In plants, pathogen attacks invoke multiple layers of host immune responses. Many pathogens of plants and animals deliver effectors into host cells to suppress host immunity, and many plants have evolved resistance proteins to recognize effectors and trigger robust resistance.
Botrytis cinerea is a fungal pathogen that infects flowers and almost all vegetable and fruit crops and annually causes $10-100 billion losses worldwide. With its broad host range, B. cinerea is a useful model for studying the pathogenicity of aggressive fungal pathogens.
In one aspect, the present application provides for plants (or a plant cell, seed, flower, leaf, fruit, or other plant part from such plants or processed food or food ingredient from such plants) having increased resistance to a pathogen (e.g., a fungal or oomycete pathogen). In another aspect, methods of making a pathogen-resistant plant are provided. In some embodiments, the method comprises:
contacting the plant or the part of the plant with a double-stranded RNA, a small RNA (sRNA), or a small RNA duplex that targets a fungal or oomycete dicer-like (DCL) gene or long terminal repeat (LTR) region, wherein the plant is a species of the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Limum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Rosa, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, or Zea, and wherein the plant or the part of the plant has increased resistance to a fungal or oomycete pathogen compared to a control plant or control plant part that has not been contacted with the double-stranded RNA, sRNA, or small RNA duplex.
In some embodiments, the method comprises:
contacting a fruit, vegetable, or flower with a double-stranded RNA or a small RNA duplex that targets a fungal or oomycete dicer-like (DCL) gene or long terminal repeat (LTR) region, wherein the fruit, vegetable, or flower has increased resistance to a fungal or oomycete pathogen compared to a control fruit, vegetable, or flower that has not been contacted with the double-stranded RNA, sRNA, or small RNA duplex.
In some embodiments, the pathogen is a fungal pathogen. In some embodiments, the pathogen is Botrytis or Verticillium.
In some embodiments, the double-stranded RNA, sRNA, or small RNA duplex targets a fungal or oomycete DCL gene. In some embodiments, the double-stranded RNA, sRNA, or small RNA duplex targets any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31 or a fragment thereof (e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides thereof). In some embodiments, the double-stranded RNA, sRNA, or small RNA duplex comprises an inverted repeat of a sequence that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to any of SEQ ID NO: 1, SEQ NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a fragment thereof or a complement thereof. In some embodiments, the double-stranded RNA, sRNA, or small RNA duplex comprises a spacer in between the inverted repeat sequences.
In some embodiments, the double-stranded RNA is siRNA. In some embodiments. the double-stranded RNA, sRNA, or small RNA duplex is sprayed or brushed onto the plant or the part of the plant (e.g., a leaf, fruit, vegetable, or flower).
In some embodiments, the method further comprises contacting the plant or the part of the plant with a second double-stranded RNA or a second small RNA duplex or a second sRNA that targets a second fimgal pathogen DCL gene. In some embodiments, the method comprises contacting the plant or the part of the plant with one or more double-stranded RNAs or small RNA duplexes or sRNAs that target a DCL gene from a first species of fungal pathogen (e.g., for targeting DCL genes in Botrytis, e.g., a double-stranded RNA, sRNA, or small RNA duplex that targets DCL1 in B. cinerea and a double-stranded RNA, sRNA, or small RNA duplex that targets DCL2 in B. cinerea) and further comprises contacting the plant or the part of the plant with one or more double-stranded RNAs or small RNA duplexes or sRNAs that target a DCL gene from a second species of fungal pathogen (e.g., for targeting DCL genes in Verticillium, e.g., a double-stranded RNA, sRNA, or small RNA duplex that targets DCL1 in V. dahilae and a double-stranded RNA, sRNA, or small RNA duplex that targets DCL2 in V. dahilae).
In another aspect, methods of increasing pathogen resistance to multiple pathogens (e.g., fungal or oomycete pathogens) are provided. In some embodiments, the method comprises:
contacting the plant or the part of the plant with (1) a first double-stranded RNA, sRNA, or small RNA duplex that targets a dicer-like (DCL) gene or a long terminal repeat (LTR) region from a first species of fungal or oomycete pathogen, and (2) a second double-stranded RNA, sRNA, or small RNA duplex that targets a DCL gene or a LTR region from a second species of fungal or oomycete pathogen, wherein the plant or the part of the plant has increased resistance to the first species of pathogen and the second species of pathogen compared to a control plant or control plant part that has not been contacted with the first and second double-stranded RNAs, sRNAs, or small RNA duplexes.
In some embodiments, the method comprises contacting the plant with two or more double-stranded RNAs, sRNAs, or small RNA duplexes for targeting two or more DCL genes or LTR regions from the first species of pathogen (e.g., for targeting DCL genes in Botrytis, e.g., DCL1 and DCL2 in B. cinerea) and two or more double-stranded RNAs, sRNAs, or small RNA duplexes for targeting two or more DCL genes or LTR regions from the second species of pathogen e.g., for targeting DCL genes in Verticillium, e.g., DCL1 and DCL2 in V. dahilae).
In another aspect, a method of making a plant having increased pathogen resistance to multiple pathogens comprises:
introducing into the plant (1) a first heterologous expression cassette comprising a first promoter operably linked to a first polynucleotide that inhibits expression of a dicer-like (DCL) gene or a long terminal repeat (LTR) region from a first species of fungal or oomycete pathogen and (2) a second heterologous expression cassette comprising a second promoter operably linked to a second polynucleotide that inhibits expression of a DCL gene or a LTR region from a second species of fungal or oomycete pathogen; and
selecting a plant comprising the first expression cassette and the second expression cassette.
In some embodiments, the method comprises introducing into the plant two or more heterologous expression cassettes for targeting two or more DCL genes or LTR regions from the first species of pathogen (e.g., for targeting DCL genes in Botrytis, e.g., DCL1 and DCL2 in B. cinerea) and two or more heterologous expression cassettes for targeting two or more DCL genes or LTR regions from the second species of pathogen (e.g., for targeting DCL genes in Verticillium, e.g., DCL1 and DCL2 in V. dahilae). In some embodiments, the polynucleotide comprises an antisense nucleic acid or inhibitory RNA (RNAi) that targets the DCL gene or LTR region or a fragment thereof.
In yet another aspect, methods of cultivating a plurality of pathogen-resistant plants are provided.
The term “pathogen-resistant” or “pathogen resistance” refers to an increase in the ability of a plant to prevent or resist pathogen infection or pathogen-induced symptoms. Pathogen resistance can be increased resistance relative to a particular pathogen species or genus (e.g., Botrytis), increased resistance to multiple pathogens, or increased resistance to all pathogens (e.g., systemic acquired resistance). In some embodiments, resistance of a plant to a pathogen is “increased” when one or more symptoms of pathogen infection are reduced relative to a control (e.g., a plant in which a polynucleotide that inhibits expression of a fungal pathogen DCL gene is not expressed).
“Pathogens” include, but are not limited to, viruses, bacteria, nematodes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, Calif. (1988)). In some embodiments, the pathogen is a fungal pathogen. In some embodiments, the pathogen is Botrytis.
The term “nucleic acid” or “polynucleotide” refers to a single or double-stranded polymer of deoxyribonucleotide, or ribonucleotide bases read from the 5′ to the 3′ end. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.
The phrase “nucleic acid encoding” or “polynucleotide encoding” refers to a nucleic acid which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences. It should be further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
Two nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
The term “substantial identity” or “substantially identical,” as used in the context of polynucleotide or polypeptide sequences, refers to a sequence that has at least 60% sequence identity to a reference sequence. Alternatively, percent identity can be any integer from 60% to 100%. Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.
For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
A “comparison window,” as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection.
Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. supra). These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=−2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10−5, and most preferably less than about 10−20.
The term “complementary to” is used herein to mean that a polynucleotide sequence is complementary to all or a portion of a reference polynucleotide sequence. In some embodiments, a polynucleotide sequence is complementary to at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, or more contiguous nucleotides of a reference polynucleotide sequence. In some embodiments, a polynucleotide sequence is “substantially complementary” to a reference polynucleotide sequence if at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the polynucleotide sequence is complementary to the reference polynucleotide sequence.
A polynucleotide sequence is “heterologous” to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).
An “expression cassette” refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition. One of skill will recognize that the inserted polynucleotide sequence need not be identical, but may be only substantially similar to a sequence of the gene from which it was derived.
The term “promoter,” as used herein, refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell. Thus, promoters used in the polynucleotide constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene. For example, a promoter can be a cis-acting transcriptional control element, including, an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5′ and 3′ untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) gene transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. A “constitutive promoter” is one that is capable of initiating transcription in nearly all tissue types, whereas a “tissue-specific promoter” initiates transcription only in one or a few particular tissue types. An “inducible promoter” is one that initiates transcription only under particular environmental conditions or developmental conditions.
The term “plant” includes whole plants, shoot vegetative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (including egg and central cells), seed (including zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid, and hemizygous.
It has been found that aggressive eukaryotic fungal pathogens, such as Botrytis and Verticillium, have evolved a novel virulence mechanism by employing small RNAs as effector molecules to suppress host immune responses to achieve successful infection. It has also been found that the majority of the small RNA effectors are generated from transposon regions, mainly the retrotransposon long terminal repeats (LTRs). As reported in genome studies of other fungal and oomycete pathogens, many fungal protein effector genes are also enriched in the transposon regions, including LTRs. These LTR-derived small RNAs, including most small RNA effectors, are generated by fungal Dicer-like proteins (DCLs).
As shown herein, DCL genes are essential for the pathogenicity of eukaryotic pathogens, such as the fungal pathogens Botrytis and Verticillium, with small RNA effectors. Thus, DCL genes are excellent targets for controlling those eukaryotic pathogens that use small RNAs as effectors. For example, Botrytis is a significant pathogen not only in the field, but also at post-harvesting stages, and can infect many different fruit, vegetable, and flowering plants.
Thus, one aspect of the present invention relates to controlling the diseases caused by aggressive fungal and oomycete pathogens by silencing their DCL genes and LTRs (e.g., using a host-induced gene silencing (HIGS) mechanism). In some embodiments, silencing is achieved by generating transgenic plants that express antisense (e.g., RNAi) constructs that target fungal or oomycete DCLs. In some embodiments, silencing is achieved by contacting (e.g., spraying) plants with small RNA duplexes or double stranded RNAs that target pathogen DCLs. Botrytis and Verticillium DCLs are exemplary genes that can be targeted.
In one aspect, methods of inhibiting or silencing expression of fungal pathogen dicer-like (DCL) genes or long terminal repeat (LTR) regions are provided. In some embodiments, the method comprises expressing in a plant an expression cassette comprising a promoter operably linked to a polynucleotide that inhibits expression of a fungal pathogen DCL gene or an expression cassette comprising a promoter operably linked to a polynucleotide that inhibits expression of a fungal pathogen LTR region. In some embodiments, the method comprises contacting the plant with a construct comprising a promoter operably linked to a polynucleotide that inhibits expression of a fungal pathogen DCL gene or a construct comprising a promoter operably linked to a polynucleotide that inhibits expression of a fungal pathogen LTR region. In some embodiments, the polynucleotide comprises an antisense nucleic acid that is complementary to the DCL gene or a fragment thereof. In some embodiments, the polynucleotide comprises a small RNA duplex or a double-stranded RNA that targets the DCL gene or a fragment thereof. In some embodiments, the polynucleotide sequence comprises an inverted repeat of a sequence targeting the DCL gene, optionally with a spacer present between the inverted repeat sequences. In some embodiments, the polynucleotide comprises an antisense nucleic acid that is complementary to the LTR region or a fragment thereof. In some embodiments, the polynucleotide comprises a small RNA duplex or a double-stranded RNA that targets the LTR region or a fragment thereof. In some embodiments, the polynucleotide sequence comprises an inverted repeat of a sequence targeting the LTR region, optionally with a spacer present between the inverted repeat sequences. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a constitutively active promoter.
In another aspect, plants having inhibited or silenced expression of pathogen DCL genes or LTR region are provided. In some embodiments, the plant is contacted with a polynucleotide that inhibits expression of a pathogen DCL gene or a pathogen LTR region, wherein the plant has increased pathogen resistance relative to a control plant that is not contacted with the polynucleotide. In some embodiments, the plant comprises a heterologous expression cassette, the expression cassette comprising a polynucleotide that inhibits expression of a pathogen DCL or LTR region, wherein the plant has increased pathogen resistance relative to a control plant lacking the expression cassette. In some embodiments, the polynucleotide comprises an antisense nucleic acid that is complementary to the DCL gene or LTR region or a fragment thereof. In some embodiments, the polynucleotide comprises a double stranded nucleic acid that targets the DCL gene or LTR region or a fragment thereof.
In yet another aspect, expression cassettes comprising a promoter operably linked to a polynucleotide that inhibits expression of a pathogen DCL gene, or isolated nucleic acids comprising said expression cassettes, are provided. In some embodiments, the expression cassette comprises a promoter operably linked to a polynucleotide comprising an antisense nucleic acid that is complementary to the DCL gene or a fragment thereof. In some embodiments, the expression cassette comprises a promoter operably linked to a polynucleotide comprising a double stranded nucleic acid that targets the DCL gene or a fragment thereof. In some embodiments, a plant in which the expression cassette is introduced has increased resistance to the pathogen compared to a control plant lacking the expression cassette.
In some embodiments, the pathogen DCL gene or DCL promoter to be targeted or silenced is from a viral, bacterial, fungal, nematode, oomycete, or insect pathogen. In some embodiments, the DCL gene is from a fungal pathogen. Examples of plant fungal pathogens include, but are not limited to, Botyritis, Verticillium, Magnaporthe, Sclerotinia, Puccinia, Fusarium, Mycosphaerella, Blumeria, Colletotrichum, Ustilago, and Melampsora. See, e.g., Dean et al., Mol Plant Pathol 13:804 (2012). In some embodiments, the pathogen is Botyritis. In some embodiments, the pathogen is Botyritis cinera. In some embodiments, the pathogen is Verticillium. In some embodiments, the pathogen is V. dahilae.
In some embodiments, one or more pathogen DCL genes is targeted, silenced, or inhibited in order to increase resistance to the pathogen in a plant by expressing in the plant, or contacting to the plant, a polynucleotide that inhibits expression of the pathogen DCL gene or that is complementary to the DCL gene or a fragment thereof. In some embodiments, the polynucleotide comprises an antisense nucleic acid that is complementary to the DCL gene or a fragment thereof. In some embodiments, the polynucleotide comprises a double stranded nucleic acid that targets the DCL gene, or its promoter, or a fragment thereof. In some embodiments, the polynucleotide comprises a double-stranded nucleic acid having a sequence that is identical or substantially similar (at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to the DCL gene or a fragment thereof. In some embodiments, a “fragment” of a DCL gene or promoter comprises a sequence of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides of the DCL gene or promoter (e.g., comprises at least (e.g., at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides of any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:28, SEQ ID NO: 29 SEQ ID NO:30, or SEQ ID NO:31). In some embodiments, the double stranded nucleic acid is a small RNA duplex or a double stranded RNA.
In some embodiments, the polynucleotide inhibits expression of a fungal pathogen DCL gene that encodes a Botrytis or Verticillium DCL protein. In some embodiments, the polynucleotide inhibits expression of a fungal DCL gene that encodes a Botrytis DCL protein that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:2 or SEQ ID NO:4, or a fragment thereof. In some embodiments, the polynucleotide inhibits expression of a fungal DCL gene that encodes a Verticillium DCL protein that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:6 or SEQ ID NO:8, or a fragment thereof.
In some embodiments, the polynucleotide comprises a sequence that is identical or substantially identical (e.g, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:1 or SEQ ID NO:3 or a fragment thereof, or a complement thereof. In some embodiments, the polynucleotide comprises a sequence that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:5 or SEQ ID NO:7 or a fragment thereof, or a complement thereof. In some embodiments, the polynucleotide comprises a sequence that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a fragment thereof, or a complement thereof.
In some embodiments, the polynucleotide comprises an inverted repeat of a sequence that is identical or substantially identical (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a fragment thereof, or a complement thereof. In some embodiments, the polynucleotide comprises a spacer in between the inverted repeat sequences.
In some embodiments, the polynucleotide targets a promoter region of a fungal pathogen DCL gene. For example, in some embodiments, the polynucleotide targets a promoter region within the sequence of any of SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31.
In some embodiments, two or more fungal pathogen DCL genes or promoters are targeted (e.g., two, three, four or more DCL genes or promoters from the same fungal pathogen or from two or more fungal pathogens). In some embodiments, two or more Botrytis DCL genes or promoters are targeted. For example, in some embodiments, two or more of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:28, and SEQ ID NO:29, or a fragment of any thereof, are targeted for inhibition of expression. In some embodiments, two or more Verticillium DCL genes or promoters are targeted. For example, in some embodiments, two or more of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:30, or SEQ ID NO:31, or a fragment of any thereof, are targeted for inhibition of expression.
The LTR regions that generate most small RNA effectors can be targeted for silencing. In some embodiments, such as for B. cinerea, sRNA effectors are derived from LTR retrotransposon regions. Additionally, the promoter regions of LTRs can also be targeted for silencing. Targeting of LTR promoter regions can trigger transcriptional gene silencing, which would avoid random silencing of host genes by LTR small RNAs.
In some embodiments, the polynucleotide targets or inhibits expression of a pathogen LTR region or of a promoter region of a pathogen LTR, wherein the pathogen is a fungal pathogen. In some embodiments, the pathogen is Botyritis. In some embodiments, the pathogen is Botyritis cinera. In some embodiments, the pathogen is Verticilium. In some embodiments, the pathogen is V. dahilae.
In some embodiments, the polynucleotide targets a sequence of any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27 or a fragment thereof, or a complement thereof. In some embodiments, a “fragment” of a LTR region or LTR promoter comprises a sequence of at least 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides of the LTR region or LTR promoter (e.g., comprises at least 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleotides of any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27).
In some embodiments, the polynucleotide comprises an antisense nucleic acid that is complementary to any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27 or a fragment thereof. In some embodiments, the polynucleotide comprises a double-stranded nucleic acid having a sequence that is identical or substantially similar (at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27 or a fragment thereof. In some embodiments, the polynucleotide comprises an inverted repeat of a fragment of any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27, and further comprises a spacer region separating the inverted repeat nucleotide sequences.
In some embodiments, the polynucleotide targets a promoter region of a fungal LTR. For example, in some embodiments, the polynucleotide targets a promoter region within the sequence of SEQ ID NO:27.
In some embodiments, the methods of inhibiting or silencing expression of fungal pathogen DCL genes or LTR regions utilizes a host-induced gene silencing (HIGS) mechanism for producing in a host plant inhibitory RNA that subsequently moves into the pathogen to inhibit expression of a pathogen gene or region. In some embodiments, HIGS is used to produce in a plant inhibitory RNAs (e.g., sRNAs) that target one or more pathogen DCLs or LTRs. In some embodiments, wherein a pathogen has more than one DCL, HIGS is used to produce inhibitory RNAs (e.g., sRNAs) that target each of the DCLs of the pathogen (e.g., for Botrytis, targeting DCL1 and DCL2). In some embodiments, HIGS is used to produce inhibitory RNAs (e.g., sRNAs) against DCLs or LTRs of multiple pathogens.
The use of HIGS for silencing expression of pathogen genes in plants is described, e.g., in Nowara et al. (Plant Cell (2010) 22:3130-3141); Nunes et al. (Mol Plant Pathol (2012) 13:519-529); and Govindarajulu et al. (Plant Biotechnology Journal (2014) 1-9). Pathogen sRNAs are described, for example, in US 2015/0203865, incorporated by reference herein.
In some embodiments, antisense technology is used to silence or inactive the pathogen DCL gene or LTR. The antisense nucleic acid sequence transformed into plants will be substantially identical to at least a fragment of the gene to be silenced. In some embodiments, the antisense nucleic acid sequence that is transformed into plants is identical or substantially identical to the pathogen DCL sequence or LTR sequence to be blocked. In some embodiments, the antisense polynucleotide sequence is complementary to the pathogen DCL sequence or LTR sequence to be blocked. However, the sequence does not have to be perfectly identical to inhibit expression. Thus, in some embodiments, an antisense polynucleotide sequence that is substantially complementary (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary) to the pathogen DCL sequence or LTR sequence to be blocked can be used (e.g., in an expression cassette under the control of a heterologous promoter, which is then transformed into plants such that the antisense nucleic acid is produced).
In some embodiments, an antisense or sense nucleic acid molecule comprising or complementary to only a fragment of the pathogen DCL gene sequence or LTR sequence can be useful for producing a plant in which pathogen gene expression is silenced. For example, a sequence of about 15, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides can be used.
Catalytic RNA molecules or ribozymes can also be used to inhibit expression of a pathogen DCL gene or LTR. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs.
A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs that are capable of self-cleavage and replication in plants. The RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs). Examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ring spot virus, lucerne transient streak virus, velvet tobacco mottle virus, solanum nodiflorum mottle virus and subterranean clover mottle virus. The design and use of target RNA-specific ribozymes is described in Haseloff et al. Nature, 334:585-591 (1988).
Another method of suppression is sense suppression (also known as co-suppression). Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes. Generally, where inhibition of expression is desired, some transcription of the introduced sequence occurs. The effect may occur where the introduced sequence contains no coding sequence per se, but only intron or untranslated sequences homologous to sequences present in the primary transcript of the endogenous sequence. The introduced sequence generally will be substantially identical to the sequence intended to be repressed. This minimal identity will typically be greater than about 65% to the target gene sequence (e.g., DCL or LTR sequence), but a higher identity can exert a more effective repression of expression of the endogenous sequences. In some embodiments, sequences with substantially greater identity are used, e.g., at least about 80%, at least about 95%, or 100% identity are used. As with antisense regulation, the effect can be designed and tested so as to not significantly affect expression of other proteins within a similar family of genes exhibiting homology or substantial homology.
For sense suppression, the introduced sequence in the expression cassette, needing less than absolute identity, also need not be full length, relative to either the primary transcription product or fully processed mRNA. This may be preferred to avoid concurrent production of some plants that are overexpressers. A higher identity in a shorter than full length sequence compensates for a longer, less identical sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non-coding segments will be equally effective. In some embodiments, a sequence of the size ranges noted above for antisense regulation is used, e.g., at least about 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more nucleotides.
Gene expression may also be suppressed by means of RNA interference (RNAi) (and indeed co-suppression can be considered a type of RNAi), which uses a double-stranded RNA having a sequence identical or similar to the sequence of the target gene. RNAi is the phenomenon in which when a double-stranded RNA having a sequence identical or similar to that of the target gene is introduced into a cell, the expressions of both the inserted exogenous acne and target endogenous gene are suppressed. The double-stranded RNA may be formed from two separate complementary RNAs or may be a single RNA with internally complementary sequences that form a double-stranded RNA. Although complete details of the mechanism of RNAi are still unknown, it is considered that the introduced double-stranded RNA is initially cleaved into small fragments, which then serve as indexes of the target gene in some manner, thereby degrading target gene. RNAi is also known to be effective in plants (see, e.g., Chuang, C. F. & Meyerowitz, E. M., Proc. Natl. Acad. Sci. USA 97: 4985 (2000); Waterhouse et al., Proc. Natl. Acad. Sci. USA 95:13959-13964 (1998); Tabara et al. Science 282:430-431 (1998); Matthew, Comp Funct. Genom. 5: 240-244 (2004); Lu, et al., Nucleic Acids Research 32(21):e171 (2004)). For example, to achieve suppression of pathogen DCL expression using RNAi, a gene fragment (e.g., from a DCL gene) in an inverted repeat orientation with a spacer could be expressed in plants to generate double-stranded RNA having the sequence of an mRNA encoding the DCL protein, or a substantially similar sequence thereof (including those engineered not to translate the protein) or fragment thereof, is introduced into a plant or other organism of interest. The resulting plants/organisms can then be screened for a phenotype associated with the target protein and/or by monitoring steady-state RNA levels for transcripts encoding the protein. Although the genes used for RNAi need not be completely identical to the target gene, they may be at least 70%, 80%, 90%, 95% or more identical to the target gene sequence. See, e.g., U.S., Patent Publication No. 2004/0029283 for an example of a non-identical siRNA sequence used to suppress gene expression. The constructs encoding an RNA molecule with a stem-loop structure that is unrelated to the target gene and that is positioned distally to a sequence specific for the gene of interest may also be used to inhibit target gene expression. See, e.g., U.S. Patent Publication No. 2003/0221211. Gene silencing in plants by the expression of small RNA duplexes is also described, e.g., in Lu et al., Nucleic Acids Res. 32(21):e171 (2004).
The RNAi polynucleotides can encompass the full-length target RNA or may correspond to a fragment of the target RNA. In some cases, the fragment will have fewer than 100, 200, 300, 400, 500 600, 700, 800, 900 or 1,000 nucleotides corresponding to the target sequence. In addition, in some embodiments, these fragments are at least, e.g., 10, 15, 20, 50, 100, 150, 200, or more nucleotides in length. In some cases, fragments for use in RNAi will be at least substantially similar to regions of a target protein that do not occur in other proteins in the organism or may be selected to have as little similarity to other organism transcripts as possible, e.g., selected by comparison to sequences in analyzing publicly-available sequence databases.
Expression vectors that continually express siRNA in transiently- and stably-transfected cells have been engineered to express small hairpin RNAs, which get processed in vivo into siRNAs molecules capable of carrying out gene-specific silencing (Brummelkamp et al., Science 296:550-553 (2002), and Paddison, et al., Genes & Dev. 16:948-958 (2002)). Post-transcriptional gene silencing by double-stranded RNA is discussed in further detail by Hammond et al., Nature Rev Gen 2: 110-119 (2001), Fire et al., Nature 391: 806-811 (1998) and Timmons and Fire, Nature 395: 854 (1998).
Yet another way to suppress expression of a gene in a plant is by recombinant expression of a microRNA that suppresses the target gene. Artificial microRNAs are single-stranded RNAs (e.g., between 18-25 mers, generally 21 mers), that are not normally found in plants and that are processed from endogenous miRNA precursors. Their sequences are designed according to the determinants of plant miRNA target selection, such that the artificial microRNA specifically silences its intended target gene(s) and are generally described in Schwab et al, The Plant Cell 18:1121-1133 (2006) as well as the interest-based methods of designing such microRNAs as described therein. See also, US Patent Publication No. 2008/0313773.
Another way to suppress expression of a gene in a plant is by application of a dsRNA to a surface of a plant or part of a plant (e.g., onto a leaf, flower, fruit, or vegetable), for example by spraying the dsRNA onto the surface or brushing the dsRNA onto the surface. Methods of applying dsRNA onto external plant parts are described, for example, in WO 2013/02560 and in Gan et al., Plant Cell Reports 29:1261-1268 (2010), incorporated by reference herein.
In some embodiments, antisense sequences such as dsRNA or sRNA can be synthesized in planta and extracted from the plant for subsequent use on a target plant. As a non-limiting example, constructs for producing one or more dsRNA or sRNA sequences of interest can be transiently introduced into a plant (e.g., N. benthamiana), for example by infiltration with Agrobacterium. The dsRNA or sRNA sequences are produced by the plant and then RNA is extracted from one or more tissues of the plant in order to extract the dsRNA or sRNA sequences of interest. An exemplary method of expressing and extracting antisense sequences from N. benthamiana is described in the Examples section below.
In another aspect, methods of making plants having increased pathogen resistance are provided. In some embodiments, the method comprises:
introducing into a plant a heterologous expression cassette comprising a promoter operably linked to a polynucleotide that inhibits fungal expression of a pathogen DCL gene; and
selecting a plant comprising the expression cassette.
In some embodiments, the method further comprises introducing into the plant a second heterologous expression cassette comprising a second promoter operably linked to a second polynucleotide that inhibits fungal expression of a second pathogen DCL gene; and selecting a plant comprising the second expression cassette.
In some embodiments, the polynucleotide that inhibits fungal expression of the pathogen DCL gene is described herein (e.g., in Section II above, e.g., an antisense polynucleotide such as a hairpin RNA or microRNA precursor). For example, in some embodiments, the polynucleotide inhibits the expression of one, two, three, four or more Botrytis or Verticillium DCL genes. In some embodiments, the polynucleotide inhibits the expression of one, two, three, four or more of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or SEQ ID NO:31.
In some embodiments, a plant into which the expression cassette(s) has been introduced has increased pathogen resistance relative to a control plant lacking the expression cassette(s). In some embodiments, a plant into which the expression cassette has been introduced has enhanced resistance to a fungal pathogen (e.g., Botyritis or Verticillium) relative to a control plant lacking the expression cassette.
In some embodiments, the promoter is heterologous to the polynucleotide. In some embodiments, the polynucleotide encoding the sRNA-resistant target is operably linked to an inducible promoter. In some embodiments, the promoter is pathogen inducible (e.g., a Botrytis inducible promoter). In some embodiments, the promoter is stress inducible (e.g., an abiotic stress inducible promoter).
In some embodiments, the method comprises:
contacting a plurality of plants with a construct comprising a promoter operably linked to a polynucleotide that inhibits fungal expression of a pathogen DCL gene or pathogen LTR region, wherein the plant has increased resistance to a pathogen compared to a control plant that has not been contacted with the construct.
In some embodiments, the method further comprises selecting a plant having increased pathogen resistance.
In some embodiments, the method comprises:
contacting a plant or a part of a plant with a double-stranded RNA, a small RNA duplex, or a small RNA (sRNA) that targets a pathogen DCL gene or pathogen LTR region, wherein the plant or part of the plant has increased resistance to the pathogen compared to a control plant that has not been contacted with the double-stranded RNA or small RNA duplex.
In some embodiments, the double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA targets Botrytis DCLs or Verticillium DCLs. In some embodiments, the double-stranded RNA or small RNA duplex or sRNA targets any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7 or a fragment thereof. In some embodiments, the double-stranded RNA is an siRNA. In some embodiments, the siRNA comprises a sequence that is identical to any of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11, or SEQ ID NO:12, or a fragment thereof (e.g., a fragment of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous nucleotides) or a complement thereof.
In some embodiments, the method comprises contacting the plant or the part of the plant with two, three, four, five, or more double-stranded RNAs or small RNA duplexes (e.g., siRNAs) or sRNAs for targeting two, three, four, five, or more pathogen DCL genes or pathogen LTR regions from one, two, three or more different pathogens. As a non-limiting example, in some embodiments, the plant is contacted with a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets Botrytis DCL1 and a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets Botrytis DCL2. As another non-limiting example, in some embodiments, the plant is contacted with a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets Verticillium DCL1 and a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets Verticillium DCL2. As yet another non-limiting example, in some embodiments, the plant is contacted with a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets one or more DCLs of Botrytis (e.g., Botrytis DCL1 and/or Botrytis DCL2) and with a double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA that targets one or more DCLs of Verticillium (e.g., Verticillium DCL1 and Verticillium DCL2).
In some embodiments, the double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA is sprayed or brushed onto the plant or part of the plant (e.g., onto a leaf, a fruit, vegetable, or flower). In some embodiments, the double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA is contacted to (e.g., sprayed or brushed onto) a part of a plant that has been removed from the plant. As a non-limiting example, the double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA can be contacted to (e.g., sprayed or brushed onto) a fruit, vegetable, or flower that has already been cut from a plant. In some embodiments, the double-stranded RNA or small RNA duplex (e.g., siRNA) or sRNA is contacted to (e.g., sprayed or brushed onto) a part of a plant (e.g., a fruit, vegetable, or flower) while the part is still attached to the plant.
The isolation of polynucleotides of the invention may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the sequences disclosed here can be used to identify the desired polynucleotide in a cDNA or genomic DNA library from a desired plant species. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. Alternatively, cDNA libraries from plants or plant parts (e.g., flowers) may be constructed.
The cDNA or genomic library can then be screened using a probe based upon a sequence disclosed here. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Alternatively, antibodies raised against a polypeptide can be used to screen an mRNA expression library.
Alternatively, the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology to amplify the sequences of the genes directly from mRNA, from cDNA, from genomic DNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes. For a general overview of PCR see PCR Protocols: A Guide to Methods and Applications. (Innis, M, Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990).
Polynucleotides can also be synthesized by well-known techniques as described in the technical literature. See, e.g., Carruthers et al., Cold Spring Harbor Symp. Quant. Biol. 47:411-418 (1982), and Adams et al., J. Am. Chem. Soc. 105:661 (1983). Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
Once a polynucleotide sequence that inhibits expression of a fungal dicer-like (DCL) gene or LTR region, or that is complementary to a fungal pathogen DCL gene or LTR region or a fragment thereof, is obtained, it can be used to prepare an expression cassette for expression in a plant. In some embodiments, expression of the polynucleotide is directed by a heterologous promoter.
Any of a number of means well known in the art can be used to drive expression of the polynucleotide sequence of interest in plants. Any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit. Alternatively, expression can be conditioned to only occur under certain conditions (e.g., using an inducible promoter).
For example, a plant promoter fragment may be employed to direct expression of the polynucleotide sequence of interest in all tissues of a regenerated plant. Such promoters are referred to herein as “constitutive” promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CMV) 35S transcription initiation region, the 1′- or 2′-promoter derived from T-DNA of Agrobacterium tumafaciens, and other transcription initiation regions from various plant genes known to those of skill.
Alternatively, the plant promoter may direct expression of the polynucleotide sequence of interest in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as leaves or guard cells (including but not limited to those described in WO/2005/085449; U.S. Pat. No. 6,653,535; Li et al. Sci China C. Life Sci. 2005 April; 48(2):181-6, Husebye, et al., Plant Physiol, April 2002, Vol. 128, pp. 1180-1188; and Plesch, et al., Gene, Volume 249, Number 1, 16 May 2000 pp. 83-89(7)). Examples of environmental conditions that may affect transcription by inducible promoters include the presence of a pathogen, anaerobic conditions, elevated temperature, or the presence of light.
In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is stress inducible (e.g., inducible by abiotic stress). In some embodiments, the promoter is pathogen inducible. In some embodiments, the promoter is induced upon infection by Botyrtis. Non-limiting examples of pathogen inducible promoters include Botyritis-Induced Kinase 1 (BIK1) and the plant defensing gene PDF1.2. See, e.g., Penninckx et al., Plant Cell 10:2103-2113 (1998); see also Veronese et al., Plant Cell 18:257-273 (2006).
In some embodiments, a polyadenylation region at the 3′-end of the coding region can be included. The polyadenylation region can be derived from a NH3 gene, from a variety of other plant genes, or from T-DNA.
The vector comprising the sequences will typically comprise a marker gene that confers a selectable phenotype on plant cells. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosluforon or Basta.
As detailed herein, embodiments of the present invention provide for transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein (e.g., a polynucleotide that inhibits expression of a fungal pathogen dicer-like (DCL) gene or a polynucleotide that inhibits expression of a fungal pathogen LTR region, such as a polynucleotide that expresses a hairpin RNA or microRNA precursor). In some embodiments, a transgenic plant is generated that contains a complete or partial sequence of a polynucleotide that is derived from a species other than the species of the transgenic plant. It should be recognized that transgenic plants encompass the plant or plant cell in which the expression cassette is introduced as well as progeny of such plants or plant cells that contain the expression cassette, including the progeny that have the expression cassette stably integrated in a chromosome.
In some embodiments, the transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein have increased or enhanced pathogen resistance compared to a plant lacking the recombinant expression cassette, wherein the transgenic plants comprising recombinant expression cassettes for expressing the polynucleotide sequence have about the same growth as a plant lacking the recombinant expression cassette. Methods for determining increased pathogen resistance are described, e.g., in Section VI below.
A recombinant expression vector as described herein may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA construct may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. While transient expression of the polynucleotide sequence of interest is encompassed by the invention, generally expression of construction of the invention will be from insertion of expression cassettes into the plant genome, e.g., such that at least some plant offspring also contain the integrated expression cassette.
Microinjection techniques are also useful for this purpose. These techniques are well known in the art and thoroughly described in the literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et at. EMBO J. 3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70-73 (1987).
Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).
Transformed plant cells derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype such as enhanced pathogen resistance. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983 and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).
One of skill will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
The expression cassettes and antisense constructs (e.g., double-stranded RNA or small RNA duplexes, e.g., siRNAs) of the invention can be used to confer increased or enhanced pathogen resistance on essentially any plant or part of a plant. Thus, the invention has use over a broad range of plants, including but not limited to species from the genera Allium, Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panicum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Rosa, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vigna, and Zea. In some embodiments, the plant is a vining plant, e.g., a species from the genus Vitis. In some embodiments, the plant is an ornamental plant, e.g., a species from the genus Rosa. In some embodiments, the plant is a vegetable- or fruit-producing plant, e.g., a tomato plant or a strawberry plant. In some embodiments, the plant is a monocot. In some embodiments, the plant is a dicot.
Plants (or parts of plants) with increased pathogen resistance can be selected in many ways. One of ordinary skill in the art will recognize that the following methods are but a few of the possibilities. One method of selecting plants or parts of plants (e.g., fruits, vegetables, leaves, and flowers) with increased pathogen resistance is to determine resistance of a plant to a specific plant pathogen. Possible pathogens include, but are not limited to, viruses, bacteria, nematodes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, Calif.) (1988)). One of skill in the art will recognize that resistance responses of plants vary depending on many factors, including what pathogen, compound, or plant is used. Generally, increased resistance is measured by the reduction or elimination of disease symptoms (e.g., reduction in the number or size of lesions or reduction in the amount of fungal biomass on the plant or a part of the plant) when compared to a control plant. In some embodiments, resistance is increased when the number or sizes of lesions or amount of fungal biomass on the plant or on a part of the plant is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to a control (e.g., relative to a plant in which a heterologous polynucleotide targeting a fungal pathogen DCL or LTR has not been expressed).
In some cases, increased resistance can also be measured by the production of the hypersensitive response (HR) of the plant (see, e.g., Staskawicz et al. (1995) Science 268(5211): 661-7). Plants with increased pathogen resistance can produce an enhanced hypersensitive response relative to control plants.
Increased pathogen resistance can also be determined by measuring the increased expression of a gene operably linked a defense related promoter. Measurement of such expression can be measured by quantifying the accumulation of RNA or subsequent protein product (e.g., using Northern or Western blot techniques, respectively (see, e.g., Sambrook et al. and Ausubel et al.).
Eukaryotic small RNAs (sRNAs) are short regulatory noncoding RNAs that induce silencing of target genes at transcriptional and posttranscriptional levels. The endoribonuclease Dicer or Dicer-like proteins (DCLs) process double-stranded RNAs (dsRNAs) or RNAs with hairpin structures, giving rise to mostly 20-30-nt long sRNAs, which are loaded into Argonauts (AGO) proteins to induce gene silencing of their complementary targets by guiding mRNA cleaving or degradation, translational inhibition, DNA methylation, and histone modification. The role of sRNAs in plant-pathogen interactions, including the role of noncoding sRNAs from bacterial and eukaryotic plant pathogens in pathogenicity, is described in Weiberg et al., Annu. Rev. Phytopathol. 2014, 52:22.1-22.22, incorporated by reference herein.
sRNA effectors, like those found in B. cinerea, are transcribed from transposable elements (TEs) and suppress host immune-related genes. Host plant resistance genes are often clustered in genomic loci enriched with TEs. Similarly, protein effector genes are often found in clusters and interspersed with TEs. See, e.g., Weiberg at
Because most of the Botrytis small RNA effectors are generated from LTR regions, there are multiple copies for each LTR, which makes Bc-sRNA knockouts impractical if not impossible. Therefore, to solve this problem, Botrytis DCL knockout mutants were generated.
As shown in
B. cinerea DCLs are essential for the pathogenicity of B. cinerea. As shown in
A genome-wide comparative sRNA analysis on a dcl1 dcl2 mutant strain and wild-type revealed that Botrytis DCLs are responsible for generating LTR-derived sRNAs, many of which are sRNA effectors. See,
B. cinerea delivers small RNAs into host cells (e.g., plant cells) to suppress host immune systems. See, e.g., Weiberg at
These results suggest that RNAi constructs, which target fungal Dicer-like protein genes to attenuate fungal virulence, can be expressed in host plants (including, but not limited to, tomato, grape and other commercially important crops). Alternatively, the RNAi constructs can be contacted to the plant, such as by being sprayed on a surface of the plant (e.g., onto the surface of a leaf) for promoting fungal resistance. As shown in
Table I. Infection-enriched Verticillium small RNAs have potential host targets
Verticillium
Enhanced fungal resistance was observed when fruits, leaves, and vegetables were treated with sRNAs targeting fungal pathogen DCL genes. The following protocol was used for treating fruits, leaves, or vegetables with RNAs extracted from N. Benthamiana expressing Bc-DCL-targeting sRNAs.
1. Plasmid construction. B. cinerea DCL1 (BcDCL1) RNAi fragment was amplified by using B. cinerea cDNAs as template, forward primer BcDCL1RNAi-F: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGGAAGAACTTGAAGGTTTGCTA CA-3′ and reverse primer BcDCL1RNAi-R: 5′-GTCCAGATCTGGTCAACACACCAAG-3′, 252bp. BcDCL2 RNAi fragment was amplified by the forward primer BcDCL2RNAi-F: 5′-CTTGGTGTGTTGACCAGATCTGGACGGATGCCATTTGCTGCACGC-3′ and reverse primer BcDCL2RNAi-R: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTACTCTTGAGTACTTTCGC CAGCTCAC-3′, 238bp. These two RNAi fragments were integrated together by overlapping PCR as BcDCL-RNAi, which was cloned into pDONR207 by BP reactions (Life Technologies), and finally to destination vector pHELLSGATE 8.0 by LR reactions (Life Technologies) as pHELLSGATE-BcDCL-RNAi. This vector as well as a negative control pHELLSGATE 8.0 empty vector were transformed into A. tumefaciens GV3101 strain.
2. Generate DCL-targeting sRNAs in N. benthamiana. The A. tumefaciens GV3101 strain carrying pHELLSGATE-BcDCL-RNAi (RNAi strain) and pHELLSGATE 8.0 empty vector (EV straw) were cultured in liquid LB with antibodies (100 μg/μl Spectinomycin, 50 μg/μl Gentamycin and 50 μg/μl Rifampicin) overnight at 28° C. shaker. Both EV and RNAi A. tumefaciens cultures were centrifuged at 4000 rpm for 15 min at room temperature, and resuspended bacterial pellets with 5 mL infiltration buffer (10 mM MgCl2, 10 mM MES, and 0.2 mM Acetosyringone). The OD600 of both EV and RNAi strain solutions were adjusted to 1.0, and kept on room temperature for 4 hours. Both solutions were diluted to OD600=0.5 by infiltration buffer right before infiltration. Then, the EV and RNAi strain solutions were used to infiltrate the 4 weeks old leaves of N. benthamiana, and allowed 2 days infection to over express DCL-targeting sRNAs in RNAi strain treated tissues.
3. Extract the sRNAs from N. benthamiana. The infiltrated N. benthamiana leaf tissues were harvested separately based on the strains (EV or RNAi)) that infiltrated, and freeze them immediately in liquid nitrogen. 10 g of each tissue were ground into fine powder in the liquid nitrogen with mortars and pestles, and total RNAs were extracted by using TRIzol Reagent (Life Technologies). Resolved the RNA pellets in 5000 μl DEPC treated H2O, and the concentration of both EV and RNAi total RNAs was examined by nanodrop. The final concentration of these two RNAs samples were both adjusted to 50 ng/μl for further use. The sRNAs targeting Bc-DCLs were only present in the RNAi set, but not in the EV set, which was used as a negative control.
4. Treat the vegetables or fruits with the RNA extracts. Two sets of vegetables or fruits under similar conditions, (e.g., similar freshness, maturity, size, shape, etc.) were gently washed and put in a plastic box with a wetted filter paper on the bottom to keep moisture. The first set was evenly treated with RNA extracts from EV strain infiltrated tissues, the other set was evenly treated with RNA extracts from RNAi strain infiltrated tissues. RNA extracts were applied by spray or by drop inoculation.
5. B. cinerea infection. B. cinerea infection was carried out after the spray of RNA extracts. The spores from 10 days old B. cinerea grown on Malt Extract Agar medium were eluted in sterile H2O, and the fungal mycelia were filtered from the spores by nylon cloth. B. cinerea spore concentration was calculated by hemocytometer and diluted in B5 medium (10 mM Sucrose, 10 mM KH2PO4, Tween-20 0.025%). 15 μl of Botrytis spore solution (2×10−5) was sprayed on the surface of the sprayed fruits or vegetable, and allowed 2-4 days B. cinerea inoculation. Different vegetables or fruits took different time to obtain obvious disease symptoms.
Alternatively, a “mix” method was used for administering a 1:1 mixture of total RNAs as described above and Botrytis spore solution (4×10−5). 15 ul of the mixed solution was directly dropped on the surface of 2 sets of fruits or vegetables under similar conditions.
As shown in
In another experiment, pretreating tomato leaves and fruits, strawberry fruits, and grape fruits with the total RNA from N. Benthamiana infiltrated with pHELLSGATE-BcDCLs and pHELLSGATE-EV by spray for 24 hours, followed by B. cinerea drop inoculation on the sprayed area of the fruits, reduced gray mold disease symptoms caused by B. cinerea. See,
In yet another experiment, Spraying tomato leaves and fruits with in vitro transcribed dsRNA against BcDCLs reduced gray mold disease caused by B. cinerea on tomato and strawberry. Tomato leaves and fruits and strawberry fruits were pre-treated with water or in vitro transcribed long dsRNA against BcDCLs for 24 hours, followed by B. cinerea drop inoculation right on the pretreated area of the leaves or fruits. See,
Host induced gene silencing (HIGS) was used to silence the dicer-like protein (DCL) genes of two fungal pathogens in plants. An RNAi approach for targeting two DCLs from Botrytis and two DCLs from Verticillium was used in Arabidopsis, resulting in the generation of “HIGS-4DCLs” lines. The HIGS-4DCLs lines, as well as wild type Arabidopsis plants, were infected with B. cinerea by drop inoculation on the leaves and were infected with V. dahilae by root inoculation. Three weeks after infection, the HIGS-4DCLs lines exhibited increased tolerance to both pathogens relative to the wild-type plants. See,
Eukaryotic pathogens, such as fungi and oomycetes, cause billions of dollars crop losses worldwide annually. B. cinerea poses a serious threat to over 200 plant species, including nearly all vegetables and fruits as well as many flowers, in their pre- and post-harvest stages by causing grey mold disease. Williamson et al., Mol. Plant Pathol 8, 561-580 (2007); van Kan, Trends in Plant Science 11:247-253 (2006)). Current disease control is mainly achieved by fungicide application, which is costly and environmentally hazardous. HIGS has worked effectively against a variety of fungal and oomycete pathogens, such as Blumeria graminis (Novara et al., Plant Cell 22, 3130-3141 (2010); Pliego et al., Molecular Plant-Microbe interactions 26, 633-642 (2013); Whigham et al., Molecular Plant-Microbe Interactions 28, 968-983 (2015)), Puccinia tritici (Panwar et al, Plant Molecular Biology 81, 595-608 (2013)), Fusarium spp. (Koch et al., PNAS 110, 19324-19329 (2013); Ghag et al., Plant Biotechnology Journal 12:541-553 (2014); Cheng et al., Plant Biotechnology Journal, doi:10.1111/pbi.12352 (2015)), Phytophthora infestans Gahan et al., Journal of Experimental Botany 66:2785-2794 (2015); Sanju et al., Functional & Integrative Genomics 15:697-706 (2015), and Phytophthora capsici (Vega-Arreguin et al, Molecular Plant-Microbe Interactions 27, 770-780(2014). However, successful HIGS largely depends on plant transformation technology that is not available for many crops, and furthermore, the safety of genetically modified organisms (GMOs) is still a major concern to the public.
As discussed above in Example 1, only the dcl1 dcl2 double mutant of B. cinerea, but not the dcl1 or dcl2 single mutants, failed to produce Bc-sRNA effectors, suggesting that these Bc-sRNA effectors are dependent on both Bc-DCL1 and Bc-DCL2. To fully evaluate the contribution of Bc-DCL-dependent Bc-sRNA effectors to B. cinerea pathogenicity on a wide range of economically important crops, various fruits (tomato—Solanum lycopersicum ‘Roma’, strawberry—Fragaria×ananassa, and grape—Vitis labrusca ‘Concord’), vegetables (iceberg lettuce—Lactuca sativa and onion—Allium cepa L.), and flower petals (rose—Rosa hybrida L.) were inoculated with the dcl1 dcl2 double mutant. The dcl2 single mutant, and wild-type (WT) strains were used as controls. The dcl1 dcl2 double mutant showed much weaker pathogenicity and produced significantly smaller lesions than the WT strain on all the samples (
To assess the DCL1 and DCL2-dependent Bc-sRNA population globally, we profiled total sRNAs isolated from the dcl1 dcl2 double mutant as well as the WT strain. In the WT strain, Bc-sRNAs ranged from 20 to 35 nucleotides (nt) in length (data not shown), with an enrichment of 24-27-nt species. The abundance of 20-27-nt sRNA species was clearly reduced but not completely eliminated in the dcl1 dcl2 double mutant (data not shown), pointing to the existence of DCL-independent sRNA biogenesis pathways in B. cinerea, as reported in Neurospora crassa (Lee et al., Molecular Cell 38:803-814 (2010); Jin al., Molecular Cell 38:775-777 (2010)). Most strikingly, the sRNAs derived from retrotransposons (ranging from 20-26-nt and peaking at 21-22-nt) were almost completely eliminated in the dcl1 dcl2 double mutant (data not shown), which indicates that Bc-DCL1/2 are mostly responsible for generating sRNAs from retrotransposons. The sRNAs from intergenic non-coding (IGN) regions (mainly the 21-, 22- and 24-nt sRNAs) and antisense to open reading frames (ORFs-antisense, mainly the 21-22-nt sRNAs) were also largely reduced in dcl1 dcl2, although the sRNAs from the sense transcripts of ORFs (ORFs-sense) were not changed significantly. As reported previously (Weiberg et al.) and as discussed in Example 1, the majority of predicted sRNA effectors are from retrotransposon long terminal repeats (LTRs); thus, Bc-DCL1/2 are largely responsible for generating sRNA effectors and contribute significantly to B. cinerea pathogenicity. This makes Bc-DCL1/2 ideal targets to test whether sRNA-mediated silencing would be an efficient strategy for controlling gray mold disease.
To test whether host-generated sRNAs can move from plant cells to B. cinerea and whether silencing Bc-DCLP2 would efficiently suppress disease symptoms of B. cinerea on plants, we generated transgenic Arabidopsis plants expressing sRNAs that target both Bc-DCLs. A DNA fragment containing 252 base-pair (bp) and 238 bp segments from the non-conserved regions of Bc-DCL1 and Bc-DCL2, respectively, was cloned into the pHELLSGATE vector system (Helliwell et al., Methods in Enzymology 392:24-35 (2005)). Two DNA segments were used, one each from Bc-DCL1 and Bc-DCL2, because there is no DNA region outside the conserved domains with sufficient homology between the two DCLs to silence both DCLs. DNA regions in the conserved functional domains were avoided to eliminate any off-target effects on DCL genes from other species. These selected Bc-DCL DNA regions have only 3.5% to 4.8% sequence identity to Arabidopsis DCLs, and indeed, no host DCL genes were silenced (data not shown). The hairpin RNA products transcribed from the pHELLSGATE construct in the transgenic plants were processed into sRNAs by plant DCLs to target Bc-DCL1 and Bc-DCL2 (
To determine whether this Bc-DCL1/2-targeting RNAi strategy could also efficiently control gray mold disease in tomato plants, we introduced the same Bc-DCL1/2 fragment into the tobacco rattle virus (TRV) silencing system (Liu et al., Plant Journal 31:777-786 (2002), which triggered the expression of Bc-DCL1/2-sRNAs in tomato. Three weeks after agro-infiltration, the tomato plants were infected with B. cinerea using spray inoculation. The tomato leaves expressing Bc-DCL1/2-sRNAs displayed very mild to almost no disease symptoms at 3 dpi (
B. cinerea also infects many other plant species, in addition to Arabidopsis and tomato. Gray mold disease is a very serious problem in post-harvest management, as it destroys millions of fruits, vegetables, and flowers during the packing, transportation, and storage processes each year. Unfortunately, stable transformation and virus-induced gene silencing technologies have not been developed in many host species. Uptake of RNAs from environments, a phenomenon named environmental RNAi, was observed in C. elegans and other insects. See, e.g., Winston et al., PNAS 104:10565-10570 (2007): Ivashuta et al., RNA 21:840-850 (2015). Spraying dsRNAs targeting the actin gene of potato beetle Leptinotarsa decemlineata on potato leaves could inhibit the larva growth (San Miguel et al., Pest Management Science, doi:10.10021ps.4056 (2015)). Therefore, we attempted to externally apply synthetic Bc-DCL1/2-sRNAs or their double-stranded RNA precursors (Bc-DCL1/2-dsRNAs) on the surface of fruits, vegetables, and flowers, to test whether B. cinerea is capable of taking up dsRNAs and/or sRNAs from the environment and inducing silencing of its own genes. The same Bc-DCL1/2 fragment was transcribed in vitro from both ends and gave rise to Bc-DCL1/2-dsRNAs. The Bc-DCL1/2-dsRNAs were subjected to RNAse III treatment to generate Bc-DCL1/2-sRNAs in vitro. The Bc-DCL1/2-sRNAs and the precursor dsRNAs (20 ng/μl) were externally applied on fruits (tomato, strawberry, and grape), vegetables (lettuce and onion), and flower petals (rose), and followed with B. cinerea infection. All the plants treated with Bc-DCL1/2-sRNAs and -dsRNAs developed much weaker disease symptoms (
Although external treatment of Bc-DCL1/2-sRNAs and the precursor Bc-DCL1/2-dsRNAs can inhibit fungal disease, in vitro RNA synthesis is too costly. In order to obtain a large amount of Bc-DCL1/2-sRNAs and -dsRNAs at a much lower cost, we transiently expressed pHELLSGATE-Bc-DCL1/2 vector in N. benthamiana, which yielded a large amount of Bc-DCL1/2-sRNAs and -dsRNA precursors two to three days after Agrobacterial inoculation (
The effect of externally applied Bc-DCL1/2-sRNAs and -dsRNAs molecules on B. cinerea virulence and growth could be a result of the direct uptake of dsRNAs and sRNAs from the ambient environment by B. cinerea or an indirect process that involves plant uptake and processing prior to transport into B. cinerea cells. In order to test whether sRNA and dsRNA can directly enter B. cinerea cells or require an intermediate step involving plant hosts, we removed the plants out of the picture, and directly applied the Bc-DCL1/2-sRNAs and -dsRNAs on B. cinerea spores and germinated them on solid malt extract (ME) medium. To visualize the RNAs, we labeled the RNAs with fluorescein-12-UTP by in vitro transcription. Microscopic inspection of germinating conidiospores after 12 hours revealed fluorescent RNA signals accumulating in fungal cells (
Such an RNAi-based disease control method could be powerful if it is effective against multiple pathogens. For example, we could design DCL-targeting dsRNAs or sRNAs to silence DCL genes of multiple pathogens that utilize sRNA effectors. The soil borne fungal pathogen Verticillium dahilae is another economically important fungal pathogen, which causes verticillium wilt on a wide range of plant species, including herbaceous annuals, perennials, and woody species (Fradin et al., Mol Plant Patrol. 7:71-86 (2006); Klosterman et al., Annual Review of Phytopathology 47:39-62 (2009). To date, there is no effective control method other than toxic fungicide application. As discussed above in Example 1, V. dahilae also utilizes host AGO1 for its sRNA effector functions; thus, targeting Vd-DCL genes could also be a potential strategy for controlling verticillium wilt disease.
To test whether the RNAi-based method can simultaneously control V. dahilae and B. cinerea, we generated Arabidopsis transgenic plants that express hairpin RNAs targeting DCL genes of both fungi. V. dahilae also has two DCL genes. Again, we were not able to find a DNA region outside the conserved domains that has sufficient homology between Vd-DCL1 and Vd-DCL2 (d-DCL1/2), or between the DCLs of V. dahilae and B. cinerea to silence two or multiple DCLs. Thus, we had to select two DNA segments, each from Vd-DCL1 (156 bp) and Vd-DCL2 (156 bp), which had 2.2% to 3.1% identity to the four At-DCLs (data not shown), and fused them to a 164 bp fragment of Bc-DCL1 and 151 bp fragment of Bc-DCL2, both derived from the Bc-DCL1/2 RNAi DNA fragment. This ligated product was then cloned into the pHELLSGATE vector. These transgenic plants expressed high levels of both Bc-DCL1/2-sRNAs and Vd-DCL1/2-sRNAs (
We have provided the first example of bi-directional sRNA trafficking between a fungal pathogen and its interacting hosts. Plant host-generated Bc-DCL-targeting sRNAs can be transported into B. cinerea to silence Bc-DCL genes for disease control. In C. elegans, dsRNA uptake from the environment requires dsRNAs that are longer than 50 bp, instead of shorter dsRNAs or mature sRNAs. See, e.g., Winston et al., PNAS 104:10565-10570 (2007); McEwan et al., Molecular Cell 47:746-754 (2012). Some herbivorous insects are also capable of taking up dsRNAs that are longer than 50-60 bp, but not sRNAs (Ivashuta et al., RNA 21:840-850 (2015). Here, we show that B. cinerea can take up both sRNAs and dsRNAs directly, and both can induce silencing of B. cinerea genes efficiently, suggesting that the RNA uptake channels or pathways may differ in different organisms.
Eukaryotic pathogens, including fungi and oomycetes, cause serious crop losses annually. Currently, fungicide and chemical spray is still the most common disease control strategy, yet they pose serious threats to human health and environments. Over the last few years, the stable plant transformation-based HIGS system was proven to efficiently control a range of pests, nematodes, filamentous pathogens, and parasitic plants in various plant models and crop species. See, e.g., Baum et al., Nat Biotechnol 25:1322-1326 (2007); Huang et al., PNAS 103:14302-14306 (2006); Nowara et al. (Plant Cell 22:3130-3141 (2010). However, these successful HIGS studies relied on a plant transformation system that is not available for many crops. Some commonly selected pathogen target genes that are important for pathogen propagation and infection include parasitism genes, effector encoding genes, or fungal ergosterol biosynthesis related genes. We found that B. cinerea DCL genes are essential for the biogenesis of sRNA effectors as well as fungal growth and development. They are the ideal targets for controlling pathogens that use sRNA effectors. Here, we have discovered that B. cinerea can take up dsRNAs or sRNAs from the environment and induce environmental RNAi, making it possible to directly use such dsRNAs and sRNAs for disease management. We show that spraying BcDCL1/2-sRNAs and -dsRNAs on the surface of various fruits, vegetables, and flowers can efficiently control gray mold disease. This RNAi-based new generation of “RNA fungicides” could circumvent the technical limitation of transformation and the public's concerns about GMOs and provide an easy-to-use and environmentally friendly disease management tool for crop products both pre- and post-harvest. Furthermore, such RNA-based strategies could be easily designed to target multiple pathogens.
Plasmid construction: The plasmids pHELLSGATE-Bc-DCL1/2 and pHELLSGATE-Bc+Vd-DLLs were constructed following the methods outlined for the Hellsgate8.0 system (Helliwell et al., Methods in Enzymology 392:24-35 (2005)). The Bc-DCL1/2 RNAi fragment was obtained by integrating Bc-DCL1 (252 bp) and Bc-DCL2 (238 bp) fragments via overlapping PCR. The Bc+Vd-DCLs RNAi fragment was obtained by integrating the 315 bp Bc-DCL1/2 RNAi fragment (164 bp of Bc-DCL1 and 151 bp of Bc-DCL2) and RNAi fragments of Vd-DCL1 (156 bp) and Vd-DCL2 (156 bp) via overlapping PCR. The RNAi fragments were cloned separately into pDONR207 using Gateway® BP clonase (Life Technologies, Carlsbad, Calif.), then into the destination vector pHELLSGATE8.0 using Gateway® LR clonase (Life Technologies, Carlsbad, Calif.). For the pTRV2-Bc-DCL1/2 plasmid, the pDONR207-Bc-DCL1/2 vector was cloned into pTRV2 EV to obtain pTRV2-Bc-DCL1/2 using LR clonase (Life Technologies, Carlsbad, Calif.) (Weiberg et al., Science 342:118-123 (2013)).
In vitro synthesis of YFP-dsRNAs, Bc-DCL1/2-dsRNAs and -sRNAs: Following the MEGAscript® RNAi Kit instructions (Life Technologies, Carlsbad, Calif.), T7 promoter sequence were introduced into both 5′ and 3′ ends of the YFP and Bc-DCL1/2 RNAi fragments by PCR, respectively. After purification, the DNA fragments containing T7 promoters at both ends were used for in vitro transcription. To obtain Bc-DCL1/2-sRNAs, the synthesized Bc-DCL1/2-dsRNAs were digested into sRNAs with ShortCut® RNase III (NEB Ipswich, Mass.).
In vitro RNA fluorescence labeling and confocal microscopy examination: Bc-DCL-dsRNAs were labeled with fluorescence following the Fluorescein RNA Labeling Mix kit instructions (Sigma, St. Louis, Mo.). The fluorescent Bc-DCL-sRNAs were obtained from the digestion of fluorescent Bc-DCL-dsRNAs with ShortCut® RNase III (NEB Ipswich, Mass.). For the confocal examination of fluorescent RNA-treated B. cinerea grown on the microscopic slides, 4 μl of a 105 spores/ml solution and 4 μl of 100 ng/μl fluorescent Bc-DCL-sRNAs or -dsRNAs was mixed and dropped on the solid ME medium prepared on the microscopic slides. After 12 hours of incubation in the dark, fluorescence was examined using confocal microscope SP5. To detect fluorescent RNA trafficking into the B. cinerea protoplast, 107 B. cinerea spores were cultured in 10 ml YEPD, and 2 μg of fluorescent Bc-DCL-sRNAs or -dsRNAs were added. The protoplasts were isolated as described previously (Gronover et al., Molecular Plant-Microbe Interactions 14:1293-1302 (2001)) after 40 hours, followed by KCl buffer or 75 U Micrococcal Nuclease (Thermo Scientific, Waltham, Mass.) treatment at 37° C. for 30 min. Fluorescence was examined using confocal microscope SP5.
Preparation of N. Benthamiana total RNA with or without Bc-DCL1/2-sRNAs and -dsRNAs: Four-week old N. benthamiana plants were infiltrated with A. tumefaciens strain carrying pHellsgate-Bc-DCL1/2 or pHellsgate-EV. The leaf tissue was harvested 2 dpi and used for total RNA extraction.
External application of RNAs on the surface of plant materials: All RNAs were adjusted to a concentration of 20 ng/μl with RNase-free water before use. For in vitro synthetic YFP-dsRNA, Bc-DCL1/2-sRNAs and Bc-DCL1/2-dsRNA, 20 μl RNA (20 ng/μl) was dropped or sprayed onto the surfaces of the plant materials. For N. benthamiana total RNA extracts, the surfaces of plant materials were evenly sprayed with 20 ng/μl RNAs.
Fungal pathogen assay and disease quantification: The B. cinerea strain B05.10 and V. dahilae strain JR2 were cultured on Malt extract agar (2% malt extract, 1% Bacto Peptone) and potato dextrose agar (PDA), respectively. The B. cinerea spores were diluted in 1% Sabouraud Maltose Broth buffer to a final concentration of 104 spores/ml for spray inoculation on tomato leaf and 105 spores/ml for the drop or spray of other plant materials (Mengiste et al., Plant Cell 14:2551-2565 (2003)). 10 μl spore suspension was used in drop or sprayed area of all plant materials, except tomato fruits in which 2.0 μl was dropped. V. dahilae sod-inoculation assay was performed as described previously.
Arabidopsis root culture and infection: For Arabidopsis liquid root culture inoculation, 2-week old. Arabidopsis were grown in root culture (0.32% MS Salt, 2% Sucrose, 0.1% MES, pH5.8 by KOH), and V. dahilae spores were added into the culture to the final concentration of 106 spores/ml. After 5 min inoculation, the root culture was replaced with fresh sterile solution. The fungal biomass quantification was performed as described previously (Gachon et al., Plant Physiol Bioch 42:367-371 (2004)).
Cloning and data analysis of Arabidopsis AGO1- and AGO2-associated sRNAs: V. dahilae infected Arabidopsis prepared in liquid root culture were collected at 2 and 4 dpi. At-AGO1 and At-AGO2 immunoprecipitations were performed using anti-AGO1- and anti-AGO2 peptide antibodies (Zhang et al., Mol Cell 42:356-366 (2011)). At-AGO1- and At-AGO2-associated RNAs were extracted and used for sRNA library construction and Illumina. HiSeq 2000 deep sequencing (Weiberg et al., Science 342:118-123 (2013)). The read number of Vd-sRNAs in At-AGO1 and At-AGO2 IP libraries was normalized with total V. dahilae sRNAs after removing tRNA, rRNA, snoRNA, snRNA, etc. The Vd-sRNAs that had a higher than 100 RPM after normalization and also had host target genes in Arabidopsis were selected. At-AGO1 associated Vd-sRNA effectors were defined as the selected Vd-sRNAs with a 10 times greater read number in the At-AGO1 IP library compared to the At-AGO2 IP library. At-AGO2 associated Vd-sRNA effectors were defined as the selected Vd-sRNAs with a 10 times greater read number in the At-AGO2 IP library compared to the At-AGO1 IP library.
AAATATGTACTGCAGAAGATCCCAGCTTGCTGCAGTACTCAATCAAAGGTAAACCT
GAGACTCTTGCCTACTATGATCCCTTGGGCCCGAAATTCAATACTCCTCTTTATCTT
CAAATGCTCCCGCTTCTAAAAGACAATCCTATCTTTCGGAAGCCATTTGTATTTGGG
ACAGAAGCCAGTAGAACTCTAGGATCTTGGTGTGTTGACCAGATCTGGACTTT
CTGT
CTGCACGCCAAAAATACATCGAGCAGATCTTCGCCTTCGAGTAAAGCTACCACTTCT
ATCTATTATCTACTATACCCCAGAGTCAAATATCATCGTGACGAAAACTGTGGCGAG
CCTGAGAAAGATTGTGCAAAGTCTCAACATTTTCGAAGACCCCTACGTTTTGACACT
AAAAAGGAGTGATAGCGAAAAAAGTCAACGTGAGCTGGCGAAAGTACTCAAGAGTT
TTAAGACATATAGTCAAACCCAATTAAAGTCAATCGACAAAACTAGCAACGAGATTAT
AAGAGAATCGCCTTTTTCCTCGTGGAAAAGGTTGCTCTTGCCCTCCAACAGCACGC
GGTTCTGGAGTGCAATCTGGAATTTCCCATTGACCGGGTATGCGGTGACATGGTAC
GGTCGGACTGGATCAAGGAGTCATGGATGAAAAGATGGGATGACAACATGGTCATG
GTCTGCACCGCCGCCATCCTTCAGCAATGCCTTGCCAGATCATTCATCCGCATGGAT
CAGATCAACCTGCTTGTCTTCGATGAAGCACATCACGCCAAGGGAAATCATCCGTA
CGCCCGGATCATCAAGGACTACTACATTACGGAACCTGACAAAGAAAGGCGCCCCAAGA
ATCCCCCTTTCCAAGTTTATGCGCCACTCCTCAATAGAGGTTGTGCACCAGCAGAC
CAAAGCTGCCACCCTTCATCCCGATCTCCCACCACAGATCATGCACCCTCTGCAAC
ATGGGTCAAGCTACCCCTGGTCTCTTCTCGCCCGTTTACATCCCGCAAAGTTCTTCT
CCCACATCCTCGAACCTGTACTCCGTGCCGTCTCCCTCGATTCCCGCCACATCGCC
GCGTGCATTCGTGTCGCCCAACGACTGCCCATTCTCCCTCTGCTCTCCCGACTGGC
AAAGGAGGACGTTCATGTCCTGCATCCGAAGCAAGAGCTGGGAGAGATCGCTGGTCCC
TTCCGAGTCAAA
TGACCAAGGAATTTGTGACGGAACAACACGGGTTGCCGGCACATGG
TTCCGAGTCAAA
TGACCAAGGAATTTGTGACGGAACAACATGGGTTGCCGGCACATGG
ATTCCGAGTCAAA
TGACCAAGGAATTTGTGACGGAACAACACGGGTTGCCGGCACATG
AGTCAAA
TGACCAAGGAATTTGTGACGGAACAACACGGGTTGCCGGCACATGGACACCA
TTCCGAGTCAAA
TGACCAAGGAATTTGTGACGGAACAACATGGGTTGCCGGCACATGGA
ATGACCAAGGAATTTGTGACGGAACAACATGGGTTGCCGGCACACGGACATCAAGGGAT
B. cinerea (B05.10) Botrytis cinerea supercontig 1.69 [DNA] 45790-46725-
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
The present application claims priority to U.S. Provisional Application No. 62/153,440, filed Apr. 27, 2015, and to U.S. patent application Ser. No. 14/809,063, filed Jul. 24, 2015, the entire content of each of which is incorporated by reference herein for all purposes.
This invention was made with Government support under Grant No. MCB-0642843, IOS-1257576 awarded by the National Science Foundation, a NIH grant (R01 GM093008). The government has certain rights in this invention.
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/US16/29560 | 4/27/2016 | WO | 00 |
Number | Date | Country | |
---|---|---|---|
62153440 | Apr 2015 | US | |
62028776 | Jul 2014 | US | |
62153440 | Apr 2015 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 14809063 | Jul 2015 | US |
Child | 15569740 | US |