Patent Application
20230414648
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 4, 2021, is named 2021-11-04_01245-0020-00PCT_ST25.txt and is 316,037 bytes in size.
Myotonic dystrophy type 1 (DM1) is a disorder caused by expansion of a CTG trinucleotide repeat in the noncoding region of the DMPK gene. The protein encoded by the DMPK gene is called myotonic dystrophy protein kinase and is believed to play a role in communication between cells. The DMPK protein is also important for the maintenance of skeletal muscle. If the number of CTG repeats in the DMPK gene is greater than normal, a longer and toxic RNA is produced, preventing cells in muscles and other tissues from functioning normally.
DM1 affects muscle and other body systems with patients typically experiencing muscle weakness and wasting. Adults may become disabled and have a shortened life span. A diagnosis of DM1 is confirmed by molecular genetic testing of DMPK.
CRISPR-based genome editing can provide sequence-specific cleavage of genomic DNA using an RNA-targeted endonuclease and a guide RNA. Providing a pair of guide RNAs that cut on either side of the trinucleotide repeat may result in excision to some extent, but the breaks may simply be resealed without loss of the intervening repeats in a significant number of cells. Accordingly, there is a need for improved compositions and methods for excision of the CTG repeat region in DMPK to treat DM1.
Adeno-associated virus (AAV) administration of the CRISPR-Cas components in vivo or in vitro is attractive due to the early and ongoing successes of AAV vector design, manufacturing, and clinical stage administration for gene therapy. See, e.g., Wang et al. (2019) Nature Reviews Drug Discovery 18:358-378; Ran et al. (2015a) Nature 520: 186-101. However, the commonly used Streptococcus pyogenes (SpCas9) is very large, and when used in AAV-based CRISPR/Cas systems, requires two AAV vectors—one vector carrying the nucleic acid encoding the spCas9, and the other carrying the nucleic acid encoding the guide RNA. One possible way to overcome this technical hurdle is to take advantage of the smaller orthologs of Cas9 derived from different prokaryotic species. Smaller Cas9s such as Staphylococcus aureus (SaCas9) and Staphylococcus lugdunensis (SluCas9) may be able to be manufactured on a single AAV vector together with a nucleic acid encoding one or more guide RNAs. One advantage of incorporating one or more guide RNAs on a single vector together with the smaller SaCas9 or SluCas9 is that doing so allows extreme design flexibility in situations where more than one guide RNA is desired for optimal performance. For example, one vector may be utilized to express SaCas9 or SluCas9 and one or more guide RNAs targeting one or more genomic targets, and a second vector may be utilized to express multiple copies of the same or different guide RNAs targeting the same or different genomic targets. Alternatively, one vector may be utilized to express SaCas9 or SluCas9, and a second vector may be utilized to express one or more guide RNAs targeting one or more genomic targets. Compositions and methods utilizing these dual vector configurations have the benefit of reducing manufacturing costs, reducing complexity of administration routes and protocols, and allowing maximum flexibility with regard to using multiple copies of the same or different guide RNAs targeting the same or different genomic target sequences. In some instances, providing multiple copies of the same guide RNA improves the efficiency of the guide, improving an already successful system. Another benefit to using a endonucleases such as SaCas9 or SluCas9 is that a vector (e.g., AAV) may accommodate a nucleic acid encoding these nucleases more easily than a nucleic acid encoding the much larger SpCas9.
Disclosed herein are compositions and methods using guide RNAs particularly suitable for use with the smaller Cas9 from Staphylococcus lugdunensis (SluCas9) and Staphylococcus aureus (SaCas9).
Accordingly, the following embodiments are provided:
Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims and included embodiments.
Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “a guide” includes a plurality of guides and reference to “a cell” includes a plurality of cells and the like.
Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.
Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of” or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims). The term “or” is used in an inclusive sense, i.e., equivalent to “and/or,” unless the context clearly indicates otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:
“Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2′ methoxy or 2′ halide substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; U.S. Pat. No. 5,378,825 and PCT No. WO 93/13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th ed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (U.S. Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2′ methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.
“Guide RNA”, “gRNA”, and simply “guide” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA), or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences.
As used herein, a “spacer sequence,” sometimes also referred to herein and in the literature as a “guide sequence,” or “targeting sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for cleavage by an RNA-targeted endonuclease. A guide sequence can be 24, 23, 22, 21, 20 or fewer base pairs in length, e.g., in the case of Staphylococcus lugdunensis (SluCas9), Staphylococcus aureus Cas9 (SaCas9), and related, e.g., modified versions, Cas9 homologs/orthologs. Shorter or longer sequences can also be used as guides, e.g., 15-, 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-, 24-, or 25-nucleotides in length. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 (for SluCas9), and 200-259 (for SaCas9). In some embodiments, the guide sequence comprises a sequence selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, or 200-259. In some embodiments, the target sequence is in a gene or on a chromosome, for example, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. For example, in some embodiments, the guide sequence comprises a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, or 200-259. In some embodiments, the guide sequence comprises a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, or 200-259. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 17, 18, 19, 20 or more base pairs. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides. In some embodiments, the guide sequence and the target region do not contain any mismatches.
In some embodiments, the guide sequence comprises a sequence selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, or 200-259, wherein if the 5′ terminal nucleotide is not guanine, one or more guanine (g) is added to the sequence at its 5′ end. The 5′ g or gg is required in some instances for transcription, for example, for expression by the RNA polymerase III-dependent U6 promoter or the T7 promoter. In some embodiments, a 5′ guanine is added to any one of the guide sequences or pairs of guide sequences disclosed herein.
Target sequences for RNA-targeted endonucleases include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence's reverse compliment), as a nucleic acid substrate for an RNA-targeted endonuclease is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence,” it is to be understood that the guide sequence may direct a guide RNA to bind to the reverse complement of a target sequence. Thus, in some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence.
As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA together with an RNA-targeted endonuclease, such as a Cas nuclease, e.g., a Cas cleavase or Cas nickase (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-targeted endonuclease such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence, which can be followed by cleaving or nicking.
As used herein, a first sequence is considered to “comprise a sequence with at least X % identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X % or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5′-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5′-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.
“mRNA” is used herein to refer to a polynucleotide that is not DNA and comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2′-methoxy ribose residues. In some embodiments, the sugars of an mRNA phosphate-sugar backbone consist essentially of ribose residues, 2′-methoxy ribose residues, or a combination thereof.
Guide sequences useful in the guide RNA compositions and methods described herein are shown in Table 2 and throughout the application.
As used herein, a “SluCas9” encompasses wild type and modified versions of Cas9 from Staphylococcus lugdunensis, where the modified versions of SluCas9 maintain their main function to direct a guide RNA to a desired target location in DNA. In some embodiments, the SluCas9 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 712:
In some embodiments, the SluCas9 is a modified SluCas9 protein. Exemplary modified versions of SluCas9 include those described in:
As used herein, a “SaCas9” encompasses wild type and modified versions of Cas9 from Staphylococcus aureus, where the modified versions of SaCas9 maintain their main function to direct a guide RNA to a desired target location in DNA. A variant of SaCas9 comprises one or more amino acid changes as compared to SEQ ID NO: 711, including insertion, deletion, or substitution of one or more amino acids, or a chemical modification to one or more amino acids. In some embodiments, the nucleic acid encoding SaCas9 encodes an SaCas9 comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 711:
As used herein, a “target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target sequence and the guide sequence directs an RNA-targeted endonuclease to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.
As used herein, “treatment” refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease or development of the disease (which may occur before or after the disease is formally diagnosed, e.g., in cases where a subject has a genotype that has the potential or is likely to result in development of the disease), arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing reoccurrence of one or more symptoms of the disease. For example, treatment of DM1 may comprise alleviating symptoms of DM1.
As used herein, “ameliorating” refers to any beneficial effect on a phenotype or symptom, such as reducing its severity, slowing, or delaying its development, arresting its development, or partially or completely reversing or eliminating it. In the case of quantitative phenotypes such as expression levels, ameliorating encompasses changing the expression level so that it is closer to the expression level seen in healthy or unaffected cells or individuals.
As used herein, “excision” of a sequence means any process that results in removal of the sequence from nucleic acid (e.g., DNA, such as gDNA) in which it originally occurred, including but not limited to processes comprising two double strand cleavage events or two or more nicking events followed by any repair process that does not include the sequence in the repair product, which may comprise one or more of ligation of distal ends, resection, or secondary structure formation by at least part of the region being excised.
As used herein, an “expanded amino acid repeat” refers to a segment of a given amino acid (e.g., one of glutamine, alanine, etc.) in DMPK that contains more instances of the amino acid than normally appears in wild-type versions of DMPK. In Table 1, the normal range indicates the range of instances of the amino acid than normally appears in wild-type versions of DMPK.
The term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined.
Methods and compositions provided herein can be used to excise trinucleotide repeats or self-complementary sequences to ameliorate genotypes associated with DM1. Table 1 provides information regarding the trinucleotide repeats associated with DM1.
This disclosure provides methods and uses for treating DM1 comprising administering one or more guide RNAs (gRNAs) or one or more nucleic acids encoding said gRNAs to a subject in need of treatment. In some embodiments, the one or more gRNA, or nucleic acid encoding the one or more gRNA, is administered in combination (e.g., at or near the same time as) a SluCas9, or a nucleic acid encoding a SluCas9, or a SaCas9, or a nucleic acid encoding an SaCas9. The one or more gRNA comprises a spacer sequence of Table 2. In some embodiments, a vector is provided comprising a nucleic acid encoding one or more gRNA comprising a spacer sequence of Table 2 and a nucleic acid encoding a SluCas9 (for SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or SaCas9 (for SEQ ID NOs: 200-259). In some embodiments, one vector is administered, wherein the vector comprises a nucleic acid encoding the one or more gRNA and a nucleic acid encoding a SluCas9 or SaCas9. In some embodiments, two or more vectors are administered, where one vector comprises a nucleic acid encoding one or more gRNA and does not comprise an endonuclease such as SluCas9 or SaCas9, and the other vector comprises a nucleic acid encoding a SluCas9 or SaCas9 and optionally one or more gRNAs, wherein the gRNAs may be the same or different than the gRNAs on the other vector not encoding the SluCas9 or SaCas9. In some embodiments, two or more vectors are administered, where one vector comprises a nucleic acid encoding one or more gRNA and a nucleic acid encoding a SluCas9 or SaCas9, and the other vector may comprise one or more nucleic acids encoding one or more gRNAs and not a SluCas9 or SaCas9. In some embodiments, two or more vectors are administered, where each vector comprises a nucleic acid encoding one or more gRNA and a nucleic acid encoding a SluCas9 or SaCas9. In some embodiments, any of the compositions described herein is administered to a subject in need thereof for use in treating DM1. In some embodiments, the composition administered comprises one or more guide RNAs (gRNAs) comprising any one or more of the guide sequences of Table 2, or a vector encoding any one or more of the gRNAs.
In some embodiments, methods of excising trinucleotide repeats in the DMPK gene are provided comprising administering two or more guide RNAs (gRNAs), each gRNA comprising any one of the spacer sequences of Table 2, or administering a vector encoding two or more gRNAs. In some embodiments, two or more gRNAs described herein (e.g., a pair of gRNAs) or a vector encoding the gRNAs are delivered to a cell in combination (e.g., at or near the same time) with SluCas9 or a nucleic acid encoding the SluCas9 (for SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or SaCas9 or a nucleic acid encoding SaCas9 (for SEQ ID NOs: 200-259). Exemplary gRNAs, vectors, and SluCas9s for treating DM1 are described herein.
In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence selected from any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70, or a nucleic acid encoding the guide RNA, and optionally a Staphylococcus lugdunensis (SluCas9) or a nucleic acid encoding a SluCas9. In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence that is at least 20 contiguous nucleotides of any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 and optionally a Staphylococcus lugdunensis (SluCas9) or a nucleic acid encoding a SluCas9. In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence that is at least 90% or 100% identical to any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or and optionally a Staphylococcus lugdunensis (SluCas9) or a nucleic acid encoding a SluCas9.
Also provided is a method of treating a disease or disorder characterized by a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene, the method comprising delivering to a cell that comprises a TNR in the 3′ UTR of the DMPK gene
Also provided is a method of excising a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene comprising delivering to a cell that comprises the TNR in the 3′ UTR of the DMPK a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: i) a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50; and ii) a SluCas9 or a nucleic acid encoding the SluCas9, wherein at least one TNR is excised.
Also provided is a method of treating DM1, the method comprising administering to a subject having DM1:
In some embodiments of methods described herein, a pair of guide RNAs that comprise a first and second spacer that deliver the SluCas9 to or near the TNR, or one or more vectors encoding the pair of guide RNAs, are provided, administered, or delivered to a cell. For example, where the TNR is in the 3′ UTR of the DMPK gene, the first and second spacer sequences may have the sequences of any one of the following pairs of SEQ ID NOs: 5 and 7, 5 and 10, 5 and 19, 5 and 41, 5 and 47, 21 and 7, 21 and 19, 21 and 41, 21 and 47, 46 and 7, 46 and 10, 46 and 19, 46 and 41, 46 and 47, 55 and 7, 55 and 19, 55 and 41, 55 and 47, 59 and 7, 59 and 19, 59 and 41, 59 and 47, 61 and 7, 61 and 10, 61 and 19, 61 and 41, 61 and 47, 64 and 7, 64 and 19, 64 and 41, or 64 and 47.
In some embodiments, methods of treating DM1, excising a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene, or treating a disease or disorder characterized by a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene are provided comprising administering to a subject in need:
Any of the foregoing methods and any other method described herein may be combined to the extent feasible with any of the additional features described herein, including in the sections above, the following discussion, the examples, and the claims.
In some embodiments, at least a pair of gRNAs are provided which direct a SluCas9 to a pair of sites flanking (i.e., on opposite sides of) a TNR. For example, the pair of sites flanking a TNR may each be within 10, 20, 30, 40, or 50 nucleotides of the TNR but on opposite sides thereof.
In some embodiments, trinucleotide repeats are excised from a locus or gene associated with DM1.
The number of repeats that is excised may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000, or in a range bounded by any two of the foregoing numbers, inclusive, or in any of the ranges listed herein. In some embodiments, the number of repeats that is excised is in a range listed in Table 1, e.g., as a pathological, premutation, at-risk, or intermediate range.
In some embodiments, excision of a repeat region ameliorates at least one phenotype or symptom associated with the repeat region. This may include ameliorating aberrant expression of the DMPK gene encompassing or near the repeat region, or ameliorating aberrant activity of a gene product (noncoding RNA, mRNA, or polypeptide) encoded by the DMPK gene encompassing the repeat region.
For example, excision of the TNRs may ameliorate one or more phenotypes associated with an expanded-repeat DMPK gene, e.g., one or more of increasing myotonic dystrophy protein kinase activity; increasing phosphorylation of phospholemman, dihydropyridine receptor, myogenin, L-type calcium channel beta subunit, and/or myosin phosphatase targeting subunit; increasing inhibition of myosin phosphatase; and/or ameliorating muscle loss, muscle weakness, hypersomnia, one or more executive function deficiencies, insulin resistance, cataract formation, balding, or male infertility or low fertility.
In some embodiments, any one or more of the gRNAs, pairs of gRNAs, vectors, compositions, or pharmaceutical formulations described herein is for use in a method disclosed herein or in preparing a medicament for treating or preventing DM1 in a subject. In some embodiments, treatment and/or prevention is accomplished with a single dose, e.g., one-time treatment, of medicament/composition.
In some embodiments, a method of treating or preventing DM1 in subject comprising administering a pair of gRNAs, vectors, compositions, or pharmaceutical formulations described herein is provided. In some embodiments, the gRNAs, vectors, compositions, or pharmaceutical formulations described herein are administered as a single dose, e.g., at one time. In some embodiments, the single dose achieves durable treatment and/or prevention. In some embodiments, the method achieves durable treatment and/or prevention. Durable treatment and/or prevention, as used herein, includes treatment and/or prevention that extends at least i) 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks; ii) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, or 36 months; or iii) 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, a single dose of the gRNAs, vectors, compositions, or pharmaceutical formulations described herein is sufficient to treat and/or prevent any of the indications described herein for the duration of the subject's life.
In some embodiments, a method of excising a TNR of DMPK is provided comprising administering a composition comprising a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50 together with SluCas9 or an mRNA or vector encoding SluCas9. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, a pair of gRNAs comprising a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50 are administered to excise a TNR in DMPK and SluCas9 or an mRNA or vector encoding SluCas9. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, a method of treating DM1 is provided comprising administering a composition comprising a pair of guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50 and SluCas9 or an mRNA or vector encoding SluCas9. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, a method of decreasing or eliminating production of an mRNA comprising an expanded trinucleotide repeat in the 3′ UTR of the DMPK gene is provided comprising administering a pair of guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 3, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50 and SluCas9 or an mRNA or vector encoding SluCas9. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, a method of decreasing or eliminating production of a protein comprising an expanded amino acid repeat in DMPK is provided comprising administering two or more guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and one or more second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50 and SluCas9 or an mRNA or vector encoding SluCas9. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, gRNAs comprising any two of the guide sequences of (i) SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 are administered to reduce expression of a polypeptide comprising an expanded amino acid repeat in DMPK together with SluCas9 or an mRNA or vector encoding SluCas9.
In some embodiments, the pair of gRNAs comprise two of the guide sequences of Table 2 together with SluCas9 (for SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or SaCas9 (for SEQ ID NOs: 200-259) to induce DSBs, and microhomology-mediated end joining (MMEJ) during repair leads to a mutation in the targeted gene. In some embodiments, MMEJ leads to excision of trinucleotide repeats.
In some embodiments, methods of excising trinucleotide repeats in the DMPK gene are provided comprising administering two or more SaCas9-specific guide RNAs (gRNAs), each gRNA comprising any one of the spacer sequences of SEQ ID NO: 200-259 in Table 2, or administering a vector encoding two or more gRNAs. In some embodiments, two or more gRNAs described herein (e.g., a pair of gRNAs) or a vector encoding the gRNAs are delivered to a cell in combination (e.g., at or near the same time) with SaCas9 or a nucleic acid encoding the SaCas9. Exemplary gRNAs, vectors, and SaCas9 for treating DM1 are described herein.
In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence selected from any one of SEQ ID NOs: 200-259, or a nucleic acid encoding the guide RNA, and optionally a Staphylococcus aureus Cas9 (SaCas9) or a nucleic acid encoding a SaCas9. In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence that is at least 20 contiguous nucleotides of any one of SEQ ID NOs: 200-259 and optionally a Staphylococcus aureus Cas9 (SaCas9) or a nucleic acid encoding a SaCas9. In some embodiments, a method of treating DM1 is provided, the method comprising delivering to a cell a guide RNA comprising a spacer sequence that is at least 90% identical to any one of SEQ ID NOs: 200-259 and optionally a Staphylococcus aureus Cas9 (SaCas9) or a nucleic acid encoding a SaCas9.
Also provided is a method of treating a disease or disorder characterized by a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene, the method comprising delivering to a cell that comprises a TNR in the 3′ UTR of the DMPK gene
Also provided is a method of excising a trinucleotide repeat (TNR) in the 3′ UTR of the DMPK gene comprising delivering to a cell that comprises the TNR in the 3′ UTR of the DMPK a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: i) a first spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239; and ii) a SaCas9 or a nucleic acid encoding the SaCas9, wherein at least one TNR is excised. In some embodiments, a pair of gRNAs is delivered to a cell, wherein the pair comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments of methods described herein, a pair of guide RNAs that comprise a first and second spacer that deliver the SaCas9 to or near the TNR, or one or more vectors encoding the pair of guide RNAs, are provided or delivered to a cell. For example, where the TNR is in the 3′ UTR of the DMPK gene, the first and second spacer sequences may have the sequences of any one of the following pairs of SEQ ID NOs: 202 and 218, 201 and 224, 202 and 213, or 202 and 206.
Any of the foregoing methods and any other method described herein may be combined to the extent feasible with any of the additional features described herein, including in the sections above, the following discussion, the examples, and the claims.
In some embodiments, at least a pair of gRNAs are provided which direct a SaCas9 to a pair of sites flanking (i.e., on opposite sides of) a TNR. For example, the pair of sites flanking a TNR may each be within 10, 20, 30, 40, or 50 nucleotides of the TNR but on opposite sides thereof.
In some embodiments, a method of excising a TNR of DMPK is provided comprising administering a composition comprising a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239.
In some embodiments, a pair of gRNAs comprising a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239 are administered to excise a TNR in DMPK. The guide RNAs may be administered together with SaCas9 or an mRNA or vector encoding SaCas9.
In some embodiments, a method of treating DM1 is provided comprising administering a composition comprising a pair of guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239; and SaCas9 or an mRNA or vector encoding SaCas9. In some embodiments, the pair of gRNAs comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments, a method of decreasing or eliminating production of an mRNA comprising an expanded trinucleotide repeat in the 3′ UTR of the DMPK gene is provided comprising administering a pair of guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239; and SaCas9 or an mRNA or vector encoding SaCas9. In some embodiments, the pair of gRNAs comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments, a method of decreasing or eliminating production of a protein comprising an expanded amino acid repeat in DMPK is provided comprising administering two or more guide RNAs comprising a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and one or more second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239; and SaCas9 or an mRNA or vector encoding SaCas9. In some embodiments, the pair of gRNAs comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments, gRNAs comprising any two of the guide sequences of (i) SEQ ID NOs: 200-259 are administered to reduce expression of a polypeptide comprising an expanded amino acid repeat in DMPK. The gRNAs may be administered together with SaCas9 or an mRNA or vector encoding SaCas9.
In some embodiments, the pair of gRNAs comprise two of the guide sequences of SEQ ID NO: 200-259 in Table 2 together with SaCas9 to induce DSBs, and microhomology-mediated end joining (MMEJ) during repair leads to a mutation in the targeted gene. In some embodiments, MMEJ leads to excision of trinucleotide repeats.
In some embodiments, the subject is mammalian. In some embodiments, the subject is human. In some embodiments, the subject is cow, pig, monkey, sheep, dog, cat, fish, or poultry.
In some embodiments, the use of a pair of guide RNAs comprising any two of the guide sequences in Table 2 (e.g., in a composition provided herein) is provided for the preparation of a medicament for treating a human subject having DM1.
For treatment of a subject (e.g., a human), any of the compositions disclosed herein may be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The compositions may be readily administered in a variety of dosage forms, such as injectable solutions. For parenteral administration in an aqueous solution, for example, the solution will generally be suitably buffered and the liquid diluent first rendered isotonic with, for example, sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous, and/or intraperitoneal administration. In some embodiments, the guide RNAs, compositions, and formulations are administered intravenously. In some embodiments, the guide RNAs, compositions, and formulations are administered intramuscularly. In some embodiments, the guide RNAs, compositions, and formulations are administered intracranially. In some embodiments, the guide RNAs, compositions, and formulations are administered to cells ex vivo.
In some embodiments, a single administration of a composition comprising a pair of guide RNAs provided herein is sufficient to excise TNRs. In other embodiments, more than one administration of a composition comprising a pair of guide RNAs provided herein may be beneficial to maximize therapeutic effects.
In some embodiments, the invention comprises combination therapies comprising any of the methods described herein (e.g., two or more gRNAs comprising any two or more of the guide sequences disclosed in Table 2 (e.g., in a composition provided herein)) together with an additional therapy suitable for ameliorating DM1 and/or one or more symptoms thereof. Suitable additional therapies for use in ameliorating DM1, and/or one or more symptoms thereof are known in the art.
Delivery of gRNA Compositions
The compositions may be administered via any suitable approach for delivering gRNAs and compositions described herein. Exemplary delivery approaches include vectors, such as viral vectors; lipid nanoparticles; transfection; and electroporation. In some embodiments, vectors or LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating DM1.
Where a vector is used, it may be a viral vector, such as a non-integrating viral vector. In some embodiments, the viral vector is an adeno-associated virus vector, a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10 (see, e.g., SEQ ID NO: 81 of U.S. Pat. No. 9,790,472, which is incorporated by reference herein in its entirety), AAVrh74 (see, e.g., SEQ ID NO: 1 of US 2015/0111955, which is incorporated by reference herein in its entirety), or AAV9 vector, wherein the number following AAV indicates the AAV serotype. In some embodiments, the AAV vector is a single-stranded AAV (ssAAV). In some embodiments, the AAV vector is a double-stranded AAV (dsAAV). Any variant of an AAV vector or serotype thereof, such as a self-complementary AAV (scAAV) vector, is encompassed within the general terms AAV vector, AAV1 vector, etc. See, e.g., McCarty et al., Gene Ther. 2001; 8:1248-54, Naso et al., BioDrugs 2017; 31:317-334, and references cited therein for detailed discussion of various AAV vectors. In some embodiments, the AAV vector size is measured in length of nucleotides from ITR to ITR, inclusive of both ITRs. In some embodiments, the AAV vector is less than 5 kb in size from ITR to ITR, inclusive of both ITRs. In particular embodiments, the AAV vector is less than 4.9 kb from ITR to ITR in size, inclusive of both ITRs. In further embodiments, the AAV vector is less than 4.85 kb in size from ITR to ITR, inclusive of both ITRs. In further embodiments, the AAV vector is less than 4.8 kb in size from ITR to ITR, inclusive of both ITRs. In further embodiments, the AAV vector is less than 4.75 kb in size from ITR to ITR, inclusive of both ITRs. In further embodiments, the AAV vector is less than 4.7 kb in size from ITR to ITR, inclusive of both ITRs.
In some embodiments, the vector is an AAV9 vector. In some embodiments, the vector (e.g., viral vector, such as an adeno-associated viral vector) comprises a tissue-specific (e.g., muscle-specific) promoter, e.g., which is operatively linked to a sequence encoding the gRNA. In some embodiments, the muscle-specific promoter is a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, or an SPc5-12 promoter. In some embodiments, the muscle-specific promoter is a CK8 promoter. In some embodiments, the muscle-specific promoter is a CK8e promoter. Muscle-specific promoters are described in detail, e.g., in US2004/0175727 A1; Wang et al., Expert Opin Drug Deliv. (2014) 11, 345-364; Wang et al., Gene Therapy (2008) 15, 1489-1499. In some embodiments, the tissue-specific promoter is a neuron-specific promoter, such as an enolase promoter. See, e.g., Naso et al., BioDrugs 2017; 31:317-334; Dashkoff et al., Mol Ther Methods Clin Dev. 2016; 3:16081, and references cited therein for detailed discussion of tissue-specific promoters including neuron-specific promoters.
In some embodiments, in addition to guide RNA sequences, the vectors further comprise nucleic acids that do not encode guide RNAs. Nucleic acids that do not encode guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding an RNA-guided DNA nuclease, which can be a nuclease such as Cas9. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and trRNA.
Lipid nanoparticles (LNPs) are a known means for delivery of nucleotide and protein cargo, and may be used for delivery of the guide RNAs, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNPs deliver nucleic acid, protein, or nucleic acid together with protein.
In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA/LNP is also associated with SluCas9 or an mRNA encoding SluCas9.
In some embodiments, the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises SluCas9 or an mRNA encoding SluCas9.
Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and SluCas9 or an mRNA encoding SluCas9.
In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is encoded by a vector, associated with an LNP, or in aqueous solution. In some embodiments, the gRNA/LNP or gRNA is also associated with SluCas9 or sequence encoding SluCas9 (e.g., in the same vector, LNP, or solution).
In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA/LNP is also associated with or SaCas9 an mRNA encoding SaCas9.
In some embodiments, the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises SaCas9 or an mRNA encoding SaCas9.
Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and SaCas9 or an mRNA encoding SaCas9.
In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is encoded by a vector, associated with an LNP, or in aqueous solution. In some embodiments, the gRNA/LNP or gRNA is also associated with SaCas9 or sequence encoding SaCas9 (e.g., in the same vector, LNP, or solution).
Compositions Comprising Guide RNA (gRNAs)
Provided herein are compositions useful for treating DM1, e.g., comprising 1) one or more guide RNAs comprising one or more guide sequences of Table 2, or nucleic acids encoding same; and optionally 2) SluCas9 or a nucleic acid encoding SluCas9 (for SEQ ID Nos: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or SaCas9 or a nucleic acid encoding SaCas9 (for SEQ ID Nos: 200-259). Such compositions may be administered to subjects having or suspected of having DM1.
Also provided herein are compositions useful for excising trinucleotide repeats from DNA of DMPK, e.g., using two or more guide RNAs with SluCas9 or SaCas9. Pairs of guide RNAs are contemplated for use in excision methods and therefore any composition described below that comprises one guide RNA can be used in combination with another to achieve the intended purpose. Further, compositions comprising two or more guide RNAs are contemplated.
The compositions may comprise one or more guide RNAs or a vector(s) encoding one or more guide RNAs comprising a spacer sequence of any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, or 200-259 and may be administered to subjects having or suspected of having DM1, optionally with SluCas9 or a nucleic acid encoding SluCas9 (for SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or a SaCas9 or a nucleic acid encoding SaCas9 (for SEQ ID NOs: 200-259).
In some embodiments, a guide RNA is provided wherein the gRNA comprises a guide sequence of any one of SEQ ID NOs 5, 21, 46, 55, 59, 61, 64, 7, 19, 41, or 47.
In some embodiments, one or more gRNAs direct a SluCas9 to a site in or near a TNR. For example, the SluCas9 may be directed to cut within 10, 20, 30, 40, or 50 nucleotides of the TNR based on the sequence of the spacer sequence.
In some embodiments, a composition is provided comprising a guide RNA comprising a spacer sequence comprising a sequence selected from any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 or a nucleic acid encoding same, and optionally, a nucleic acid encoding a Staphylococcus lugdunensis (SluCas9). In some embodiments, a composition is provided comprising a gRNA encoding a spacer sequence comprising a sequence that is at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or or a nucleic acid encoding same, and optionally a gRNA encoding a Staphylococcus lugdunensis (SluCas9). In some embodiments, a composition is provided comprising a first nucleic acid encoding a spacer sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 and optionally a second nucleic acid encoding a Staphylococcus lugdunensis (SluCas9). In some embodiments, the composition comprises the second nucleic acid encoding a Staphylococcus lugdunensis (SluCas9).
In some embodiments, one or more guide RNAs and SluCas9 are provided on a single nucleic acid molecule. In some embodiments, the single nucleic acid molecule is a vector. In some embodiments, the vector expresses the guide RNA(s) and SluCas9. In some embodiments, the guide RNA(s) and SluCas9 are expressed from the same vector, but with different promoters. In some embodiments, the guide RNA(s) and SluCas9 are provided on two separate nucleic acid molecules. In some embodiments, two separate nucleic acid molecules are provided wherein the first comprises one or more sequences encoding a spacer sequence of a guide RNA (e.g., one or more copies of one or more different spacer sequences) and does not comprise a sequence encoding an endonuclease, and the second comprises a sequence encoding a SluCas9 or SaCas9 and optionally sequence(s) encoding one or more guide RNAs. In some embodiments, the nucleic acid molecules are vectors. In some embodiments, the vectors express one or more guide RNA and SluCas9.
In some embodiments, at least a pair of gRNAs are provided which direct a SluCas9 to a pair of sites flanking (i.e., on opposite sides of) a TNR in DMPK. For example, the pair of sites flanking a TNR may each be within 10, 20, 30, 40, or 50 nucleotides of the TNR but on opposite sides thereof. In some embodiments, a pair of gRNAs is provided that comprise SluCas9 guide sequences selected from SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, and 70 and direct a SluCas9 to a pair of sites according to any of the foregoing embodiments. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In some embodiments, a composition is provided comprising a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: a) a first spacer sequence selected from SEQ ID NOs: 21, 46, 55, 59, 61, or 64, and a second spacer sequence selected from SEQ ID NOs: 7, 19, 41, or 47; b) a first and second spacer sequence of SEQ ID NOs: 5 and 7; c) a first and second spacer sequence of SEQ ID NOs: 5 and 10; d) a first and second spacer sequence of SEQ ID NOs: 5 and 19; e) a first and second spacer sequence of SEQ ID NOs: 5 and 41; f) a first and second spacer sequence of SEQ ID NOs: 5 and 47; g) a first and second spacer sequence of SEQ ID NOs: 21 and 7; h) a first and second spacer sequence of SEQ ID NOs: 21 and 19; i) a first and second spacer sequence of SEQ ID NOs: 21 and 41; j) a first and second spacer sequence of SEQ ID NOs: 21 and 47; k) a first and second spacer sequence of SEQ ID NOs: 46 and 7; 1) a first and second spacer sequence of SEQ ID NOs: 46 and 10; m) a first and second spacer sequence of SEQ ID NOs: 46 and 19; n) a first and second spacer sequence of SEQ ID NOs: 46 and 41; o) a first and second spacer sequence of SEQ ID NOs: 46 and 47; p) a first and second spacer sequence of SEQ ID NOs: 55 and 7; q) a first and second spacer sequence of SEQ ID NOs: 55 and 19; r) a first and second spacer sequence of SEQ ID NOs: 55 and 41; s) a first and second spacer sequence of SEQ ID NOs: 55 and 47; t) a first and second spacer sequence of SEQ ID NOs: 59 and 7; u) a first and second spacer sequence of SEQ ID NOs: 59 and 19; v) a first and second spacer sequence of SEQ ID NOs: 59 and 41; w) a first and second spacer sequence of SEQ ID NOs: 59 and 47; x) a first and second spacer sequence of SEQ ID NOs: 61 and 7; y) a first and second spacer sequence of SEQ ID NOs: 61 and 10; z) a first and second spacer sequence of SEQ ID NOs: 61 and 19; aa) a first and second spacer sequence of SEQ ID NOs: 61 and 41; bb) a first and second spacer sequence of SEQ ID NOs: 61 and 47; cc) a first and second spacer sequence of SEQ ID NOs: 64 and 7; dd) a first and second spacer sequence of SEQ ID NOs: 64 and 19; ee) a first and second spacer sequence of SEQ ID NOs: 64 and 41; or ff) a first and second spacer sequence of SEQ ID NOs: 64 and 47.
In some embodiments, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence selected from SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, and a second spacer sequence selected from SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 3 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 5 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 6 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 9 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 10 and a second spacer sequence selected from any one of SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 16 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 21 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 22 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 25 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 26 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 30 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 36 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 38 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 39 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 40 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 46 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 51 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 53 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 55 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 56 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 58 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 59 and a second spacer sequence selected from any one of SEQ ID NOs: ID 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 61 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 62 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 64 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 66 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 70 and a second spacer sequence selected from any one of SEQ ID NOs: 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, 50, respectively.
In some embodiments, nucleotide sequences encoding two guide RNAs and a nucleotide sequence encoding SluCas9 are provided on a single nucleic acid molecule. In some embodiments, the single nucleic acid molecule is a vector. In some embodiments, the vector expresses the two guide RNAs and SluCas9. In some embodiments, the two guide RNAs are identical. In some embodiments, the two guide RNAs are not identical. In some embodiments, the two guide RNAs and SluCas9 are separately expressed, e.g., from their own promoters.
Each of the guide sequences shown in Table 2 at SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70 may further comprise additional nucleotides to form or encode a crRNA, e.g., using any known sequence appropriate for the SluCas9 being used. In some embodiments, the crRNA comprises (5′ to 3′) at least a spacer sequence and a first complementarity domain. The first complementary domain is sufficiently complementary to a second complementarity domain, which may be part of the same molecule in the case of an sgRNA or in a tracrRNA in the case of a dual or modular gRNA, to form a duplex. See, e.g., US 2017/0007679 for detailed discussion of crRNA and gRNA domains, including first and second complementarity domains. For sgRNA, a spacer sequence is typically followed (5′ to 3′) by a crRNA, a linker (e.g., GAAA), and a tracrRNA. The crRNA, linker, and tracrRNA is sometimes referred to herein and in the art as a “scaffold” sequence. See, for example, Briner et al. (2014) Mol. Cell 56: 333-339, incorporated herein in its entirety, and in particular, the generalized structure of a sgRNA at
in 5′ to 3′ orientation. Note that in these sequences, T's are representative of the DNA version, and with U's in an RNA version. In some embodiments, an exemplary sequence for use with SluCas9 to follow the 3′ end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 600, SEQ ID NO: 601, SEQ ID NO: 602, SEQ ID NO: 603, or SEQ ID NO: 604, or a sequence that differs from SEQ ID NO: 600 or SEQ ID NO: 601 or SEQ ID NO: 602, SEQ ID NO: 603, or SEQ ID NO: 604 by no more than 1, 2, 3, 4, 5, 10, 15, 20, or 25 nucleotides.
In some embodiments, a guide RNA is provided wherein the gRNA comprises a guide sequence of any one of SEQ ID Nos: 200-259.
In some embodiments, one or more gRNAs direct a SaCas9 to a site in or near a TNR. For example, the SaCas9 may be directed to cut within 10, 20, 30, 40, or 50 nucleotides of the TNR based on the sequence of the spacer sequence.
In some embodiments, a composition is provided comprising a guide RNA comprising a spacer sequence comprising a sequence selected from any one of SEQ ID NOs: 200-259, or a nucleic acid encoding same, and optionally a nucleic acid encoding a Staphylococcus aureus (SaCas9). In some embodiments, a composition is provided comprising a gRNA encoding a spacer sequence comprising a sequence that is at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs: 200-259, or a nucleic acid encoding same, and optionally a gRNA encoding a Staphylococcus aureus (SaCas9). In some embodiments, a composition is provided comprising a first nucleic acid encoding a spacer sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 200-259 and optionally a second nucleic acid encoding a Staphylococcus aureus (SaCas9). In some embodiments, the composition comprises the second nucleic acid encoding a Staphylococcus aureus (SaCas9).
In some embodiments, one or more guide RNAs and SaCas9 are provided on a single nucleic acid molecule. In some embodiments, the single nucleic acid molecule is a vector. In some embodiments, the vector expresses the guide RNA(s) and SaCas9. In some embodiments, the guide RNA and SaCas9 are expressed from the same vector, but with different promoters. In some embodiments, a guide RNA and SaCas9 are provided on two separate nucleic acid molecules. In some embodiments, two separate nucleic acid molecules are provided wherein the first comprises one or more sequences encoding a spacer sequence of a guide RNA and does not comprise a sequence encoding an endonuclease, and the second comprises a sequence encoding a SluCas9 or SaCas9 and optionally sequence(s) encoding one or more guide RNAs. In some embodiments, the nucleic acid molecules are vectors. In some embodiments, the vectors express one or more guide RNAs and SaCas9.
In some embodiments, at least a pair of gRNAs are provided which direct a SaCas9 to a pair of sites flanking (i.e., on opposite sides of) a TNR in DMPK. For example, the pair of sites flanking a TNR may each be within 10, 20, 30, 40, or 50 nucleotides of the TNR but on opposite sides thereof. In some embodiments, a pair of gRNAs is provided that comprise SaCas9 guide sequences selected from SEQ ID NOs: 200-259 and direct a SaCas9 to a pair of sites according to any of the foregoing embodiments. In some embodiments, the pair of gRNAs comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments, a composition is provided comprising a pair of guide RNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise: a) a first spacer sequence selected from SEQ ID NOs: 201 and 202, and a second spacer sequence selected from SEQ ID NOs: 206, 213, 218, and 224. In some embodiments, the pair of gRNAs comprises any one of the SEQ ID NO: 202 and SEQ ID NO: 218, SEQ ID NO: 202 and SEQ ID NO: 213, SEQ ID NO: 201 and SEQ ID NO: 224, or SEQ ID NO: 201 and SEQ ID NO: 206.
In some embodiments, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence selected from SEQ ID NOs: 201-203, 211, 215, 220, 225, 231, 235, 238, and 240-259, and a second spacer sequence selected from SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 201 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 202 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 203 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 211 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 215 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 220 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 225 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 231 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 235 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 238 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 240 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 240 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 241 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 242 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 243 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 244 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 245 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 246 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 247 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 248 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 249 and a second spacer sequence selected from any one of SEQ ID NOs: ID 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 250 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 251 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 252 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 253 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 254 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 255 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 256 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 257 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 258 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively. In one embodiment, a composition is provided comprising a pair of gRNAs comprising a pair of spacer sequences, or one or more vectors encoding the pair of guide RNAs, wherein the pair of spacer sequences comprise a first spacer sequence that is SEQ ID NO: 259 and a second spacer sequence selected from any one of SEQ ID NOs: 200, 204-210, 212-214, 216-219, 221-224, 226-230, 232-234, 236-237, and 239, respectively.
In some embodiments, nucleotide sequences encoding two guide RNAs and a nucleotide sequence encoding SaCas9 are provided on a single nucleic acid molecule. In some embodiments, the single nucleic acid molecule is a vector. In some embodiments, the vector expresses the two guide RNAs and SaCas9. In some embodiments, the two guide RNAs are identical. In some embodiments, the two guide RNAs are not identical. In some embodiments, the two guide RNAs and SaCas9 are separately expressed, e.g., from their own promoters.
Each of the guide sequences shown in Table 2 at SEQ ID NOs: 200-259 may further comprise additional nucleotides to form or encode a crRNA, e.g., using any known sequence appropriate for the SaCas9 being used. In some embodiments, the crRNA comprises (5′ to 3′) at least a spacer sequence and a first complementarity domain. The first complementary domain is sufficiently complementary to a second complementarity domain, which may be part of the same molecule in the case of an sgRNA or in a tracrRNA in the case of a dual or modular gRNA, to form a duplex. See, e.g., US 2017/0007679 for detailed discussion of crRNA and gRNA domains, including first and second complementarity domains. For sgRNA, a spacer sequence is typically followed (5′ to 3′) by a crRNA, a linker (e.g., GAAA), and a tracrRNA. The crRNA, linker, and tracrRNA is sometimes referred to herein and in the art as a “scaffold” sequence. See, for example, Briner et al. (2014) Mol. Cell 56: 333-339, incorporated herein in its entirety, and in particular, the generalized structure of a sgRNA at
An exemplary scaffold sequence suitable for use with SaCas9 to follow the guide sequence at its 3′ end is: GTTTAAGTACTCTGTGCTGGAAACAGCACAGAATCTACTTAAACAAGGCAAAATGCCGT GTTTATCTCGTCAACTTGTTGGCGAGA (SEQ ID NO: 500) in 5′ to 3′ orientation. In some embodiments, an exemplary scaffold sequence for use with SaCas9 to follow the 3′ end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 500, or a sequence that differs from SEQ ID NO: 500 by no more than 1, 2, 3, 4, 5, 10, 15, 20, or 25 nucleotides.
In some embodiments, if the composition comprises one or more nucleic acids encoding an RNA-targeted endonuclease and one or more guide RNAs, the one or more nucleic acids are designed such that they express the one or more guide RNAs at an equivalent or higher level (e.g., a greater number of expressed transgene copies) as compared to the expression level of the RNA-targeted endonuclease. In some embodiments, the one or more nucleic acids are designed such that they express (e.g., on average in 100 cells) the one or more guide RNAs at at least a 1.1, 1.2, 1.3, 1.4, or 1.5 times higher level (e.g., a greater number of expressed transgene copies) as compared to the expression level of the RNA-targeted endonuclease. In some embodiments, the one or more nucleic acids are designed such that they express the one or more guide RNAs at 1.01-1.5, 1.01-1.4, 1.01-1.3, 1.01-1.2, 1.01-1.1, 1.1-2.0, 1.1-1.8, 1.1-1.6, 1.1-1.4, 1.1-1.3, 1.2-2.0, 1.2-1.8, 1.2-1.6, 1.2-1.4, 1.4-2.0, 1.4-1.8, 1.4-1.6, 1.6-2.0, 1.6-1.8, or 1.8-2.0 times higher level (e.g., a greater number of expressed transgene copies) as compared to the expression level of the RNA-targeted endonuclease. In some embodiments, the one or more guide RNAs are designed to express a higher level than the RNA-targeted endonuclease by: a) utilizing one or more regulatory elements (e.g., promoters or enhancers) that express the one or more guide RNAs at a higher level as compared to the regulatory elements (e.g., promoters or enhancers) for expression of the RNA-targeted endonuclease; and/or b) expressing more copies of one or more of the guide RNAs as compared to the number of copies of the RNA-targeted endonuclease (e.g., 2× or 3× as many copies of the nucleotide sequences encoding the one or more guide RNAs as compared to the number of copies of the nucleotide sequences encoding the RNA-targeted endonuclease). For example, in some embodiments, the composition comprises multiple nucleic acid molecules (e.g., in multiple vectors), wherein for every nucleotide sequence encoding an RNA-targeted endonuclease in the nucleic acid molecules in the composition, there are two or three copies of the nucleotide sequence encoding the guide RNA in the nucleic acid molecules in the composition. In some embodiments, the composition comprises a first guide RNA and a second guide RNA, wherein the first guide RNA and the second guide RNA are not the same (e.g., any of the guide RNA pairs disclosed herein), and for every nucleotide sequence encoding an RNA-targeted endonuclease in the nucleic acid molecules in the composition, there are two or three copies of the nucleotide sequence encoding the first guide RNA and/or the second guide RNA.
In some embodiments, the disclosure provides for specific nucleic acid sequence encoding one or more guide RNA components (e.g., any of the spacer and or scaffold sequences disclosed herein). The disclosure contemplates RNA equivalents of any of the DNA sequences provided herein (i.e., in which “T”s are replaced with “U”s), as well as complements (including reverse complements) of any of the sequences disclosed herein. In general, in the case of a DNA vector encoding a gRNA, the U residues in any of the RNA sequences described herein may be replaced with T residues. In general, in the case of a given DNA sequence, the T residues may be replaced with U residues to depict the same sequence as a RNA sequence.
Provided herein are compositions comprising one or more guide RNAs or one or more nucleic acids encoding one or more guide RNAs comprising a guide sequence disclosed herein in Table 2.
SID means SEQ ID NO. In Table 2, the descriptions have the following meaning. A 5 or 3 indicates whether the guide directs cleavage 5′ or 3′ of the repeat region (in the orientation of the forward strand), followed by the genomic coordinates of the sequence (version GRCh38 of the human genome). Where a combination of guides is to be used to direct cleavage 5′ and 3′ of a repeat region, one skilled in the art can select a combination of a 5′ guide disclosed herein and a 3′ guide disclosed herein for a given target such as DMPK.
The following are guide sequences directed to DMPK: SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, 70, and 200-259.
In some embodiments, the disclosure provides a composition comprising one or more guide RNAs (gRNAs) comprising a guide sequence that directs SluCas9 to a target DNA sequence in or near the CTG repeat region in the myotonic dystrophy protein kinase gene (DMPK) associated with myotonic dystrophy type 1. In some embodiments, the invention provides two or more compositions each comprising a guide RNA (gRNA) comprising a guide sequence that directs SluCas9 or SaCas9 to a target DNA sequence in or near the CTG repeat region in the myotonic dystrophy protein kinase gene (DMPK) associated with myotonic dystrophy type 1. The gRNA may comprise a crRNA comprising a DMPK guide sequence shown in Table 2. The gRNA may comprise a crRNA comprising 20 contiguous nucleotides of a DMPK guide sequence shown in Table 2. In some embodiments, the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 20 contiguous nucleotides of a DMPK guide sequence shown in Table 2. In some embodiments, the gRNA comprises a crRNA comprising a sequence with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a guide sequence shown in Table 2. The gRNA may further comprise a trRNA. In each composition and method embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of sgRNAs, the crRNA and trRNA components may be covalently linked, e.g., via a phosphodiester bond or other covalent bond.
In each of the composition, use, and method embodiments described herein, the guide RNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.” The dgRNA comprises a first RNA molecule comprising a crRNA comprising, e.g., a guide sequence shown in Table 2, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex via the base pairing between portions of the crRNA and the trRNA.
In each of the composition, use, and method embodiments described herein, the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”. The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 2 covalently linked to a trRNA. The sgRNA may comprise 20 contiguous nucleotides of a guide sequence shown in Table 2. In some embodiments, the crRNA and the trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure via the base pairing between portions of the crRNA and the trRNA. In some embodiments, the crRNA and the trRNA are covalently linked via one or more bonds that are not a phosphodiester bond.
In some embodiments, the trRNA may comprise all or a portion of a trRNA sequence derived from a naturally-occurring CRISPR/Cas system. In some embodiments, the trRNA comprises a truncated or modified wild type trRNA. The length of the trRNA depends on the CRISPR/Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.
In some embodiments, a composition comprising one or more guide RNAs (or one or more vectors encoding one or more guide RNAs) is provided wherein the one or more gRNAs comprise a guide sequence of any one of SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 25, 26, 30, 36, 38, 39, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70; and a composition comprising one or more guide RNAs (or one or more vectors encoding one or more guide RNAs) wherein the one or more gRNAs comprise a guide sequence of any one of SEQ ID NOs 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In one aspect, the disclosure provides a composition comprising a gRNA or a vector encoding a gRNA that comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 3, 5, 6, 9, 16, 21, 22, 26, 30, 36, 38, 39, 40, 46, 51, 53, 55, 56, 58, 59, 61, 62, 64, 66, and 70; and a composition comprising a gRNA or a vector encoding a gRNA that comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs 1, 2, 4, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 23, 24, 27, 28, 29, 31, 32, 33, 34, 35, 37, 41, 42, 43, 44, 45, 47, 48, 49, and 50. In some embodiments, the pair of spacer sequences comprises SEQ ID NO: 5 and SEQ ID NO: 10, SEQ ID NO: 46 and SEQ ID NO: 10, SEQ ID NO: 61 and SEQ ID NO: 10, or SEQ ID NO: 64 and SEQ ID NO: 47.
In other embodiments, the composition comprises at least two gRNAs, or one or more vectors encoding at least two gRNAs, wherein the gRNAs comprise guide sequences selected from any two or more of the guide sequences of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70. In some embodiments, the composition comprises at least two gRNAs that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70.
Any type of vector, such as any of those described herein, may be used. In some embodiments, the composition comprises one or more vectors encoding one or more gRNAs described herein. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a non-integrating viral vector (i.e., that does not insert sequence from the vector into a host chromosome). In some embodiments, the viral vector is an adeno-associated virus vector, a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector. In some embodiments, the vector comprises a muscle-specific promoter. Exemplary muscle-specific promoters include a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, or an SPc5-12 promoter. See US 2004/0175727 A1; Wang et al., Expert Opin Drug Deliv. (2014) 11, 345-364; Wang et al., Gene Therapy (2008) 15, 1489-1499. In some embodiments, the muscle-specific promoter is a CK8 promoter. In some embodiments, the muscle-specific promoter is a CK8e promoter. In any of the foregoing embodiments, the vector may be an adeno-associated virus vector.
In some embodiments, the muscle specific promoter is the CK8 promoter. The CK8 promoter has the following sequence (SEQ ID NO. 700):
In some embodiments, the muscle-cell cell specific promoter is a variant of the CK8 promoter, called CK8e. The CK8e promoter has the following sequence (SEQ ID NO. 701):
The guide RNA compositions of the present invention are designed to recognize (e.g., hybridize to) a target sequence in or near a trinucleotide repeat, such as a trinucleotide repeat region in the DMPK gene. For example, the target sequence may be recognized and cleaved by SluCas9. In some embodiments, SluCas9 may be directed by a guide RNA to the target sequence, where the guide sequence of the guide RNA hybridizes with the target sequence and the SluCas9 cleaves the target sequence.
In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a target sequence present in the human gene of interest. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.
In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-targeted endonuclease, such as a Cas nuclease as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-targeted endonuclease, such as a Cas nuclease, is provided, used, or administered.
In some embodiments, the SluCas9 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 712:
In some embodiments, the SluCas9 is a variant of the amino acid sequence of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an Q at the position corresponding to position 781 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an R at the position corresponding to position 1013 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises a K at the position corresponding to position 781 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises a K at the position corresponding to position 966 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an H at the position corresponding to position 1013 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an Q at the position corresponding to position 781 of SEQ ID NO: 712; and an amino acid other than an R at the position corresponding to position 1013 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises a K at the position corresponding to position 781 of SEQ ID NO: 712; a K at the position corresponding to position 966 of SEQ ID NO: 712; and an H at the position corresponding to position 1013 of SEQ ID NO: 712.
In some embodiments, the SluCas9 comprises an amino acid other than an R at the position corresponding to position 246 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an N at the position corresponding to position 414 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than a T at the position corresponding to position 420 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an R at the position corresponding to position 655 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an amino acid other than an R at the position corresponding to position 246 of SEQ ID NO: 712; an amino acid other than an N at the position corresponding to position 414 of SEQ ID NO: 712; an amino acid other than a T at the position corresponding to position 420 of SEQ ID NO: 712; and an amino acid other than an R at the position corresponding to position 655 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 246 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 414 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 420 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 655 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 246 of SEQ ID NO: 712; an A at the position corresponding to position 414 of SEQ ID NO: 712; an A at the position corresponding to position 420 of SEQ ID NO: 712; and an A at the position corresponding to position 655 of SEQ ID NO: 712.
In some embodiments, the SluCas9 comprises an amino acid other than an R at the position corresponding to position 246 of SEQ ID NO: 712; an amino acid other than an N at the position corresponding to position 414 of SEQ ID NO: 712; an amino acid other than a T at the position corresponding to position 420 of SEQ ID NO: 712; an amino acid other than an R at the position corresponding to position 655 of SEQ ID NO: 712; an amino acid other than an Q at the position corresponding to position 781 of SEQ ID NO: 712; a K at the position corresponding to position 966 of SEQ ID NO: 712; and an amino acid other than an R at the position corresponding to position 1013 of SEQ ID NO: 712. In some embodiments, the SluCas9 comprises an A at the position corresponding to position 246 of SEQ ID NO: 712; an A at the position corresponding to position 414 of SEQ ID NO: 712; an A at the position corresponding to position 420 of SEQ ID NO: 712; an A at the position corresponding to position 655 of SEQ ID NO: 712; a K at the position corresponding to position 781 of SEQ ID NO: 712; a K at the position corresponding to position 966 of SEQ ID NO: 712; and an H at the position corresponding to position 1013 of SEQ ID NO: 712.
In some embodiments, the SluCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 713 (designated herein as SluCas9-KH or SLUCAS9KH):
In some embodiments, the SluCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 714 (designated herein as SluCas9-HF):
In some embodiments, the SluCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 715 (designated herein as SluCas9-HF-KH):
In some embodiments, the Cas protein is any of the engineered Cas proteins disclosed in Schmidt et al., 2021, Nature Communications, “Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleases.”
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 716 (designated herein as sRGN1):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 717 (designated herein as sRGN2):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 718 (designated herein as sRGN3):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 719 (designated herein as sRGN3.1):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 720 (designated herein as sRGN3.2):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 721 (designated herein as sRGN3.3):
In some embodiments, the Cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 722 (designated herein as sRGN4):
Modified gRNAs
In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally and/or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.” Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with “dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (v) replacement or modification of the ribose-phosphate backbone (an exemplary backbone modification); (vi) modification of the 3′ end or 5′ end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, cap or linker (such 3′ or 5′ cap modifications may comprise a sugar and/or backbone modification); and (vii) modification or replacement of the sugar (an exemplary sugar modification).
Chemical modifications such as those listed above can be combined to provide modified gRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase, or a modified sugar and a modified phosphodiester. In some embodiments, every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all, or substantially all, of the phosphate groups of an gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 5′ end of the RNA. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 3′ end of the RNA.
In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in a modified gRNA are modified nucleosides or nucleotides.
Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Accordingly, in one aspect the gRNAs described herein can contain one or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.
In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the wholesale replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
Examples of modified phosphate groups include, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp). The backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.
The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification. For example, the 2′ hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents. In some embodiments, modifications to the 2′ hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2′-alkoxide ion.
Examples of 2′ hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20). In some embodiments, the 2′ hydroxyl group modification can be 2′-O-Me. In some embodiments, the 2′ hydroxyl group modification can be a 2′-fluoro modification, which replaces the 2′ hydroxyl group with a fluoride. In some embodiments, the 2′ hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2′ hydroxyl can be connected, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge, to the 4′ carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2)n-amino, (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) In some embodiments, the 2′ hydroxyl group modification can include “unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2′-C3′ bond. In some embodiments, the 2′ hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).
“Deoxy” 2′ modifications can include hydrogen (i.e. deoxyribose sugars, e.g., at the overhang portions of partially dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2— amino (wherein amino can be, e.g., as described herein), —NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino as described herein.
The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form, e.g. L-nucleosides.
The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
In embodiments employing a dual guide RNA, each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA and/or tracr RNA. In embodiments comprising an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, and/or internal nucleosides may be modified, and/or the entire sgRNA may be chemically modified. Certain embodiments comprise a 5′ end modification. Certain embodiments comprise a 3′ end modification.
Modifications of 2′-O-methyl are encompassed.
Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2′-fluoro (2′-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability. Modifications of 2′-fluoro (2′-F) are encompassed.
Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.
Abasic nucleotides refer to those which lack nitrogenous bases.
Inverted bases refer to those with linkages that are inverted from the normal 5′ to 3′ linkage (i.e., either a 5′ to 5′ linkage or a 3′ to 3′ linkage).
An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5′ nucleotide via a 5′ to 5′ linkage, or an abasic nucleotide may be attached to the terminal 3′ nucleotide via a 3′ to 3′ linkage. An inverted abasic nucleotide at either the terminal 5′ or 3′ nucleotide may also be called an inverted abasic end cap.
In some embodiments, one or more of the first three, four, or five nucleotides at the 5′ terminus, and one or more of the last three, four, or five nucleotides at the 3′ terminus are modified. In some embodiments, the modification is a 2′-O-Me, 2′-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art to increase stability and/or performance.
In some embodiments, the first four nucleotides at the 5′ terminus, and the last four nucleotides at the 3′ terminus are linked with phosphorothioate (PS) bonds.
In some embodiments, the first three nucleotides at the 5′ terminus, and the last three nucleotides at the 3′ terminus comprise a 2′-O-methyl (2′-O-Me) modified nucleotide. In some embodiments, the first three nucleotides at the 5′ terminus, and the last three nucleotides at the 3′ terminus comprise a 2′-fluoro (2′-F) modified nucleotide.
In some embodiments, a composition is encompassed comprising one or more gRNAs comprising one or more guide sequences from Table 2 and SluCas9 (for SEQ ID NOs: 1-51, 53, 55-56, 58-59, 61-62, 64, 66, or 70) or SaCas9 (for SEQ ID NOs: 200-259).
In some embodiments, the gRNA together with SluCas9 is called a ribonucleoprotein complex (RNP).
In some embodiments, a chimeric SluCas9 or SaCas9 is used, where one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, a domain may be replaced with a domain from a different nuclease such as Fok1. In some embodiments, SluCas9 or SaCas9 may be a modified nuclease.
In some embodiments, the SluCas9 or SaCas9 is modified to contain only one functional nuclease domain. For example, the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity.
In some embodiments, a conserved amino acid within SluCas9 or SaCas9 is substituted to reduce or alter nuclease activity. In some embodiments, SluCas9 or SaCas9 may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain.
In some embodiments, the SluCas9 or SaCas9 lacks cleavase activity. In some embodiments, the SluCas9 or SaCas9 comprises a dCas DNA-binding polypeptide. A dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase/nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-targeted endonuclease lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 2014/0186958 A1; US 2015/0166980 A1 relating to other species of Cas9 that may be used for guidance.
In some embodiments, the SluCas9 or SaCas9 comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).
In some embodiments, the heterologous functional domain may facilitate transport of the SluCas9 or SaCas9 into the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the SluCas9 or SaCas9 may be fused with 1-10 NLS(s). In some embodiments, the SluCas9 or SaCas9 may be fused with 1-5 NLS(s). In some embodiments, the SluCas9 or SaCas9 may be fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the SluCas9 or SaCas9 sequence. It may also be inserted within the SluCas9 or SaCas9 sequence. In other embodiments, the SluCas9 or SaCas9 may be fused with more than one NLS. In some embodiments, the SluCas9 or SaCas9 may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the SluCas9 or SaCas9 may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the SluCas9 or SaCas9 is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the SluCas9 or SaCas9 may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, the SluCas9 may be fused with 3 NLSs. In some embodiments, the SluCas9 or SaCas9 may be fused with no NLS.
In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the SluCas9 or SaCas9. In some embodiments, the half-life of the SluCas9 or SaCas9 may be increased. In some embodiments, the half-life of the SluCas9 or SaCas9 may be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the SluCas9 or SaCas9. In some embodiments, the heterologous functional domain may be capable of reducing the stability of the SluCas9 or SaCas9. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the SluCas9 may be modified by addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal-precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire,), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein. In other embodiments, the marker domain may be a purification tag and/or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AUS, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6×His, 8×His, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.
In additional embodiments, the heterologous functional domain may target the SluCas9 to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the SluCas9 or SaCas9 to muscle.
In further embodiments, the heterologous functional domain may be an effector domain. When the SluCas9 or SaCas9 is directed to its target sequence, e.g., when SluCas9 or SaCas9 is directed to a target sequence by a gRNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be chosen from a nucleic acid binding domain or a nuclease domain (e.g., a non-Cas nuclease domain) In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, e.g., U.S. Pat. No. 9,023,649.
In some embodiments, the SluCas9 is any of the modified SluCas9 polypeptides as described in WO2020186059, WO2019118935, or WO2019183150, incorporated herein in their entirety and as discussed in more detail in the definitions section and provided in the Table of Additional Sequences.
Determination of Efficacy of gRNAs
In some embodiments, the efficacy of a gRNA is determined when delivered or expressed together with other components forming an RNP. In some embodiments, the gRNA is expressed together with SluCas9. In some embodiments, the gRNA is delivered to or expressed in a cell line that already stably expresses SluCas9 or SaCas9. In some embodiments the gRNA is delivered to a cell as part of a RNP. In some embodiments, the gRNA is delivered to a cell along with a mRNA encoding SluCas9 or SaCas9.
As described herein, use of SluCas9 or SaCas9 and a pair of guide RNAs disclosed herein can lead to double-stranded breaks in the DNA which can produce excision of a trinucleotide repeat upon repair by cellular machinery. In some embodiments, a pair of guide RNAs can both excise a portion of a genome and function independent of excision such that a pair of guides has both dual and single-cut efficacy.
In some embodiments, the efficacy of particular gRNAs is determined based on in vitro models. In some embodiments, the in vitro model is a cell line containing a target trinucleotide repeat, such as any such cell line described in the Example section below.
In some embodiments, the efficacy of particular gRNAs is determined across multiple in vitro cell models for a gRNA selection process. In some embodiments, a cell line comparison of data with selected gRNAs is performed. In some embodiments, cross screening in multiple cell models is performed.
In some embodiments, the efficacy of particular gRNAs is determined based on in vivo models. In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mouse which expresses a gene comprising an expanded trinucleotide repeat. The gene may be the human version or a rodent (e.g., murine) homolog of the DMPK gene. In some embodiments, the gene is human DMPK. In some embodiments, the gene is a rodent (e.g., murine) homolog of DMPK. In some embodiments, the in vivo model is a non-human primate, for example cynomolgus monkey.
In some embodiments, the efficacy of a guide RNA is measured by an amount of excision of a trinucleotide repeat of interest. The amount of excision may be determined by any appropriate method, e.g., quantitative sequencing; quantitative PCR; quantitative analysis of a Southern blot; etc.
The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way.
A. Materials and Methods
Guide and Primer sequences. Primer sequences are shown in the Table of Additional Sequences. The crRNA and tracrRNA used for gRNAs with SluCas9 was
The crRNA and tracrRNA used for gRNAs with SaCas9
Preparation and Electroporation of DM1 iPSC Cell Lines. SB1 Cell Line: Cells were isolated from peripheral blood mononuclear cells from an adult female DM1 patient (source of cells from Nicholas E. Johnson (Virginia Commonwealth University)) and reprogrammed with the CytoTune®-iPS Sendai reprogramming kit. Individual iPSC clones were isolated, including clone SB1. The SB1 cell line had a pluripotency signature consistent with an iPSC cell line by Nanostring assay. High resolution aCGH karyotyping revealed no gross genomic abnormalities. Southern analysis confirmed that the SB1 cell line contains a pathogenic CTG repeat expansion (˜300 CTG repeats) (
Electroporation of DM1 iPSC cells: DM1 iPSC cells (200,000 per reaction) were mixed with RNPs prepared as follows.
Broadly, RNP complexes for the experiment corresponding to
RNP complexes for the experiment corresponding to
Cells were electroporated with a Lonza Nucleofector (CA-137 setting) and harvested 72 hours post electroporation. Genomic DNA was isolated and used as template for subsequent PCR for TIDE analysis and ddPCR deletion analysis.
Differentiation Protocol for DM1 Cardiomyocytes. DM1 cardiomyocytes were prepared from the DM1 iPSC cell line SB1. Cells were activated with Wnt (4 μM CHIR) for 2 days, followed by Wnt inactivation (4 μM WNT-059) for 2 days. Cells were rested for a recovery period in CDM3 media for 6 days. Cells were then transferred to CDM3-no glucose media for metabolic selection for 2 days.
RNP complexes for experiments corresponding to
Cells were electroporated a with Lonza Nucleofector (CA-137 setting) and incubated in iCell Maintenance Media. Cells were harvested 72 hours post electroporation. Genomic DNA was isolated and used as template for subsequent PCR for TIDE analysis and ddPCR deletion analysis.
Sequencing and TIDE Analysis. PCR was performed on genomic DNA as follows.
PCR Sample:
PCR Conditions:
PCR products were cleaned up using AMPure bead-based PCR purification (Beckman Coulter). The AMPure bead bottle was vortexed and aliquoted into a falcon tube. Following incubation for 30 minutes at room temperature, 85 μL of beads were added to each well of PCR products, pipetted up and down 10 times and incubated for 10 minutes. The bead mixture was then placed on a magnet for 5 minutes. Liquid was aspirated, and beads were washed twice with 70% EtOH while keeping the plate on the magnet. The plate was then removed from the magnet and 20 μL of dH2O was added to the beads and pipetted up and down to mix. Following incubation for 5-10 minutes, the plate was placed on the magnet for 1 minute. The dH2O containing the DNA was removed and PCR concentrations were analyzed on by nanodrop.
PCR products were sent for sequenced using Forward Primer (SEQ ID NO: 101) and Reverse Primer (SEQ ID NO: 102). Indel values were estimated using the TIDE analysis algorithm. TIDE is a method based on the recovery of indels' spectrum from the sequencing electrophoretograms to quantify the proportion of template-mediated editing events (Brinkman, E A et al. (2014) Nucleic Acids Res. 42: e168; PMID: 25300484).
Two Loss-of-Signal (LOS) Droplet Digital PCR (ddPCR) Assay. The loss-of-signal ddPCR assay amplifies a region of the 3′ UTR of DMPK that is 5′ of the CTG repeat region or 3′ of the CTG region and detects the loss-of-signal of a probe targeting the amplified region as a result of successful deletion of the CTG repeat region (see
For the 5′ LOS ddPCR assay, Forward Primer (SEQ ID NO: 103), Reverse Primer (SEQ ID NO: 104), and Probe (SEQ ID NO: 105) were used.
For the 3′ LOS ddPCR assay, Forward Primer (SEQ ID NO: 106), Reverse Primer (SEQ ID NO: 107), and Probe (SEQ ID NO: 108) were used.
The ddPCR samples were setup at room temperature. DNA samples were diluted to a concentration of 10-20 ng/μL Diluted DNA (4 μL) was added to 21 μL of ddPCR mix.
ddPCR Mix:
The plate was sealed with a heat seal and mixed by vortexing, and then centrifuged briefly. The final volume was 25 μL.
The samples were transferred to a 96 well plate for auto digital generation. Droplets (40 μL) were generated and the plate was transferred to the PCR machine.
A three-step cycling protocol was run:
The reference gene used for 5′ and 3′ loss-of-signal (LOS) ddPCRs was RPP30.
B. Results
1. Screening of SluCas9 gRNAs
To assess editing efficiency of individual gRNAs, 61 gRNAs were selected for screening in the wildtype iPSC cell line. The wildtype iPSC cells used, cell line number 0052, is a GMP-grade iPSC line available through Rutgers University Cell and DNA Repository.
Cells were transfected with RNPs containing individual guide RNAs and SluCas9 using electroporation with a Lonza Nucleofector. Genomic DNA was isolated from the cells and amplified by PCR. Sanger sequencing and TIDE analysis were used to quantify the frequency of indels generated by each sgRNA. Results are shown as % editing efficiency by TIDE analysis (Table 3,
2. Screening of SluCas9 gRNA Pairs in DM1 iPSC Cells
Seven upstream gRNAs (SEQ ID NOs: 5, 21, 46, 55, 59, 61, and 64) and four downstream gRNAs (SEQ ID NOs: 7, 9, 41, and 47) were selected for evaluation of CTG repeat region deletion in DM1 iPSC SB1 cells with SluCas9.
Specifically, the following pairs of gRNAs were tested: SEQ ID NOs: 5 and 7; SEQ ID NOs: 5 and 9; SEQ ID NOs: 5 and 41; SEQ ID NOs: 5 and 47; SEQ ID NOs: 21 and 7; SEQ ID NOs: 21 and 9; SEQ ID NOs: 21 and 41; SEQ ID NOs: 21 and 47; SEQ ID NOs: 46 and 7; SEQ ID NOs: 46 and 9; SEQ ID NOs: 46 and 41; SEQ ID NOs: 46 and 47; SEQ ID NOs: 55 and 7; SEQ ID NOs: and 9; SEQ ID NOs: 55 and 41; SEQ ID NOs: 55 and 47; SEQ ID NOs: 59 and 7; SEQ ID NOs: 59 and 9; SEQ ID NOs: 59 and 41; SEQ ID NOs: 59 and 47; SEQ ID NOs: 61 and 7; SEQ ID NOs: 61 and 9; SEQ ID NOs: 61 and 41; SEQ ID NOs: 61 and 47; SEQ ID NOs: 64 and 7; SEQ ID NOs: 64 and 9; SEQ ID NOs: 64 and 41; and SEQ ID NOs: 64 and 47.
The percentage of CTG repeat region deletion for SluCas9 gRNA pairs and individual SluCas9 gRNAs is shown in
The percentage of dual deletion in SB1 iPSCs for SluCas9 gRNA pairs is shown in Table 5 based on results from MS1 deletion screen.
The percentage of CTG repeat region deletion for selected SluCas9 gRNA pairs is shown in Table 6 and 7, and
3. Screening of SluCas9 gRNA Pairs in DM1 Cardiomyocytes
Three upstream gRNAs (SEQ ID NOs: 5, 46, and 61) and one downstream gRNA (SEQ ID NO: 10) were selected for evaluation of CTG repeat region deletion in DM1 cardiomyocyte cells with SluCas9.
Specifically, the following pairs of gRNAs were tested: SEQ ID NOs: 5 and 10; SEQ ID NOs: 46 and 10; and SEQ ID NOs: 61 and 10.
The percentage of CTG repeat region deletion for selected SluCas9 gRNA pairs is shown in
4. Screening of SaCas9 gRNAs
To assess editing efficiency of individual saCas9 gRNAs, 58 saCas9gRNAs were selected for screening in the wildtype iPSC cell line. The wildtype iPSC cells used, cell line number 0052, is a GMP-grade iPSC line available through Rutgers University Cell and DNA Repository.
Cells were transfected with RNPs containing individual guide RNAs and SaCas9 using electroporation with a Lonza Nucleofector. Genomic DNA was isolated from the cells and amplified by PCR. Sanger sequencing and TIDE analysis were used to quantify the frequency of indels generated by each sgRNA. Results are shown as % editing efficiency by TIDE analysis (Table 9,
5. Screening of SaCas9 gRNA Pairs in DM1 iPSC Cells
Two upstream gRNAs (SEQ ID NOs: 201 and 202 (Sa2 and Sa3)) and four downstream gRNAs (SEQ ID NOs: 206 (Sa7), Sa14, Sa19, and Sa25) were selected for evaluation of CTG repeat region deletion in DM1 iPSC SB1 cells with SaCas9.
Specifically, the following pairs of gRNAs were tested: SEQ ID NOs: 202 and 218 (Sa3 and Sa19); SEQ ID NOs: 201 and 224 (Sa2 and Sa25); SEQ ID NOs: 202 and 206 (Sa3 and Sa7); and SEQ ID NOs: 202 and 213 (Sa3 and Sa14).
The percentage of CTG repeat region deletion for SaCas9 gRNA pairs and individual SaCas9 gRNAs is shown in
The percentage of dual deletion in SB1 iPSCs for SaCas9 gRNA pairs is shown in Table 11 based on results from MS1 deletion screen.
The percentage of CTG repeat region deletion for selected SaCas9 gRNA pairs is shown in Table 12 and 13, and
6. Screening of SaCas9 gRNA Pairs in DM1 Cardiomyocytes
One upstream gRNA (SEQ ID NO: 3) and two downstream gRNAs (SEQ ID NOs: 14 and 19) were selected for evaluation of CTG repeat region deletion in DM1 cardiomyocyte cells with SaCas9.
Specifically, the following pairs of gRNAs were tested: SEQ ID NOs: 3 and 19; and SEQ ID NOs: 3 and 14.
The percentage of CTG repeat region deletion for selected SaCas9 gRNA pairs is shown in
This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about,” to the extent they are not already so modified. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
It is noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the,” and any singular use of any word, include plural referents unless expressly and unequivocally limited to one referent. As used herein, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items.
Staphylococcus
pasteuri Cas9
Staphylococcus
microti Cas9
Staphylococcus
hyicus Cas9
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
Staphylococcus
lugdunensis mini-
Staphylococcus
pasteuri mini-
Staphylococcus
hyicus mini-
Staphylococcus
microti mini-
This application claims the benefit of priority to U.S. Provisional Application No. 63/110,579, filed Nov. 6, 2020, which is incorporated by reference in its entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/058157 | 11/5/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63110579 | Nov 2020 | US |
