Patent Application
20250027085
The present disclosure provides, inter alia, methods for treating neurodegenerative diseases including Alzheimer's disease. Also provided are in vivo methods for identifying DNA-binding profiles of dimeric transcription factor complexes such as, e.g., CREB3L2-ATF4.
This application contains references to amino acids and/or nucleic acid sequences that have been filed concurrently herewith as sequence listing XML file “CU22191-seq.xml”, file size of 87,248 bytes, created on Dec. 5, 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
Alzheimer's disease (AD) is a prevalent and irreversible neurodegenerative disorder characterized by a gradual decline in cognition that most commonly affects the elderly (Long and Holtzman, 2019). Its complex biological presentation has long curbed treatment strategies, but recent genome-wide genetic association studies have provided a more uniform framework for understanding its etiology, with cholesterol metabolism, immune responses, and endosomal trafficking emerging as new focal pathways that interact with the primary pathogenic hallmarks of AD, extracellular β-amyloid deposition and intraneuronal neurofibrillary tangles of hyperphosphorylated tau protein (Scheltens et al., 2016; Small et al., 2017; Verheijen and Sleegers, 2018). It is also increasingly evident that AD pathophysiology reconfigures the expression of specific groups of genes, indicating a role for network regulators such as transcription factors (TFs), cofactors, and chromatin remodelers in the progression of the condition (Mathys et al., 2019; Mostafavi et al., 2018; Zhang et al., 2013).
TFs typically work together to achieve specific transcriptional responses. This combinatorial regulation can occur, for example, through the mutual stabilization of DNA associations, the promotion of more accessible chromatin states, or direct protein-protein interactions between TFs (Amoutzias et al., 2008; Reiter et al., 2017). The latter mechanism is seen within the basic-region leucine zipper (bZIP) family through dimerization (Newman and Keating, 2003). Because multiple binding possibilities commonly exist, TF heterodimerization can generate significant variability in DNA-binding profiles, which cells exploit to expand their regulatory repertoire and orchestrate differential gene expression programs in a context-dependent fashion. On a global scale, however, these synergistic relationships remain largely unmapped (Lambert et al., 2018b), not least due to the lack of methodologies to do so comprehensively across the genome, limiting our understanding of how TFs regulate gene expression and hence also their contribution to disease states.
Emerging evidence pinpoints malfunction at the level of the retromer, a protein complex that coordinates cargo-sorting events within the endosomal network, as a driver of endosomal dysfunction and AD pathogenesis (Cullen and Steinberg, 2018; Nixon, 2017; Small and Petsko, 2015). A role for retromer in AD was first suggested by the finding that two of its core subunits, VPS26 and VPS35, involved in endosomal cargo selection, are deficiently expressed in the brain of affected individuals in an age-independent fashion (Small et al., 2005). Since then, genetic and functional studies have confirmed that retromer-mediated processes are disrupted in AD and other neurodegenerative disorders, such as Parkinson's disease (Small and Petsko, 2015; Vilarino-Guell et al., 2011; Wang et al., 2013; Zimprich et al., 2011). Most significantly, the trafficking and processing of amyloid precursor protein (APP) is altered by retromer-related defects, leading to the accumulation of neurotoxic β-amyloid peptides (Small and Petsko, 2015). However, despite much progress in understanding the consequences of retromer malfunction, it remains unknown why retromer deregulation first develops in late-onset AD (LOAD), the most prevalent form of AD.
Accordingly, there is a need for identifying and characterizing pathological TF complexes associated with neurodegenerative diseases as this can lead for example to a mechanistic understanding of the role of retromer transcriptional misregulation in LOAD. This disclosure is directed to meeting these and other needs.
Transcription factors (TFs) regulate gene expression and define cellular homeostasis via cooperative interactions. Transcriptional deregulation can drive pathologies, including Alzheimer's disease (AD). The present disclosure revealed that the bZIP TF heterodimer CREB3L2-ATF4 formed in neurons in response to β-amyloid exposure and accumulates in AD brain. Using ChIP-seq on human prefrontal cortex, several transcriptional networks deregulated by CREB3L2 in AD were identified. A method was developed to resolve the transcriptional program of defined dimeric TFs and uncovered the cause of this deregulation in the combination of the transcriptional properties of CREB3L2 and ATF4, i.e., the former's boarder scope of targets and the latter's stronger activity. Among other AD susceptibility genes, the retromer was identified as a target of CREB3L2-ATF4 transcriptional regulation and connects heterodimer formation to retromer dysfunction in AD and β-amyloid metabolism. The data established CREB3L2-ATF4 as a transcriptional hub of AD pathology and highlighted TF combinatorics as a relevant disease mechanism.
Accordingly, one embodiment of the present disclosure is a method for treating or ameliorating the effects of a neurodegenerative disease in a subject, comprising: (a) determining the level of CREB3L2-ATF4 transcription factor (TF) complex in a sample obtained from the subject; and (b) administering to the subject an effective amount of an agent that modulates the association between CREB3L2 and ATF4, if the level of CREB3L2-ATF4 complex determined in step (a) is significantly different from that of a control subject.
Another embodiment of the present disclosure is a method for restoring retromer complex function in a subject, comprising administering to the subject an effective amount of an agent that modulates CREB3L2 expression.
Another embodiment of the present disclosure is a method for determining the progression of a neurodegenerative disease in a subject, comprising: (a) determining the level of CREB3L2-ATF4 transcription factor (TF) complex in a sample obtained from the subject; and (b) concluding that the neurodegenerative disease in the subject is progressing, if the level of CREB3L2-ATF4 complex determined in step (a) is significantly increased from that of a control subject.
Another embodiment of the present disclosure is method for identifying the DNA-binding profile of a dimeric transcription factor complex in vivo, comprising: (a) generating a DNA construct of a first transcription factor comprising: (i) fusing a specific first dimerization domain to the C-terminal of the first transcription factor; and (ii) adding a first N-terminal epitope tag to the first transcription factor; (b) generating a DNA construct of a second transcription factor comprising: (i) fusing a specific second dimerization domain to the C-terminal of the second transcription factor, wherein the second dimerization domain is different from the first dimerization domain; and (ii) adding a second N-terminal epitope tag to the second transcription factor, wherein the second N-terminal epitope tag is different from the first N-terminal epitope tag; (c) identifying a bivalent ligand that recognizes both dimerization domains from steps (a) and (b); (d) co-transfecting a host cell with the DNA constructs generated in steps (a)-(b) and co-expressing polypeptides encoded by the DNA constructs in the presence of the bivalent ligand identified in step (c) to form the dimeric transcription factor complex; and (e) identifying the DNA-binding profile of the dimeric transcription factor complex by determining the complex's binding sites to the genome using ChIP-sequencing (ChIP-seq).
A further embodiment of the present disclosure is a method for restoring amyloid precursor protein (APP) homeostasis in a subject in need thereof, comprising: (a) determining the Aβ1-42/Aβ1-40 ratio in a sample obtained from the subject; and (b) administering to the subject an effective amount of an agent that increases the expression level of CREB3L2 or prevents the dimerization of CREB3L2 with ATF4, if the Aβ1-42/Aβ1-40 ratio determined in step (a) is significantly higher that a predetermined reference.
An additional embodiment of the present disclosure is a method for restoring tau metabolism in a subject in need thereof, comprising administering to the subject an effective amount of an agent that modulates the association between CREB3L2 and ATF4.
Another embodiment of the present disclosure is a composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69.
Another embodiment of the present disclosure is a method for preventing CREB3L2-ATF4 heterodimerization in a subject, comprising administering to the subject an effective amount of the composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69.
Another embodiment of the present disclosure is a method for rescuing Aβ42-induced neuronal cell death in a subject, comprising administering to the subject an effective amount of the composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
In the present disclosure, a pathological TF complex associated with LOAD and CREB3L2-ATF4, was identified and characterized. This association was discovered in a screen for axon-derived modulators of neurodegenerative responses set off by peripheral β-amyloid and confirmed its pathological significance in LOAD brain tissue. To dissect its role in disease, a new methodology, ChIPmera, was developed, which resolves the DNA-binding profile of dimeric TFs in vivo. In combination with other analyses, the retromer machinery was identified as a disease-relevant transcriptional target of CREB3L2-ATF4, and the heterodimer was linked to disrupted retromer gene expression.
Accordingly, one embodiment of the present disclosure is a method for treating or ameliorating the effects of a neurodegenerative disease in a subject, comprising: (a) determining the level of CREB3L2-ATF4 transcription factor (TF) complex in a sample obtained from the subject; and (b) administering to the subject an effective amount of an agent that modulates the association between CREB3L2 and ATF4, if the level of CREB3L2-ATF4 complex determined in step (a) is significantly different from that of a control subject.
As used herein, “significantly different” refers to statistical significance, which means a result is unlikely due to chance. It can be determined by comparing p-value, which is the probability of obtaining a result at least as extreme, with an arbitrary pre-set significance level (a). In the context of this disclosure, if a is selected to be 0.05, the level of CREB3L2-ATF4 complex in a sample is significantly different from that of a control subject if the calculated p-value is less than 0.05.
In some embodiments, the neurodegenerative disease is associated with retromer complex dysfunction, altered β-amyloid metabolism, tau hyperphosphorylation, or combinations thereof. In some embodiments, the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Parkinson's Disease, Frontotemporal Lobar Degeneration, Down's Syndrome, Hereditary Spastic Paraplegia, Neuronal Ceroid Lipofuscinoses, Amyotrophic lateral sclerosis, Friedreich's ataxia, Multiple sclerosis, Huntington's Disease, Transmissible spongiform encephalopathy, Charcot-Marie-Tooth disease, Dementia with Lewy bodies, Corticobasal degeneration, and Progressive supranuclear palsy. In some embodiments, the neurodegenerative disease is Alzheimer's disease or Parkinson's disease. In some embodiments, the neurodegenerative disease is late-onset Alzheimer's disease (LOAD).
As used herein, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc. In some embodiments of the present disclosure, the phrase “a subject” means a subject having a neurodegenerative disease such as, e.g., Alzheimer's disease.
In some embodiments, the agent that modulates the association between CREB3L2 and ATF4 does not ablate CREB3L2 signaling. An exemplary agent may include those that reduce ATF4 activity such as, e.g., ursolic acid and tomatidine. In some embodiments, the agent is dovitinib.
In some embodiments, the determining step (i.e., step (a)), may be carried out using any conventional method for determining the level of CREB3L2-ATF4 TF complex in a biological sample. In certain aspects of this embodiment, the determining step is as set forth in, e.g., Examples 1 and 4 of the present disclosure.
As used herein, a “biological sample” means a biological specimen, which may be a bodily fluid or a tissue. Biological samples include, for example, whole blood, serum, plasma, cerebro-spinal fluid, leukocytes or leukocyte subtype cells (e.g. neutrophils, basophils, and eosinophils, lymphocytes, monocytes, macrophages), fibroblast sample, olfactory neuron sample, and tissues from the central nervous system, such as the cortex (e.g., dorsolateral PFC) and hippocampus, and cells previously exposed to the CNS environment, such as dendritic cells trafficked from the brain, or other immune or other cell types (Mohamed-M G et al., 2014). Examples of preferred biological samples include, e.g., a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, or a mucous sample. In some embodiments, the biological sample can be a tissue section or a biopsy from dorsolateral PFC, blood, or other appropriate bodily fluid.
Another embodiment of the present disclosure is a method for restoring retromer complex function in a subject, comprising administering to the subject an effective amount of an agent that modulates CREB3L2 expression.
In some embodiments, the modulation of CREB3L2 expression comprises modulating the association between CREB3L2 and ATF4.
In some embodiments, the modulation of CREB3L2 expression results in at least one retromer-associated gene in the subject being deregulated by CREB3L2. In some embodiments, the at least one retromer-associated gene is selected from the group consisting of SNX3, SNX27, RAB7A, SNX1, VPS29, SNX5, VPS26B, SNX2, EHD1, SNX6, VPS26A, VPS35, and combinations thereof. In some embodiments, the at least one retromer-associated gene is selected from the group consisting of VPS26B, VPS35, SNX2, SNX5, SNX3, RAB7A, EHD1, and combinations thereof.
As defined above, in the context of the present disclosure, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc. In some embodiments of the present disclosure, the phrase “a subject” means a subject having retromer complex(es) dysfunction.
Another embodiment of the present disclosure is a method for determining the progression of a neurodegenerative disease in a subject, comprising: (a) determining the level of CREB3L2-ATF4 transcription factor (TF) complex in a sample obtained from the subject; and (b) concluding that the neurodegenerative disease in the subject is progressing, if the level of CREB3L2-ATF4 complex determined in step (a) is significantly increased from that of a control subject.
In the context of this disclosure, the term “significantly increased”, as defined above, means that the increase of the level of CREB3L2-ATF4 complex in the sample over that of a control subject is statistically significant (e.g., with a p-value <0.05).
In some embodiments, the neurodegenerative disease is associated with retromer complex dysfunction, altered β-amyloid metabolism, tau hyperphosphorylation, or combinations thereof. In some embodiments, the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Parkinson's Disease, Frontotemporal Lobar Degeneration, Down's Syndrome, Hereditary Spastic Paraplegia, Neuronal Ceroid Lipofuscinoses, Amyotrophic lateral sclerosis, Friedreich's ataxia, Multiple sclerosis, Huntington's Disease, Transmissible spongiform encephalopathy, Charcot-Marie-Tooth disease, Dementia with Lewy bodies, Corticobasal degeneration, and Progressive supranuclear palsy. In some embodiments, the neurodegenerative disease is Alzheimer's disease or Parkinson's disease. In some embodiments, the neurodegenerative disease is late-onset Alzheimer's disease (LOAD).
As defined above, in the context of the present disclosure, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc. In some embodiments of the present disclosure, the phrase “a subject” means a subject having a neurodegenerative disease such as, e.g., Alzheimer's disease.
In some embodiments, the determining step (i.e., step (a)), may be carried out using any conventional method for determining the level CREB3L2-ATF4 TF complex in a biological sample. In certain aspects of this embodiment, the determining step is as set forth in, e.g., Examples 1 and 4 of the present disclosure.
In some embodiments, if the level of CREB3L2-ATF4 complex determined in step (a) is significantly increased from that of a control subject, then the subject may optionally be treated with an agent that modulates the association between CREB3L2 and ATF4. An exemplary agent may include those that reduce ATF4 activity such as, e.g., ursolic acid and tomatidine.
In the context of this disclosure, a “sample” or “biological sample” is as defined above. In some embodiments, the sample is obtained from the dorsolateral prefrontal cortex (PFC) of the subject.
Another embodiment of the present disclosure is method for identifying the DNA-binding profile of a dimeric transcription factor complex in vivo, comprising: (a) generating a DNA construct of a first transcription factor comprising: (i) fusing a specific first dimerization domain to the C-terminal of the first transcription factor; and (ii) adding a first N-terminal epitope tag to the first transcription factor; (b) generating a DNA construct of a second transcription factor comprising: (i) fusing a specific second dimerization domain to the C-terminal of the second transcription factor, wherein the second dimerization domain is different from the first dimerization domain; and (ii) adding a second N-terminal epitope tag to the second transcription factor, wherein the second N-terminal epitope tag is different from the first N-terminal epitope tag; (c) identifying a bivalent ligand that recognizes both dimerization domains from steps (a) and (b); (d) co-transfecting a host cell with the DNA constructs generated in steps (a)-(b) and co-expressing polypeptides encoded by the DNA constructs in the presence of the bivalent ligand identified in step (c) to form the dimeric transcription factor complex; and (e) identifying the DNA-binding profile of the dimeric transcription factor complex by determining the complex's binding sites to the genome using ChIP-sequencing (ChIP-seq).
In some embodiments, the dimerization domain is selected from the group consisting of FKBP, Calcineurin A (CNA), CyP-Fas, FRB, GyrB, GAI, GID1, SNAP-tag, HaloTag, eDHFR, Bcl-xL, and Fab(AZ1).
In some embodiments, the bivalent ligand is selected from the group consisting of FK1012, FK506, FKCsA, Rapamycin, Coumermycin, Gibberellin, HaXS, TMP-HTag, and ABT-737.
In some embodiments, the co-transfection in step (d) is a transient co-transfection. In some embodiments, the transient co-transfection can be carried out by a liposome-mediated method, a non-liposomal method, a viral delivery method, or electroporation.
In some embodiments, the DNA construct generation step (i.e., steps (a) and (b)), identification step (i.e., steps (c) and (e)) and co-transfection step (i.e., step (d)) may be carried out using any conventional method in the art. In certain aspects of this embodiment, such steps are as set forth in, e.g., Examples 1 and 5 of the present disclosure.
In some embodiments, the host cell is selected from the group consisting of HEK293, COS, CHO, and BHK cells. In some embodiments, the host cell is HEK293 cell. In some embodiments, the methods described above can be used in animals such as, e.g., a mammal including a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.
A further embodiment of the present disclosure is a method for restoring amyloid precursor protein (APP) homeostasis in a subject in need thereof, comprising: (a) determining the Aβ1-42/Aβ1-40 ratio in a sample obtained from the subject; and (b) administering to the subject an effective amount of an agent that increases the expression level of CREB3L2 or prevents the dimerization of CREB3L2 with ATF4, if the Aβ1-42/Aβ1-40 ratio determined in step (a) is significantly higher that a predetermined reference.
As used herein, “amyloid precursor protein (APP) homeostasis” means an optimal condition of amyloid precursor protein (APP) in a subject. APP has been implicated as a regulator of synapse formation, neural plasticity, antimicrobial activity, and iron export. Either up- or down-regulation of APP expression may contribute to physiological deficits that are disease-associated. Proteolytic processing of APP results in the release of Aβ peptides of different length including Aβ1-42 and Aβ1-40. The longer Aβ1-42 peptide exhibits stronger neurotoxic properties, and has been identified as the major component in senile plaques, which presumably contributes to Alzheimer's disease. In the context of this disclosure, β-amyloid precursor protein (APP) homeostasis can be assessed by measuring the concentrations of Aβ1-42, Aβ1-40, and/or calculating the Aβ1-42/Aβ1-40 ratio in a biological sample from a subject. The concentrations or calculated ratio cutoff can vary in different types of biological samples as defined above.
In the context of this disclosure, the term “significantly higher”, as defined above, means that the increase of the Aβ1-42/Aβ1-40 ratio determined in the sample over that of a control subject is statistically significant (e.g., with a p-value <0.05).
An additional embodiment of the present disclosure is a method for restoring tau metabolism in a subject in need thereof, comprising administering to the subject an effective amount of an agent that modulates the association between CREB3L2 and ATF4. In some embodiments, the modulation is to reduce level of CREB3L2-ATF4 heterodimer in the subject. In some embodiments, the modulation of CREB3L2-ATF4 association restores expression level of holoenzyme protein phosphatase 2A (PP2A). In some embodiments, the modulation of CREB3L2-ATF4 association restores expression levels of genes selected from the group consisting of SCG3, CLU, HSPA2, P4HB, HSPB1, PHGDH, MBNL2, PPP2CA, CELF3, AKT1, PKN1, CFL1, DBN1, MAOB, IGF1, NTRK2, AIF1, SLC1A3, and cominations thereof. In some embodiments, the restoration of tau metabolism comprises reduction of phosphorylation at Ser404.
Another embodiment of the present disclosure is a composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69. The nucleotide of SEQ ID NO: 68 in the present disclosure is named “CREB3L2 aZIP”, comprising: 5′-GGATCCGCCACCATGGACTACAAAGATGATGACGACAAGCACATGGCCAGCATGA CCGGGGGCCAGCAGATGGGAAGAGACCCTGATTTGGAACAAAGGGCAGAGGAGC TGGCCCGGGAGAACGAAGAACTGGAGAAGGAAGCTGAGGAACTTGAGCAGGAGC TCGCTGAACTTCGGAAGAAGGTGGAGGTGCTGGAGAACACCAACAGGACTCTCCT TCAGCAACTTCAGAAGCTTCAGACTTTGGTGATGGGGAAGGTCTCTCGAACCTGCA AGTTAGCTGGTACACAGACTGGCACCTGCCTCATGGTCGTTGTGCTTTAAGAATTC-3′. The nucleotide of SEQ ID NO: 69 in the present disclosure is named “ATF4 aZIP”, comprising: 5′-GGATCCGCCACCATGGACTACAAAGATGATGACGACAAGCACATGGCCAGCATGA CCGGGGGCCAGCAGATGGGAAGAGACCCTGATTTGGAACAAAGGGCAGAGGAGC TGGCCCGGGAGAACGAAGAACTGGAGAAGGAAGCTGAGGAACTTGAGCAGGAGC TCGCTGAACTCACTGGCGAGTGTAAAGAGCTAGAAAAGAAGAACGAGGCTCTGAA AGAGAAGGCAGATTCTCTCGCCAAAGAGATTCAGTATCTAAAAGACCTGATAGAAG AGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCTTAAGAATTC-3′.
Another embodiment of the present disclosure is a method for preventing CREB3L2-ATF4 heterodimerization in a subject, comprising administering to the subject an effective amount of the composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69.
Another embodiment of the present disclosure is a method for rescuing Aβ42-induced neuronal cell death in a subject, comprising administering to the subject an effective amount of the composition comprising a nucleotide of SEQ ID NO: 68 or SEQ ID NO: 69.
An agent of the present disclosure (e.g., an agent that increases the expression level of CREB3L2) may be administered to a subject via oral, parenteral or other administration in any appropriate manner such as, e.g., intraperitoneal, subcutaneous, topical, intradermal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. An agent of the present disclosure may be encapsulated or otherwise protected against gastric or other secretions, if desired. Further, such agent may be administered in conjunction with other treatments.
As used herein, the terms “treat,” “treating,” “treatment” and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present disclosure may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population, may fail to respond or respond inadequately to treatment.
As used herein, the terms “ameliorate”, “ameliorating” and grammatical variations thereof mean to decrease the severity of the symptoms of a disease in a subject.
As used herein, a “subject” is a mammal, preferably, a human. In addition to humans, categories of mammals within the scope of the present disclosure include, for example, agricultural animals, veterinary animals, laboratory animals, etc. Some examples of agricultural animals include cows, pigs, horses, goats, etc. Some examples of veterinary animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc. In the context of the present disclosure, the phrase “a subject in need thereof” means a subject in need of restoration for β-amyloid precursor protein (APP) homeostasis.
As used herein, the terms “modulate”, “modulating”, “modulator” and grammatical variations thereof mean to change, such as increasing or decreasing the expression of CREB3L2, or alternatively increasing or decreasing the association between CREB3L2 and ATF4.
In the present disclosure, an “effective amount” of an agent is an amount of such an agent that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of the subject, and like factors well known in the arts of, e.g., medicine and veterinary medicine. In general, a suitable dose of an agent according to the disclosure will be that amount of the agent, which is the lowest dose effective to produce the desired effect with no or minimal side effects. The effective dose of an agent according to the present disclosure may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
The following examples are provided to further illustrate the methods of the present disclosure. These examples are illustrative only and are not intended to limit the scope of the disclosure in any way.
Hippocampi were dissected from embryonic day (E) 16-18 rat embryos obtained from pregnant Sprague-Dawley dams (Envigo). All animal procedures were approved by the Institutional Animal Care and Use Committee at Columbia University. Cell dissociation was performed using TripLE Express. Neurons (50,000-60,000 per microfluidic chamber) were plated on 0.1 mg ml−1 poly-D-lysine (Millipore Sigma) and 2 μg ml−1 laminin (Bio-Techne) coated substrates and grown in Neurobasal supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotics (50 U ml−1 penicillin-streptomycin). Tripartite microfluidic chambers were produced with Dow Corning Sylgard 184 Silicone Encapsulant Clear Kit (10:1 mix ratio; Ellsworth Adhesives) cured at −70° C. for at least 4 hours following published protocols (Park et al. 2006; Desai et al. 2009). Chamber design incorporated two sets of 200-μm-long microgroove barriers to exclude crossing of cell bodies and dendrites (Taylor et al. 2005; Hengst et al. 2009). After 24 hours, medium was changed to Neurobasal containing 1×B27 and 2 mM L-glutamine. Subsequent medium changes (half volumes) were performed at DIV4 and thereafter every 3-5 days. To prevent glial cell proliferation, medium changes included 5-flurodeoxyuridine and uridine (final concentration 10 mM; Millipore Sigma) after DIV4. Neuronal cultures were grown in a 37° C., 5% CO2 humidified atmosphere until DIV12-14. Whenever stated, axonal or cell body compartments were treated with 100 nM emetine (Millipore Sigma), 30 μM ciliobrevin A (R&D Systems), or 10/15 μM nelfinavir (Millipore Sigma). Unless otherwise specified, reagents were purchased from Thermo Fisher.
Aβ1-42 peptide oligomerization and treatment
Lyophilized synthetic Aβ1-42 peptides (Bachem) were dissolved to 1 mM in ice-cold 100% 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP; Millipore Sigma) under a chemical fume hood by multiple rounds of pipetting, aliquoted and spun in a SpeedVac (Savant Instruments) for 30 minutes. The resulting peptide films were then resuspended in dimethylsulfoxide (DMSO; Millipore Sigma) to 5 mM, further diluted to 100 μM with HAM's F12 medium (Thermo Fisher), and incubated overnight at 4° C. Immediately before use, peptide concentration was adjusted with Neurobasal medium to a suitable working dilution, and added to axonal compartments at 3 μM, as previously described (Baleriola et al. 2014). Oligomerized Aβ1-42 peptides were delivered to dissociated, non-compartmentalized cultures at concentrations in the range of 250-500 nM (reflecting batch-to-batch variations). Vehicle controls consisted of a DMSO/F12 mixture, similarly incubated overnight.
Axonal siRNA Transfection
siRNAs were delivered at a final concentration of 50 nM using NeuroPORTER transfection reagent (Genlantis) 24 hours prior to Aβ1-42 treatment, as previously described (Baleriola et al. 2014). siRNA/NeuroPORTER mixture was prepared in serum- and antibiotic-free Neurobasal medium. Two hours post-transfection, axonal compartments were supplemented with an equal volume of Neurobasal medium containing 2×B27 and 4 mM L-glutamine. Stealth RNAi pre-designed siRNAs were used (Thermo Fisher); Creb3/2: 5′-CGAGGGCUAUCCCAUUCCAACCAAA-3′ (RSS324942; SEQ ID NO: 1); Hif1a: 5′-GCUAACAGAUGAUGGUGACAUGAUU-3′ (RSS310066; SEQ ID NO: 2). A control siRNA was similarly purchased from Thermo Fisher (Stealth RNAi siRNA Negative Control Med GC Duplex #3).
Labeling of apoptotic cells was performed in accordance with manufacturer's instructions (DeadEnd Fluorometric TUNEL System, Promega). Cells were fixed in pre-warmed 4% paraformaldehyde, 4% sucrose phosphate-buffered saline (PBS) solution for 20 minutes at room temperature. After washing with PBS, a 3 mg ml−1 bovine serum albumin, 100 mM glycine, 0.25% Triton X-100, PBS-based solution was incubated for 30 minutes at room temperature to permeabilize cells and block non-specific binding. Nuclei were counterstained with DAPI and samples mounted in ProLong Diamond Antifade Mountant (Thermo Fisher). Per replicate/condition, TUNEL-positive nuclei were scored against total cell number in no fewer than 10 fields situated in the vicinity of microgroove barriers.
Neurons grown in microfluidic chambers were fixed for 20 minutes at room temperature with a PBS-based 4% paraformaldehyde, 4% sucrose solution and thoroughly washed with PBS. Permeabilization and blocking was performed with 3 mg ml−1 bovine serum albumin, 100 mM glycine and 0.25% Triton X-100 in PBS. Samples were incubated overnight with a primary antibody against CHOP (1:1,000; #2895, Cell Signaling Technology) diluted in permeabilization/blocking buffer. Following multiple PBS washes, a fluorophore-conjugated Alexa secondary antibody (1:1,000, Thermo Fisher) was applied for 1 hour. Samples were preserved in ProLong Diamond Antifade Mountant reagent (Thermo Fisher) and imaged using an EC Plan-Neofluar 40×/1.3 objective on an Axio-Observer.Z1 microscope equipped with an AxioCam MRm Rev. 3 camera (Zeiss). Image acquisition settings were selected so to avoid pixel saturation using AxioVision software (Zeiss). Acquisition parameters were kept constant between samples in any given experiment. Mean pixel intensity values were computed after background fluorescence subtraction.
For each immunoprecipitation/condition, approximately 15×106 rat cortical neurons obtained from E16 Sprague-Dawley pups were cultured for a week on 0.1 mg ml−1 poly-D-lysine (Millipore Sigma), 2 μg ml−1 laminin (Bio-Techne) pre-coated flasks and maintained in Neurobasal medium supplemented with B27 and L-glutamine; Aβ31-42 oligomers, prepared as described above, were bath-applied 36 hours prior to immunoprecipitation protocol. Protein-DNA cross-links were promoted using formaldehyde at a final concentration of 1% (v/v), and crosslinking reaction allowed to proceed for 10 minutes at room temperature, as per manufacturer's instructions (SimpleChIP Plus Kit [#9005], Cell Signaling Technology). After glycine quenching, cells were washed twice with ice-cold PBS, harvested in protease inhibitor-containing PBS by scrapping, and centrifuged at 2,000 g and 4° C. Chromatin fragments (150-900 base pair-long) were obtained by partial digestion with micrococcal nuclease (MNase) incubated for 11 minutes at 37° C. in a Thermomixer R (Eppendorf) with frequent mix cycles. Nuclear membranes were broken up by three rounds of 20-second pulses on a low setting (15% amplitude) using a Sonic Dismembrator (Model 500, Fisher Scientific) and lysates subsequently clarified by centrifugation. Adequate digestion was confirmed by agarose gel electrophoresis. Per immunoprecipitation/condition, 10 μg of digested, cross-linked chromatin were used and 2% input samples reserved. Antibodies were incubated overnight at 4° C. with end-over-end rotation: anti-CREB3L2 (2 μg; HPA015068, Atlas Antibodies) or, as negative control, rabbit normal serum IgG (#2729). Immunoprecipitates were captured using Protein G magnetic beads (#9006, Cell Signaling Technology) and washed with low- and high-salt buffers. Elution was performed at 65° C. and 1,200 rpm for 30 minutes using a thermomixer. Protein-DNA cross-links were then reversed by treatment with Proteinase K for 2 hours at 65° C., and DNA column-purified. ChIP signals were measured by quantitative PCR with QuantiTect SYBR Green PCR master mixes from Qiagen (Table 1). CREB3L2 enrichment was computed using the percent input method, whereby ChIP signals are normalized to input.
cDNA containing H. sapiens CREB3L2 open reading frame was acquired from Genecopoeia (NCBI Reference sequence: NM_194071; product #EX-H2495-M01) and subcloned into pEGFP-C1 (Clontech). EcoRI and BamHI restriction sites were introduced by PCR with CloneAmp HiFi polymerase (Takara; Table 2) and end products validated by Sanger sequencing. In-fusion cloning was used to mutate the S1P cleavage site (In-Fusion HD EcoDry Cloning Kit, Takara).
TGCTGGAGAGCGGGGAG
C (SEQ ID NO: 29)
AAGTGGTGTTCACTCTT
TGCTGGAGAGCGGGGAG
C (SEQ ID NO: 31)
GCACCACAACCATGAGG
CAG (SEQ ID NO: 32)
GCAAACCTGGCGATCTA
GATCGCCAGGTTTGCGG
Capped, poly(A)-tailed H. sapiens CREB3L2 (GFP-tagged, full-length and cleaved forms) and ATF4 (FLAG-tagged; kind gift from Yihong Ye, Addgene plasmid #26114) transcripts were synthesized from Xbal-linearized pRK5 plasmids using the mMESSAGE mMACHINE SP6 and Poly(A) Tailing kits from Thermo Fisher. RNAs were column-purified in accordance to manufacturer's instructions (RNeasy Mini Kit, Qiagen) and efficient poly(A) tailing evaluated by agarose gel electrophoresis. CREB3L2 and ATF4 translation reactions were incubated separately for 90 minutes at 30° C. following vendor's guidelines (Rabbit Reticulocyte Lysate System, Promega). CREB3L2 and ATF4 protein products were confirmed by immunoblotting during pilot experiments. Upon completion of the translation protocol, lysates (45 μl) containing CREB3L2 and ATF4 were mixed and incubated at 37° C. for 30 minutes with gentle agitation (300 rpm for 5 seconds every minute) before immunoprecipitation, as previously described (Hai and Curran, 1991). Immunoprecipitation was carried out overnight at 4° C. with gentle rotation in PBS saline supplemented with 0.1% NP-40 and protease inhibitors (cOmplete, EDTA-free Protease Inhibitor Cocktail (Roche), using an anti-ATF4 antibody (1:200; #11815, Cell Signaling Technology). Immunoprecipitates were captured with M-280 Sheep Anti-Rabbit IgG Dynabeads (70 μl per immunoprecipitation; Thermo Fisher) pre-blocked with 0.1% BSA, with beads being incubated at 4° C. for 3 hours under rotary agitation. Washing cycles were repeated five times with immunoprecipitation buffer and the supernatant from the first wash put aside (‘flow-through fraction’). Complex elution was performed in 2×Laemmli buffer (130 mM Tris-Cl pH 6.8, 0.1 mM dithiothreitol, 20% (v/v) glycerol and 4% sodium dodecyl sulfate diluted in water) by boiling at 95° C. for 5 minutes. Immunoblot detection of GFP-tagged CREB3L2 in ATF4 immunoprecipitates: anti-GFP (1:2,000; ab290, Abcam), in conjugation with TrueBlot anti-rabbit IgG HRP (1:1,000; Rockland).
Unless otherwise specified, protein extracts were prepared in ice-cold RIPA buffer (150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris [pH 8.0]) and resolved by SDS-PAGE using the NuPAGE electrophoresis system (Thermo Fisher). Both ‘semi-dry’ and ‘wet’ electroblotting methods were employed, depending on protein size. Nitrocellulose membranes (Amersham Protran 0.45 μm NC, GE Healthcare) were blotted using the following primary antibodies: anti-CREB3L2 (1:1000; HPA015068, Atlas Antibodies), anti-ATF4 (1:1,000; #11815, Cell Signaling Technology), anti-ATF4 (1:1,000, WH0000468M1, Millipore Sigma) or anti-ATF4 (ab50546, Abcam, at 1:1,000 [product discontinued], anti-GFP (1:2,000; ab290, Abcam), anti-VPS26 (1:1,000, ab23892, Abcam); anti-VPS29 (1:500; ab98929, Abcam); anti-VPS35 (1:2,500; ab10099, Abcam); anti-SNX1 (1:10,000, ab134126, Abcam); anti-SNX3 (1:500; ab56078, Abcam), anti-Rab7a (1:1,000; #9367, Cell Signaling Technology), anti-EHD1 (1:2,500; ab109311, Abcam), anti-APP (1:20,000; ab32136, Abcam), anti-N-Cadherin (1:1,000; #13116, Cell Signaling Technology), anti-FLAG (1:1,000; F1804, Millipore Sigma), anti-βIII-tubulin (1:10,000-1:20,000, #MA1-118, Thermo Fisher); anti-p-actin (1:10,000; #3700, Cell Signaling Technology) or anti-p-actin (1:10,000; MAB1501, Millipore Sigma); anti-GAPDH (1:10,000; 60004-1-Ig, Proteintech); anti-HDAC1 (ab109411; 1:10,000). Signals were visualized on a KwikQuant Imager (Kindle Biosciences) and quantified using Fiji/ImageJ.
Cells grown in glass bottom dishes (P50G-1.5-30-F, MatTek Corporation) were fixed in pre-warmed 4% paraformaldehyde, 4% sucrose in PBS (pH 7.4) for 20 minutes at room temperature. After repeated wash cycles, microfluidic chambers were carefully removed (as applicable) and 0.25% Triton X-100 saline was added for 10 minutes to permeabilize membranes. Antigen retrieval with steaming 0.01 M sodium citrate (0.05% Tween 20, pH 6.0) was then carried out for 1 minute. Blocking was performed for 1 hour with 5% heat-inactivated goat serum diluted in PBS, and primary antibodies, prepared in blocking solution, incubated overnight at 4° C. (anti-CREB3L2: 1:100; HPA015068, Atlas Antibodies; anti-ATF4 (ab50546, Abcam, at 1:1,000 [product discontinued], or WH0000468M1, Millipore Sigma, at 1:100, or 60035-1-Ig, Proteintech, at 1:100). Proximity ligation assay protocol was performed using Duolink In situ Red Detection reagents (DU092008; Millipore Sigma) as per manufacturer's guidelines. Plus (DU092002) and minus (DU092004) probes were diluted 1:5 in blocking buffer and incubated at 37° C. for 1 hour in an hybridization oven (Hoefer Red Roller II). After the last wash step of the Duolink protocol, neurons were counterstained with Alexa 488-conjugated βIII-tubulin antibody (1:500; #801203, Biolegend) diluted in a water-based 2 mM Tris, 1 mM NaCl solution (pH 7.5) for 1 hour, and preserved in Duolink In situ Mounting Medium with DAPI (DU082040, Millipore Sigma). All incubations were performed in a humidity chamber. Samples were imaged using an Axio-Observer.Z1 microscope (Zeiss) equipped with an AxioCam MRm Rev. 3 camera through an EC Plan-Neofluar 40×/1.3 oil objective; alternatively, a LSM800 confocal microscope (Zeiss) with a Plan Apo 63×/1.4 oil objective was employed for analysis of nuclear interactions. Imaging settings were kept constant between conditions. Signals were counted manually and, when applicable, normalized to axon length.
Hippocampal neurons were cultured in microfluidic chambers until DIV12 and treated with Aβ1-42 as described above. Puromycin (final concentration 1.8 μM; A1113802, Thermo Fisher) was supplemented into axonal media for 10 minutes at the end of the Aβ1-42 stimulation. Puromycin labeling was combined with a proximity ligation assay protocol to detect newly synthesized CREB3L2 and signal specificity controlled for using the protein synthesis inhibitor anisomycin (final concentration: 10 μM; 176880, Thermo Fisher). Primary antibodies were incubated overnight at 4° C.; mouse anti-puromycin antibody (1:250; S9684, Millipore), rabbit anti-CREB3L2 (1:100; ARP34673_T100, Aviva Systems Biology).
Millicell transwell inserts (1 μm pore size; Millipore [MCRP06H48]) were mounted on 6-well plates and both sides of the membrane sequentially coated with 0.1 mg ml−1 poly-D-lysine (Millipore Sigma) and 2 μg ml−1 laminin (Bio-Techne). A mix of E18 rat cortical and hippocampal neurons (800,000 per well) were plated on the bottom side of the insert (flipped up during this part of the protocol), and allowed to settle for 20-30 minutes. Transwell inserts were then carefully placed back in the plates, now reverted to their original orientation. With this set-up, neurites grow upward towards the top side of the membrane, which is more accessible to treatment. Cells were maintained for 10-12 DIV in Neurobasal containing 1×B27 and 2 mM L-glutamine, after the first 24 hours on Neurobasal supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotics (50 U ml−1 penicillin-streptomycin). Following a PBS wash (ice-cold), cell bodies were gently scraped off with a cotton swab and neuritic fractions (comprised of at least two pooled transwells, ca. 200 μg of protein) collected in CHAPS buffer (150 mM KCl, 50 mM HEPES, 0.1% CHAPS, adjusted to pH 7.4, plus protease inhibitors). Co-immunoprecipitations were performed overnight at 4° C. with rotation using antibody-bound M-280 Dynabeads (Thermo Fisher); antibodies: mouse anti-CREB3L2 (1:200; MABE1018, Millipore) or, as negative control, normal mouse IgG serum. Finally, beads were washed five times with PBS, resuspended in 25 μl of Laemmli buffer containing 5% P-mercaptoethanol and boiled before western blot analysis.
Post-mortem human material was obtained through the New York Brain Bank at Columbia University in accordance to institutional guidelines governed by approved protocols. Autopsy cases underwent a uniform neuropathological evaluation (Table 3 and Table 4), including assignment of CERAD (Mirra et al. 1991), Braak (Braak and Braak, 1991; Braak and Braak, 1993), and NIA-Reagan scores (Consensus recommendations for the postmortem diagnosis of Alzheimer's disease, 1997). Cerebral amyloid angiopathy was assessed according to the Vonsattel criteria (Greenberg and Vonsattel, 1997). Frozen dorsolateral prefrontal cortex tissue specimens were derived from Brodmann area (BA) 9/10. Protein extracts were prepared from 30-50 mg of tissue in ice-cold RIPA buffer supplemented with protease and phosphatase inhibitors (cOmplete cocktail tablets, Roche) using a Dounce homogenizer; RIPA buffer volumes were adjusted taking tissue weigh CREB3L2-ATF4 heterodimers were visualized t in consideration (300 μl per ˜5 mg of tissue). Samples were incubated in RIPA buffer for 2 hours at 4° C. under constant rotation. Halfway through this step, a 10-minute ice-cold sonication bath was run to improve tissue lysis (Branson 1510). Extract aliquots (500 μl) were centrifuged for 20 minutes at 12,000 rpm and 4° C., and supernatants mixed with 2×Laemmli buffer. Extracts were then denatured at 95° C. for 5 minutes before western blot analysis.
LOAD mRNA expression measurements and significance P-values were obtained from publicly available datasets (E-GEOD-44770 [ArrayExpress identifier]; GSE95587 [GEO] and GSE15222 [GEO]) (Zhang et al. 2013; Webster et al. 2009; Friedman et al, 2018). Developmental and aging transcriptome profiles were retrieved from BrainSpan and the Aging, Dementia and Traumatic Brain Injury atlases (Miller et al. 2017; Miller et al. 2014). Heatmaps were generated using Plotly Chart Studio.
Paraffin-embedded sections (5-μm-thick) were obtained from LOAD dorsolateral prefrontal cortex through the New York Brain Bank at Columbia University. Before deparaffinization with xylene, slides were placed in a 60° C. oven for 1 hour; we proceeded by rehydrating slides using a graded ethanol series (100%>95%>70%>50%>water), plus two 10-minute PBS-T (0.1% Tween 20) washes. Epitope unmasking was done for 20 minutes in steaming 0.01 M sodium citrate buffer (0.05% Tween 20, pH 6.0), followed by three 5-minute PBS-T rinses. For blocking, a PBS-based 10% heat-inactivated goat serum (v/v), 1% BSA (w/v), 0.1% Triton X-100 (v/v), 0.1% sodium azide (w/v) solution was applied for at least 1 hour. Primary antibodies were incubated overnight at 4° C.: anti-MAP2 (1:2,000; ab5392, Abcam), anti-GFAP (1:250; ab10062, Abcam), anti-IBA1 (1:1,000; ab5076, Abcam); antibodies were prepared in PBS supplemented with 1% BSA (w/v), 0.1% Triton X-100 (v/v), 0.1% sodium azide (w/v) (henceforth termed ‘antibody diluent’). MAP2, GFAP or IBA1 detection utilized alkaline phosphatase-conjugated secondary antibodies (incubated for 2 hours at room temperature) coupled with Vector Blue substrate precipitation (SK-5300, Vector Laboratories); Vector blue substrate working solution was prepared in 150 mM Tris-Cl buffer (pH 8.2) supplemented with levamisole (SP-5000, Vector Laboratories), as per manufacturer's instructions. We subsequently quenched endogenous peroxidases slides with 1% hydrogen peroxide for 30 minutes and continued by staining for CREB3L2 (1:100 dilution, overnight at 4° C.; HPA015068, Atlas Antibodies). For visualization, slides were incubated with a biotinylated secondary antibody for at least 1 hour at room temperature; next, we made use of the Vectastain ABC system (PK-6101, Vector Laboratories) to increase detection sensitivity, and finally developed signals employing the Vector NovaRED substrate kit (SK-4800, Vector Laboratories), all in accordance with manufacturer's guidelines. Sections were dehydrated with ethanol (50%>70%>95%>100%), cleared with Histo-Clear (64110-01, Electron Microscopy Sciences), and mounted in Vectamount (H-5000, Vector Laboratories). Slides were imaged on an Axioplan 2 microscope equipped with an AxioCam HRc and Plan-Apochromat 20×/0.75 objective (Zeiss); panoramas were created in Photoshop CSS (Adobe) from multiple, overlapping fields.
Protein A magnetic beads (#S1425S, New England Biolabs) were washed in PBS containing 0.1% BSA and incubated at 4° C. for 1 hour with rotation. Following two rinses with PBS, beads were resuspended in lysis buffer, mixed for 4 hours with anti-CREB3L2 antibody (1 μg per immunoprecipitation; HPA015068, Atlas Antibodies), and washed three times with lysis buffer. At this point, we proceeded by covalently cross-linking the immobilized anti-CREB3L2 antibody to Protein A beads using bis(sulfosuccinimidyl)suberate (BS3; #21586, Thermo Fisher) following manufacturer's guidelines.
Dorsolateral prefrontal cortex tissue (approximately 20-30 mg) was processed in ice-cold lysis buffer (20 mM Tris-Cl pH 8, 137 mM NaCl, 1% Nonidet P-40 (NP-40), 2 mM EDTA, supplemented with protease and phosphatase inhibitors [cOmplete cocktail tablets, Roche]; sample volumes were weight-adjusted in a sample-by-sample manner using a Dounce homogenizer; tissue extracts were then incubated for 2 hours at 4° C. with end-over-end rotation. During this incubation, a 10-minute bath sonication step was performed to improve extraction efficiency. After centrifugation at 12,000 rpm and 4° C., pellets were discarded and supernatants transferred to new tubes. Equal amounts of antibody-bead conjugates were mixed with lysates overnight at 4° C. with constant rotation, and washed a total of four times with ice-cold PBS containing 0.1% NP-40 and protease inhibitors (cOmplete cocktail, Roche); the supernatant resulting from the first wash step was saved for further analysis (‘flow-through’ fraction). CREB3L2 immunoprecipitates were eluted in 50 μl of 0.2 M glycine buffer (pH 2.5) allowed to react for 5 minutes at 4° C. with rotation after a short vortexing step. Eluates were transferred to a new tube, and the elution protocol repeated. Pooled eluates were neutralized by the addition of 20 μl of 1 M Tris-Cl (pH 9.0), and Laemmli buffer-treated sampled heated at 80° C. for 5 minutes. ATF4 signals were visualized using anti-ATF4 serum (sc390063, Santa Cruz Biotechnology) and a light chain-specific monoclonal secondary antibody (211-032-171, Jackson ImmunoResearch).
Autopsy cases #4856 and #5450 (Tables 3 and 4), both females with moderate LOAD pathology were chosen for ChIP-seq analysis based on: 1) high CREB3L2 and ATF4 expression level, 2) CREB3L2-ATF4 complex accumulation, and 3) reduced postmortem processing intervals. Frozen minced brain tissue (approximately 150 mg per immunoprecipitation and a total of 300 mg per case) was transferred to a conical tube containing 6 ml of PBS supplemented with protease inhibitors (PBS+PI), and protein-DNA cross-linking allowed to develop for 20 minutes at room temperature using formaldehyde at a final concentration of 1.5% (v/v). Cross-linking reaction was then quenched with glycine (5 minutes at room temperature), as per manufacturer's instructions (SimpleChIP Plus Kit [#9005], Cell Signaling Technology). After rinsing in ice-cold PBS+PI, further proceeded by disaggregating tissue using an ice-cold Dounce homogenizer (7 ml total capacity) until a single-cell suspension was obtained. A 2,000 g and 4° C. centrifugation step followed, and supernatants discarded. Chromatin fragments (mainly 1-3 nucleosomes in size) were obtained by partial digestion with micrococcal nuclease (MNase; 2 μl in 500 μl) incubated for 13 minutes at 37° C. in a Thermomixer R (Eppendorf) programmed for frequent mix cycles. Nuclear membranes were broken up by three rounds of 20-second, 15% amplitude pulses using a Sonic Dismembrator Model 500 (Fisher Scientific), and lysates subsequently clarified by centrifugation. Adequate digestion was confirmed by agarose gel electrophoresis. Approximately 6 μg of chromatin, diluted in 400 μl of ChIP buffer, was used per immunoprecipitation; CREB3L2-bound DNA was immunoprecipitated by overnight incubation at 4° C. with anti-CREB3L2 serum (2 μg; HPA015068, Atlas Antibodies). Immunoprecipitates were captured using Protein G magnetic beads, and washed with low- and high-salt buffers, as directed. Elution was performed at 65° C. and 1,200 rpm for 30 minutes using a thermomixer, protein-DNA cross-links reversed by treatment with Proteinase K for 2 hours at 65° C., and DNA purification achieved by using a column-based system.
ChIP-seq library preparation and sequencing reactions were conducted at GENEWIZ, Inc. (South Plainfield, NJ, USA). ChIP samples were quantified using Qubit 2.0 Fluorometer (Life Technologies) and the DNA integrity checked with 4200 TapeStation (Agilent Technologies). NEB NextUltra DNA Library Preparation kit was used following the manufacturer's recommendations (Illumina, San Diego, CA, USA). Briefly, the ChIP DNA was end repaired and adapters were ligated after adenylation of the 3′ ends. Adapter-ligated DNA was size selected, followed by clean up, and limited cycle PCR enrichment. The ChIP library was validated using Agilent TapeStation and quantified using Qubit 2.0 Fluorometer as well as real time PCR. During library preparation, immunoprecipitated samples were normalized to input DNA, i.e., chromatin cross-linked and fragmented side by side with immunoprecipitated DNA using the same conditions. The sequencing libraries were multiplexed and clustered on one lane of a flowcell. After clustering, the flowcell was loaded on the Illumina HiSeq instrument according to manufacturer's instructions. Sequencing was performed using a 2×150 Paired End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina's bcl2fastq v2.17 software. One mismatch was allowed for index sequence identification.
ChIP-seq sequencing data were processed and analyzed within the Galaxy web platform (Afgan et al. 2018), using the public server at usegalaxy.org. First, FastQC was run to evaluate overall sequencing quality (unique reads >90%). Second, library adapters and low-quality reads were removed using Trimmomatic v0.36. Third, reads were mapped to the hg38 reference genome with Bowtie v0.12.7, and non-uniquely mapped reads filtered out. Forth, unmapped and low quality (MAPQ <20) reads were excluded with samtools v1.2. Fifth, peak calling was performed with MACS2 v2.1.1 with minimum false discovery rate (FDR) cutoff for peak detection fixed at 0.05, lower and upper mfold bounds defined as 5 and 50, respectively, and extension size set at 144. Finally, peaks were exported to the UCSC genome browser for visualization after conversion to bigwig format. CREB3L2 gene ontology (GO) term enrichment was analyzed using ClueGO v2.5.4 within the Cytoscape platform (v3.6.1) (Shannon et al. 2003; Bindea et al. 2009). Protein interaction network was constructed using the STRING v10.5 database (Lassot et al. 2001), and results subsequently exported into Cytoscape.
C-terminal FRB (T82L mutant) or FKBP (wild-type) fusions, N-terminally tagged with HA or V5 epitopes were synthesized by Genewiz and transferred into pGL4.20[/uc2/Puro] (Promega) using SacI and FseI sites. Human CREB3L2 (residues 2-384, corresponding to its transcriptionally active form) and ATF4 (S219A stabilization mutant (McLean et al. 2010)) were utilized in transgene design; control Renilla luciferase sequence was obtained from pGL4.75 (Promega). Successful insertions were screened by Sanger sequencing. A/C heterodimerizer (C-16-(S)-7-methylindolerapamycin [Aβ21967]) was purchased from Takara.
HEK293T cells (#CRL-3216), plated in 150 mm dishes (CLS430599, Corning), were maintained in DMEM supplemented with 10% fetal bovine serum plus antibiotics (50 U ml−1 penicillin-streptomycin), and transfected using Lipofectamine 3000 (Thermo Fisher). Amounts of DNA delivery were optimized to achieve comparable expression levels between the different homodimer and heterodimer configurations (ATF4 transgenes: 18.35 μg; CREB3L2 transgenes: 4.5 μg; luciferase transgenes: 2.3 μg), as ATF4 and CREB3L2 have significantly different half-lives. While lipofectamine complexes were incubating, we performed a complete media change, which now included the A/C heterodimerizer at 500 nM.
Twenty-four hours post-transfection, we proceeded by crosslinking protein-DNA contacts with 1% (v/v) formaldehyde (#28908, Thermo Fisher) for 10 minutes at room temperature. After quenching cross-linking reaction with glycine, cells were washed twice with ice-cold PBS, harvested by scrapping in PBS with protease inhibitors, and centrifuged at 2,000 g and 4° C., as per manufacturer's instructions (SimpleChIP Plus Kit [#9005], Cell Signaling Technology). Chromatin fragments (mainly 1-3 nucleosomes in size) were obtained by incubation with micrococcal nuclease (3.5 μl [equivalent to 7,000 gel units] in 200 μl; M0247S, NEB) for 45 minutes in a 37° C.-water bath. Nuclear membranes were subsequently broken up by three rounds of 20-second, 15% amplitude pulses using a Sonic Dismembrator Model 500 (Fisher Scientific), and lysates clarified by centrifugation. Adequate digestion was assessed by agarose gel electrophoresis. For each condition, digested chromatin was split into two tubes and immunoprecipitated overnight at 4° C. with end-over-end rotation using pre-washed magnetic beads conjugated with anti-HA- or anti-V5 antibodies (anti-HA beads: P188836, Thermo Fisher; anti-V5 beads: NC0777490, MBL International); 35 μl of anti-HA beads and 25 μl of anti-V5 beads were utilized per immunoprecipitation. Beads were captured on a magnetic stand and washed with low- and high-salt buffers, as directed. Elution was performed at 65° C. and 1,200 rpm for 30 minutes using a thermomixer, protein-DNA cross-links reversed by treatment with Proteinase K for 2 hours at 65° C., and DNA column-purified. A representative 2% input sample was prepared by combining chromatin from the different backgrounds.
ChIP-seq library preparation and sequencing reactions were conducted at GENEWIZ, Inc., as described above. A total of 24 samples were submitted for analysis, comprising parallel HA and V5 immunoprecipitations, from 2 independent replicates, and sequencing libraries multiplexed and clustered on two lanes of a flowcell. Sequencing was performed using a 2×150 Paired End (PE) configuration.
As above, ChIP-seq sequencing data were processed and analyzed within the Galaxy web platform (Afgan et al. 2018). First, library adapters and low quality reads were removed using Trim Galore (version 0.6.3) with the following settings: phred quality score threshold=20, overlap with adapter sequence required to trim a sequence=2, maximum allowed error rate=0.1. Also during this step, reads shorter than 36 bp were discarded. Second, reads were mapped to the hg38 reference genome with Bowtie 2 v2.3.4.1. Third, unmapped and low quality (MAPQ <20) reads were excluded with samtools v1.8. Forth, files were converted to bigWig format using bamCoverage v3.3.0 and signals visualized in UCSC genome browser. Fifth, after running MACS predicted function, peak calling was performed with MACS2 v2.1.1.2 with minimum false discovery rate (FDR) cutoff for peak detection fixed at 0.01 and luciferase homodimers defined as controls. Sixth, MACS2 output was filtered to exclude peaks with fold enrichments lower than 5. Seventh, differential binding analysis was performed on pooled replicated samples using DiffBind package v2.10.0 with FDR threshold set at 0.01. Eighth, genomic context was analyzed using ChIPseeker v1.18.0 against GENCODE v32/GRCh38 genome assembly (September 2019 release) and gene annotations assigned by GREAT v4.0.4 (McLean et al. 2010); cut off for promoter regions was defined as ±3 kb from a transcription start site. HA and V5-ChIP-seq signal overlap assessment employed the bedtools WindowBed function (v2.29.0). GO analysis was performed using the Gene Ontology Consortium database (geneontology.org) (The Gene Ontology, C. The Gene Ontology Resource: 20 years and still Going strong, 2019; Ashburner et al. 2000). The MEME suite was employed for motif discovery (Bailey et al. 2009; Machanick and Bailey, 2011).
VPS26B, VPS29, VPS35, SNX1, SNX3, RAB7A, EHD1, CHOP, SEC24A and PTBP1 promoter/enhancer regions were amplified from human genomic DNA (G3041, Promega) by PCR (Table 5) and inserted into pGL4.20[/uc2/Puro] using XhoI- and HindIII- or Sac- and XhoI-flanked products. This was achieved by first amplifying the genomic region of interest by PCR, followed by a second, ‘nested’ reaction to introduce restriction sites. Primer design was guided by ChIPmera and CREB3L2 ChIP-seq signals. Successful insertions were screened by Sanger sequencing. Human CHOP enhancer/promoter region (−647 to +91), originally derived from Addgene plasmid #36035 (Oh et al. 2012), was transferred into pGL4.20[/uc2/Puro] (E6751, Promega) using the BgIII and HindIII sites. Luciferase reporter constructs (300 ng) were delivered by transient transfection to HEK293T cells (#CRL-3216, ATCC; grown in 6-well plates) together with specific CREB3L2/ATF4 dimer configurations (achieved by chemically induced proximity; ATF4 transgenes: 1,000 ng; CREB3L2 transgenes: 250 ng; luciferase transgenes: 125 ng), and luminescence measured 24 hours later using ONE-Glo Luciferase Assay System (E6110, Promega). Just before the addition of lipofectamine complexes, new media was added with A/C heterodimerizer at 500 nM. Lysis proceeded at room temperature on an orbital shaker for 5 minutes, as instructed by the manufacturer, and duplicate 200 μl fractions transferred to a white polystyrene 96-well plate. Luminescence signals were measured at room temperature on an Infinite M200 instrument (Tecan) and normalized to cell number, measured independently (RealTime-Glo MT Cell Viability Assay, G9711, Promega).
Raw sequencing files were downloaded from the ENCODE portal (Dunham et al. 2012; Davis et al. 2018) (https://www.encodeproject.org/) with the following identifiers: ENCFF081 USS, ENCFF069VNL, ENCFF565KLI, ENCFF6821GK, belonging to two ATF4 ChIP-seq technical replicates. Control ChIP-seq files were: ENCFF002EFF, ENCFF002EFH, ENCFF002EFD, and ENCFF002EFA, similarly from two independent replicates. As above, ChIP-seq sequencing data were processed and analyzed within the Galaxy web platform (Afgan et al. 2018). First, library adapters and low quality reads were removed using Trimmomatic v0.36.6. Also during this step, reads shorter than 36 bp were discarded. Second, reads were mapped to the hg38 reference genome with Bowtie v1.1.2, and non-uniquely mapped reads filtered out. Third, unmapped and low quality (MAPQ <20) reads were excluded with samtools v1.8. Forth, files were converted to bam format using Galaxy's SAM-to-BAM converter v 2.1.1. Fifth, peak calling was performed with MACS2 v2.1.1 with minimum false discovery rate (FDR) cutoff for peak detection fixed at 0.005, lower and upper mfold bounds defined as 10 and 50, respectively. Sixth, MACS2 output was filtered to exclude peaks with fold enrichments lower than 5. Seventh, overlapping peaks (minimum 50 bp) between ATF4 ChIP-seq replicates were identified using Operate on Genomic Intervals' Join tool, v1.0.0. Eighth, we downloaded ENCODE's replicate consistency irreproducible discovery rate (IDR) analysis file, ENCFF6821GK, and crosschecked this to the filtered MACS2 output to produce a high confidence peak file. Ninth, genomic context (GENCODE v21/GRCh38 genome assembly, October 2014 release) was analyzed using ChIPseeker v1.18. Finally, a GO term enrichment study was performed using the Gene Ontology Consortium database (geneontology.org) (The Gene Ontology, C. The Gene Ontology Resource: 20 years and still Going strong, 2019; Ashburner et al. 2000). Analysis by cellular component revealed the endosome to be among the most enriched GO terms; this endosome-associated gene set was analyzed a second time to obtain a more detailed GO categorization.
shRNA Preparation and Delivery
shERWOOD-UltramiR shRNAs targeting R. norvegicus Creb3/2 (TLRSU1400-362339) and Atf4 (TLRSU1400-79255) mRNAs were acquired from transOMIC Technologies. For expression in primary neuronal cells, the original CMV promoter was substituted with that of human ubiquitin C gene (UBC) using the ClaI and AgeI sites. shRNA lentiviral particles were produced in HEK293T cells and titers measured with qPCR Lentivirus Titration Kit (Applied Biological Materials). Briefly, envelope, packaging and shRNA-carrying lentiviral vectors (3:7:10 ratio) were delivered using Lipofectamine 3000; 6 hours post-transfection, medium was changed to Neurobasal containing B27 and L-glutamine. Viral supernatant was collected after 36 hours, passed through a 0.45 μm PES filter, aliquoted, and stored at −80° C. Viral particles were added to neuronal cultures at a multiplicity of infection of 16.
At the time of collection, cells were washed with ice-cold Hank's Balanced Salt Solution (HBSS; Thermo Fischer) and lysed with TRIzol reagent (#15596026, Thermo Fisher) by scrapping. The reaction was allowed to proceed on ice for 5 minutes, at which point samples were centrifuged at 12,000 g and 4° C. and supernatants transferred to new tubes before a 1:1 (v/v) dilution with molecular biology-grade 100% ethanol (Millipore Sigma). The RNA extraction protocol was continued using the Direct-zol RNA MicroPrep kit (Zymo Research), in accordance to manufacturer's instructions, and included an on-column DNA digestion step with DNase I. RNA was typically eluted in 50 μl of water. Real-time quantification of target RNA species was performed in triplicate on a StepOnePlus Real-Time qPCR system using the Luna Universal One-Step RT-qPCR kit (New England Biolabs); reverse transcription and PCR amplification were primed with TaqMan hydrolysis probes (Table 6; Thermo Fisher). The ΔΔCt method was employed for obtaining relative gene expression data points; reference gene stability across conditions was tested in preliminary experiments using the geNorm module in qbase+ (Biogazelle).
Axonal or somatic total RNA was similarly isolated by TRizol extraction coupled with Direct-zol RNA MicroPrep kit purification from 25 microfluidic chambers per condition, reverse transcribed (SuperScript III, Thermo Fisher), and cDNA preamplified for 20 cycles using the TaqMan PreAmp Master Mix kit (Thermo Fisher), according to manufacturer's instructions. Real-time PCR quantification was performed on a StepOnePlus system using the TaqMan Gene Expression Master Mix. Serial dilution calibration curves were calculated to assess overall sample quality and amplification efficiency. Ct values were interpolated from these curves and expression levels normalized to input RNA.
Rat cortical neurons were cultured in 6-well plates (650,000 cells/well) as described above and transduced with control or Creb3/2 shRNAs using lentiviral particles at DIV4. On DIV8, cells were quickly washed twice with ice-cold PBS and incubated with biotinylation reagent for 30 minutes at 4° C. on an orbital shaker, according to manufacturer's instructions (Pierce Cell Surface Protein Isolation Kit, Thermo Fisher) with volume adjustments. At this point, biotinylation reaction was quenched and cells gently scrapped into solution. Per condition/replicate, ca. 2×106 neurons were pooled from three wells, and centrifuged at 500 g and 4° C. Labeling and quenching reactions were performed inside an environmental cold room maintained at 4° C. Pelleted cells were resuspended in lysis buffer supplemented with protease inhibitors, subjected to five 1-second pulses (10% amplitude) using a Sonic Dismembrator Model 500 (Thermo Scientific), and incubated on ice for 30 minutes. Cell lysates were then centrifuged at 10,000 g for 2 minutes and applied to NeutrAvidin agarose columns for 60 minutes a room temperature with end-over-end mixing. Before washing, column flow-throughs (i.e., the non-bound, internal fractions) were collected and saved for further analysis. Finally, columns were incubated for 60 minutes with end-over-end mixing in 200 μl of 2×Laemmli buffer, centrifuged at 1000 g for 2 minutes, and eluates denatured at 80° C. for 5 minutes. Surface and cytoplasmic fractions were probed by western blot.
Rat cortical neurons were cultured in 6-well plates (650,000 cells/well, in 2 ml of culture medium) as described above and transduced with control or Creb3/2 shRNAs using lentiviral particles at DIV4. On the day of infection, a medium change (half volume) was done, and shRNA-treated cells incubated for an additional 4 days before supernatant collection. At this point, culture supernatants were transferred to 15-ml falcon tubes, spun at 2000 g and 4° C. for 5 minutes, aliquoted, and stored at −80° C. A 96-well sandwich immunoassay (V-PLEX Aβ Peptide Panel 1 kit, #4G8, Meso Scale Discovery) was employed in the measurement of β-amyloid species. Manufacturer's guidelines were followed thoroughly during plate preparation, and samples diluted 1:1 with Diluent 35 (provided as part of the kit) to avoid matrix saturation. All biological replicates (n=7) were measured in parallel. Signal readings were performed on a Sector Imager 2400 instrument (Meso Scale Discovery). For assessing sAPPα levels in culture supernatants, we utilized a sandwich ELISA assay (sAPPα [Mouse/Rat] [highly sensitive], #27419, Immuno-Biological Laboratories).
Each experiment was repeated at least three times unless otherwise indicated. Details of biological replication and statistical analysis are indicated in figure legends or main text. Data were analyzed with Prism (GraphPad). For all tests, a significance level (a) of 0.05 was used.
Neurodegenerative insults and peripheral injury can be communicated from axons to the neuronal soma via TFs (Baleriola et al.; Ben-Yaakov et al.; Ying et al.). For example, neurodegeneration in response to axonally sensed oligomeric Aβ1-42 requires the local production and retrograde transport of the TF ATF4 followed by the ATF4-dependent expression of the proapoptotic TF CHOP (Baleriola et al., 2014). Curiously, ATF4 is constitutively expressed in neurons, including axons (Shigeoka et al., 2016), and regulates synaptic plasticity and memory formation (Chen et al., 2003; Pasini et al., 2015). Why is ATF4 different in the context of β-amyloid pathology? A potential solution for this conundrum might be that Aβ1-42-dependent local synthesis of ATF4 allows the formation of specific TF complexes through the coordinated production of dimerization partners of ATF4. To identify such potential ATF4-binding partners, we delivered siRNAs specifically to axons of hippocampal neurons cultured in microfluidic chambers (
Co-immunoprecipitation experiments with in vitro translated and overexpressed proteins revealed that CREB3L2 and ATF4 can heterodimerize (
Creb3/2 and Atf4 mRNAs are recruited into axons following exposure to Aβ1-42 (
CREB3L2 is produced as a transcriptionally inactive ER-bound TF precursor that can only translocate to the nucleus after being proteolytically processed (
To determine the disease relevance of these findings, we first examined CREB3L2 and ATF4 expression levels in the dorsolateral prefrontal cortex (PFC) of non-demented control and LOAD subjects with mild or moderate pathology. Protein levels for both TFs, as measured by western blot, were significantly increased in LOAD cases, and positively correlated with each other (
LOAD is characterized by transcriptional alterations in specific groups of co-expressed genes, pointing to deregulated or adaptive network regulators as important drivers of pathology (Mathys et al., 2019; Mostafavi et al., 2018; Zhang et al., 2013). As an upregulated LOAD TF complex, CREB3L2-ATF4 could play a role in promoting these changes during disease progression, which prompted us to investigate its specific transcriptional program. While significant developments have been described recently, current methods are not tailored to identifying binding sites of specific TF dimers on a genome-wide scale in vivo (Hass et al., 2015; Isakova et al., 2017; Jolma et al., 2015). With this in mind, we developed a novel approach to analyze genome-wide patterns of DNA-binding of specific TF dimers in a cellular context. Specifically, we tagged CREB3L2 and ATF4 with FK-binding domains and made use of chemically induced proximity to promote the formation of specific homo- or heterodimers (Stanton et al., 2018). Our design further included HA or V5 epitopes to enable the immunoprecipitation of each component of the dimer and identification of genomic binding sites by ChIP-sequencing (ChIP-seq) (
ChIPmera analysis revealed that CREB3L2-ATF4 heterodimer-bound sequences were enriched in either CREB3L2 or ATF4 recognition sites (
Gene ontology (GO) terms for CREB3L2-ATF4 included a combination of biological functions individually associated with CREB3L2 or ATF4 (
To obtain further insight into the pathological function of CREB3L2-ATF4 complexes, we next used ChIP-seq to study these TFs in the LOAD brain. Two disease cases (both females, with moderate pathology, aged +89 years) were chosen for analysis on the basis of high PFC CREB3L2 and ATF4 expression in addition to reduced post-mortem processing intervals. ChIP-seq on human postmortem tissue has not been widely reported, probably due to inherent technical challenges associated with biobanked material. Still, we were able to resolve 228 genomic sites enriched in CREB3L2 from one LOAD brain, assignable to a set of 179 non-random, highly interconnected protein-coding genes (P=1.22×10−7;
Next, we asked whether CREB3L2 targets showed expression changes in LOAD PFC and found 25 genes with highly significant deregulation profiles (P<1×10−20;
Differently, our efforts to immunoprecipitate ATF4-bound chromatin from LOAD postmortem tissue were inconclusive, presumably for issues related to antibody-matrix incompatibility. Instead, we examined an ENCODE Consortium ATF4 ChIP-seq from human K562 cells and found that retromer and other endosome-related gene ontology terms were also significantly enriched in this dataset (
Analysis of ChIPmera signals in the vicinity of retromer-associated genes further clarified the role of CREB3L2 and ATF4 in their regulation. CREB3L2 homodimers spanned elements of the cargo-selective, tubulation and membrane-recruiting modules (
While it is increasingly clear that retromer dysfunction contributes to the progression of AD, the molecular mechanisms underlying its impairment are currently not understood. Our finding that the CREB3L2-ATF4 heterodimer targets a number of retromer-associated genes suggests that it might function as a master regulator driving AD pathology via transcriptional misregulation. To explore this, we analyzed the LOAD PFC transcriptome for potential correlations between retromer, CREB3L2 and ATF4 (Zhang et al., 2013). We discovered that retromer deregulation in LOAD is much more extensive than previously recognized (
The finding that in LOAD brain CREB3L2 upregulation correlates with expression changes of several retromer-associated genes suggested a link between CREB3L2 and pathological retromer deregulation. Knowing the CREB3L2-ATF4 complex to transcriptionally target a number of retromer subunits, we considered whether this association interfered with retromer gene regulation. To test this, we compared the activation responses of firefly luciferase reporters of retromer expression between homodimer or heterodimer backgrounds using chemically induced proximity to drive specific CREB3L2/ATF4 dimer configurations in HEK293 cells. Despite their widespread enrichment over retromer gene loci, these analyses revealed that CREB3L2 homodimers were generally weak activators of retromer reporter responses (averaging 1.7-fold increments over baseline;
A primary role of retromer is centered on retrieving newly endocytosed integral cell surface proteins from degradation in the lysosome by directing cargoes back to the plasma membrane (Cullen and Steinberg, 2018). Among these, APP recycling is particularly relevant during AD pathogenesis, as its missorting and dwell time in the endosome downstream of retromer dysfunction potentiates the generation of neurotoxic β-amyloid. CREB3L2 and ATF4 might thus be important in maintaining APP homeostasis through their transcriptional regulation of retromer genes. Here, however, we focused exclusively on CREB3L2, as ATF4 was found to interfere with normal APP mRNA expression levels in neuronal cells (
Transcriptional changes are widespread in disease and directly linked to the appearance and maintenance of pathological phenotypes (Lee and Young, 2013). Identifying the transcriptional cues responsible for gene network deregulation is thus crucial for a deeper understanding of disease mechanisms and potentially the identification of novel therapeutic targets. Our finding that CREB3L2 and ATF4 form a pathologically relevant complex underscores the importance of considering TF combinatorial relationships in order to understand gene expression and disease etiology. As TF dimerization and other higher-order associations are widespread for many TF families (Amoutzias et al., 2008), but remain largely unmapped (Lambert et al., 2018b), it is expected that significant biological insights can be gained from future investigations of TF interactions in normal and disease states. Here, ChIPmera, a novel methodology we introduced to interrogate specific TF combinations on their association with the genome, could prove particularly useful, especially when coupled with improved strategies for systematic protein-protein interaction scrutiny on a cellular level.
TF dimerization is recognized as a way of cells generating variability in DNA-binding profiles and hence differential gene regulation programs (Reiter et al., 2017). Akin to this, the CREB3L2-ATF4 heterodimer forms a gain-of-function relationship, whereby ATF4 acquires a large number of new genomic targets from CREB3L2, and the latter benefits from the stronger transcriptional output of ATF4. Importantly, CREB3L2-ATF4 signaling can be initiated in the neuronal periphery in response to local amyloid insults via the coordinated synthesis of CREB3L2 and ATF4, acting as a long-range sensor of neurodegenerative stimuli. This is consistent with the increasingly recognized role of neuronal projections as conduits of AD pathology (Baleriola et al., 2014; Liu et al., 2008; Pascoal et al., 2019). CREB3L2-ATF4 complex formation might thus be promoted as a way of encoding the source and nature of the input, similarly to NPAS4 heterodimers and their stimulus-specific induction by different patterns of neuronal activity (Brigidi et al., 2019).
The logic behind the CREB3L2-ATF4 heterodimer can also be understood from the combined CREB3L2 and ATF4 transcriptional programs. For example, both TFs are ER stress transducers (Hetz and Papa, 2018; Kondo et al., 2007), but regulate different branches of the unfolded protein response: CREB3L2 impacts primarily genes of the IRE1 pathway, while ATF4 controls elements of the PERK and ATF6 arms. As a complex, the CREB3L2-ATF4 heterodimer integrates components of all three branches of the UPR, making for a master regulator of cellular proteostasis. It is noteworthy that the retromer protects against accumulation of misfolded proteins and is essential to mitigate UPR activation (Dhungel et al., 2015), a biochemical feature of AD and other neurodegenerative disorders (Hetz and Saxena, 2017). In this sense, retromer deregulation might be a side effect of the heighted response to stress enforced by CREB3L2-ATF4 upregulation. Moreover, by impairing retromer function, Aβ1-42-initiated CREB3L2-ATF4 signaling can contribute over time to aggravate neuronal amyloid load, in a feed-forward mechanism of disease.
Finally, the notion that specific TF interactions can perturb homeostatic balances presents in itself a unique therapeutic opportunity—while directly silencing a transcription factor is likely to impact the entirety of its regulatory program, preventing specific associations holds promise of fewer undesired consequences. Precise interference with TF dimerization has already been achieved using dominant-negative peptide inhibitors and small non-peptide molecules (Gerdes et al., 2006; Lambert et al., 2018a), indicating that the targeted modulation of TF interactions could emerge as an amenable therapeutic strategy.
Neurodegenerative disorders, including Alzheimer's disease (AD), are characterized by pathological gene expression misregulation, but the upstream mechanisms triggering these changes remain largely unknown. Many transcription factors (TF) function as obligate dimers and the transcriptional effects of a given TF can be modulated by its choice of binding partner. Currently, it remains unexplored whether and how differential TF dimerization contributes to disease pathogenesis. We report that the bZIP TFs CREB3L2 and ATF4 heterodimerize specifically in AD brain and neurons exposed to β-amyloid in a local translation-dependent manner. Using ChIP-seq, human AD brain expression studies, and RNA-seq analyses of neurons with chemically induced CREB3L2-ATF4 signaling, we define the transcriptome-wide changes caused by this disease-linked TF heterodimer. Among other relevant AD pathways, CREB3L2-ATF4 disrupts the expression profile of the retromer, an endosomal sorting complex whose impairment is associated with disease progression. While CREB3L2 is itself a physiological regulator of retromer gene expression in neurons, its β-amyloid-induced dimerization with ATF4 leads to a partial loss-of-function that recapitulates the transcriptional signature of the retromer in AD and overall promotes characteristic disease phenotypes. Together, our findings show that differential TF heterodimerization can encode disease stimuli and elicit pathogenic gene expression changes in neurons.
Late-onset Alzheimer's disease (AD) is a devastating neurodegenerative disorder with a complex biological presentation (Long and Holtzman, 2019). Recent genomic studies have, however, put a spotlight on endosomal trafficking, the innate immune response, and cholesterol metabolism for their pivotal role in pathogenesis. This view is also supported by expression analyses of the AD brain, directly implicating the transcriptional misregulation of these pathways in AD pathophysiology. Clarifying how these changes are orchestrated is therefore key to a mechanistic understanding of the condition. While some ‘hub’ transcriptional regulators have already been identified, a coherent model is unlikely to emerge without accounting for the collaborative nature of transcriptional control processes. These include prominently context-dependent transcription factor (TF) interactions in the form of homo- and heterodimers, each with potentially unique regulatory responses (Amoutzias et al. 2008; Lambert et al. 2018).
Within the endosomal system, evidence points to a malfunctioning retromer, a multimodule protein complex that coordinates cargo-sorting events, as a driver of AD (Small and Petsko, 2015; Nixon, 2017; Cullen and Steinberg, 2018; Simoes et al. 2020). Retromer's role in pathogenesis was first suggested by the finding that two of its core cargo-selection subunits, VPS26 and VPS35, are deficiently expressed in the brain of affected individuals (Small et al. 2005). Since then, genetic and functional studies have confirmed that retromer-mediated endosomal recycling is disrupted in AD and other neurodegenerative disorders (Small and Petsko, 2015). Significantly, the trafficking and processing of amyloid precursor protein (APP) are altered by retromer impairment in neurons, while recent observations have additionally established links to the development of tau pathology. Still, despite much progress in understanding the consequences of retromer dysfunction, it remains unknown why retromer misregulation occurs in AD in the first place.
Here, we report the identification and characterization of a pathological TF heterodimer, CREB3L2-ATF4, associated with late-onset AD. We discovered that heterodimer formation is triggered by β-amyloid and confirmed its enrichment in the brain of AD patients. To dissect its role in disease, we developed a new chemogenetic methodology, ChIPmera, which resolves the DNA-binding profile of dimeric TFs in their cellular context. We found that the retromer machinery is a transcriptional target of CREB3L2-ATF4 and uncovered a mechanistic link between heterodimer appearance in AD and disrupted retromer gene expression.
We have previously reported that in the AD brain, exposure of axons to oligomeric Aβ42 (a neurotoxic β-amyloid peptide derived from APP) causes pathogenic changes and neurodegeneration that spread retrogradely via the local production of the basic-region leucine zipper (bZIP) TF ATF4 (Baleriola et al. 2014; Walker et al. 2018). Intriguingly, ATF4 is constitutively expressed in neurons, including axons (Shigeoka et al. 2016), and contributes to synaptic plasticity and memory formation (Chen et al. 2003; Pasini et al. 2015). What accounts for ATF4 being different in the context of β-amyloid pathology? Since bZIP TFs function as obligate dimers and, alongside Atf4, other bZIP transcripts are expressed in axons (Baleriola et al. 2014; Ji and Jaffrey, 2014), we hypothesized that local Aβ42 stimuli might trigger the formation of unique heterodimers through the coordinated production of ATF4 and a second TF. To identify such potential ATF4-binding partners, we delivered siRNAs specifically to axons of hippocampal neurons cultured in microfluidic chambers and screened for candidates involved in the retrograde spread of Aβ42 pathology. One of the candidates, CREB3L2, recapitulated ATF4-mediated effects: its axonal knockdown mitigated cell death downstream of local exposure to oligomeric Aβ42 (
While current knowledge indicates that CREB3 TFs exclusively dimerize within their family and particularly favor homodimerization, our observations raised the possibility that both CREB3L2 and ATF4 could work as part of the same Aβ42-initiated signaling complex. Consistent with this idea, co-immunoprecipitation studies with both in vitro translated and overexpressed proteins revealed that CREB3L2 and ATF4 heterodimerize and do so in a direct manner without requiring post-translational modifications or additional cofactors (
CREB3L2 is produced as a transcriptionally inactive endoplasmic reticulum-transmembrane protein that only translocates to the nucleus after being proteolytically processed (Kondo et al. 2007) (
Having found that Aβ42 triggers CREB3L2-ATF4 heterodimerization in neurons, we next asked whether it occurred in human AD brain. Specifically, we preformed co-immunoprecipitation from samples of non-demented control and late-onset AD cases with clinical diagnoses of mild or moderate pathology. For each individual, we profiled tissue from the dorsolateral prefrontal cortex (PFC; Brodmann area 9/10), a vulnerable brain region during AD progression with an essential role in cognition. A significant enrichment of ATF4 in CREB3L2 immunoprecipitates was present in moderate disease samples, while clinically mild AD cases did not show increased heterodimer levels compared to controls (
CREB3L2 and ATF4 protein expression levels were significantly increased in these same disease cases and positively correlated with each other (
Pathological gene expression changes develop concurrently with AD, implying a failure of transcriptional regulatory mechanisms in maintaining network homeostasis (Zhang et al. 2013; Mathys et al. 2019; Mostafavi et al. 2018; Bossers et al. 2010). As an AD-associated TF heterodimer, CREB3L2-ATF4 could contribute to these changes, which prompted us to investigate its specific transcriptional program. However, while recently described developments have clarified with unprecedented detail the binding properties of TF dimers (Isakova et al. 2017; Jolma et al. 2015; Hass et al. 2015), these methods are not tailored to their study in a cellular context. With this in mind, we developed an approach to investigate the genome-wide DNA-binding patterns of specific TF dimers. We fused CREB3L2 and ATF4 with FK-binding domains and utilized chemically induced proximity to promote the formation of specific homo- or heterodimers in HEK293 cells (Stanton et al. 2018). Each TF monomer was also tagged with a unique epitope (HA or V5) to enable its capture and subsequent identification of genomic binding sites by ChIP-sequencing (ChIP-seq) (
Our evaluation of control Renilla luciferase homodimers, equally promoted by chemically induced proximity, revealed the ChIPmera protocol was mostly without intrinsic background noise (
We found that CREB3L2-ATF4-bound DNA sequences were centrally enriched in either CREB3L2 or ATF4 canonical recognition sites (
Enriched gene ontology (GO) terms among CREB3L2-ATF4-bound genes included a combination of biological functions individually associated with CREB3L2 or ATF4 (
We next investigated the transcriptional response of CREB3L2-ATF4 in the context of human disease using ChIP-seq. Two AD disease cases (both females, with moderate pathology, aged >89 years) were chosen for analysis based on high PFC CREB3L2 and ATF4 expression in addition to reduced post-mortem processing intervals. To the best of our knowledge, ChIP-seq of point-source TFs on human brains has not been reported, probably due to inherent technical challenges associated with biobanked material. While our efforts to immunoprecipitate ATF4-bound chromatin from AD brain were inconclusive, we were able to resolve 228 genomic sites enriched in CREB3L2 from one AD brain, assignable to a set of 179 functionally coherent, highly interconnected protein-coding genes (P=1.22×10−7) (
We asked next whether CREB3L2 targets showed expression changes in AD PFC and found 25 genes with markedly altered transcriptional profiles (P<1×10−20) (
Reexamination of ChIPmera signals in the vicinity of retromer genes further supported a potentially important regulatory role held by CREB3L2 (and ATF4). The CREB3L2 program was found to span elements of the cargo-selective, tubulation, and membrane-recruiting modules (
Together, our findings so far suggested that CREB3L2 is a transcriptional regulator of retromer gene expression. To begin to test this, we knocked down Creb3/2 in rat cortical neurons using RNAi and determined retromer levels by western blot four days post-infection (
A primary retromer function is the retrieval of newly endocytosed integral cell surface proteins from degradation in the lysosome by directing them instead back to the plasma membrane6. For example, APP recycling is particularly relevant during AD pathogenesis, as its missorting and dwell time in the endosome downstream of retromer dysfunction potentiates the generation of neurotoxic β-amyloid. CREB3L2 could thus be important in maintaining APP homeostasis through its transcriptional regulation of retromer expression. With that in mind, and having first confirmed that App mRNA expression was unaltered (
CREB3L2 Correlates with Widespread Retromer Misregulation in AD
While retromer dysfunction is an integral part of AD pathogenesis, the molecular mechanisms underlying its impairment are currently not understood. Our finding that the CREB3L2-ATF4 heterodimer targeted the retromer suggested that its contribution to AD could arise in part via the transcriptional misregulation of this endosomal cargo-sorting complex. This prompted us to analyze publicly available late-onset AD PFC transcriptomes to gain further insight into disease-associated retromer gene expression patterns. We discovered that retromer misregulation is more extensive than previously recognized in affected individuals (
Could CREB3L2-regulated gene expression be disrupted by its association with ATF4? To investigate this, we performed RNA-sequencing (RNA-seq) on primary rat hippocampal neurons with increased dosage of CREB3L2-ATF4 using, as above, chemically induced proximity to promote their heterodimerization (
We next examined in detail whether CREB3L2-ATF4 signaling was causally linked to the disruption of retromer gene expression. To this end, we measured retromer transcript and protein profiles in cultured hippocampal neurons using RT-qPCR and western blot four days after induction of CREB3L2-CREB3L2 or CREB3L2-ATF4. Globally, these analyses revealed a general trend towards the downregulation of the retromer machinery as a consequence of CREB3L2-ATF4 activation (mRNA average decrease=−12.9%; protein average decrease=−18.6%), albeit with some nuances (
Finally, we asked whether CREB3L2-ATF4 signaling was disruptive to P-amyloid and tau metabolism, two disease-relevant retromer cargos. We first measured Aβ peptides in the medium of hippocampal neurons expressing CREB3L2-ATF4 using a Meso Scale multiplex immunoassay. Compared to controls, CREB3L2-ATF4 neurons had significantly higher Aβ42/Aβ40 ratios (
Transcriptional changes are widespread in disease and directly linked to the appearance and maintenance of pathological phenotypes (Lee and Young, 2013). Identifying the transcriptional inputs responsible for gene network misregulation is thus crucial for a deeper understanding of disease mechanisms and potentially the identification of novel therapeutic targets. Collectively, our finding that CREB3L2 and ATF4 form a pathologically relevant heterodimer in AD emphasizes the importance of considering TF combinatorial relationships in order to understand gene expression and disease etiology. As TF dimerization and other higher-order associations are widespread for many TF families (Amoutzias et al. 2008), it is expected that significant biological insights can be gained from future investigations of TF interactions in normal and disease states. Here, ChIPmera, a novel methodology we introduced to interrogate specific TF combinations on their association with the genome, could prove particularly useful, especially when coupled with improved strategies for systematic scrutiny of protein-protein interactions.
TF dimerization is recognized as a way of cells generating variability in DNA-binding profiles and hence differential gene expression programs (Reiter et al. 2017). In line with this idea, we found that the CREB3L2-ATF4 heterodimer jointly regulates transcriptional targets of both CREB3L2 and ATF4, which results in a broader set of biological functions being influenced by its upregulation. However, in the case of CREB3L2, the CREB3L2-ATF4 heterodimer can perhaps be best understood as a partial loss-of-function interaction, given that its association with ATF4 dampens the activation of the core CREB3L2 transcriptional program. Key examples of this include the downregulation of the secretory pathway and other vesicle trafficking-related processes, such as the retromer machinery. Notably, in respect to these signature targets of CREB3L2 regulation, both CREB3L2-CREB3L2 and CREB3L2-ATF4 dimers bind to the same genomic regions—i.e., the two dimers compete with one another for access to these sites, the upregulation of CREB3L2-ATF4 displacing CREB3L2-CREB3L2 inputs, and vice-versa. Rather than producing an additive effect, our findings indicate that increased CREB3L2-ATF4 signaling actually elicits an inhibitory outcome similar to a dominant negative mechanism, leading to an overall suppression of the CREB3L2 program.
Still, our analyses also make clear that the CREB3L2-ATF4 heterodimer goes beyond a mere CREB3L2 loss-of-function, since its upregulation does not fully recapitulate the consequences of knocking down CREB3L2 in neurons. Indeed, despite both conditions disrupting retromer expression patterns in a way that closely resembles those seen in AD, the APP processing pathway is impacted to a greater extent by CREB3L2-ATF4 activation. This indicates that it is the combination of CREB3L2 and ATF4 programs (the former downregulated, the latter upregulated) that may be in fact pathological.
It is noteworthy that proper retromer function protects against the accumulation of misfolded proteins in the ER and is essential to mitigate UPR activation (Dhungel et al. 2015), a biochemical feature of AD and other neurodegenerative disorders (Hetz and Saxena, 2017).
The finding that specific TF interactions can perturb homeostatic networks presents in itself a unique therapeutic opportunity—while directly silencing a TF is likely to impact the entirety of its regulatory program, preventing specific pathological associations holds promise of fewer undesired consequences. Precise interference with TF dimerization has already been achieved using dominant-negative peptide inhibitors and small non-peptide molecules (Gerdes et al. 2006; Lambert et al. 2018), indicating that the targeted modulation of TF interactions could emerge as an amenable therapeutic strategy. In this regard, it is encouraging to note that recent interventions employing retromer-enhancing agents have shown positive outcomes in rodent models of AD (Mecozzi et al. 2014; Li et al. 2019). Modulation of CREB3L2-ATF4 signaling could thus be explored to normalize retromer function and, more broadly, to restore the transcriptional network disrupted by its upregulation.
ChIPmera datasets are available at the Gene Expression Omnibus repository https://www.ncbi.nlm.nih.gov/geo/(accession no. GSE147205).
Same as that described above in Example 1.
Same as that described above in Example 1.
Axonal siRNA Transfection
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
A standard prerequisite of the PLA protocol in its kit format is the availability of specific primary antibodies raised in different hosts. As we were unable to locate a compatible IHC-validated pair of CREB3L2 and ATF4 antibodies, we resorted to using the Duolink Probemaker kits (DU092009 and DU092010, Sigma) to directly conjugate CREB3L2 (HPA015068, Atlas Antibodies) and ATF4 (ab184909, Abcam) antibodies, both of which raised in rabbit, with PLA PLUS and MINUS oligonucleotides. However, this approach requires that the antibodies are in solubilized a carrier- and preservative-free buffer; to achieve this, both antibodies were dialyzed by employing a Slide-A-Lyzer device with a 10K molecular weight cutoff (#69570, Thermo Scientific) made to float on a glass beaker containing 200 ml of PBS for 2 hours. The whole protocol was performed inside a cold room to minimize degradation and, in the case of the anti-CREB3L2 antibody, was followed by a concentration step (#88513, Thermo Scientific). The conjugation reaction was performed overnight at room temperature, and CREB3L2-ATF4 heterodimers stained using Duolink In situ Brightfield Detection reagents (DU092012; Millipore Sigma). As per manufacturer's instructions, the PLA Probe Diluent included in the Probemaker kit was used in substitution of the PLA Antibody Diluent in the PLA protocol. Up until the blocking step, tissue pre-treatment steps were equivalent to those described for the immunohistochemistry detection of CREB3L2 expression in human brain. Co-staining with anti-MAP2 (1:2000; ab5392, Abcam) or anti-Neurofilament (1:400; heavy chain subunit; #N0142, Millipore Sigma) antibodies was performed afterward, and signals developed using the Vector Blue Alkaline Phosphatase substrate kit (SK-5300, Vector Laboratories). To increase detection sensitivity, we additionally employed the Vectastain ABC-AP system (AK-5002, Vector Laboratories) in the staining procedure before signal development. Finally, sections were dehydrated with ethanol (50%>70%>95%>100%), cleared with Histo-Clear (64110-01, Electron Microscopy Sciences), and mounted in Vectamount (H-5000, Vector Laboratories). Slides were imaged on an Olympus BX53 microscope equipped with an Olympus DP72 camera and a UPlan FL n 20×/0.50 objective (Olympus). cellSens Standard v1.13 (Olympus) was used as the acquisition software.
Same as that described above in Example 1.
C-terminal FRB (T82L mutant) or FKBP (wild-type) fusions, N-terminally tagged with HA or V5 epitopes, respectively, were synthesized by Genewiz and transferred into pGL4.75[hR/uc/CMV] (Promega) using Sac and FseI sites. Human CREB3L2 (residues 2-384, corresponding to its transcriptionally active form) and full-length ATF4 (S219A stabilization mutant were utilized in transgene design53); control Renilla luciferase sequence was obtained from pGL4.75 (Promega). Successful insertions were screened by Sanger sequencing. For neuronal expression, these same transgenes were cloned into a modified FUGW plasmid (Addgene #14883, gift by David Baltimore) in which the GFP open reading frame was substituted by a custom multiple cloning site (CTCTAGAGGATCCCCGGGTACCGGTGGCGCGCCGCTTAGCGTTAACGCTAGCCG GACCGCCTGCAGGAGGCCTGCCCGGGCATTTAAATGAATTCAAC; SEQ ID NO: 67, fragment synthesized by Genewiz) using BamHI and EcoRI sites. Lentiviral particles were harvested from HEK293T cells after Lipofectamine 3000-mediated transfection with lentiviral and packaging plasmids (pCMVD R8.9 and pHCMV VSVg); 6 hours post-transfection, the medium was changed to Neurobasal containing B27 and L-glutamine. Viral supernatant was collected 18 hours later, centrifuged 500 g for 5 minutes, passed through a 0.45 μm PES filter, aliquoted, and stored at −80° C. A/C heterodimerizer (C-16-(S)-7-methylindolerapamycin [Aβ21967]) was purchased from Takara.
Same as that described above in Example 1.
shRNA Preparation and Delivery
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Prior to RNA collection, neuronal cultures were washed with ice-cold HBSS (Thermo Fischer) and lysed with TRIzol reagent (#15596026, Thermo Fisher) by scrapping. The reaction was allowed to proceed on ice for 5 minutes, at which point samples were centrifuged at 12,000 g and 4° C. and supernatants transferred to new tubes before a 1:1 (v/v) dilution with molecular biology-grade 100% ethanol (Millipore Sigma). The RNA extraction protocol was continued using the Direct-zol RNA MicroPrep kit (Zymo Research), in accordance to manufacturer's instructions, and included an on-column DNA digestion step with DNase I. RNA was eluted in 30 μl of water. RNA-seq library preparation and sequencing reactions were conducted at GENEWIZ, Inc. (South Plainfield, NJ, USA). RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer's instructions (NEB). Briefly, mRNAs were first enriched with oligo(dT) beads. Enriched mRNAs were fragmented for 15 minutes at 94° C. First-strand and second-strand cDNAs were subsequently synthesized. cDNA fragments were end-repaired and adenylated at 3′-ends, and universal adapters ligated to cDNA fragments, followed by index addition and library enrichment by limited-cycle PCR. The sequencing libraries were validated on an Agilent TapeStation (Agilent Technologies) and quantified using a Qubit 2.0 Fluorometer (Life Technologies) as well as quantitative PCR (KAPA Biosystems). The sequencing libraries (15 in total) were clustered on 1 lane of a flowcell. After clustering, the flowcell was loaded onto an Illumina HiSeq instrument (4000 or equivalent) according to manufacturer's instructions. The samples were sequenced using a 2×150 bp Paired-End (PE) configuration. Image analysis and base calling were conducted by HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina's bcl2fastq 2.17 software. One mismatch was allowed for index sequence identification. RNA-seq sequencing data were processed and analyzed within the Galaxy web platform, using the public server at usegalaxy.org. First, library adapters and low-quality reads were removed using Trimmomatic (version 0.38) with the following settings: initial ILLUMINACLIP step to cut adapters and other Illumina-specific sequences from the reads, seedMismatches=2, palindromeClipThreshold=30, simpleClipThreshold=10, minAdapterLength=8, keepBothReads=True, AVGQUAL >20, SLIDINGWINDOW: windowSize=4 and requiredQuality=20, and MINLEN=50. Second, reads were mapped to the Rattus norvegicus (Rn) 6.0 reference genome and gene model (downloaded from Ensembl) with RNA STAR (version 2.7.5b) using default settings except: sjdbOverhang=149, outFilterType=True, alignintronMax=1000000, alignMatesGapMax=1000000, and alignSJoverhangMin=8; additionally, unmapped reads, alignments that had junctions with inconsistent strands, alignments across unannotated non-canonical junctions and all alignments across non-canonical junctions were excluded from output. Third, featureCounts (version 1.6.4+galaxy2) was run to quantify reads mapping to exons with the following parameters: ‘create gene length file’=True, ‘count fragments instead of reads’=True, ‘only allow fragments with both reads aligned’=True, ‘exclude chimeric fragments’=True, ‘GFF feature type filter’=exon, ‘GFF gene identifier’=gene_id, ‘on feature level’=False, ‘allow reads to map to multiple features’=False, ‘minimum mapping quality per read’=10; otherwise default tool settings. Forth, differentially expressed features were determined using default DESeq2 (version 2.11.40.6+galaxy1) settings, except: ‘output normalized counts table’=True. Fifth, DESeq2 output was filtered to extract only the most differentially expressed genes (adjusted P-value <0.05) between conditions. Sixth, the Galaxy tool ‘Annotate DESeq2/DEXSeq output tables' (version 1.1.0) was employed to retrieve gene annotations. Subsequently, to visualize gene expression profiles over samples, Z-scores were computed from normalized gene counts and plotted using the heatmap2 tool. Comparative gene ontology enrichment meta-analyses were performed with differential expression lists through the Metascape web portal (Zhou et al. 2019).
Culture supernatants were transferred to 15-ml falcon tubes, spun at 2000 g and 4° C. for 5 minutes, aliquoted, and stored at −80° C. A sandwich immunoassay (V-PLEX Aβ Peptide Panel 1 kit, #4G8, Meso Scale Discovery) was employed in the measurement of β-amyloid species. Manufacturer's guidelines were followed thoroughly during plate preparation, and samples diluted 1:1 with Diluent 35 (provided as part of the kit) to avoid matrix saturation. All biological replicates were measured in parallel. Signal readings were performed on a Sector Imager 2400 instrument (Meso Scale Discovery). For assessing sAPPα levels in culture supernatants, we utilized a sandwich ELISA assay (sAPPα [Mouse/Rat] [highly sensitive], #27419, Immuno-Biological Laboratories) and samples were diluted 10-fold. Extracellular tau levels were assessed using the Phospho(Thr231)/Total Tau Kit from Meso Scale Discovery following the protocol provided by the manufacturer. It is noteworthy, however, that phospho-tau signals were deemed too low to provide any meaningful assessment of phospho-tau levels, likely a consequence of no phosphatase inhibitor being added to the supernatants at the time of collection, and were discarded. LDH release was evaluated using an LDH-Glo Cytotoxicity Assay from Promega.
Same as that described above in Example 1.
This study is to determine how ATF4 transcription factor heterodimers regulate gene expression changes in Parkinson's disease (PD).
Gene expression analysis of substantia nigra from PD patients has identified numerous differentially expressed genes (DEGs) involved in cellular pathways such as mitochondrial function, synapse organization, and macroautophagy. However, how changes in gene expression are regulated remains unknown. ATF4 is a stress-responsive, obligate heterodimeric transcription factor (TF) that has been implicated in PD. Most studies of the role of TFs in disease have focused on identifying changes in TF expression level and correlating that with function. However, we hypothesized that changes in heterodimerization patterns could also result in disease-specific transcriptional deregulation. This project has focused on understanding how ATF4 transcription factor heterodimer complexes affect PD pathogenesis by altering gene expression.
We focused primarily on a novel TF heterodimer consisting of ATF4 and another stress-responsive TF, CREB3L2 (
We identified 255 genes that are both dysregulated in PD and potential transcriptional targets of the ATF4-CREB3L2 TF complex. Network and functional enrichment analysis of these genes identified several clusters associated with different cellular pathways, including those well-known to be dysregulated in PD, such as mitochondrion organization, and less well-studied pathways such as RNA splicing (
These results demonstrate a novel approach for dissecting the link between specific TF complexes, differential gene expression, and cellular dysfunction in PD.
We have obtained ATF4 and CREB3L2 conditional knock-out mice. We plan to validate the effect of ATF4 and CREB3L2 TFs on differential gene expression and cellular dysfunction in PD, using primary cultured midbrain neurons from these animals. This will include: 1. qPCR for changes in gene expression. 2. Cell biologic assays of mitochondrial function, mRNA processing, intracellular transport, and other pathways identified through this analysis in in vitro models of PD.
Gene expression is changed by disease, but how these molecular responses arise and contribute to pathophysiology remains less understood. We discover that β-amyloid, a trigger of Alzheimer's disease (AD), promotes the formation of pathological CREB3L2-ATF4 transcription factor heterodimers in neurons. Through a multi-level approach based on AD datasets and a novel chemogenetic method that resolves the genomic binding profile of dimeric transcription factors (ChIPmera), we find that CREB3L2-ATF4 activates a transcription network that interacts with roughly half of the genes differentially expressed in AD, including subsets associated with β-amyloid and tau neuropathologies. CREB3L2-ATF4 activation drives tau hyperphosphorylation and secretion in neurons, in addition to misregulating the retromer, an endosomal complex linked to AD pathogenesis. We additionally provide evidence for increased heterodimer signaling in AD brain and identify dovitinib as a candidate molecule for normalizing β-amyloid-mediated transcriptional responses. The findings overall reveal differential TF dimerization as a mechanism linking disease stimuli to the development of pathogenic cellular states.
Alzheimer's disease (AD) is a progressive neurodegenerative disorder with an increasing worldwide prevalence. The preclinical phase of AD, which can last 10-20 years, is characterized by the gradual accumulation of β-amyloid and tau aggregates in the brain, together with neuroinflammation and synaptic alterations (Long and Holtzman, 2019). Several lines of evidence indicate that β-amyloid deposition precedes and accelerates tau pathology, the latter correlating with the onset of cognitive decline (Long and Holtzman, 2019; Hanseeuw et al., 2019; Sato et al., 2018). Concurrently, gene expression changes across specific pathways tied to pathophysiology are observed (Zhang et al., 2013; Mostafavi et al., 2018; Bossers et al., 2010; Mathys et al., 2019), highlighting an important role for altered transcriptional regulators in AD. What causes these changes, how they interact with β-amyloid and tau pathologies, and whether they are drivers of disease or a response to it remain, however, unclear.
Far from a binary on/off switch, gene expression has emerged as a nuanced, dynamic and collaborative process involving various transcriptional layers (Buccitelli and Selbach, 2020). It follows that AD-associated expression changes can only be fully explained in light of this regulatory interdependency. Transcription factor (TF) dimerization, a common feature among many TF families, is a salient but mostly overlooked case in point, in that it can generate enormous variability in DNA-binding specificities and transcriptional activities (Amoutzias et al., 2008; Reiter et al., 2017; Rodriguez-Martinez et al., 2017; Brigidi et al., 2019). Nonetheless, network analyses of gene co-expression profiles typically employed in AD research are not designed to capture these synergistic TF combinations, resulting in a fragmented mechanistic understanding of the gene programs underlying AD progression and, most likely, missed therapeutic opportunities.
Here, we report the discovery and characterization of a pathological TF heterodimer, CREB3L2-ATF4, linked to AD pathogenesis. CREB3L2-ATF4 heterodimerization is potentiated by β-amyloid in neurons, and we confirmed that their association is enriched in AD brain. To probe its role in pathogenesis, we engineered a new chemogenetic methodology, ChIPmera, which resolves the DNA-binding specificities of dimeric TFs in their cellular context. We found that the CREB3L2-ATF4 heterodimer regulates a transcription network linked to AD gene expression and triggers characteristic cellular features of the condition, including tau hyperphosphorylation, a primary driver of neurodegeneration in AD (Long and Holtzman, 2019). Overall, the findings reveal that TF dimerization can contribute to the disruption of gene networks and the exacerbation of disease processes.
The basic-region leucine zipper (bZIP) TF ATF4, an integral part of the unfolded protein response (Hetz et al., 2020), is constitutively expressed in neurons and contributes to synaptic plasticity and memory formation (Shigeoka et al., 2016; Chen et al., 2003; Pasini et al., 2015). ATF4 is also associated with various neurodegenerative disorders, including AD, and is known to activate both pro-survival and pro-death signaling pathways in a context-dependent manner (Sun et al., 2013; Pitale et al., 2017). We have previously reported that axonally synthesized ATF4 mediates pathogenic transcriptional changes and neurodegeneration triggered by soluble oligomeric Aβ42 (Baleriola et al., 2014; Walker et al., 2018), a neurotoxic β-amyloid peptide linked to the onset of AD (Long and Holtzman, 2019). What accounts for the different functions displayed by ATF4 in these various settings? In particular, how does ATF4 function downstream of Aβ42 as a driver of AD pathogenesis? Since bZIP TFs operate as obligate dimers (Amoutzias et al., 2008), we hypothesized that differential heterodimerization could modulate ATF4's unique mode of action in response to Aβ42 by allowing for a distinct transcriptional output. To identify such potential ATF4-binding partners, we delivered siRNAs to axons of hippocampal neurons cultured in microfluidic chambers and screened for genes involved in the retrograde spread of β-amyloid pathology. Specifically, we focused on candidate mRNAs that, like Atf4, were previously found to be recruited into axons upon exposure to Aβ42 (
These observations raised the possibility that CREB3L2 and ATF4 act in the same Aβ42-initiated signaling pathway. Indeed, co-immunoprecipitation studies with either in vitro translated or overexpressed tagged proteins revealed that CREB3L2 and ATF4 form stable heterodimers via their leucine zipper domains (
Together, our findings identify CREB3L2 as a dimerization partner of ATF4 and show that Aβ42, an early trigger of AD pathogenesis (Long and Holtzman, 2019), potentiates their heterodimerization.
While AD-associated gene expression changes have been characterized in detail (Zhang et al., 2013; Mostafavi et al., 2018; Bossers et al., 2010; Mathys et al., 2019), they occur via mostly unknown mechanisms. As an Aβ42-regulated TF heterodimer, CREB3L2-ATF4 could contribute to these transcriptional responses, prompting us to investigate its DNA-binding program. However, despite recent methodological developments allowing for an unprecedented understanding of the binding specificities of TF dimers (Isakova et al., 2017; Jolma et al., 2015), these protocols are not tailored to their study in a cellular context and have a steep technical barrier to entry. Instead, we developed an approach that builds upon the well-established ChIP-sequencing (ChIP-seq) protocol. In our workaround, CREB3L2 and ATF4 were fused with FKBP/FRP domains, and specific homo- or heterodimers were promoted in HEK293 cells using chemically induced proximity (Stanton et al., 2018). In addition, each TF monomer was also tagged with a unique epitope (HA or V5) to facilitate its capture and purification of bound chromatin (
Preliminary reporter assays with chemically induced CREB3L2-ATF4 heterodimers showed that their pairing makes up a functional unit capable of significantly driving Chop activation, as interference with CREB3L2 or ATF4 using dominant negative bZIP-like inhibitor peptides completely prevented CREB3L2-ATF4-induced reporter expression gains above baseline levels (
Unbiased motif searches using CentriMo revealed that CREB3L2-ATF4-bound DNA fragments were centrally enriched in either CREB3L2 or ATF4 canonical recognition sites (
Next, we performed a gene ontology (GO) enrichment analysis to explore the functional profile of CREB3L2-ATF4. Top statistically overrepresented GO terms among CREB3L2-ATF4-bound genes included RNA metabolism, protein translation and turnover, ER stress, mitochondrial organization, DNA repair, and intracellular vesicular trafficking (
Genes uniquely regulated by the CREB3L2-ATF4 heterodimer (i.e., not shared with the CREB3L2 homodimer;
Collectively, our analyses uncover the CREB3L2-enriched DNA-binding program of the CREB3L2-ATF4 heterodimer and reveal direct links with key pathways associated with cellular proteostasis and trafficking. They also serve as proof-of-concept for ChIPmera in its ability to identify genomic sites bound by specific TF dimers within their cellular environment.
To gain further insight into the pathological role of CREB3L2-ATF4, we performed RNA-sequencing (RNA-seq) on primary rat hippocampal neurons with increased dosage of CREB3L2-ATF4 using, as above, chemically induced proximity to promote their dimerization (
The finding that CREB3L2-ATF4 controls a transcription network activated in AD speaks to a broader role for the heterodimer in modulating disease-linked gene expression, prompting us to explore its regulatory and functional relationships. To this end, we combined ChIP-seq analyses from the ENCODE Consortium (the exception being SOX9, whose transcriptional program we mined from published literature) (Ohba et al., 2015) with the ChIPmera CREB3L2-ATF4 readout and contrasted these datasets against the AD transcriptome (top 3,000 DEGs; bulk tissue-level) as well as our own RNA-seq results using the Metascape platform (
To compensate for potential biases in cell composition associated with bulk AD brain transcriptomes, we extended these analyses using neuron-specific gene expression profiles obtained from dorsolateral prefrontal cortex single-nucleus RNA-seq (snRNA-seq) datasets (
Together, these analyses provide a data-driven, unbiased view of AD-relevant cellular dysfunctions to which the CREB3L2-ATF4 heterodimer potentially contributes via its transcriptional program.
Next, we sought to characterize how the heterodimer might influence specific AD gene expression responses. Among other functions, endosome-related processes were consistently enriched across our various datasets (
First, by inspecting AD-associated retromer gene expression patterns in the dorsolateral prefrontal cortex (Zhang et al., 2013), we discovered that retromer misregulation was more extensive than previously recognized (
In line with this idea, CREB3L2 knockdown reduced the expression of various retromer subunits at both mRNA and protein levels in neurons (
Collectively, our findings reveal that the neuronal retromer is impacted by CREB3L2-ATF4 via a transcriptional response in many respects comparable to that seen in AD, suggesting a mechanism for its functional impairment. They additionally provide a concrete example of how the heterodimer can produce gene expression disruptions linked to relevant AD cellular dysfunctions.
CREB3L2-ATF4 Interacts with β-Amyloid and Tau Neuropathologies
Because CREB3L2-ATF4 is regulated by β-amyloid, an upstream component of the Alzheimer's pathological cascade (Long and Holtzman, 2019), we next asked how the heterodimer might globally relate to this neuropathology and other characteristic disease phenotypes. To this end, we leveraged gene-trait molecular networks previously elucidated by Mostafavi and colleagues linking AD-associated transcriptomic patterns to disease-relevant endpoints (e.g., β-amyloid burden or cognitive decline) and assessed their interaction with CREB3L2-ATF4 (Mostafavi et al., 2018). These data were originally derived from participants enrolled in the Religious Orders Study (ROS) or the Rush Memory and Aging Project (MAP), two large-scale longitudinal cohort studies of aging and dementia (Bennett et al., 2018). We first examined gene expression changes in the dorsolateral prefrontal cortex conditioned by β-amyloid and tau neuropathologies and looked for direct overlaps with the CREB3L2-ATF4 transcription network.
We subsequently used GO annotations to determine which biological processes within the CREB3L2-ATF4 network were most significantly enriched in connection to these traits (
Following up on these observations, we asked whether CREB3L2-ATF4 interacted with APP and tau regulation. We first measured soluble Aβ peptides in the medium of rat hippocampal neurons expressing CREB3L2-ATF4 heterodimers using a Meso Scale multiplex immunoassay. Compared to controls, CREB3L2-ATF4 neurons had significantly higher Aβ42/Aβ40 ratios (
To assess tau metabolism, we initially focused on neuronal tau phosphorylation patterns, as hyperphosphorylated forms of this protein are associated with increased tau aggregation in AD (Wang and Mandelkow, 2016). Using antibodies that recognize specific tau phospho-epitopes, we found that the CREB3L2-ATF4 heterodimer led to significantly higher phosphorylation of various disease-relevant sites (
While tau is predominantly an intracellular protein, it is also known to be released by neurons and contribute to the spread of pathology (Wang and Mandelkow, 2016), prompting us to evaluate whether CREB3L2-ATF4 might similarly influence tau secretion. Using a Meso Scale platform, we found that extracellular tau accumulation in CREB3L2-ATF4 cultures was 62.9% above control levels (
How does CREB3L2-ATF4 activation influence tau metabolism? Analysis of neuronal RNA-seq datasets revealed that various subunits of the holoenzyme protein phosphatase 2A (PP2A) were disrupted at the transcriptional level by CREB3L2-ATF4 (
Together, our findings reveal that CREB3L2-ATF4 drives abnormal tau phosphorylation and secretion in neurons, two key aspects linked to the development and spread of tau pathology, overall supporting a model whereby the heterodimer is regulated by and functionally interacts with AD neuropathologies (
The analyses so far offer evidence of a potentially important role for CREB3L2-ATF4 in AD pathophysiology, which motivated us to pursue additional corroboration that their heterodimerization mediates a disease-relevant transcriptional mechanism. We first asked whether CREB3L2-ATF4 was found in the human brain and to what extent its heterodimerization levels were different in AD by performing co-immunoprecipitation in samples of non-demented control and disease cases (Table 7). Akin to our earlier bioinformatic analyses, we chose to evaluate tissue originating from the dorsolateral prefrontal cortex (Brodmann area 9), a cerebral region linked to higher cognitive functions affected by AD (Mathys et al., 2019). These studies revealed that proportionally higher levels of CREB3L2 were present in ATF4 co-immunoprecipitates from AD brains than those found in controls (131% average enrichment, P=0.013;
Employing PLA analyses in AD prefrontal cortex, we further found that CREB3L2-ATF4 heterodimers were present in neurons, predominantly inside the nucleus, but also in axons, as well as in other cells (
aCold PMI: Postmortem interval calculated from the reported time of death to the time the patient was brought into the cold room.
bFrozen PMI: Postmortem interval calculated from the reported time of death to the mean time the brain was processed.
Cases are listed in the same order used for loading co-immunoprecipitation gels in
aFrozen PMI (hours): Postmortem interval calculated from the reported time of death to the mean time the brain was processed.
CRE1B33L2 Transcriptionally Overlaps with CREB3L2-ATF4 in AD
Next, we sought to substantiate our characterization of the CREB3L2-ATF4 transcriptional program with direct human evidence. Two individuals (both females with moderate AD pathology, aged >89 years; Table 9) were chosen for ChIP-seq analysis based on high prefrontal cortex CREB3L2 and ATF4 expression in addition to reduced post-mortem processing intervals. To our knowledge, ChIP-seq of point-source TFs in human brains has not been reported, likely due to the inherent technical challenges associated with biobanked material. While our efforts to immunoprecipitate ATF4-bound chromatin were unfruitful, we resolved 228 genomic sites enriched in CREB3L2, assignable to a set of 179 functionally coherent protein-coding genes (STRING network enrichment: P=1.22×10−7).
In agreement with our ChIPmera study, further breakdown of CREB3L2 binding showed that 83.1% of these signals were located within ±3 kb of a transcription start site (
ChIPmera and the bioinformatic analyses that followed have thus captured a core set of disease-relevant pathways strikingly congruous with those regulated by CREB3L2 in AD brain. Although to some extent correlative, the findings support the pathophysiological significance of our proposed model regarding the nature of the CREB3L2-ATF4 program, especially since it is CREB3L2 that largely defines the regulatory landscape of the heterodimer (
aCold PMI: Postmortem interval calculated from the reported time of death to the time nthe patient was brought into the cold room.
bFrozen PMI: Postmortem interval calculated from the reported time of death to the mean time the brain was processed.
Because CREB3L2-ATF4 interacts with a substantial subset of the AD transcriptome and recapitulates aspects of disease progression, disrupting its activity may mitigate the detrimental effects mediated by Aβ42 and hence potentially improve disease outcomes. Targeted interference with bZIP TFs is well-established and has found applicability in cancer models (Sun et al., 2019; Gerdes et al., 2006). Briefly, bZIPs homo- and/or heterodimerize by forming a parallel coiled-coil (the ‘leucine zipper’) and bind DNA via a proximal region rich in basic (i.e., positively charged) amino acids (Amoutzias et al., 2008; Reiter et al., 2017; Vinson et al., 2002). Replacing the latter with an acidic (i.e., negatively charged) sequence creates very efficient dominant-negative bZIP sponges (aZIPs), which simultaneously prevent dimerization and DNA binding of target TFs. Based on this principle, we designed CREB3L2 and ATF4 aZIPs and tested their ability to rescue Aβ42-induced neuronal cell death after viral delivery. Remarkably, both peptides significantly improved cell viability in neurons exposed to Aβ42 across a 48-hour stimulation protocol in relation wild-type neurons (
While TFs have traditionally been considered poor therapeutic targets (Su and Henley, 2021), gene expression is emerging as a powerful platform for drug discovery and repurposing efforts (Dönerta§ et al., 2018; Williams et al., 2019). This is made possible by resources like The Connectivity Map (CMap; Lamb et al., 2006), which has characterized more than one million gene expression signatures for a range of drugs and other perturbations. With CMap, changes in gene expression linked to a disease process can be compared for similarity to drug-induced perturbations and those with the most negative correlations followed up as therapeutic leads. A query of the CMap database using the CREB3L2-ATF4 transcriptome that included both upregulated and downregulated genes (top 150 DEGs, 75 from each arm) identified dovitinib, a pan-receptor tyrosine kinase inhibitor (Trudel et al., 2005), as the most significant hit (connectivity score=−0.65; −log10[false discovery rate]=15.65). Interestingly, this molecule had been previously classified as a top repurposing candidate for AD based on two independent analyses (Rodriguez et al., 2021; Issa et al., 2016), prompting us to test it in neurons challenged with A342. Using RNA-seq, we found 203 DEGs (P<0.05) after a 24-hour Aβ42 stimulation protocol (average absolute log fold-change=0.29), 131 of which showed corrective shifts 0.10 with dovitinib co-treatment, and a subset of 30 genes surpassing 0.25 differences in head-to-head comparisons (
Altogether, in this study, we have discovered a TF heterodimer regulated by β-amyloid that interacts with a molecular network linked to disease phenotypes and have confirmed that key components of this transcriptional pathway are present in the AD brain. We additionally provide evidence that gene expression may be a promising Intervention Target for AD Therapies.
Our findings collectively support the conclusion that CREB3L2 and ATF4 form a pathologically important association in AD and highlight TF combinatorial relationships as a relevant disease mechanism. As TF interactions are widespread phenomena (Amoutzias et al., 2008; Reiter et al., 2017), significant pathophysiological insights are likely within reach of future investigations. ChIPmera, a methodology we developed to interrogate dimeric TFs, could prove particularly useful in this regard, especially when coupled with much-needed improved strategies for detecting context-dependent TF associations. Indeed, CREB3L2 and ATF4 have no known genetic variants associated with AD risk and were likely to have been disregarded as candidates of study had we focused uniquely on their expression profiles, given that they would not be considered obvious top picks by this measure alone (Zhang et al., 2013; Andrews et al., 2020). Instead, it is their heterodimerization that makes them remarkable in the context of AD.
Despite not encompassing the full complexity of AD, the amyloid cascade hypothesis remains the predominant model of pathogenesis (Musiek et al., 2015) (Long and Holtzman, 2019; Musiek and Holtzman, 2015). It postulates that β-amyloid deposition is a key instigator of the ensuing degenerative process involving tau aggregation, neuron loss, and cognitive impairment (Musiek and Holtzman, 2015). Elucidating the mechanisms by which β-amyloid precipitates this chain of events is of critical significance (Musiek and Bennett, 2021), not least because current evidence strongly suggests that tau pathology is the primary mediator of neurodegeneration in AD (Long and Holtzman, 2019). Remarkably, CREB3L2-ATF4 bridges both hallmark AD neuropathologies, being regulated by β-amyloid and promoting aspects of tau dyshomeostasis typical of AD. Our findings thus indicate that gene expression changes are not merely responsive to but function as actual drivers of AD pathology. Given the scope of the heterodimer's transcriptional program, it is doubtful that its effects can be ascribed to a single dysfunctional pathway (e.g., retromer or PP2A) but more likely emerge from globally interdependent disturbances spanning different cellular processes. This is ultimately why AD and other conditions with multifactorial etiologies may be ideally suited for therapeutic interventions focusing on gene expression (Rodriguez et al., 2021), as these open the possibility of correcting cellular imbalances even when the underlying pathogenic mechanisms are not entirely understood.
We recognize that some inferences we make in this study regarding CREB3L2-ATF4 are based on correlation analyses. We have accommodated this limitation by using human datasets from different sources and favoring unbiased readouts whenever possible. Ultimately, the identification of dovitinib attests to the strength of the approach. Indeed, we and others have closed in on the same molecule using different strategies and datasets (Rodriguez et al., 2021; Issa et al., 2016), which provides a strong indication that CREB3L2-ATF4 captures a core gene expression signature of AD. Focused development of a small molecule that specifically inhibits their heterodimerization will be needed to allow more direct validations and fundamentally prove the role of CREB3L2-ATF4.
In conclusion, we report that TF heterodimerization can encode pathogenic stimuli and reconfigure transcription networks associated with disease processes. Our study provides a novel mechanistic perspective for understanding gene expression programs in the context of AD and suggests a transcriptional link between P-amyloid and tau pathologies, the two hallmark brain lesions that characterize this neurodegenerative condition.
Same as that described above in Example 1.
Same as that described above in Example 1.
Axonal siRNA Transfection
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1 under “Rabbit reticulocyte lysate translation system and immunoprecipitation.”
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 1 under “Analysis of LOAD-associated and related transcriptional profiles”.
Protein A magnetic beads (#S1425S, New England Biolabs) were washed in PBS containing 0.1% BSA and incubated at 4° C. for 1 hour with rotation. Following two rinses with PBS, beads were resuspended in lysis buffer, mixed for 4 hours with anti-ATF4 antibody (1 μg per immunoprecipitation; ab184909, Abcam), and washed three times with lysis buffer. At this point, we proceeded by covalently cross-linking the immobilized antibodies to Protein A beads using bis(sulfosuccinimidyl)suberate (BS3; #21586, Thermo Fisher) following manufacturer's guidelines. Frozen dorsolateral prefrontal cortex tissue (approximately 80 mg per IP; Table 7) was processed in ice-cold lysis buffer (20 mM Tris-Cl pH 8, 137 mM NaCl, 1% Nonidet P-40 (NP-40), 2 mM EDTA, supplemented with protease and phosphatase inhibitors (cOmplete cocktail tablets, Roche). Sample volumes were weight-adjusted in a sample-by-sample manner and tissue extracts were incubated for 2 hours at 4° C. with end-over-end rotation. During this incubation, a 10-minute bath sonication step was performed to improve extraction efficiency. After centrifugation at 12,000 rpm and 4° C., pellets were discarded and supernatants transferred to new tubes. Equal amounts of antibody-bead conjugates were mixed with lysates overnight at 4° C. with constant rotation and washed a total of four times with ice-cold lysis buffer. Immunoprecipitation input and the supernatant resulting from the first wash step (‘flow-through’ fraction) were saved for further analyses. Immunoprecipitates were eluted in 50 μl of 0.2 M glycine buffer (pH 2.5) and allowed to react for 5 minutes at 4° C. with rotation after a short vortexing step. Eluates were transferred to a new tube, and the elution protocol repeated. Pooled eluates were neutralized by the addition of 20 μl of 1 M Tris-Cl (pH 9.0), and Laemmli buffer-treated samples heated at 80° C. for 5 minutes. CREB3L2 signals were visualized using anti-CREB3L2 serum (HPA015068, Atlas Antibodies) and a light chain-specific monoclonal secondary antibody (211-032-171, Jackson ImmunoResearch); successful ATF4 immunoprecipitation was confirmed using anti-ATF4 sera (ab184909, Abcam, and #11815, Cell Signaling Technology).
All experiments were reviewed and monitored by the IACUC at Columbia University in accordance with NIH guidelines for the humane treatment of animals. Hemizygous 5-weeks-old B6SJL-Tg(APPSwFILon,PSEN1*M146L*L286V)6799Vas/Mmjax (5×FAD) mice (MMRRC Stock No: 34840-JAX) were purchased from Jackson Laboratories. This strain overexpresses both mutant human APP with the Swedish (K670N, M671L), Florida (1716V), and London (V7171) Familial Alzheimer's Disease (FAD) mutations and human presenilin 1 (PS1) harboring two FAD mutations, M146L and L286V. Age- and sex-matched wild-type B6SJLF1/J mice (Stock No: 100012) were acquired from Jackson Laboratories at the same time. Both groups were maintained in our breeding colony until 10 weeks of age. Mice were euthanized following ketamine (80-100 mg/kg) and xylazine (5-10 mg/kg) administration, perfused with normal saline (Mckesson, #37-6280), and fixed with 4% paraformaldehyde (vol/vol). Brains were post-fixed overnight in 4% paraformaldehyde, washed in PBS, transferred to 30% sucrose, and finally embedded for cryostat sectioning (12-μm thick coronal cuts). Epitope unmasking was done for 20 minutes in steaming 0.01 M sodium citrate buffer (0.05% Tween 20, pH 6.0), which was followed by three 10-minute PBS-T washes. A standard prerequisite of the PLA protocol in its kit format is the availability of specific primary antibodies raised in different hosts. As we were unable to locate a compatible pair of CREB3L2 and ATF4 antibodies, we resorted to using the Duolink Probemaker kits (DU092009 and DU092010, Sigma) to directly conjugate two rabbit-raised antibodies, anti-CREB3L2 (HPA015068, Atlas Antibodies) and anti-ATF4 (ab184909, Abcam), with PLA PLUS and MINUS oligonucleotides. This approach requires that both antibodies are solubilized in a carrier- and preservative-free buffer; to achieve this, we dialyzed the antibodies by employing a Slide-A-Lyzer device with a 10K molecular weight cutoff (#69570, Thermo Scientific) made to float on a glass beaker containing 200 ml of PBS for 2 hours. The whole protocol was performed inside a cold room to minimize degradation and, in the case of the anti-CREB3L2 antibody, was followed by a concentration step (#88513, Thermo Scientific). The conjugation reaction was performed overnight at room temperature, and CREB3L2-ATF4 heterodimers stained using Duolink In situ Far-red Detection reagents (DU092013; Millipore Sigma). As per manufacturer's instructions, the PLA Probe Diluent included in the Probemaker kit was used in substitution of the PLA Antibody Diluent in the PLA protocol. Tissue sections were preserved in Duolink In situ Mounting Medium with DAPI (DU082040, Millipore Sigma). Images were acquired on a LSM800 confocal microscope (Zeiss) with a Plan-Apochromat 40×/1.3 Oil DIC M27 oil objective (Zeiss). Imaging settings were kept constant between conditions. PLA interactions were unbiasedly analyzed in Fiji using the ‘Analyze Particles’ function after auto-thresholding (‘Yen’ method). We excluded one 5×FAD animal due to technical difficulties in the tissue preparation phase; sample size was determined by power analysis.
Same as that described above in Example 11.
Same as that described above in Example 1.
shRNA Preparation and Delivery
Same as that described above in Example 1.
Same as that described above in Example 1.
Same as that described above in Example 11.
Integration of Wider CREB3L2-ATF4 Transcription Network with AD Profiles
Overlapping hits among CREB3L2-ATF4 datasets were found using the Venn diagram module accessible at http://genevenn.sourceforge.net/. Processed ChIP-seq files (identifiers: ENCFF794DLT [NFE2L2], ENCFF516MEQ [NFATC1], ENCFF353RDB [MXD4]), prepared and analyzed by the ENCODE Consortium, were retrieved from https://www.encodeproject.org/. The DNA-binding program of SOX9 was mined from published literature and only ‘Class I’ sites were considered, catalogued as such by Ohba et al. based on their clustering around transcription start sites (Ohba et al., 2015). Gene annotations of ranked peaks were assigned by GREAT v4.0.4 using a ±3 kb transcription start site cutoff. For each dataset, only the top (i.e., strongest) 3000 hits within this cutoff were carried forward to accommodate the requirements of the Metascape analysis pipeline (Zhou et al., 2019), which was used to produce the comparative gene ontology meta-analysis. AD-associated gene expression changes were obtained from publicly available datasets (Zhang et al., 2013; Mathys et al., 2019). Top 3,000 differentially expressed genes in AD prefrontal cortex (bulk RNA-seq dataset), excluding conflicting entries, were grouped according to expression profile, totaling 1267 upregulated and 1692 downregulated genes (lowest adjusted P-value=9.93×10−20).
Culture supernatants were transferred to 15-ml falcon tubes, spun at 2000 g and 4° C. for 5 minutes, aliquoted, and stored at −80° C. A sandwich immunoassay (V-PLEX Aβ Peptide Panel 1 kit, #4G8, Meso Scale Discovery) was employed in the measurement of β-amyloid species. Manufacturer's guidelines were followed thoroughly during plate preparation, and samples diluted 1:1 with Diluent 35 (provided as part of the kit) to avoid matrix saturation. All biological replicates were measured in parallel. Signal readings were performed on a Sector Imager 2400 instrument (Meso Scale Discovery). For assessing sAPPα levels in culture supernatants, we utilized a sandwich ELISA assay (sAPPα [Mouse/Rat] [highly sensitive], #27419, Immuno-Biological Laboratories) and samples were diluted 10-fold. Extracellular tau levels were assessed using the Phospho(Thr231)/Total Tau Kit from Meso Scale Discovery following the protocol provided by the manufacturer. Neurofilament-light and Map2 were measured by ELISA using PathScan Total Neurofilament-L Sandwich ELISA kit (#99175, Cell Signaling Technology) and Abcam's SimpleStep MAP2 ELISA kit (ab253229), respectively.
DIV1 rat hippocampal neurons were infected with lentiviruses carrying FRB/FKBP-tagged ATF4 or CREB3L2 transgenes. One day later, the heterodimerizer was added to cultures diluted in Neurobasal growth medium at 100 nM, and cells allowed to mature until DIV10. Additional rounds of heterodimerizer supplementation (100 nM, diluted in growth medium) were made every other day. On DIV10, cells were washed in ice-cold HBSS and lysed in 2×Laemmli buffer (130 mM Tris-Cl pH 6.8, 0.1 mM dithiothreitol, 20% (v/v) glycerol and 4% sodium dodecyl sulfate diluted in water) by scrapping. Fresh lysates were boiled at 85° C. for 5 minutes and immediately analyzed by western blot. Antibodies: anti-Tau (1:1,000; Clone HT7, MN1000, Invitrogen), anti-phospho-Tau (pSer202/pThr205; 1:4,000; AT8, Invitrogen), anti-phospho-Tau (pSer396/pSer404; PHF-1, formerly available through Dr. Peter Davies), anti-phospho-Tau (pSer404; 1:1,1000; T7444, Millipore Sigma).
Hippocampal neurons were initially lysed in accordance with the instructions provided in Serine/Threonine Phosphatase Assay Kit (V2460; Promega). Lysates were then centrifuged at 1×105 g at 4° C. for 1 hour in phosphatase storage buffer (2 mM EGTA, 5 mM EDTA, 0.5 mM PMSF, 150 mM NaCl, 1% Triton X-100, 50 mM Tris-HCl pH 7.4, and 0.5% protease inhibitor cocktail). Sephadex G-25 spin columns were used to remove free phosphate found endogenously, followed by incubation for 1 h at 37° C. in PP2A reaction buffer (250 mM imidazole pH 7.2, 1 mM EGTA, 0.1% P-mercaptoethanol, 0.5 mg/ml BSA) supplemented with Ser/Thr phosphopeptide. The reaction was stopped by adding 50 μl of molybdate dye/additive mixture. After 30 minutes, and absorbance was measured at 600 nm in a 96-well microplate reader (Tecan). PP2A activity measurements were normalized to total DNA content in biological replicates using a CyQUANT assay (Thermo Fisher). Protein phosphatases 2B and 2C (PP2B and PP2C) show very low to no detectable activity in the presence of EGTA (PP2B) and EDTA (PP2C); it is also noteworthy that the phosphopeptide utilized in this assay is a poor substrate for protein phosphatase 1.
Post-mortem human material was obtained through the New York Brain Bank at Columbia University and the Neuropathology Brain Bank at Mount Sinai according to institutional guidelines governed by approved protocols. Neuropathological evaluations (Table 7, Table 8, and Table 9) included assignment of CERAD, Braak, NIA-Reagan, or ABC scores. Dorsolateral prefrontal cortex tissue specimens were derived from Brodmann area 9.
Protein A magnetic beads (#S1425S, New England Biolabs) were washed in PBS containing 0.1% BSA and incubated at 4° C. for 1 hour with rotation. Following two rinses with PBS, beads were resuspended in lysis buffer, mixed for 4 hours with anti-ATF4 antibody (1 μg per immunoprecipitation; ab184909, Abcam), and washed three times with lysis buffer. At this point, we proceeded by covalently cross-linking the immobilized antibodies to Protein A beads using bis(sulfosuccinimidyl)suberate (BS3; #21586, Thermo Fisher) following manufacturer's guidelines. Frozen dorsolateral prefrontal cortex tissue (approximately 80 mg per IP; Table 7) was processed in ice-cold lysis buffer (20 mM Tris-Cl pH 8, 137 mM NaCl, 1% Nonidet P-40 (NP-40), 2 mM EDTA, supplemented with protease and phosphatase inhibitors (cOmplete cocktail tablets, Roche). Sample volumes were weight-adjusted in a sample-by-sample manner and tissue extracts were incubated for 2 hours at 4° C. with end-over-end rotation. During this incubation, a 10-minute bath sonication step was performed to improve extraction efficiency. After centrifugation at 12,000 rpm and 4° C., pellets were discarded and supernatants transferred to new tubes. Equal amounts of antibody-bead conjugates were mixed with lysates overnight at 4° C. with constant rotation and washed a total of four times with ice-cold lysis buffer. Immunoprecipitation input and the supernatant resulting from the first wash step (‘flow-through’ fraction) were saved for further analyses. Immunoprecipitates were eluted in 50 μl of 0.2 M glycine buffer (pH 2.5) and allowed to react for 5 minutes at 4° C. with rotation after a short vortexing step. Eluates were transferred to a new tube, and the elution protocol repeated. Pooled eluates were neutralized by the addition of 20 μl of 1 M Tris-Cl (pH 9.0), and Laemmli buffer-treated samples heated at 80° C. for 5 minutes. CREB3L2 signals were visualized using anti-CREB3L2 serum (HPA015068, Atlas Antibodies) and a light chain-specific monoclonal secondary antibody (211-032-171, Jackson ImmunoResearch); successful ATF4 immunoprecipitation was confirmed using anti-ATF4 sera (ab184909, Abcam, and #11815, Cell Signaling Technology).
CREB3L2-ATF4 heterodimers were visualized using Duolink In situ Brightfield Detection reagents (DU092012; Millipore Sigma). CREB3L2 and ATF4 PLA probes were prepared as described for the detection of CREB3L2-ATF4 heterodimers in 5×FAD mice. Per manufacturer's instructions, the PLA Probe Diluent included in the Probemaker kit was used in substitution of the PLA Antibody Diluent in the PLA protocol. Before deparaffinization with xylene, slides were placed in a 60° C. oven for 1 hour; we proceeded by rehydrating slides using a graded ethanol series (100%>95%>70%>50%>water), plus two 10-minute PBS-T (0.1% Tween 20) washes. Epitope unmasking was done for 20 minutes in steaming Tris-EDTA buffer (10 mM Tris base, 1 mM EDTA, 0.05% Tween 20, pH 9.0), followed by three 5-minute PBS-T rinses. We quenched endogenous peroxidases slides with 1% hydrogen peroxide for 30 minutes before blocking. Co-staining of neurofilament (1:400; heavy chain subunit; #N0142, Millipore Sigma) was performed afterwards using the Vector Blue Alkaline Phosphatase substrate kit (SK-5300, Vector Laboratories). To increase detection sensitivity, we additionally employed the Vectastain ABC-AP system (AK-5002, Vector Laboratories) before signal development. Finally, sections were dehydrated in a graded ethanol series (50%>70%>95%>100%), cleared with Histo-Clear (64110-01, Electron Microscopy Sciences), mounted in Vectamount (H-5000, Vector Laboratories), and airdried for 24 hours before proceeding with imaging. Human dorsolateral prefrontal cortex specimens (Brodmann area 8/9; Table 8) were manually counted by an experimenter ‘blind’ to the underlying diagnosis. Technical controls: PLA Probe Rabbit IgG Isotype Control MINUS (DU087004; Millipore Sigma) and CREB3L2 blocking peptide (APrEST73339; Atlas Antibodies). For each case, CREB3L2-ATF4 measurements were interspersed between 5 randomly selected tissue sub-regions; specifically, 10 neurons within layers III-V were analyzed in each sub-region, for a total of 50 independent measurements per brain.
Recombinant human α-synuclein monomers (#RP-003, Porteus) were used to generate pre-formed fibrils as previously described (Volpicelli-Daley et al., 2011). Briefly, monomers were diluted to a concentration of 5 mg/mL in PBS and shaken at 1000 rpm in an Eppendorf Thermomixer C for 7 days at 37° C. to generate fibrils. Fibrils were aliquoted and stored at −80° C. Prior to treatment of hippocampal neurons, aliquots were thawed at room temperature, diluted to a concentration of 0.1 μg/μL in PBS, and sonicated in a QSonica 700 sonicator with cup horn at 30% amplitude for a total of 22.5 minutes (3 seconds on, 2 seconds off). Sonicated fibrils were added to hippocampal neurons on DIV 4 at a concentration of 5 mg/mL for 10 days. Intraneuronal pathology was confirmed by staining against phospho-α-synuclein (pSer129; 1:250; #23706, Cell Signaling Technology).
Control and CREB3L2-ATF4-expressing rat hippocampal neurons, supplemented every 2 days with 100 nM heterodimerizer, were grown until DIV10 before treatment with cycloheximide (40 μg/ml, #C4859, Millipore Sigma) for 2-6 hours, as previously described (Arighi et al., 2004). Cells were lysed in 2×Laemmli buffer (130 mM Tris-Cl pH 6.8, 0.1 mM dithiothreitol, 20% (v/v) glycerol and 4% sodium dodecyl sulfate diluted in water) by scraping, boiled at 85° C. for 5 minutes, and analyzed by western blot using an antibody against CI-M6PR (1:30,000; ab124767, Abcam).
Autopsy cases #ALZ_11 and #ALZ_12 (Table 9), both females with moderate AD pathology, were chosen for ChIP-seq analysis based on 1) high CREB3L2 and ATF4 expression level, 2) CREB3L2-ATF4 complex accumulation and 3) reduced postmortem processing intervals. Frozen minced brain tissue (approximately 150 mg per immunoprecipitation and a total of 300 mg per case) was transferred to a conical tube containing 6 ml of PBS supplemented with protease inhibitors (PBS+PI), and protein-DNA cross-linking allowed to develop for 20 minutes at room temperature using formaldehyde at a final concentration of 1.5% (v/v). Cross-linking reaction was then quenched with glycine (5 minutes at room temperature), as per manufacturer's instructions (SimpleChIP Plus Kit [#9005], Cell Signaling Technology). After rinsing in ice-cold PBS+PI, we proceeded by disaggregating tissue using an ice-cold Dounce homogenizer (7 ml total capacity) until a single-cell suspension was obtained, which was followed by a 2,000 g and 4° C. centrifugation step. The resulting supernatants were discarded. Chromatin fragments (mainly 1-3 nucleosomes in size) were obtained by partial digestion with micrococcal nuclease (MNase; 2 μl in 500 μl) incubated for 13 minutes at 37° C. in a Thermomixer R (Eppendorf) programmed for frequent mix cycles. Nuclear membranes were broken up by three rounds of 20-second, 15% amplitude pulses using a Sonic Dismembrator Model 500 (Fisher Scientific), and lysates subsequently clarified by centrifugation. Adequate digestion was confirmed by agarose gel electrophoresis. Approximately 6 μg of chromatin, diluted in 400 μl of ChIP buffer, was used per immunoprecipitation; CREB3L2-bound DNA was immunoprecipitated by overnight incubation at 4° C. with anti-CREB3L2 serum (2 μg; HPA015068, Atlas Antibodies). Immunoprecipitates were captured using Protein G magnetic beads and washed with low- and high-salt buffers, as directed. Elution was performed at 65° C. and 1,200 rpm for 30 minutes using a thermomixer, protein-DNA cross-links reversed by treatment with Proteinase K for 2 hours at 65° C., and DNA purification achieved by using a column-based system. ChIP-seq library preparation and sequencing reactions were conducted at GENEWIZ, Inc. (South Plainfield, NJ, USA). During library preparation, immunoprecipitated samples were normalized to input DNA, i.e., chromatin cross-linked and fragmented side by side with immunoprecipitated DNA using the same conditions. The sequencing libraries were multiplexed and clustered on one lane of a flowcell. Sequencing was performed using a 2×150 Paired-End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data generated from Illumina HiSeq were converted into fastq files and de-multiplexed using Illumina's bcl2fastq v2.17 software. One mismatch was allowed for index sequence identification. ChIP-seq sequencing data were processed and analyzed within the Galaxy web platform, using the public server at usegalaxy.org. First, we run FastQC to evaluate overall sequencing quality (unique reads >90%). Second, library adapters and low-quality reads were removed using Trimmomatic v0.36. Third, reads were mapped to the hg38 reference genome with Bowtie v0.12.7, and non-uniquely mapped reads filtered out. Forth, unmapped and low quality (MAPQ <20) reads were excluded with samtools v1.2. Fifth, peak calling was performed with MACS2 v2.1.1 with minimum false discovery rate (FDR) cutoff for peak detection fixed at 0.05, lower and upper mfold bounds defined as 5 and 50, respectively, and extension size set at 144. Finally, peaks were exported to the UCSC genome browser for visualization after conversion to bigwig format. CREB3L2 gene ontology (GO) term enrichment was analyzed using ClueGO v2.5.4 within the Cytoscape platform (v3.6.1).
CREB3L2 and ATF4 aZIPs: Reagent Preparation and Neuronal Viability Analysis
Specific aZIPs sequences were synthesized by Genewiz. CREB3L2 aZIP: 5′-GGATCCGCCACCATGGACTACAAAGATGATGACGACAAGCACATGGCCAGCATGA CCGGGGGCCAGCAGATGGGAAGAGACCCTGATTTGGAACAAAGGGCAGAGGAGC TGGCCCGGGAGAACGAAGAACTGGAGAAGGAAGCTGAGGAACTTGAGCAGGAGC TCGCTGAACTTCGGAAGAAGGTGGAGGTGCTGGAGAACACCAACAGGACTCTCCT TCAGCAACTTCAGAAGCTTCAGACTTTGGTGATGGGGAAGGTCTCTCGAACCTGCA AGTTAGCTGGTACACAGACTGGCACCTGCCTCATGGTCGTTGTGCTTTAAGAATTC-3′. (SEQ ID NO: 68) ATF4 aZIP: 5′-GGATCCGCCACCATGGACTACAAAGATGATGACGACAAGCACATGGCCAGCATGA CCGGGGGCCAGCAGATGGGAAGAGACCCTGATTTGGAACAAAGGGCAGAGGAGC TGGCCCGGGAGAACGAAGAACTGGAGAAGGAAGCTGAGGAACTTGAGCAGGAGC TCGCTGAACTCACTGGCGAGTGTAAAGAGCTAGAAAAGAAGAACGAGGCTCTGAA AGAGAAGGCAGATTCTCTCGCCAAAGAGATTCAGTATCTAAAAGACCTGATAGAAG AGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCTTAAGAATTC-3′. (SEQ ID NO: 69) aZIP transgenes were cloned into the modified FUGW plasmid described in ‘Chemically induced proximity: reagent preparation’ using BamHI+EcoRI sites. Lentiviral particles were delivered at DIV1, 24 hours post-dissection. Neuronal cultures were allowed to mature until DIV15 and treated with Aβ42 at 750 nM for 48 hours. Cell viability was assayed using RealTime-Glo MT Cell Viability Assay (Promega) following manufacturer's guidelines; reaction was allowed to proceed for 1 hour before taking luminescence readings (SpectraMax iD5, Molecular Devices). Also see
Each experiment was independently repeated at least three times unless otherwise indicated. Individual measurements were taken from distinct samples. Details of biological replication and statistical analysis are indicated in figure legends or main text. For all tests, a significance level (a) of 0.05 was used. Datasets were analyzed with Prism (GraphPad). Representation factors and associated probabilities were calculated using the formulas described in http://nemates.org/MA/; 25,000 was assumed as the total number genes in the human genome.
All documents cited in this application are hereby incorporated by reference as if recited in full herein.
Although illustrative embodiments of the present disclosure have been described herein, it should be understood that the disclosure is not limited to those described, and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the disclosure.
The present application is a continuation of PCT international application no. PCT/US2023/065614, filed on Apr. 11, 2023, which claims benefit of U.S. Provisional Patent Application Ser. No. 63/329,999, filed on Apr. 12, 2022, and U.S. Provisional Patent Application Ser. No. 63/386,098, filed on Dec. 5, 2022. The contents of above applications are incorporated by reference herein in their entireties.
This disclosure was made with government support under grant nos. AG008702 and NS109607, awarded by National Institutes of Health. The government has certain rights in the disclosure.
| Number | Date | Country | |
|---|---|---|---|
| 63329999 | Apr 2022 | US | |
| 63386098 | Dec 2022 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2023/065614 | Apr 2023 | WO |
| Child | 18906851 | US |
