This application is a national stage filing under 35 U.S.C. 371 of International Application No. PCT/US2007/078785, filed Sep. 18, 2007, which claims priority to U.S. Provisional Application No. 60/825,983, filed Sep. 18, 2006, which is incorporated herein by reference in its entirety.
Influenza virus infection, particularly avian influenza H5N1, presents a mounting health and economic concern. Evidence clearly indicates that H5N1 is continuing to circulate between susceptible birds and swine in widening regions of the world. Many scientists believe that if left unchecked, the current H5N1 avian influenza will mutate to allow for human to human transmission and cause a world-wide pandemic. With a mortality rate of over 50%, such an outbreak would be devastating. Regardless of the ability of the virus to cause human disease, avian influenza H5N1 is already threatening to have a huge economic impact due to the eradication of poultry flocks in affected areas. Therefore, development of a vaccine to protect humans, poultry, swine and other domesticated animals from H5N1 influenza is needed. An influenza vaccine that is capable of protecting against H5N1 as well as other influenza viruses would be optimal.
Salmonella enteritidis 13A strains having ATCC deposit numbers PTA-7871, PTA-7872 or PTA-7873 are disclosed. Also disclosed is a composition comprising an attenuated Salmonella strain and a pharmaceutically acceptable carrier.
In another aspect, methods of enhancing an immune response in a subject by administering a vaccine vector to the subject are provided. A polynucleotide encoding a polypeptide of CD154 capable of binding CD40, the polypeptide having fewer than 50 amino acids and comprising amino acids 140-149 of SEQ ID NO:26 or a homolog thereof. The vaccine vector is administered to the subject in an amount effective to enhance the immune response of the subject to the vaccine.
In a further aspect, methods of enhancing the immune response against Influenza A in a subject by administering to the subject a bacterium comprising a polynucleotide encoding a polypeptide of Influenza A M2e protein in an amount effective to enhance the immune response of the subject to Influenza A are provided.
In yet another aspect, methods of reducing the morbidity associated with Influenza A infection in a subject by administering to the subject a bacterium comprising a polynucleotide encoding a polypeptide of Influenza A M2e protein in an amount effective to reduce the morbidity associated with a subsequent infection with Influenza A are provided.
In still another aspect, methods of generating site-specific mutations in a bacterium are provided. A first polynucleotide comprising a counter-selection marker and an antibiotic resistance marker flanked by polynucleotides homologous to the sequences flanking a mutation site in the chromosome of the bacterium is generated. The first polynucleotide is then introduced into the bacterium and after homologous recombination and antibiotic selection an intermediate is isolated. A second polynucleotide comprising the mutation flanked by polynucleotides homologous to sequences flanking the mutation site is generated. The second polynucleotide is then introduced into the intermediate and the site-specific mutant is isolated by counter-selecting for loss of the counter-selection marker.
In a still further aspect, methods for developing bacterial vaccine vectors are provided. A bacterium capable of colonizing a subject is selected. The bacterium is attenuated and a polynucleotide comprising a sequence encoding a polypeptide of CD154 capable of binding to CD40 is incorporated into the bacterium.
Recombinant DNA technologies enable relatively easy manipulation of many bacterial and viral species. Some bacteria and viruses are mildly or non-pathogenic, but are capable of generating a robust immune response. These bacteria and viruses make attractive vaccine vectors for eliciting an immune response to a heterologous or foreign antigen. Bacterial or viral vaccine vectors may mimic the natural infection and produce robust and long lasting immunity. Vaccine vectors are often relatively inexpensive to produce and administer. In addition, such vectors can often carry more than one antigen and may provide protection against multiple infectious agents.
In one aspect, this invention relates to the use of Salmonella vectors in vaccination and generation of immune responses against Salmonella and other pathogenic agents. Salmonella strains make suitable vaccine vectors because of the ability to make bacteria capable of expressing heterologous polypeptides. In addition, bacterial genes may be mutated or attenuated to create bacteria with low to no pathogenesis to the infected or immunized subject, while maintaining immunogenicity.
The ability of the Salmonella to survive the gastrointestinal tract of the host and give rise to a mucosal immune response is documented. Oral vaccines using a Salmonella vector produce a robust mucosal immune response and are relatively easy to administer to both animals and humans. Many of the current Salmonella vaccine strains are not as effective in generating a strong protective immune response as compared to their more virulent counterparts. A Salmonella strain that could be used for effective mucosal, e.g., oral, vaccination would provide a vector that could be used to readily vaccinate a subject against one or more pathogenic agents, such as H5N1 influenza.
A Salmonella enteritidis strain useful as a vaccine vector, and various recombinant vaccine vectors made using this strain, are described. Specifically, a vaccine vector carrying the M2e epitope of Influenza A virus is provided. In addition, methods of developing vaccine vectors and methods of enhancing an immune response in a subject by administering a vaccine vector comprising a polynucleotide encoding a polypeptide of CD154 or a homolog thereof that is capable of binding to CD40 are disclosed. The vaccine vectors may be used to enhance an immune response against Influenza A or to reduce the morbidity associated with Influenza A infection. Finally, a method of generating site-specific mutations in a bacterium using the Red recombination system in conjunction with overlapping extension PCR to generate mutants containing no extraneous DNA is provided.
A wild-type isolate of Salmonella, Salmonella enteritidis 13A (SE13A) (deposited with the American Type Culture Collection (ATCC) on Sep. 13, 2006, deposit number PTA-7871), was selected based upon its unusual ability to cause mucosal colonization and submucosal translocation in chickens, permitting robust presentation of associated antigens or epitopes in commercial chickens. Importantly, this wild-type Salmonella isolate causes no clinically detectable disease or loss of performance in commercial chickens, indicating little disease-causing potential of the wild-type Salmonella in vertebrate animals. The ability of an organism to colonize a subject, such as a chicken, is indicated by the ability of the organism to replicate at the site of infection. Optimally, a vaccine candidate can also invade and spread to tissues beyond the infection site. As demonstrated in Example 4, SE13A is capable of replication in the cecal tonsils after oral infection and can be isolated from the tonsils for weeks after infection. In addition, SE13A can invade other tissues, and is found in the liver and the spleen up to a month after infection.
The SE13A isolate may be further attenuated by inactivating at least one gene necessary for sustained replication of the bacteria outside of laboratory or manufacturing conditions. Attenuated Salmonella strains that can be used as vaccine vectors are described below. SE13A was used to generate attenuated Salmonella strains to develop vaccines and generate enhanced immune responses. As demonstrated in the Examples, SE13A is invasive, non-pathogenic for poultry and causes no measurable morbidity. These features result in an enhanced immune response as compared to non-invasive bacterial vectors. Attenuation of SE13A by mutation of genes that limit the ability of the bacterium to spread may increase the safety of the vaccine. As demonstrated in the Examples at Table 4, SE13A strains with mutations in aroA or htrA retain the ability to generate an immune response, but have limited replication in the host. Thus, the attenuation increases the safety of the vaccine vector without compromising the immunogenicity.
Mutations may be made in a variety of other Salmonella genes including, but not limited to, cya, crp, asd, cdt, phoP, phoQ, ompR, outer membrane proteins, dam, htrA or other stress related genes, aro, pur and gua. As shown in the Examples, mutations in aroA and htrA were found to attenuate SE13A. The aro genes are enzymes involved in the shikimate biosynthesis pathway or the aromatase pathway and aro mutants are auxotrophic for the aromatic amino acids tryptophan, tyrosine and phenylalanine. htrA is a stress response gene that encodes a periplasmic protease that degrades aberrant proteins. Mutants in htrA are also attenuated and display increased sensitivity to hydrogen peroxide.
The mutations in aroA and htrA described in the Examples are deletion mutations, but the mutations can be made in a variety of ways. Suitably, the mutations are non-reverting mutations that cannot be repaired in a single step. Suitable mutations include deletions, inversions, insertions and substitutions. A vaccine vector may include more than one mutation, for example a vaccine vector may contain mutations in both aroA and htrA. Methods of making such mutations are well known in the art.
SE13A or the attenuated recombinant SE13A derivatives may be used as vaccine vectors. Polynucleotides encoding polypeptide epitopes from any number of pathogenic organisms may be inserted into the bacteria and expressed by the bacteria to generate antigenic polypeptides. The polynucleotides may be inserted into the chromosome of the bacteria or encoded on plasmids or other extrachromosomal DNA. Suitably, polynucleotides encoding epitopes are inserted into a bacterial polynucleotide that is expressed. Suitably, the bacterial polynucleotide encodes a transmembrane protein, and the polynucleotide encoding the epitope is inserted into the bacterial polynucleotide sequence to allow expression of the epitope on the surface of the bacteria. For example, the polynucleotide encoding the epitope may be inserted in frame into the bacterial polynucleotide in a region encoding an external loop region of a transmembrane protein such that the bacterial polynucleotide sequence remains in frame. See Example 1.
Alternatively, the polynucleotide encoding the epitope may be inserted into a secreted polypeptide. Those of skill in the art will appreciate that the polynucleotide encoding the epitope could be inserted in a wide variety of bacterial polynucleotides to provide expression and presentation of the epitope to the immune cells of a subject treated with the bacterial vaccine vector. In the Examples, an Influenza A virus M2e epitope was inserted into loop 9 of the lamB gene of SE13A and surface expression of the epitope was confirmed by antibody-mediated precipitation. The polynucleotide encoding an epitope may be included in a single copy or more than one copy. In the Examples, a bacterial vaccine vector containing multiple copies of the M2e epitope inserted into loop 9 of lamB is described. Alternatively, multiple copies of an epitope may be inserted into the bacterial vaccine vector at more than one location.
Polynucleotides encoding polypeptides that are homologous to proteins of the subject and capable of stimulating the immune system to respond to the foreign epitope may also be inserted into a vaccine vector. As described in more detail below, a vaccine vector may include a CD154 polypeptide that is capable of binding CD40 in the subject and stimulating the subject to respond to the vaccine vector and its associated foreign epitope. As described above with regard to epitopes, these polynucleotides may be inserted into the chromosome of the vaccine vector or maintained extrachromosomally. One of skill in the art will appreciate that these polypeptides can be inserted in a variety of polynucleotides and expressed in different parts of the vaccine vector or may be secreted. The polynucleotide encoding a CD154 polypeptide capable of enhancing the immune response to a foreign epitope may also encode the foreign epitope. The polynucleotide encoding a CD154 polypeptide may be linked to the polynucleotide encoding the epitope, such that in the vaccine vector the CD154 polypeptide and the foreign epitope are present on the same polynucleotide. In the Examples, a polynucleotide encoding a polypeptide of CD154 that is capable of binding to CD40 also encodes the M2e epitope of Influenza A. See SEQ ID NOS: 8 and 9 in the attached sequence listing. In the Examples, the polynucleotide encoding the M2e epitope and the polynucleotide encoding the CD154 polypeptide are both inserted in loop 9 of the lamB gene. Those of skill in the art will appreciate that bacterial polynucleotides encoding other transmembrane proteins and other loops of the lamB gene may also be used.
The SE13A bacteria may include a polynucleotide encoding a polypeptide of the influenza M2 protein. The ectodomain of the Influenza A virus M2 protein, known as M2e, protrudes from the surface of the virus. The M2e portion of the M2 protein contains about 24 amino acids. The M2e polypeptide varies little from one isolate to the next within a given species. In fact, only a few naturally occurring mutations in M2e have been isolated from infected humans since the 1918 flu epidemic. In addition, influenza viruses isolated from avian and swine hosts have different, yet still conserved, M2e sequences. For reviews of the M2e polypeptide sequences isolated from human, avian and swine hosts see Liu et al., Microbes and Infection 7:171-177 (2005) and Reid et al., J. Virol. 76:10717-10723 (2002) each of which are incorporated herein by reference in its entirety. See also SEQ ID NO: 1-4 in the attached sequence listing.
Suitably a polynucleotide encoding the entire M2e polypeptide may be inserted into the vaccine vector or only a portion may be used. In the Examples, an eight amino acid polypeptide (LM2 having amino acid sequence: EVETPIRN, SEQ ID NO:5 or its variant M2eA having amino acid sequence EVETPTRN, SEQ ID NO:20) was incorporated into SE13A and demonstrated to produce an antibody response after administration to chickens. Suitably, the portion of the M2e polypeptide inserted into the vaccine vector is immunogenic. An immunogenic fragment is a peptide or polypeptide capable of eliciting a cellular or humoral immune response. Suitably, an immunogenic fragment of M2e may be the full-length M2e polypeptide, or suitably may be 20 or more amino acids, 15 or more amino acids, 10 or more amino acids or 8 or more amino acids of the full-length sequence.
Other suitable epitopes for inclusion in an Influenza A vaccine vector include, but are not limited to, polynucleotides encoding polypeptides of the hemagglutinin or the nuclear protein of Influenza A. For example, polynucleotides encoding SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 may be included in a vaccine vector. One of skill in the art will appreciate that any of these sequences may be used in combination with any other epitope and may also be used in conjunction with polypeptides encoding immune stimulatory peptides such as a polypeptide of CD154.
As discussed above, a polynucleotide encoding a polypeptide homologous to a protein of the subject that is capable of enhancing the immune response to the epitope may be included in the vaccine vector. In the Examples, SE13A strains including a polynucleotide encoding a CD154 polypeptide capable of binding to CD40 were demonstrated to enhance the immune response to the M2e epitope as measured by increased antibody production in response to vaccination. Suitably, the CD154 polypeptide is fewer than 50 amino acids long, more suitable fewer than 40, fewer than 30 or fewer than 20 amino acids in length. The polypeptide may be between 10 and 15 amino acids, between 10 and 20 amino acids or between 10 and 25 amino acids in length. The CD154 sequence and CD40 binding region are not highly conserved among the various species. The CD154 sequences of chicken and human are provided in SEQ ID NO: 25 and SEQ ID NO: 26, respectively.
The CD40 binding regions of CD154 have been determined for a number of species, including human chicken, duck, mouse and cattle and are shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, respectively. Although there is variability in the sequences in the CD40 binding region between species, the Examples below indicate that the human CD154 polypeptide was able to enhance the immune response in chickens. Therefore, one may practice the invention using species specific CD154 polypeptides or a heterologous CD154 polypeptide.
In the Examples, several SE13A recombinant bacteria were generated. In each of the SE13A strains the M2e polypeptide and the CD154 polypeptide were encoded on the same polynucleotide and were in frame with each other and the Salmonella polynucleotide in which they were inserted. In alternative embodiments, the CD154 polypeptide and the M2e polypeptide may be encoded by distinct polynucleotides. SE13A aroA M2e contains a deletion in aroA and the LM2-M2e epitope (SEQ ID NO:5) inserted into loop 9 of lamB. SE13A aroA M2e-CD154 is the same as SE13A aroA M2e, but also contains the CD154 peptide (SEQ ID NO:6) inserted in loop 9 of lamB with the M2e epitope (See SEQ ID NO:8). This strain is deposited with the ATCC as deposit number PTA-7872.
SE13A htrA M2E contains a deletion in htrA and has the M2e-LM2 epitope inserted in loop 9 of lamB. SE13A htrA M2E-CD154 has the CD154 peptide inserted in loop 9 of lamB with the M2e epitope (SEQ ID NO:8) and is deposited with the ATCC as strain PTA-7873.
The strain designated as SE13A HM contains SEQ ID NO:9 inserted in loop 9 of lamB. This strain contains multiple copies of two epitopes of M2e, referred to as M2e-LM2 (SEQ ID NO:5) and M2eA (SEQ ID NO:20) and the CD154 polypeptide (SEQ ID NO:6).
In the Examples, the above-described recombinant Salmonella strains were demonstrated to produce high, putatively protective antibody titers against the M2e epitope of influenza viruses. Furthermore, expression of the immune-stimulating molecule was shown to further increase antibody titers, confirming functionality of this concept and these particular bacterial vaccine vectors.
Compositions comprising an attenuated Salmonella strain and a pharmaceutically acceptable carrier are also provided. A pharmaceutically acceptable carrier is any carrier suitable for in vivo administration. The pharmaceutically acceptable carrier may include water, buffered solutions, glucose solutions or bacterial culture fluids. Additional components of the compositions may suitably include excipients such as stabilizers, preservatives, diluents, emulsifiers and lubricants. Examples of pharmaceutically acceptable carriers or diluents include stabilizers such as carbohydrates (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein-containing agents such as bovine serum or skimmed milk and buffers (e.g., phosphate buffer). Especially when such stabilizers are added to the compositions, the composition is suitable for freeze-drying or spray-drying.
Methods of enhancing immune responses in a subject by administering a vaccine vector containing a CD154 polypeptide capable of binding to CD40 and activating CD40 are also provided. The vaccine vector comprising the polynucleotide encoding a polypeptide of CD154 capable of binding to CD40 is administered to a subject in an amount effective to enhance the immune response of the subject to the vaccine. Suitably, the vaccine vector contains a polynucleotide encoding a polypeptide including amino acids 140-149 of the human CD154 polypeptide (SEQ ID NO: 26) or a homolog thereof. Several suitable polypeptides are identified herein. Suitably, the polynucleotide encodes a CD154 polypeptide from the same species as the subject. Suitably, a polynucleotide encoding the polypeptide of SEQ ID NO: 6 is used in human subjects, a polynucleotide encoding the polypeptide of SEQ ID NO: 7 is used in chickens, a polynucleotide encoding the polypeptide of SEQ ID NO: 27 is used in ducks, a polynucleotide encoding the polypeptide of SEQ ID NO:28 is used in mice, and a polynucleotide encoding the polypeptide of SEQ ID NO:29 is used in cows. In the Examples, the human CD154 polypeptide (SEQ ID NO: 6) is used in a chicken vaccine vector and is demonstrated to enhance the immune response to a foreign antigen. Thus other heterologous combinations of CD154 polypeptides and subjects may be useful in the methods of the invention. The CD154 polypeptide may be used to enhance the immune response in the subject to any foreign antigen or antigenic polypeptide present in the vaccine vector. One of skill in the art will appreciate that the CD154 polypeptide could be used to enhance the immune response to more than one antigenic polypeptide present in a vaccine vector.
The polypeptide from CD154 stimulates an immune response at least in part by binding to its receptor, CD40. In the Examples, a polypeptide homologous to the CD154 expressed on immune cells of the subject and which is capable of binding to the CD40 receptor on macrophages and other antigen presenting cells was utilized. Binding of this ligand-receptor complex stimulates macrophage (and macrophage lineage cells such as dendritic cells) to enhance phagocytosis and antigen presentation while increasing cytokine secretions known to activate other local immune cells (such as B-lymphocytes). As such, molecules associated with the CD154 peptide are preferentially targeted for immune response and expanded antibody production.
Potential vaccine vectors for use in the methods include, but are not limited to, Salmonella (Salmonella enteritidis), Shigella, Escherichia (E. coli), Yersinia, Bordetella, Lactococcus, Streptococcus, Vibrio (Vibrio cholerae), Listeria, adenovirus, poxvirus, herpesvirus, alphavirus, and adeno-associated virus.
In addition, methods of enhancing an immune response against influenza A and methods of reducing morbidity associated with subsequent Influenza A infection are disclosed. Briefly, the methods comprise administering to a subject a bacterium comprising an Influenza A M2e polynucleotide sequence encoding a polypeptide of Influenza A M2e in an effective amount. The M2e polypeptides include SEQ ID NO:1-5 and 20. The insertion of the M2e polypeptides into the bacterium may be accomplished in a variety of ways known to those of skill in the art, including but not limited to the scarless site-directed mutation system described herein. The bacterium may also be engineered to express the M2e polypeptides in conjunction with polynucleotides capable of enhancing the immune response as discussed above, such as in SEQ ID NO:8 and SEQ ID NO:9. In particular, a polypeptide of CD154 capable of binding CD40 may be expressed by the bacterium to enhance the immune response of the subject to the M2e polypeptide.
The useful dosage to be administered will vary depending on the age, weight and species of the subject, the mode and route of administration and the type of pathogen against which an immune response is sought. The composition may be administered in any dose of bacteria sufficient to evoke an immune response. It is envisioned that doses ranging from 103 to 1010 bacteria, from 104 to 109 bacteria, or from 105 to 107 bacteria are suitable. The composition may be administered only once or may be administered two or more times to increase the immune response. For example, the composition may be administered two or more times separated by one week, two weeks, or by three or more weeks. The bacteria are suitably viable prior to administration, but in some embodiments the bacteria may be killed prior to administration. In some embodiments, the bacteria may be able to replicate in the subject, while in other embodiments the bacteria may not be capable of replicating in the subject.
For administration to animals or humans, the compositions may be administered by a variety of means including, but not limited to, intranasally, mucosally, by spraying, intradermally, parenterally, subcutaneously, orally, by aerosol or intramuscularly. Eye-drop administration or addition to drinking water or food are additionally suitable. For chickens, the compositions may be administered in ovo.
Some embodiments of the invention provide methods of enhancing immune responses in a subject. A subject includes, but is not limited to, a vertebrate, suitably a mammal, suitably a human, or birds, suitably poultry such as chickens. Other animal models of infection may also be used. Enhancing an immune response includes, but is not limited to, inducing a therapeutic or prophylactic effect that is mediated by the immune system of the subject. Specifically, enhancing an immune response may include enhanced production of antibodies, such as demonstrated in
It is envisioned that several epitopes or antigens from the same or different pathogens may be administered in combination in a single vaccine vector to generate an enhanced immune response against multiple antigens. Recombinant vaccine vectors may encode antigens from multiple pathogenic microorganisms, viruses or tumor associated antigens. Administration of vaccine vectors capable of expressing multiple antigens has the advantage of inducing immunity against two or more diseases at the same time. For example, live attenuated bacteria, such as Salmonella enteritidis 13A, provide a suitable vaccine vector for eliciting an immune response against multiple antigens.
Heterologous polynucleotides encoding antigens can be inserted in the bacterial genome at any non-essential site or alternatively may be carried on a plasmid using methods well known in the art. One suitable site for insertion of polynucleotides is within external portions of transmembrane proteins or coupled to sequences which target the heterologous polynucleotide for secretory pathways. One example of a suitable transmembrane protein for insertion of polynucleotides is the lamB gene. In the Examples, M2e and CD154 polynucleotides were inserted into loop 9 of the lamB sequence.
Heterologous polynucleotides include, but are not limited to, polynucleotides encoding antigens selected from pathogenic microorganisms or viruses other than the vaccine vector. Such polynucleotides may be derived from pathogenic viruses such as influenza (e.g., M2e, hemagglutinin, or neuraminidase), herpesviruses (e.g., the genes encoding the structural proteins of herpesviruses), retroviruses (e.g., the gp160 envelope protein), adenoviruses, paramyxoviruses, coronaviruses and the like. Heterologous polynucleotides can also be obtained from pathogenic bacteria, e.g., genes encoding bacterial proteins such as toxins, and outer membrane proteins. Further, heterologous polynucleotides from parasites, such as Eimeria are attractive candidates for use of a vector vaccine.
Polynucleotides encoding polypeptides involved in triggering the immune system may also be included in a vaccine vector, such as a live attenuated Salmonella vaccine. The polynucleotides may encode immune system molecules known for their stimulatory effects, such as an interleukin, Tumor Necrosis Factor or an interferon, or another polynucleotide involved in immune-regulation. The vaccine vector may also include polynucleotides encoding peptides known to stimulate an immune response, such as the CD154 polypeptide described herein.
A method of generating site-specific mutations in a bacterium that is a member of the Enterobacteraciae family is provided. The method as exemplified makes use of overlapping extension PCR, the Red recombinase system, and an intermediary insertion of the I-SceI endonuclease recognition site as a counter-selection marker. Alternatively, sacB may also be used as a counter-selection marker. The overall strategy is shown in
The procedure for generating site-directed mutants may be used in any member of the Enterobacteraciae family. The Enterobacteraciae family includes, but is not limited to, members of the Salmonella, Shigella, Escherichia and Yersinia genera. A site-directed mutant includes but is not limited to insertion, deletion, substitution and replacement mutations targeted to a specific location in the chromosome of the bacteria. The advantage of the current system is that it results in a “scarless” mutation or a mutation that does not contain any extraneous sequences. Thus, the site-directed mutagenesis disclosed herein can be used to generate autologous bacteria which are deleted for a single gene or even a single amino acid or nucleotide.
In the Examples, the polynucleotides were generated by overlapping extension PCR, but one of skill in the art will appreciate that other methods of generating linear polynucleotides are available and could be utilized. The linear first and second polynucleotides must contain some sequence homologous to the sequence flanking the mutation site to allow for Red mediated recombination. The amount of homologous sequence may comprise less than 300 base pairs on either side of the mutation site. Suitable the homologous sequence is less than 200 base pairs. The polynucleotides may be introduced into the bacteria by any method known to those of skill in the art. In the Examples, the linear polynucleotides were electroporated into the bacteria.
Methods of developing a bacterial vaccine vector are also provided. First, a bacterium capable of colonizing a subject is selected. Then, the bacterium is attenuated to generate an attenuated bacterium. Attenuation may be performed by a variety of methods known to those of skill in the art. Finally, a CD154 polynucleotide sequence encoding a CD154 polypeptide capable of binding CD40 is incorporated into the attenuated bacterium to generate a vaccine vector. The CD154 polypeptide may be fewer than 50 amino acids long and will comprise amino acids 140-149 of CD154 SEQ ID NO: 26 or a homolog thereof. The bacterial vaccine vector may also incorporate a second polynucleotide sequence encoding an antigenic polypeptide. In one embodiment, the CD154 polypeptide and the antigenic polypeptide are encoded on the same polynucleotide sequence.
The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims.
Strains and Culture Conditions
All plasmids were first maintained in TOP10 E. coli cells (Invitrogen, Carlsbad, Calif., USA) unless described otherwise. Salmonella enteritidis 13A was used for introduction of mutations. Salmonella enteritidis strain 13A was a field isolate available from USDA/APHIS/NVSL and deposited with the ATCC as deposit number PTA-7871. Bacteria carrying plasmid pKD46 were grown at 30° C. Other bacteria were grown at 37° C. Plasmid curing was conducted at 37° C.
Luria-Bertani (LB) media was used for routine growth of cells, and SOC media (Invitrogen, Carlsbad, Calif., USA) was used for phenotypic expression after electroporation. When appropriate, the following antibiotics were added to the media: ampicillin (Amp) at 100 μg/ml, kanamycin (Km) at 50 μg/ml, and chloramphenicol (Cm) at 25 μg/ml.
Plasmids
Plasmids pKD46, pKD13, and pBC-I-SceI were described previously (Datsenko and Wanner, PNAS 2000, 97:6640-6645 and Kang et al., J Bacteriol 2004, 186:4921-4930, both of which are incorporated herein by reference in their entireties). Plasmid pKD46 encodes Red recombinase enzymes which mediate homologous recombination of incoming linear DNA with chromosomal DNA. This plasmid also contains the Ampicillin resistance gene and is temperature-sensitive so that it requires 30° C. for maintenance in the cell. Plasmid pKD13 served as a template for amplification of the Km resistance (Kmr) gene used in overlapping PCR. Plasmid pBC-I-SceI, which is maintained in the cell at 37° C., produces the I-SceI enzyme, which cleaves the following 18 base pair, rare recognition sequence: 5′-TAGGGATAACAGGGTAAT-3′ (SEQ ID NO:30). Plasmid pBC-I-SceI also contains the chloramphenicol resistance (Cmr) gene.
PCR
All primers used for PCR are listed in Table 1. Typically, PCR was performed using approximately 0.1 μg of purified genomic, plasmid or PCR-generated DNA (Qiagen, Valencia, Calif., USA), 1× cloned Pfu polymerase buffer, 5U Pfu polymerase (Stratagene La Jolla, Calif., USA), 1 mM dNTPs (GE Healthcare Bio-Sciences Corp., Piscataway, N.J.), and 1.2 μM of each primer in a total volume of 50 μL. The DNA engine thermal cycler (Bio-Rad, Hercules, Calif., USA) was used with the following amplification conditions: 94° C. for 2 minutes; 30 cycles of 94° C. sec for 30 sec, 58° C. for 60 sec, 72° C. for 90 sec per 1 kb; and 72° C. for 10 minutes for final extension. Each PCR product was gel purified (Qiagen, Valencia, Calif., USA) and either eluted in 25 μL EB buffer for preparation of templates used in overlapping extension PCR or in 50 μL EB buffer, ethanol precipitated and suspended in 5 μL of ddH2O for electroporation into S. enteritidis.
AACTATAACGGGAGGTCCTAAGGTAG
CGAATTTCCGTCCGTCGA 3′
GAAGTTGAAACCCCGATTCGTAAC
A
TTTCCCGTTATGCCGCAGCG 3′
TGGGCAGAAAAAGGTTATTATACCA
TGTCT
ATTTCCCGTTATGCCGCAG
C 3′ (SEQ ID NO: 17)
CATGTCTGGTGGTGGTGAAGTTGAA
ACCCCGATTCGTAACGGTGGTGGT
A
TTTCCCGTTATGCCGCAGC 3′
CTGCCCAACCACCACC
GTTATCGCC
GTCTTTGATATAGCC 3′
CATGTCTTCCTCCTCCTCCGAAGTT
GAAACCCCGATTCGTAACTCCTCCT
CCTCCGAAGTTGAAACCCCGATTCG
TAACTCCTCCTCCTCC
ATTTCCCGT
TATGCCGCAGC 3′
CTGCCCAGGAGGAGGAGGAGTTACG
GGTCGGGGTTTCAACTTCGGAGGAG
GAGGAGTTACGGGTCGGGGTTTCAA
CTTCGGAGGAGGAGGA
GTTATCGCC
GTCTTTGATATAGCC 3′
In Table 1, italicized nucleotides are complementary to either side of the lamB gene loop 9 insertion site, which corresponds to nucleotide 1257 using S. typhimurium as an annotated reference genome. Bold font nucleotides represent the I-SceI recognition site in the Km-f primer. All other insertion sequences are shown as underlined.
Electroporation
Transformation of pKD46 into S. enteritidis was the first step carried out so that Red recombinase enzymes could be used for mediating recombination of subsequent mutations. Plasmid pKD46 was harvested from E. coli BW25113 (Datsenko and Wanner, PNAS 2000, 97:6640-6645) using a plasmid preparation kit (Qiagen Valencia, Calif., USA). Then 0.5 μL of pKD46 DNA was used for transformation into S. enteritidis 13A which had been prepared for electroporation. (Datsenko and Wanner, PNAS 2000, 97:6640-6645). Briefly, cells were inoculated into 10-15 mL of 2×YT broth and grown at 37° C. overnight. Then 100 μL of overnight culture was re-inoculated into 10 mL fresh 2×YT broth at 37° C. for 3-4 hours. Cells to be transformed with pKD46 plasmid were heated at 50° C. for 25 minutes to help inactivate host restriction. Cells were washed five times in ddH2O water and resuspended in 60 μL of 10% glycerol. Cells were then pulsed at 2400-2450 kV for 1-6 ms, incubated in SOC for 2-3 hours at 30° C. and plated on LB media with appropriate antibiotics. S. enteritidis transformants with pKD46 were maintained at 30° C. When these transformants were prepared for additional electroporation reactions, all steps were the same except that 15% arabinose was added to induce Red recombinase enzymes one hour prior to washing, and cells did not undergo the 50° C. heat step.
Loop 9 up-I-SceI/Kmr-Loop 9 Down Construct
Introduction of I-SceI enzyme recognition site along with the Kmr gene into loop 9 of the lamB gene was done by combining the Red recombinase system (Datsenko and Wanner, PNAS 2000, 97:6640-6645, which is incorporated herein by reference in its entirety) and overlapping PCR (Horton et al., BioTechniques 1990, 8:528-535, which is incorporated herein by reference in its entirety). The insertion site corresponds to nucleotide 1257 of the lamB gene using Salmonella typhimurium LT2 (S. typhimurium) as an annotated reference genome. First, the upstream and downstream regions immediately flanking the loop 9 insertion site (loop 9 up and loop 9 down, respectively) were amplified separately. Primers used were lam-up-f and lam-up-r for loop 9 up and lam-dn-f and lam-dn-r for loop 9 down. Then the Kmr gene from pKD13 plasmid was amplified using primers Km-f and Km-r. Here, the 1-SceI enzyme site was synthetically added to the 5 end of Km-f primer then preceded by a region complimentary to the loop-up-r primer. Likewise, a region complimentary to the loop-dn-f primer was added to the 5′ end of Km-r primer. The complimentary regions allow all 3 PCR products to anneal when used as templates in one PCR reaction.
Loop 9 up-LM2 or CD154s or Combination Sequence-Loop 9 Down Construct
The final overlapping PCR fragment, PCR-B, contained the added LM2 (or CD154s or combination sequences flanked by loop 9 up and down regions (
To shorten the amount of steps for construction of the next fragment, the LM2 or CD154 sequence was synthetically added to the 5′ end of the lam-dn-f primer and preceded by the complimentary region to the loop-up-r primer. The previously used PCR product for loop 9 up could be used together with the newly constructed PCR product in which LM2 or CD154s were incorporated at the 5′ end of loop 9 down to perform the final PCR reaction. However, for other insert sequences (referred to as combination sequences), an extra PCR step was needed, due to the longer lengths of insert sequences, to amplify loop 9 up with added nucleotides specific to insertion sequences connected to loop-up-r primer. The coding sequence for Gly (GGT) and Serine (TCC) as well as all other amino acids were chosen based on compiled data of the most frequently used codons in E. coli and Salmonella typhimurium proteins. See Table 1 for further details of primer design.
Genomic Replacement of I-SceI/Kmr with LM2 or CD154s or Combination Sequences
PCR-B products were electroporated into S. enteritidis cells along with plasmid pBC-1-SceI at a molar ratio of approximately 40:1 (Kang et al., J Bacteriol 2004, 186:4921-4930, which is incorporated herein by reference in its entirety). Clones for each PCR-B recombination mutation were chosen according to the ability to grow on Cm plates but not on Km plates, due to the replacement of PCR-B for the Kmr encoding PCR-A sequence. Modified regions in the selected clones were PCR-amplified, and DNA sequences were determined using primers lam3f and lam3r located outside the loop 9 down and up amplified regions.
I-SceI Site/Kmr Insertion Mutation
The first mutation step involved designing a PCR fragment, PCR-A, which would serve as the carrier of the I-SceI site/Kmr cassette to be inserted into the lamB site. PCR-A consisted of the I-SceI enzyme recognition site adjacent to the Kmr gene with approximately 200-300 bp of flanking DNA on each end homologous to the upstream and downstream regions of lamB loop 9 insertion site (loop 9 up and loop 9 down, respectively). The fragment was introduced into S. enteritidis cells expressing Red recombinase enzymes and Kmr colonies were selected. After screening a few colonies by colony PCR, positive clones were sequenced for the desired inserted I-SceI site/Kmr sequence, and the identified mutant was designated SE164.
Genomic Replacement of I-SceI/Kmr with LM2 or CD154s or Combination Sequences
The second mutation step required constructing a PCR fragment, referred to as PCR-B and shown in
Attenuation of SE13A was achieved by deletion mutation of the aroA gene and/or the htrA gene. Mutation of the aroA gene, a key gene in the chorismic acid pathway of bacteria, results in a severe metabolic deficiency which affects seven separate biochemical pathways. Mutation of the htrA gene reduces the cell's ability to withstand exposure to low and high temperatures, low pH, and oxidative and DNA damaging agents and reduces the bacteria's virulence.
To achieve deletion mutations in SE13A, the target gene sequence in the bacterial genome of S. enteritidis was replaced with the Km resistant gene sequence. This was completed using overlapping extension PCR and electroporation of the PCR products as described above. The Km resistance gene was targeted into the genomic region containing the genes of interest (aroA or htrA) by flanking the Km resistance gene with 200-300 base pairs of sequences homologous to the genes of interest. Once Km resistant mutants were obtained, the aroA or htrA deletion mutations were confirmed by DNA sequencing. The resulting aroA- and htrA-Salmonella strains were deposited with the American Type Culture Collection on Sep. 13, 2006 (Deposit No. PTA-7872 and Deposit No. PTA-7873, respectively). The attenuated strains were also tested in vivo with regards to clearance time. Both of the attenuated strains had quicker clearance times than did the wildtype 13A strain, but both were able to colonize the liver, spleen, and cecal tonsils of chickens after oral infection. In addition, an attenuated strain lacking both aroA and htrA was also isolated.
Cell surface expression of the M2e and CD154 inserts was confirmed with a simple antibody/antigen precipitation reaction. In short, polyclonal antibodies were made against the amino acid sequences of both M2E-LM2 (EVETPIRN; SEQ ID NO:5) and CD154 (WAEKGYYTMSC; SEQ ID NO:6) conjugated to a carrier protein (KLH). The resulting antibodies were then incubated with SE13A wildtype (no inserts) or SE13A with either the M2e-LM2, the CD154 or the M2e-LM2 and CD154 combined insert on a glass plate at room temperature and allowed to incubate for 30 seconds. Cell surface expression was determined by the presence of a precipitate. Results are shown in Table 2. A positive precipitation reaction is indicated by a (+) sign and a negative precipitation reaction is indicated by a (−) sign. The results demonstrate that the SE13A wildtype did not react with the M2e and CD154 peptide antibodies, while the strains expressing M2e, CD154 or M2e and CD154 reacted with the appropriate antibodies. Thus, M2e and CD154 peptides are being expressed on the surface of the bacteria.
Day-of-hatch (day 0) chicks were obtained from a local commercial hatchery and randomly distributed into treatment groups (n=55/treatment group). Fifteen chicks out of the possible 55 in each treatment group were tagged and numbered. The chicks were orally infected by gavage with 0.25 ml of 104, 105, or 107 (data not shown) cfu/ml of the various SE13A treatments as indicated in Table 3.
Each treatment group was housed in an individual floor pen on fresh pine litter and provided water and feed ad libitum. On days 7, 14, 21 and 28 post-hatch, approximately 1 ml of blood was collected from each of the fifteen tagged birds and the serum was removed for later use in determining antibody titers. On the same days, ten birds from each treatment group were euthanized, their liver, spleen and ceca tonsils aseptically removed for determination of bacterial colonization (ceca tonsils) and bacterial invasion (liver and spleen). Individual liver, spleen and ceca tonsil samples were pre-enriched in tetrathionate broth overnight at 37° C. The next day loopfuls of each broth culture were streaked onto XLD agar plates supplemented with Novabicin and Naladixic Acid and incubated overnight at 37° C. The following morning the plates were read for the presence or absence of Salmonella colonies. Bacterial colonization and invasion data are presented in Table 4 by treatment group. Each ratio presented in Table 4 represents the number of birds from which Salmonella positive isolates were recovered out of the possible ten birds that were cultured on days 7, 14, 21, and 28 post-challenge.
Positive Salmonella bacterial isolates recovered from birds in each treatment group were subjected to analysis by polymerase chain reaction (PCR) using the primers specific to each insert disclosed in Table 1 to verify the M2e- and or CD154 insert. This technique was utilized to ensure that the strain that the birds were originally given was equivalent to the strain recovered. In each treatment group, PCR confirmed that the recovered strains were the same as the strains with which the birds were infected. The results indicated acceptable colonization of tissues with the various Salmonella strains tested.
Serum collected from the tagged birds in each treatment group was used in an antigen capture ELISA to calculate M2e antibody levels. In brief, individual wells of a 96-well plate were coated with 5 μg/ml of the M2e-LM2 epitope (EVETPIRN: SEQ ID NO:5) conjugated to BSA. Antigen adhesion was allowed to proceed overnight at 4° C. Plates were rinsed with PBS+0.05% Tween 20 and incubated for 2 hours with the serum previously collected from the birds in each of the 6 treatment groups described above. The plates were rinsed with PBS+0.05% Tween 20 followed by incubation with peroxidase conjugated Goat-anti-Chicken IgY secondary antibody (1:10,000 dilution) obtained from Jackson ImmunoResearch Laboratories (West Grove, Pa.) for an additional hour. After subsequent rinsing, the plates were developed using a peroxidase substrate kit obtained from Fisher Scientific and absorbances read on a spectrophotometer at 450 nm and 405 nm.
Each plate also contained a positive control and negative control where the M2e polyclonal antibody described above and chicken serum from an untreated bird respectively replace the serum from the treatment groups. The absorbances obtained for the positive control, negative control and experimental samples were used to calculate Sample to Positive control ratios (S/P ratios) using the following calculation:
The calculated S/P ratios for each group are shown in
Antisera (collected 2 weeks after the booster immunization in each experiment) generated against the recombinant SE vectors described above were subjected to virus neutralization testing using H9N2 Influenza (Charles River Laboratories, Franklin, Conn.) using standard protocols (Charles River Laboratories). See Table 5. Neutralizing indices indicate that the antisera from vaccinated chickens were effective in neutralizing Avian Influenza and thus in protecting embryos from the virus (VN titers ranged from 6.3 to 8.8 in two studies). Hyperimmune serum raised against synthetic M2e peptide was used as a positive control.
Viruses.
The influenza viruses used in these studies were A/Turkey/Virginia/158512/2002 (TV/02) H7N2 LP Avain Influenza (LPAI H7N2) and A/Egret/Hong Kong/757.2/2002 (Eg/02) H5N1 HP avian influenza (HPAI H5N1). Viruses were grown and titered in 9-11 day old embryonated SPF (specific pathogen free) chicken eggs as previously described (Suarez et al., J Virol. 1998 August; 72(8):6678-88.).
Chickens and Housing.
For LP and HPAI challenge chickens were transferred into negative-pressure-stainless steel Horsfall units containing HEPA filters in a USDA-certified biosafety level 3 agriculture facility. Feed and water were provided ad libitum.
Serology and Virus Isolation.
Hemagglutination inhibition test was performed with BPL-inactivated homologous H5N1 antigen with sera collected at day 0 in Expt. I and Day 0 and 14 in Expt. II as previously described (Suarez et al., 1998). Titers greater ≧3 (log2) were considered positive. Virus isolation from oral and cloacal swabs on days 2 and 4 post-challenge was performed in 9-11 day of embryonation SPF chicken eggs as previously described (Tumpey et al., Avian Dis. 2004 January-March; 48(1):167-76). Briefly, swabs were collected into 2 ml brain-heart infusion (BHI) broth with antibiotics (1000 units/ml penicillin G, 200 μg/ml gentamicin sulfate, and 4 μg/ml amphotericin B; Sigma Chemical Company, St. Louis, Mo.) from each bird on day 0, 2, 4, days post challenge for virus isolation.
Western Blot.
Purified AIV proteins from whole virus (H5N1 and 1-17N2) were separated by SDS-PAGE in a 10% polyacrylamide gel and transferred as previously described (Kapczynski and Tumpey, Avian Dis. 2003 July-September; 47(3):578-87). Briefly, anti-M2e serum from birds previously immunized with ΔSE M2e-HM (1:1000) was incubated with the membrane containing AIV antigen for 1 hour at room temperature. Following three washes in PBS-Tween 20 (0.05%) the membrane was reacted with horseradish peroxidase-labeled goat anti-chicken IgG secondary antibody (Southern Biotech Associates, Inc, Birmingham, Ala.) at a 1:2000 dilution for 1 hour. After washing as above, the membrane was reacted with ECL Western Blotting Detection Reagents (Amersham Biosciences, Piscataway, N.J.) according to the manufacturers' recommendations, and exposed to Hyperfilm ECL (Amersham Biosciences). The film was developed using Kodak GBX developing reagents (Eastman Kodak Company) according to the manufacturers' recommendations.
Protection Studies.
The initial experimentation was designed to assess protection of chickens receiving vaccination with ΔSE M2e-HM (multi-copy M2e-CD154 with the SEQ ID NO:9 insertion sequence) Salmonella from challenge with LPAI TV/02 (106 EID50 per bird (EID refers to embryo infectious dose)) to determine reduction of morbidity and viral shedding. Subsequently, protection from HPAI Eg/02 challenge was investigated using a sublethal (0.1 CLD50 per bird (CLD refers to chick lethal dose)) and lethal dose (100 CLD50 per bird), in terms of morbidity, mortality and viral shedding.
Experiment I. Challenge with LPAI H7N2
Groups of ten 1-day old SPF chickens were divided into 3 groups. Birds in groups 1 and 2 received sham vaccination with 100 μl of phosphate-buffered saline (PBS, pH 7.4). Birds in group 3 received vaccination with ΔSE M2e-HM. Three weeks later (Day 21) the three groups of SPF chickens received an identical second vaccination (boost) utilizing saline (Groups 1 and 2) or the recombinant Salmonella vectored vaccine (Group 3). Three weeks after boost (Day 42), birds in group 2 and 3 were challenged intranasally (IN) with 106 embryo infectious dose 50 (EID50)/bird of TV/02 (LPAI H7N2). Unchallenged birds were sham-challenged with 100 μl PBS via intranasal route. Following challenge, birds were monitored daily for disease signs for 14 days post-infection (PI). The morbidity results following challenge with LPAI H7N2 are shown in
Experiment II. Challenge with HPAI H5N1
Groups of ten 1-day old SPF chickens were divided into 5 groups. Birds in groups 1, 2 and 3 received sham vaccination with 100 μl of phosphate-buffered saline (PBS, pH 7.4). Birds in group 4 and 5 received vaccination with ΔSE M2e-HM as described in Expt. I. On day 42, birds in group 1 receive sham challenge with 100 μl PBS via intranasal route. Birds in groups 2 and 3 received challenge with 0.1 and 100 CLD50 Eg/02 (HPAI H5N1) per bird, respectively. Birds in groups 4 and 5 received challenge with 0.1 and 100 CLD50 Eg/02 (HPAI H5N1) per bird, respectively. Following challenge, birds were monitored daily for morbidity and mortality for 14 days PI. Chickens displaying severe clinical signs of disease were euthanized by overdose of sodium pentobarbital. The morbidity results following challenge with HPAI H5N1 are shown in
This invention was made with United States government support awarded by National Institutes of Health grant R21 AI063137. The United States may have certain rights in this invention.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US2007/078785 | 9/18/2007 | WO | 00 | 9/28/2010 |
Publishing Document | Publishing Date | Country | Kind |
---|---|---|---|
WO2008/036675 | 3/27/2008 | WO | A |
Number | Name | Date | Kind |
---|---|---|---|
5683700 | Charles et al. | Nov 1997 | A |
5747309 | Allan et al. | May 1998 | A |
5962406 | Armitage et al. | Oct 1999 | A |
5981724 | Armitage et al. | Nov 1999 | A |
6087329 | Armitage et al. | Jul 2000 | A |
6190669 | Noriega et al. | Feb 2001 | B1 |
6264951 | Armitage et al. | Jul 2001 | B1 |
6290972 | Armitage et al. | Sep 2001 | B1 |
6306387 | Galan | Oct 2001 | B1 |
6410711 | Armitage et al. | Jun 2002 | B1 |
6479258 | Short | Nov 2002 | B1 |
6713279 | Short | Mar 2004 | B1 |
6902906 | Chatfield | Jun 2005 | B1 |
6923957 | Lowery et al. | Aug 2005 | B2 |
6923958 | Xiang et al. | Aug 2005 | B2 |
6936425 | Hensel et al. | Aug 2005 | B1 |
6969609 | Schlom et al. | Nov 2005 | B1 |
7087573 | Lazarus et al. | Aug 2006 | B1 |
7332298 | Kornbluth | Feb 2008 | B2 |
7371392 | Tripp et al. | May 2008 | B2 |
7405270 | Armitage et al. | Jul 2008 | B2 |
7495090 | Prussak et al. | Feb 2009 | B2 |
7842501 | Cai et al. | Nov 2010 | B2 |
7928213 | Prussak et al. | Apr 2011 | B2 |
20010021386 | Nuijten et al. | Sep 2001 | A1 |
20040047873 | Al-Shamkhani et al. | Mar 2004 | A1 |
20040203039 | Hensel et al. | Oct 2004 | A1 |
20050181994 | Chamberlain et al. | Aug 2005 | A1 |
20050226888 | Deisseroth et al. | Oct 2005 | A1 |
20060014248 | Marshall et al. | Jan 2006 | A1 |
20060078994 | Healey et al. | Apr 2006 | A1 |
20060233829 | Curtiss | Oct 2006 | A1 |
20060286074 | Tang et al. | Dec 2006 | A1 |
20070025982 | Ledbetter et al. | Feb 2007 | A1 |
20070082400 | Healey et al. | Apr 2007 | A1 |
20070128223 | Tang et al. | Jun 2007 | A1 |
20070237779 | Ledbetter et al. | Oct 2007 | A1 |
20100047231 | Zabaleta Azpiroz et al. | Feb 2010 | A1 |
Number | Date | Country |
---|---|---|
9308207 | Apr 1993 | WO |
9514487 | Jun 1995 | WO |
9626735 | Sep 1996 | WO |
9640918 | Dec 1996 | WO |
9927948 | Jun 1999 | WO |
9932138 | Jul 1999 | WO |
0063395 | Oct 2000 | WO |
0063405 | Oct 2000 | WO |
0142298 | Jun 2001 | WO |
0156602 | Aug 2001 | WO |
0230461 | Apr 2002 | WO |
0236769 | May 2002 | WO |
02092773 | Nov 2002 | WO |
03004683 | Jan 2003 | WO |
03004684 | Jan 2003 | WO |
03099340 | Dec 2003 | WO |
2004009615 | Jan 2004 | WO |
2004046345 | Jun 2004 | WO |
2005035570 | Apr 2005 | WO |
2005058950 | Jun 2005 | WO |
2005113598 | Dec 2005 | WO |
2006012373 | Feb 2006 | WO |
2006042177 | Apr 2006 | WO |
2006105972 | Oct 2006 | WO |
2007042583 | Apr 2007 | WO |
2007054658 | May 2007 | WO |
2007056266 | May 2007 | WO |
2007103048 | Sep 2007 | WO |
2007117682 | Oct 2007 | WO |
2008109825 | Sep 2008 | WO |
Entry |
---|
Vega, M.L. et al., “A salmonella typhi OmpC fusion protein expressing the CD154 Trp140-Ser149 amino acid strand binds CD40 and activates a lymphoma B-cell line,” Immunol. (2003) 110:206-216. |
Verjans, G.M. et al., “Intracellular processing and presentation of T cell epitopes, expressed by recombinant Eschenchia coli and Salmonella typhimurium, to human T cells,” Eur J Immunol (1995) 25(2):405-410. |
Vierira-Pinto, M. et al., “Occurrence of salmonella in the ileum, ileocolic lymph nodes, tonsils, mandibular lymph nodes and carcasses of pigs slaughtered for consumption,” J Vet Med B Infection Dis Vet Public Health (2005) 52 (10):476-81. |
Wang, J. et al., “Immunogenicity of viral B-cell epitopes inserted into two surface loops of the Escherichia coli K12 LamB protein and expressed in an attenuated aroA strain of Salmonella typhimurium,” Vaccine (1999) 17(1):1-12. |
Xu, Y. et al., “The role of CD40-CD154 interaction in cell immunoregulation,” Biomed. Sci. (2004) 11:426-438. |
Zebedee, S.L. et al., “Influenza A virus M2 protein: monoclonal antibody restriction of virus growth and detection of M2 in virions,” J. Virol. (1988) 62:2762-2772. |
Zharikova, D. et al., “Influenza type A virus escape mutants emerge in vivo in the presence of antibodies to the ectodomain of matrix protein 2,” J. Virol. (2005) 79:6644-6654. |
Zou, P. et al., “The epitope recognized by a monoclonal antibody in influenza A virus M2 protein is immunogenic and confers immune protection,” Int. Immunopharmacol. (2005) 5:631-635. |
European Patent Office Search Report for Application No. 07842706.9 dated Jan. 5, 2010 (8 pages). |
International Search Report and Written Opinion of the International Searching Authority for Application No. PCT/US07/78785 dated Sep. 29, 2008 (11 pages). |
Kotton, C.N. et al., “Enteric pathogens as vaccine vectors for foreign antigen delivery,” Infect. Immun. (2004) 72:5535-5547. |
Agterberg, M. et al., “Outer membrane protein PhoE as a carrier for the exposure of foreign antigenic determinants at the bacterial cell surface,”Antonie Van Leeuwenhoek (1991) 59(4):249-262. |
Barr, T.A. et al., “A potent adjuvant effect of CD4O antibody attached to antigen,” Immunology (2003) 109:87-92. |
Black, R.A. et al., “Antibody response to the M2 protein of influenza A virus expressed in insect cells,” J. Gen. Virol. (1993) 74(Pt.1):143-146. |
Blomfield, I.C. et al., “Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon,” Mol Microbiol (1991) 5(6):1447-1457. |
Capua, I. et al., “The challenge of avian influenza to the veterinary community,” Avian Pathol. (2006) 35:189-205. |
Capua, I. et al., “Vaccination for avian influenza in Asia,” Vaccine (2004) 22:4137-4138. |
Capua, I. et al, “Control of avian influenza in poultry,” Emerg. Infect. Dis. (2006) 12:1319-1324. |
Charbit, A. et al., “Probing the topology of a bacterial membrane protein by genetic insertion of a foreign epitope: expression at the cell surface,” EMBO J (1986) 5(11):3029-3037. |
Charbit, A. et al., “Versatility of a vector for expressing foreign polypeptides at the surface of gram-negative bacteria,” Gene (1988) 70(1 ):181-189. |
Cox, M.M. et al., “Scariess and site-directed mutagenesis in salmonella enteritidis chromosome,” BMC Biotech. (2007) 7(59):10 pages. |
De Filette, M. et al, “The universal influenza vaccine M2e-HBc administered intranasally in combination with the adjuvant CTA1-DD provides complete protection,” Vaccine (2006) 24:544-551. |
De Filette, M. et al., “Universal influenza A vaccine: Optimization of M2-based constructs,” Virology (2005) 337:149-161. |
De Filette, M. et al., “Improved design and intranasal delivery of an M2e-based human influenza A vaccine,” Vaccine (2006) 24:6597-6601. |
Ernst, W.A. et al., “Protection against H1, H5, H6 and H9 influenza A infection with liposomal matrix 2 epitope vaccines,” Vaccine (2006) 24:5158-5168. |
Fan, J. et al., “Preclinical study of influenza virus A M2 peptide conjugate vaccines in mice, ferrets and rhesus monkeys,” Vaccine (2004) 22:2993-3003. |
Farnell, M.B. et al., “Upregulation of oxidative burst and degranulation in chicken heterophils stimulated with probiotic bacteria,” Poult. Sci. (2006) 85:1900-1906. |
Fecteau, J.E. et al , “CD40 Stimulation of Human Peripheral B Lymphocytes: Distinct Response from Naive and Memory Cells,” J Immunol (2003) 171:4621-4629. |
Fiers, W. et al., “A universal human influenza A vaccine,” Virus Research (2004) 103:173-176. |
Frace, A.M. et al., “Modified M2 proteins produce heterotypic immunity against influenza A virus,” Vaccine (1999) 17:2237-2244. |
Gares, S.L. et al., “Immunotargeting with CD154 (CD40 ligand) enhances DNA vaccine reponses in ducks,” Clin. Vaccine Immun. (2006) 13:958-965. |
Gast, R.K. et al., “The relationship between the magnitude of the specific antibody response to experimental salmonella enteritidis infection in laying hens and their production of contaminated eggs,” Avian Diseases (2001) 45:425-431. |
Grangette, C. et al., Protection against tetanus toxin after intragastric adminstration of two recombinant lactic acid bacteria: Impact and strain viability and in vivo persistence, Vaccine (2002) 20:3304-3309. |
Grewal, I.S. et al. “CD40 and CD154 in cell-mediated immunity,” Annu. Rev. Immunology. (1998) 16:111-35. |
Herrero, M. et al., “Transposon vectors containing non-antibiotic resistance selection markers for cloing and stable chromosomal insertion of foreign genes in gram-negative bacteria,” J Bacteriol (1990) 172(11):6557-6567. |
Holmgren, J. et al., “Mucosal immunity: implications for vaccine development,” Immunobiol. (1992) 184:157-179. |
Husseiny, M.L. et al., “Rapid method for the construction of salmonella enterica serovar typhimurium vaccine carrier strains,” Infec. Immun. (2005) 73(3)1598-1605. |
Katz, J.M. et al., “Adjuvant activity of the heat-labile enterotoxin from enterotoxigenic Escherichia coli for oral administration of inactivated influenza virus vaccine,” J. Infect. Dis. (1997) 175:352-363. |
Koch, F. et al., “High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10,” J. Exp. Med. (1996) 184:741-746. |
Kodihalli, S. et al., “Cross-protection among lethal H5N2 influenza viruses induced by DNA vaccine to the hemagglutinin,” J. Virol. (1997) 71:3391-3396. |
Kwon, Y.M. et al., “Salmoneila-based vaccines for infectious diseases,” Expert Review of Vaccines (2007) 6(2):147-152. |
Lapalombella, R. et al., “A Novel Raji-Burkitt's Lymphoma Model for Preclinical and Mechanistic Evaluation of CD52-Targeted Immunotherapeutic Agents,” Clin. Cancer Res. (2008) 14:569-578. |
Lee, J.S. et al., “Surface-displayed viral antigens on salmonella carrier vaccine,” Nat. Biotechnol. (2000) 18:645-648. |
Liu, W. et al., “Monoclonal antibodies recognizing EVETPIRN epitope of influenza A virus M2 protein could protect mice from lethal influenza A virus challenge,” Immunol. Lett. (2004) 93:131-136. |
Liu, W. et al., “Sequence comparison between the extracellular domain of M2 protein human and avian influenza A virus provides new information for bivalent influenza vaccine design,” Microbes and Infection (2005) 7:171-177. |
Lowe, D.C. et al., “Characterization of candidate live oral Salmonella typhi vaccine strains harboring defined mutations in aroA, aroC, and htrA,” Infection and Immunity Feb. 1999, 700-707. |
Miga, A. et al., “The role of CD40-CD154 interactions in the regulation of cell mediated immunity,” Immunol. Invest. (2000) 29:111-114. |
Mozdzanowska, K. et al., “Induction of influenza type A virus-specific resistance by immunization of mice with a synthetic multiple antigenic peptide vaccine that contains ectodomains of matrix protein 2,” Vaccine (2003) 21:2616-2626. |
Neirynck, S. et al., “A universal influenza A vaccine based on the extracellular domain of the M2 protein,” Nat. Med. (1999) 5:1157-1163. |
Ninomiya, A. et al., “Intranasal administration of a synthetic peptide vaccine encapsulated in liposome together with an anti-CD40 antibody induces protective immunity against influenza A virus in mice,” Vaccine (2002) 20:3123-3129. |
Pasetti, M. et al., “Animal models paving the way for clinical trials of attenuated Salmonella enterica servoar Typhi live oral vaccines and live vectors,” Vaccine (2003) 21:401-418. |
Palese, P. et al., “Influenza vaccines: prevent and future,” J. Clin. Invest. (2002) 110:9-13. |
Rabsch, W. et al., “Competitive exclusion of Salmonella enteritidis by Salmonella gallinarum in poultry,” Emerging Inf. Diseases (2000) 6(5):443-448. |
Russmann, H. et al., “Delivery of epitopes by the salmonella type III secretion system for vaccine development,” Science (1998) 281(5376):565-568. |
Slepushkin, V.A. et al., “Protection of mice against influenza A virus challenge by vaccination with baculovirus-expressed M2 protein,” Vaccine (1995) 13:1399-1402. |
Su, G.F. et al., “Construction of stable LamB-Shiga toxin B subunit hybrids: analysis of expression in Salmonella typhimurium aroA strains and stimulation of B subunit-specific mucosal and serum antibody responses,” Infect Immun (1992) 60(8):3345-3359. |
Monteihet, C. et al., “Purification and characterization of the in vitro activity of I-Sce I, a novel and highly specific endonuclease encoded by a group I intron,” Nucleic Acids Res. (1990) 18(6)1407-1413. |
Tischer, B.K. et al., “Two-step red mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli,” Biotechniques (2006) 40(2):191-197. |
Tompkins, S.M. et al., “Matrix protein 2 vaccination and protection against influenza viruses, including subtype H5N1,” Emerging Infectious Diseases (2007) 13(3):426-435. |
Tresgaskes, C.A. et al., “Conservation of biological properties of the CD40 ligand, CD154 in a non-mammalian vertebrate,” Dev. Comp. Immunol. (2005) 29:361-374. |
Tumpey, T.M. et al., “Comparative susceptibility of chickens and turkeys to avian influenza A H7N2 virus infection and protection efficacy of a commerical avian influenza H7N2 virus vaccine,” Avian Dis. (2004) 48(1):167-176. |
Gao, w. et al., “Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization,” J. Viro.l. (2006) 80:1959-1964. |
Harcourt, J.L. et al., “CD4O ligand (CD154) improves the durability of respiratory syncytial virus DNA vaccination in BALB/c mice,” Vaccine (2003) 21(21-22):2964-2979. |
Hayes, L.J. et al., “Chlamydia trachomatis major outer membrane protein epitopes expressed as fusions with LamB in an attenuated aro A strain of Salmonella typhimurium; their application as potential immunogens,” Journal of General Microbiology (1991) 137:1557-1564. |
Kaiser, J., “A one-size-fits-all flu vaccine?,” Science (2006) 312:380-382. |
Lavelle, E.C. et al., “Delivery systems and adjuvants for oral vaccines,” Expert Opin. Drug Deliv. (2006) 3 (6):747-762. |
Lee, J. et al., “Mucosal immunization with surface-displayed severe acute respiratory syndrome coronavirus spike protein on Lactobacillus casei induces neutralizing antibodies in mice,” J. Virol. (2006) 80:4079-4087. |
Li, W., “Synergistic antibody induction by antigen-CD40 ligand and fusion protein as improved immunogen,” Immunology (2005) 115(2):215-222. |
Liu, M. et al., “Display of avian influenza virus nucleoprotein on Bacillus thuringiensis cell surface using CTC as a fusion partner,” Applied Genetics and Molecular Biotechnology (2008)78:669-676. |
Moyle, P.M. et al., “Mucosal immunisation: adjuvants and delivery systems,” Curr. Drug Deliv. (2004) 1(4):385-396 (Abstract). |
O'Callaghan, D et al., “Immunogenicity of foreign peptide epitopes expressed in bacterial envelope proteins,” Research in Microbiology (1990),141:963-969. |
Swayne, D.E. et al., “Protection against diverse highly pathogenic H5 avian influenza viruses in chickens immunized with a recombinant fowlpox vaccine containing an H5 avian influenza hemagglutinin gene insert,” Vaccine (2000) 18:1088-1095. |
Swayne, D.E., “Vaccines for List A poultry diseases: emphasis on avian influenza,” Dev. Biol. (2003) 114:201-212. |
Tang, M. et al., “Recombinant adenovirus encoding the HA gene from swine H3N2 influenza virus partially protects mice from challenge with heterologous virus: A/HK/1/68 (H3N2),” Arch. Virol. (2002) 147:2125-2141. |
Written Opinion of the Intellectual Property Office of Singapore for Application No. 2009018599 dated May 13, 2010 (9 pages). |
Written Opinion of the Intellectual Property Office of Singapore for Application No. 2009018599 dated Jan. 21, 2011 (7 pages). |
Examination Report of the Intellectual Property Office of Singapore for Application No. 2009018599 dated Aug. 4, 2011 (6 pages). |
Office Action for Chinese Patent Application No. 200780037268.8 dated Mar. 27, 2012 (8 pages). |
European Patent Office Action for Application No. 07842706.9 dated Apr. 11, 2012 (6 pages). |
Office Action for Philippine Patent Application No. 1-2009-500491 dated May 30, 2012 (2 pages). |
European Patent Office Search Report for Application No. 12165985.8 dated Sep. 28, 2012 (11 pages). |
European Patent Office Action for Application No. 07842706.9 dated Sep. 26, 2012 (4 pages). |
Number | Date | Country | |
---|---|---|---|
20110027309 A1 | Feb 2011 | US |
Number | Date | Country | |
---|---|---|---|
60825983 | Sep 2006 | US |