ ID NO: 179) sequence of the C-terminal-extended Foxp3. While the loss of the first arginine (QNKR) (SEQ ID NO: 181) resulted in partial processing, loss of both arginines (QNKS) (SEQ ID NO: 182) completely prevented proteolytic cleavage (
To further study the role of the RKKR (SEQ ID NO: 179) sequence in Foxp3 function, four Foxp3 constructs were prepared by site-directed mutagenesis. The first encodes a short 417-aa Foxp3, ending with 414RKKR417 (SEQ ID NO: 179) (RKKR• (SEQ ID NO: 179) in
Foxp3 mutants were cloned from Bluescript into Minr-1 vector and expressed by the same bicistronic message as hNGFR in CD4+ T cells via retroviral transduction. Assessment of individual Foxp3 mutants and their relative levels of hNGFR at 4 d post-transduction showed the Foxp3 mutants were equally expressed and were equally stable (
Since the basic RXXR (SEQ ID NO: 180) sequence may function as a cleavage target and NLS, it was the focus of further study. All constructs were first tested for equal expression and for their nuclear transport ability prior to suppression assays and animals studies. Mutations in the RKKR (SEQ ID NO: 179) sequence of the full-length Foxp3 were found not to affect the nuclear transport ability of the protein (
Foxp3 is activated by a mechanism that involves PCs, with proteolytic cleavage resulting in release of both N- and C-terminal ends (51-aa and 12-aa, respectively). The double cleaved short Foxp3 is present only in the chromatin fraction, indicating Foxp3 is processed following its interaction with DNA, and that proteolytic cleavage is required for its activity. Of the known PCs, PC1 expression is increased markedly in Tregs upon activation and is equipped with a functional NLS (56). The C-terminal RXXR (SEQ ID NO: 180) motif in Foxp3 (RKKR) (SEQ ID NO: 179) sequence, fulfills the recognition criteria for PC1. Thus, PC1 appears to be the enzyme responsible for Foxp3 activation.
The search for RXXR (SEQ ID NO: 180) motifs in the other FoxP family members revealed Foxp1, 2 and 3 all have an RXXR (SEQ ID NO: 180) motif close to their N-termini. Interestingly, Foxp1, -2 and -3 do not have any significant homology outside their forkhead domains. Foxp3 is only 18% identical to Foxp1 and 16% to Foxp2 within the first N-terminal 51-amino acids where the RXXR (SEQ ID NO: 180) motifs are located. The fact that all three members have an RXXR (SEQ ID NO: 180) motif despite a lack of significant homology suggests N-terminal recognition and processing by proprotein convertases may be a common mechanism by which members of this family are activated through removal of their N-terminal ends.
A 41-kDa Foxp3 species on Western blots was detected that represents a form of Foxp3 (366-aa) cleaved at both N-terminal and C-terminal RXXR (SEQ ID NO: 180) motifs (48RDLR↓S52 (SEQ ID NO: 191) and 414RKKR↓S418) (SEQ ID NO: 188). To assess whether the 41-kDa species detected on Western blots could be Foxp3 that has lost both its N-terminal and C-terminal ends through proteolytic cleavage, the migration property of the 41-kDa species was compared to that of an engineered Foxp3 (used as a size control). This control Foxp3 lacks the N-terminal 51-aa and the C-terminal tail sequences and has exactly the same number of residues as a double-cleaved Foxp3 (366-aa). Western blot analysis showed the engineered “size control” protein co-migrated with the 41-kDa Foxp3 species (
The subcellular distribution of the 41-kDa species was then studied. This shorter species was again not detected in the nuclear or cytoplasmic extracts but was confined to the chromatin fraction (
C-Terminal-Cleaved Foxp3 Missing the Last 12-aa is Functional and Rransduced CD4+ Cells Expressing C-Cleaved-Foxp3 have Higher Suppressive Activity than WT-Foxp3
WT Foxp3 and engineered Foxp3 mutants (N-terminal cleaved, C-terminal cleaved and N -plus C-terminal-cleaved (double-cleaved)) were retrovirally expressed in CD4+ cells and the ability of the transduced cells to suppress Teff cell proliferation was measured.
As shown in
To test the effects of the different Foxp3 mutants in vivo, RAG−/− (C57BL/6) mice were injected with 1×105 transduced Thy1.1+CD4+ cells expressing either WT-Foxp3 or a mutant Foxp3 (RKKR• (SEQ ID NO: 179), QNKR• (SEQ ID NO: 180), QNKR-- (SEQ ID NO: 180)) or empty vector (control), plus 1×106 CD4+CD25− Teff cells. Additional mice received CD4+CD25− Teff cells alone. The weights of the animals in each group were monitored weekly for 45 days.
Mice that received cells expressing empty vector (MINR1) or no Treg progressively lost weight and succumbed to disease, whereas mice receiving cells expressing WT-Foxp3 showed minor weight loss but survived (p<0.01 vs. MINR1 or no Treg groups) (
Use of differing QNKR (SEQ ID NO: 181) mutants also had contrasting effects on weight loss in this model (
The study was terminated at day 45 and splenocytes from each group were analyzed for Thy1.1 and Foxp3 expression. Flow cytometry showed most splenic Thy1.1+ cells expressed Foxp3, consistent with survival of transferred Foxp3+ cells throughout the study. When the number of spleen cells from each group was quantitated, (RKKR•) (SEQ ID NO: 179) group yielded the least number of total T cells (p<0.05), consistent with the absence of inflammatory disease in this group (
The results obtained have lead to the construction of a proposed mechanism of biochemical activation of Foxp3 (
While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. It will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the scope of the present invention, as set forth in the following claims.
This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application 60/913,960, filed on Apr. 25, 2007. The foregoing application is incorporated by reference herein.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US08/61595 | 4/25/2008 | WO | 00 | 8/23/2010 |
Number | Date | Country | |
---|---|---|---|
60913960 | Apr 2007 | US |