The present application is a 35 U.S.C. §371 National Phase Application of International Application Serial No. PCT/EP02/09843, filed Sep. 3, 2002 and published in English as PCT Publication No. WO 03/020927 on Mar. 13, 2003, which claims priority to German Patent Application Serial No. DE 101 43 237.2, filed Sep. 4, 2001, the disclosures of each of which are incorporated herein by reference in their entireties.
The present invention is directed to a method of creating artificial internal ribosome entry site (IRES) elements capable of causing cap-independent translation of a nucleotide sequence of interest in eukaryotic cells or organisms. Further, a process of expressing a nucleotide sequence of interest in eukaryotic cells under translational control of an artificial IRES element according to the invention is provided. The invention further relates to a vector and an expression cassette comprising such an IRES element and to eukaryotic cells transformed or transfected with such a vector or expression cassette.
There is a growing interest in using internal ribosome entry site (IRES) elements for expressing foreign genes in eukaryotic cells. Although the number of nucleotide sequences that are capable to provide cap-independent translation increases constantly, identification of new IRESes has been occasional or accidental without distinct methodology of predicting IRES elements.
In most cases, the regulation of translation in eukaryotic cells occurs at the stage of initiation by a scanning mechanism. This involves binding of eukaryotic initiation factor 4F (eIF4F), a complex of proteins which includes eIF4E (the cap binding protein), eIF4G (a large protein which acts as a scaffold for the proteins in the complex and has binding sites for eIF4E, eIF4a, eIF3, and a poly(A) binding protein), and eIF4A (RNA helicase) to the m7GpppN cap structure, recruitment of a 40 S ribosomal subunit, and scanning to the first AUG codon in the correct context (Pain, V. M., 1996, Eur. J. Biochem. 236, 747-771).
Translation initiation can also occur by a mechanism that does not require the cap structure. In this case, the ribosome enters the mRNA at a region termed an internal ribosome entry site (IRES) that is up to 1,000 bp long. IRESes were originally identified in picornaviral RNAs, and during picornaviral infection, there is often a switch of translation from host encoded cellular mRNAs to viral transcripts (Jackson and Kaminski, 1995, RNA 1, 985-1000).
IRES-containing animal mRNAs can presumably recruit 40 S ribosomes either via their capped 5′ ends or their IRES elements, which likely allows translation under conditions when cap-dependent translation is reduced as, for example, during viral infection, at the G2/M phase of cell cycle, apoptosis or stress conditions (Johannes et al., (1999) Proc. Natl. Acad. Sci. USA 96, 13118-13123; Cornelis et al., (2000) Molecular Cell 5, 597-605; Pyronnet et al., (2000) Molecular Cell 5, 607-616; Stein et al., 1998 Mol. and Cell. Biol. 18, 3112-3119; Holcik et al., 2000 Oncogene 19, 4174-4177; Stoneley et al., 2000 Mol. and Cell. Biol. 20, 1162-1169). Up to 3% of animal cellular mRNAs are translated despite that eIF4F-RNA binding is inhibited (Johannes et al., 1999).
In contrast to animal cellular mRNA, there are no published reports concerning IRES-mediated initiation of translation in plant cells in vivo. However, the uncapped 5′ leaders of several plant viral genomic RNAs including poty-, como-, and luteoviruses are responsible for cap-independent translation (Carrington and Freed, 1990; Gallie et al., 1995; Niepel and Gallie, 1999; Tacke et al., 1990; Thomas et al., 1991). Tobamoviruses and potexvirus X are the only examples of IRESes located in internal parts of viral genomes (Hefferon et al., 1997 J. Gen. Virol. 78, 3051-3059; Hefferon et al., 2000 Arch. Virol. 145, 945-956; Ivanov et al., (1997) Virology 232, 32-43; Skulachev et al., (1999) Virology 263, 139-154).
Tobacco mosaic tobamovirus (TMV) is a positive-stranded RNA plant virus with a monopartite genome of 6395 nucleotides (nt) in length (Goelet et al., 1982 Proc. Natl. Acad. Sci. USA 79, 5818-5822). The 5′ proximal ORFs encoding replicative proteins are expressed directly from the genomic RNA and the level of synthesis of the smaller (126 kDa) protein is approximately 10 times higher than the level of the 183 kDa protein which is produced by occasional readthrough of the stop codon for the 126-kDa ORF (Siegel et al., 1976 Virology 73, 363-371). Although some replication can occur with the larger protein only, both proteins are required for efficient replication (Ishikawa et al., 1986). The remaining TMV gene products, the movement protein (MP) and the coat protein (CP), are expressed from 3′ coterminal subgenomic mRNAs (sgRNAs) (reviewed by Palukaitis and Zaitlin, 1986 In: “The plant virus”. M. H. V. van Regenmortel and M. Fraenkel-Conrat, Eds. Vol. 2, pp. 105-131. Plenum Press, NY). Thus, the internal movement protein (MP) gene and the 3′-proximal coat protein gene cannot be translated from genomic RNA of typical tobamoviruses (TMV UI is the type member of the genus Tobamovirus). The dicistronic intermediate-length RNA-2 called sgRNA I2 RNA is translated to produce the 30-kDa MP (Bruening et al., 1976 Virology 71, 498-517; Higgins et al., 1976 Virology 71, 486-497; Beachy and Zaitlin, 1977 Virology 81, 160-169; Goelet and Karn, 1982 J. Mol. Biol. 154, 541-550), whereas the 3% proximal coat protein (CP) gene of I2 RNA is translationally silent. This gene is expressed only from the small monocistronic sgRNA (Beachy and Zaitlin, 1977).
It has been shown (Ivanov et al., (1997) Virology 232, 32-43) that, unlike the typical tobamoviruses, the translation of the CP gene of a crucifer-infecting tobamovirus (crTMV) occurs in vitro by an internal ribosome entry mechanism. The genome of crTMV (6312 nts) contains four traditional genes encoding two components of the replicase (proteins of 122-kDa and 178-kDa, the readthrough product of the 122-kDa protein), a 30-kDa MP and a 17-kDa CP (Dorokhov et al., 1993 Dokl. Russian Acad. Sci. 332, 518-52; Dorokhov et al., 1994 FEBS Lett. 350, 5-8). It was found that the 148-nt region upstream of the CP gene of crTMV RNA contains an internal ribosome entry site (IRESCP148CR) promoting the internal translation initiation of the CP gene and different reporter genes (Ivanov et al., 1997). By analogy with crTMV, the 3′-proximal CP gene of potato virus X occurs by a mechanism of internal initiation (Hefferon et al., 1997). The capacity of crTMV IRESCRCP for mediating internal initiation of translation distinguishes this tobamovirus from the well-known type member of the genus, TMV U1. The equivalent 148-nt sequence from TMV U1 RNA was incapable (UICP,148SP) of mediating internal initiation of translation (Ivanov et al., 1997).
Recently, it has been shown that the 228- and 75-nt regions upstream of the MP gene of crTMV and TMV U1 RNAs contain IRES elements, IRESMP,75CR and IRESMP,228CR, respectively, which direct expression of 3′-proximal reporter genes from dicistronic constructs in cell-free translation systems and in isolated protoplasts (Skulachev et al., 1999). Moreover, the equivalent sequence from TMV U1 RNA used as the intercistronic spacer (IRESMP,75U1) was able to mediate translation of the second gene in dicistronic transcripts.
Recent studies on plant viruses also gave new examples of cap-independent initiation of translation without IRES. RNAs of viruses and satellite viruses in the Luteovirus and Necrovirus genera, and the large Tombusviridae family lack both a 5′ cap and a 3′ poly(A) tail. However, they can be translated efficiently owing to different translation enhancement sequences located in the coding region close to their 3′ UTR. These sequences are different from IRES elements in two fundamental ways: they do not confer internal ribosome entry and they are located in the 3′ untranslated region (3′UTR). The structure and putative mechanism of action of these sequences are described in details for Barley Yellow Dwarf Virus (BYDV) (Guo et al., 2000 RNA 6, 1808-1820).
IRESes have been identified within some cellular and viral mRNAs of higher eukaryotes (mammals and plants), however, it remains unclear if IRESes do also exist within the mRNAs of lower eukaryotes. Recently, the 5′ leader sequences of two yeast mRNAs functioning as IRESs were identified (Zhou et al., 2001 Proc. Natl. Acad. Sci. USA 98, 1531-1536).
The sequences of the animal IRESes characterized are dissimilar (Jackson, 2000, see also
The low activity of animal viral IRESes (encephalomyocarditis virus IRES, IRESEMCV) in plants was reported (Urwin et al., 2000 Plant J. 24, 583-589). So far, there is no evidence for cross-kingdom (plant, animal, yeast) activity of any IRES element. Although the number of nucleotide sequences that are capable of providing cap-independent translation increases constantly, identification of new IRESes has been occasional and accidential, without methodology of prediction. Moreover, the known IRESes do not allow a fine adjustment of efficiency. They are taxonomically limited and structurally highly disparate.
Therefore, it is an object of the invention to provide a method of creating artificial IRES elements.
It is another object to provide artificial IRES elements having cross-kingdom activity.
It is another object of the invention to provide a method of creating IRES elements of a desired degree of efficiency.
It is a further object to provide a process of expressing a nucleotide sequence of interest in eukaryotic cells under translational control of a novel IRES element of the invention.
It is another object to provide a method of identifying nucleic acid elements having IRES activity by searching nucleotide sequences e.g. of data bases.
The above objects are solved according to the claims.
This invention provides a method of creating a nucleic acid sequence having an adenine-rich nucleic acid block of at least 25 nucleotides in length, whereby said nucleic acid sequence is capable of causing translation of a downstream coding sequence by internal ribosome entry (IRES element).
The inventors of the present invention have surprisingly identified simple criteria for creating nucleic acid sequences which exhibit IRES activity (IRES elements), i.e. sequences which are capable of providing cap-independent translation of a downstream gene or coding sequence by an internal ribosome entry mechanism. The inventors have found that nucleic acid sequences having a block of at least 25 nucleotides with a high adenine content have a high propensity of exhibiting IRES activity in eukaryotic cells. This allows for the first time the creation of artificial IRES elements which are active in eukaryotic cells. Moreover, they surprisingly have cross-kingdom activity, i.e. are active in plant, animal, and fungal cells. An IRES element according to the invention may be tested for (the degree of) IRES activity by:
This or a similar test may further be used to create an IRES element of a desired activity, which is preferably done by modulating the ratio of the adenine to the pyrimidine nucleotide content. Tests on the activity of an artificial IRES element according to the invention may of course also be carried out in plant or animal cells or in vivo.
Herein, “adenine-rich” or “high adenine content” means a content of adenine that is higher than 30 mol-%. Within this invention, said adenine-rich nucleic acid block has preferably at least adenine-rich if it preferably has at least 40 mol-% adenine. “Pyrimidine-poor” or “low pyrimidine content” means a content of thymine (uracil)+cytidine that is lower than 40 mol-% thymine (uracil)+cytidine.
As to the criteria applied when creating an IRES element according to the invention, a block of at least 25 nucleotides with an adenine content of at least 30, preferably at least 60 and most preferably at least 80 mol-% is provided. The highest IRES activities may be achieved if the adenine content is between 90 and 100 mol-%. The pyrimidine content should preferably be low, i.e. less than 40 mol-%, preferably less than 30 mol-%, and most preferably less than 20 mol-%.
Preferred methods are defined as follows in the order of increasing IRES efficiency:
Any pyrimidine sub-block within said adenine-rich nucleic acid block should preferably be at most 3 nucleotides in length, more preferably at most 2 nucleotides in length. Any sub-block of non-adenine bases separating two adenine bases within said adenine-rich nucleic acid block should preferably have a length of at most 10 bases, more preferably of at most 5 bases. The criteria given above regarding the content of bases of the IRES element of the invention refer to mRNA or to the corresponding coding strand on the DNA level.
There is no strict upper limit for the length of said nucleic acid block. For practical purposes, said block may be chosen to be shorter than 500 nucleotides. It is preferred to create blocks of less than 200 nucleotides. More preferably, said block has between 30 and 100 nucleotides and most preferably it has between 30 to 70 nucleotides. The minimal length of said nucleic acid block is 25 nucleotides. However, its length is preferably at least 40, more preferably at least 50 nucleotides.
Said nucleic acid block according to the invention has a high propensity of conferring IRES activity to a sequence comprising it. The above criteria for creating an artificial IRES element leave many different possibilities to create IRES elements of varying activity. This freedom may be used for fine-tuning IRES activity to a desired level, preferably in combination with an in vitro translation assay.
Whereas this invention focuses on IRES elements made up of a single adenine-rich nucleic acid block, it should be mentioned that 2, 3 or even more adenine-rich nucleic acid blocks may be incorporated in a nucleic acid sequence in order to achieve IRES activity. Such sequences have a particularly high propensity of having strong IRES activity. If 2 or more adenine-rich nucleic acid blocks are used, good IRES activity can be achieved.
Many different approaches may be employed for constructing the IRES element of the invention. Construction is in general performed on the DNA level. An IRES element the sequence of which has been designed according to the principles of the invention may be synthesized by automated DNA synthesis. The complementary strand may be synthesized accordingly. This approach is most suited for IRES elements up to a length of 40 to 100 nucleotides. The designed IRES element may also be synthesized in pieces of suitable length by automated DNA synthesis and annealed after synthesis. These and other methods for construction of a DNA element are known in the art. Of course suitable stretches of DNA may be cut out from longer stretches or from genome sequences.
The invention further provides a process of expressing a nucleotide sequence of interest in eukaryotic cell(s) by introducing into said cell(s) a vector comprising said nucleotide sequence of interest operably linked to an upstream nucleic acid sequence (IRES element) created according to the invention, whereby said nucleotide sequence of interest is translated cap-independently by way of said upstream IRES element.
Said nucleotide sequence of interest may be expressed in a plant or in plant cells. It may also be expressed in an animal or in animal cells. Among animals, mammalian cells or mammals including humans (e.g. for gene therapy) are preferred. Further, said nucleotide sequence of interest may be expressed in fungi, preferably in yeast cells.
The IRES element contained in said vector may be any artificial IRES element created according to the invenion. It may e.g. be the (GAAA)16 or the poly(A) IRES element as specifically disclosed in the examples or functionally equivalent IRES elements. Further examples of artificial IRES elements are shown in
Said nucleotide sequence of interest may be expressed from monocistronic mRNA. However, the high potential of IRES technology is in bicistronic or polycistronic expression, which allows to express all subunits of a protein complex or a whole biochemical cascade or pathway. Therefore, said nucleotide sequence of interest is preferably expressed from a bicistronic or polycistronic mRNA.
Said eukaryotic cells or eukaryotic organisms may be stably transformed or transiently transfected with said vector. Methods of transforming or transfecting animal or plant cells are well-known in the art. Various methods can be used to deliver a DNA or RNA vector into a plant cell, including direct introduction of said vector into a plant cell by means of microprojectile bombardment, electroporation or PEG-mediated treatment of protoplasts (for review see: Gelvin, S. B., 1998, Curr. Opin. Biotechnol., 9, 227-232; Hansen & Wright, 1999, Trends Plant Sci., 4, 226-231). Plant RNA and DNA viruses are also efficient delivery systems (Hayes et al., 1988, Nature, 334, 179-182; Palmer et al., 1999, Arch. Virol., 144, 1345-1360; Lindbo et al., 2001, Curr. Opin. Plant. Biol., 4, 181-185). Said vectors can deliver a transgene either for stable integration into the genome/plastome of the plant (direct or Agrobacterium-mediated DNA integration) or for transient expression of the transgene (“agroinfiltration”). Similarly, animal cells may be electroporated, infected by viral vectors or transfected using Lipofectin.
Construction of the vectors for the expression process of the invention may be done according to standard procedures of molecular biology. The IRES elements of the invention are placed upstream of said nucleotide sequence of interest in said vector for IRES-dependent translation of said nucleotide sequence of interest. Specific embodiments are given in the figures and in the examples section.
The invention comprises transgenic or transiently modified eukaryotic cell(s) containing a nucleic acid sequence (IRES element) created according to the invention and operably linked to a nucleotide sequence of interest.
The invention further comprises a vector containing an IRES element created according to the invention and an expression cassette containing said IRES element for constructing the vector of the invention. Said vector may be an RNA vector containing an IRES RNA sequence, as well as a DNA vector containing a cDNA copy of a novel IRES RNA sequence.
The invention is useful, as it allows one skilled in the art to create artificial translational elements with IRES activity. It allows to identify IRES elements that are more active than previously described ones. In addition, it allows creation or identification of IRES elements that are universal with cross-kingdom activity and have taylor-made activity.
There are several inventions which describe IRES elements that were used for cap-independent expression of foreign gene(s) in linear multicistronic mRNA in mammalian cells (U.S. Pat. No. 6,060,273; U.S. Pat. No. 6,114,146; U.S. Pat. No. 5,358,856; U.S. Pat. No. 6,096,505; U.S. Pat. No. 171,821; U.S. Pat. No. 5,766,903), plant cells (WO98/54342) and, generally, in eukaryotic cells (U.S. Pat. No. 171,821; U.S. Pat. No. 5,766,903; U.S. Pat. No. 5,925,565; U.S. Pat. No. 6,114,146). Also, circular RNA was developed to provide cap-independent IRES-mediated expression of a gene (U.S. Pat. No. 5,766,903). Cap-independent translation of eukaryotic mRNA could be mediated by a translation enhancement sequence taken from barley yellow dwarf virus RNA which is principally different from known IRESes (U.S. Pat. No. 5,910,628). Generally, all published inventions in the field describe natural IRESes isolated from animal (see, for example, U.S. Pat. No. 5,358,856) or plant viruses (WO98/54342) without addressing the question for their cross-kingdom activity, i.e. the activity of known IRESes is limited to either animal or plant cells. No approaches for the creation of non-natural, artificial IRESes that are capable of providing efficient cap-independent foreign gene expression in animal and plant cells have been described. Furthermore, there are no approaches available of creating or identifying new IRES elements having cross-kingdom activity.
WO01/55369 describes the creation of synthetic IRES elements based on natural IRES element fragments interacting with 18 S ribosomal RNA. However, the approach is limited to identifying IRES elements functional in animal systems. In addition, chimeric dicistronic constructs that were proposed in this invention were not analyzed to rule out the possibility that the GC-rich intercistronic putative IRES element functions as a transcriptional promoter, thereby producing a monocistronic mRNA from which the cistron was actually translated (Kozak, 2001 Mol. Cell. Biol 21, 1899-1907). Without having ruled out this and other alternative explanations, the authors concluded that the Gtx-derived sequence was an IRES. They postulate that IRES activity results from base pairing between mRNA and rRNA, citing as evidence the ability of the CCGGCGGGU element to be photochemically cross-linked to 18 S rRNA (Hu et al., 1999, Proc. Natl. Acad. Sci. USA 96, 1339-1344). This cross-linking, however, may well be unrelated to the putative IRES function, as it did not require formation of a ribosome-mRNA initiation complex. Indeed, cross-linking occurred even when the Gtx-derived sequence was incubated with deproteinized 18 S rRNA.
In contrast to WO01/55369, the possibility of transcriptional promoter activity of the IRESs of the present invention was investigated. It was proven by Northern blotting that the artificial IRES elements of this invention used in dicistronic assays do not act as transcriptional promoters. Further, evidence showing that polypurine (A)-rich sequences (PARS) do not act as promoters in plant cells comes from experiments with transgenic plants expressing PARS-rich IRESCP,148CR (Dorokhov et al. 2002. Proc. Natl. Acad. Sci. USA 99, 5301-5306).
Contrary to known technologies, the present invention provides the principles for the creation of artificial IRESes which may be easily synthesized according to methods known in the art. These IRESes should preferably have a high level of cross-kingdom activity in eukaryotic cells, including fungal (e.g. yeast), mammalian and plant cells. Moreover, owing to the fact that IRESes of the invention have similarity to prokaryotic ribosome binding sites (RBS) of bacteria e.g. E. coli as functional analogs of eukaryotic IRESes, the artificial IRESes of the invention are active in prokaryots as well as chloroplasts and mitochondria.
For testing an IRES element created according to the invention, a test system was deviced comprising the bicistronic DNA construct “H-GFP-GUS” having the following elements in this order: a structure that forms a stable hairpin (H) on the mRNA level, a green fluorescent protein (GFP) gene (GFP coding sequence), an intercistronic spacer with restriction site(s) for inserting potential IRES elements, and the GUS gene (GUS coding sequence). A potential IRES element is inserted into the spacer between GUS and GFP. This construct is then transcribed in vitro using e.g. T7 RNA polymerase to obtain mRNA. The obtained mRNA is then translated in vitro using a rabbit reticulocyte lysate (RRL) or a wheat germ extract (WGE) in vitro translation system. Both in vitro translation systems are commercially available e.g. from Promega and from Roche Diagnostics and may be used according to the manufacturer's instructions. After translation, GUS expression is determined e.g. via its enzymatic activity and a colorimetric detection, by autoradiography, or by Western blotting. GUS gene expression is quantitated preferably relative to a construct having a reference IRES element or a non-IRES element between said upstream gene and said GUS gene. As a reference IRES element having strong IRES activity said poly(A) nucleic acid block (see examples) may be used. As a non-IRES element, said poly(G) nucleic acid block (see examples) or the nucleic acid blocks depicted in
Said hairpin structure in said bicistronic DNA construct prevents cap-dependent translation, such that all GUS expression can be ascribed to the translational activity of the potential IRES element inserted in said intercistronic spacer of said construct. Said hairpin has to be stable enough to efficiently prevent cap-dependent translation. Preferably, its stability is higher than 30 kcal/mol (see Kozak, M. (1986) Proc. Natl. Acad. Sci. USA 83, 2850-2850). Insufficient stability of said hairpin may be recognized by any expression of said GFP gene. GFP translation may be detected e.g. by way of its fluorescence, by Western blotting or by autoradiography.
The H-GFP-GUS construct used herein was built from plasmid pBluescriptll SK+, a GUS nucleotide sequence and a GFP sequence (Example 1). The hairpin structure has the sequence: ggtaccgggccccccctcgaggtcgacggtatcgataccgtcgacctcgagggggggcccggtacc (SEQ ID NO:60). Equivalent structures can be easily created by a person skilled in the art.
All aspects in connection with the in vitro translation systems are well studied and known in the prior art. Details can be found in the following documents and in references cited therein: Anderson, C., et al. (1985) Meth. Enzymol. 101, 635; Krieg, P. and Melton, D. (1984) Nucl. Acids Res. 12, 7057; King, R. W. et al. (1997) Science 277, 973; DiDonato, J. A. and Karin, M. (1993). Promega Notes 42, 18; Pelham, H. R. B. and Jackson, R. J. (1976) Eur. J. Biochem. 67, 247; Jackson, R. J. and Hunt, T. (1983) Meth. Enzymol. 96, 50; Technical Bulletins from Promega Corp. No. 126 and No. 165 and Technical Manual No. 232 from the same company.
Potential IRES elements which give rise to GUS gene expression in such a WGE or RRL translation assay are IRES elements according to the invention. The IRES elements created or identified according to the invention typically exhibit cross-kingdom activity, i.e. they can be used to express a gene of interest under translational control of said IRES in plants and in animals. In spite of said cross-kingdom activity, the activity of said IRES element is normally not the same when expression of a gene of interest is compared in plant or animal systems. Variations in expressions levels naturally exist between the two in vitro translation systems mentioned above. In in vivo systems, these variations are in general even higher. Still, the IRES elements of this invention show surprisingly high IRES activity in both in vitro systems, in plant cells and in animal cells.
This invention further provides a method of identifying nucleic acid elements having IRES activity by searching nucleotide sequences, notably nucleotide sequences of genome data bases, applying the above-described group of criteria.
Said searching may be carried out on any known nucleotide sequence and on sequences that will become known in the future. Nucleotide sequences of eukaryotic origin, i.e. plant and animal sequences are preferably searched and those of higher plants or higher animals are most preferred.
Whole genome sequences including nuclear genomes and organelle genomes like plastid or mitochondrial genomes may be searched. Eukaryotic nuclear genome sequences are preferred. Searching may be carried out on DNA or on RNA sequences. If double-stranded DNA is used, both strands may be screened. The coding strand is screened preferentially. The searching may be restricted to 5′ UTR sequences of genes. It is equivalent to screen 5′ UTR sequences on the mRNA level.
Searching may be carried out, in the simplest case, by eye by scanning along printed or written nucleotide sequences. This approach can be successful, especially if one focuses on 5′ UTR sequences. It is more convenient to employ an automatic screening method e.g. by using a computer and a suitable computer program. In this way, large data bases of nucleotide sequences may be screened with the potential of finding many IRES elements.
The invention therefore comprises the use of a computer and a computer program for the above-described searching for IRES elements in nucleotide sequences. Said computer program comprises an algorithm based on the group of criteria as defined in the claims.
One essential advantage of the present invention is the possibility to express two or more genes in multicistronic cassettes in plant cells either transiently or via stable transformation (transgenic plants).
Another advantage of the present invention is the possibility to express two or more genes in multicistronic cassettes in human or other mammalian cells via transient or stable transformation (transgenic animals).
A further advantage of the present invention is the possibility to express two or more genes in multicistronic cassettes in yeast cells.
A further advantage of the present invention is the possibility to create viral vectors for expressing a foreign gene via adenine-rich IRESes in mammalian and especially in human cells.
Another preferred embodiment of this invention is the creation of new IRESs on the basis of eukaryotic mRNA 5′-UTR containing AGNB(s). Our analysis of 5′-UTRs of heat shock protein (HSF) mRNAs revealed adenine-rich 5′ leaders. Moreover, experimental testing of the Nicotiana tabacum heat shock factor (NtHSF) mRNA leader confirmed this prediction. NtHSF 5′-UTR turned out to have IRES activity not only in plant but also in human cells. This invention provides 5′ non-translated regions of eukaryotic mRNA that contain adenine-rich sequences as IRESes for the expression of several genes in multicistronic cassettes in plant or animal cells either transiently or via stable transformation (transgenic organisms). Moreover, such IRESs might be used for expression of foreign and natural genes in animal virus-based vectors e.g. in gene therapy.
In the following, the invention will be further described using specific examples. Standard molecular biological techniques were carried out according to Sambrook et al (1989, Molecular Cloning: a Laboratory Manual. 2nd edn. Cold Spring Harbor, N.Y.). All plasmids utilized in the invention can be prepared according to the directions of the specification by a person of ordinary skill.
A Method of Creating Non-Natural, Artificial IRESes Containing an Adenine-Rich Nucleotide Block
In this example it is shown that it is possible to create artificial IRES elements having an adenine-rich nucleotide block.
Cloning strategy: Bacteriophage T7 transcriptional promoter- and 35 S-based bicistronic plasmids of the series H-CP-ICS-GUS or CP-ICS-GUS, wherein crTMV CP gene expression as a 5′ proximal cistron is blocked by a stable artificial hairpin (H) structure. On the contrary, GUS gene expression is under the control of an intercistronic sequences (ICS) including a synthetic polylinker-based sequence (72 nts of length), IRESMP,228CR, IRESMP,75CR and IRESCP148CR, UICP,148SP, and IRESCP148UI which have been described previously (Ivanov et al., 1997; Skulachev et al., 1999). Construction of H-GFP-ICS-GUS plasmids was as follows. The construct pH-Cla was obtained by cloning of the pBluescript SK+ (Stratagene) polylinker (PL) fragment into the same vector. The fragment was excised from SK+ by ClaI and KpnI (KpnI was blunted with T4 DNA polymerase) and cloned back into the SK+ vector using ClaI and SmaI sites. Then, a polylinker BamHI-SacI fragment from plasmid pGEM-3Z was cloned into pH-Cla by BamHI and SacI sites yielding vector phClaPoly. This vector contained two inverted 45-nt repeats followed by multiple cloning sites. At the next stage, plasmid phGFP was obtained by cloning the GFP gene into plasmid pH-ClaPoly by BamHI and Hind III sites (the GFP gene was obtained as a PCR product using ccggatccttatggtgagcaagggcgaggag (SEQ ID NO:61) and cgcaagcttacttgtacagctcgtccatg (SEQ ID NO:62) oligonucleotides and plasmid GFP-241 (Solovyev et al., 1999) as a template. To obtain pH-GFP-IRESCP,148CR-GUS, the EcoRI-SacI fragment from plasmid pH-CP-IRESCP,148CR-GUS (Skulachev et al., 1999) was cloned into vector phGFP using EcoRI and SacI sites. Plasmid pH-GFP-PL-GUS was obtained by digesting pH-GFP-IRESCP,148-GUS with EcoRI and NcoI enzymes, filling protruding ends with Klenow fragment followed by self-ligation of the plasmid. As a result, this plasmid contains GFP and GUS genes with HindIII, SmaI, KpnI and EcoRI sites in between.
To produce a non-natural, artificial IRES having an adenine-rich nucleotide block, two pairs of oligonucleotides were annealed to each other (see
In vitro translational assays: WGE and RRL translation assay were carried out as described in Technical Bulletin No. 165 and No. 126, respectively, from Promega Corporation using the coupled transcription/translation systems of catalogue numbers L4140 and L4610, respectively. Alternatively, a conventional RRL system from Promega, catalogue number L4960 (Technical Manual No. 232) was employed. Linear H-GFP-GUS vectors having potential IRES elements inserted between GFP and GUS were transcribed using the T7 promoter/RNA polymerase system. RNA transcripts were precipitated with LiCl, dissolved in water, and reprecipitated with ethanol. RNA concentrations were measured by spectrophotometry and 5 μg of transcript was taken for 25-μl in vitro translation sample. GFP and GUS expression were detected by autoradiography.
Transient assay system of plant protoplasts The following procedures of protoplasts preparation and transfection were used: (i) The protoplasts were isolated from N. tabacum (cv. W38) leaves as described (Saalbach et al., 1996 Plant Physiol. 112, 975-985). Aliquots of 4×105 protoplasts were transfected with 30 μg of pFF19-based dicistronic DNA constructs “GFP-spacer-GUS” and incubated for 36 hours at 25° C. in the dark. GUS activity was measured as relative light units (RLU). GUS activity was determined according to (Jefferson 1987. Plant Mol. Biol. Rep. 5, 387-405) using MUG. For each experiment background GUS activity associated with non-transfected protoplasts was subtracted. Protein concentrations were estimated using the Bio-Rad protein assay kit based on the method of Bradford (1976 Anal. Biochem. 72, 248-254). GFP expression was detected with Western-blot analysis using monoclonal mouse antibodies (Boehringer Mannheim No 1814460) according to the manufacturer's manual. GFP amounts in western-blot bands were calculated using Bio-Rad Quality-One software.
Transfection of HeLa Cells Using Vaccinia Virus and T7 Promoter Containing Plasmids Encoding GUS
HeLa cell monolayers were grown on 3.5 cm Petri dishes in Dulbecco's modified minimal essential medium supplemented with 10% heat-inactivated fetal calf serum and 100 units/ml streptomycin and penicillin. Virus stocks of modified vaccinia virus Ankara (MVA) expressing the bacteriophage T7 RNA polymerase gene were prepared according to usual methods. HeLa cell dishes that were 80-90% confluent were infected with virus using 30-40 pfu/cell. After a 45 min absorption period the cells were washed and transfected using Opti-MEM (Life Technologies, Inc.) plasmid DNA and Lipofectin (life Technologies, Inc.). A transfection mixtures of 2 μg DNA in 5 μl Lipofectin was used for a 3.5 cm plate. For each construct, 6 plates were used in each experiment. Cells were incubated at 37° C. for 6 h. After incubation the media was removed, cells were washed twice with PBS and lysed directly on the plate in 250 μl lysis buffer (100 mM KHPO3 pH 7.8, 0.2% Triton X-100, 0.5 mM DTT) for 10 minutes. The lysate was collected, clarified by centrifugation at 2000 g for 10 minutes and stored at −70° C. GUS activity was detected in 20 μl of lysate using GUS Light™ reagent system (Tropix, MA, USA) according to the manufacturer's protocols.
A Method of Creating Non-Natural, Artificial IRES Containing 16 Copies of the GAAA Element
The main goal of this example is to demonstrate the possibility to create a non-natural, artificial IRES element having an adenine-rich nucleic acid block of 16 copies of the GAAA sequence, whereby the A and the G nucleotide contents are 75% and 25%, respectively.
Cloning Strategy
To produce a non-natural, artificial IRES containing multiple copies of the GAAA sequence, two pairs of oligonucleotides were annealed (see
Approaches for testing artificial IRESes are described in Example 1.
A Method of Creation of Non-Natural, Containing a Poly(A) Nucleic Acid Block
The main goal of this example is to test the possibility to create a non-natural, artificial IRES containing a poly(A) sequence with an A nucleotide contents of 100%. This sequence was compared to a poly(G) sequence with a G content of 100%. The main result of these examples is that an artificial sequence containing the poly(A) sequence does function as an IRES, whereas the artificial sequence containing the poly(G) sequence does not.
Cloning strategy of the poly(A)-containing IRES and of the poly(G) sequence are presented in
Creation of Non-Natural, Artificial Adenine-Rich Sequences Containing Different Guanine and Pyrimidine Base Contents
The main goal of this example is to test the possibility to create non-natural, artificial IRES elements containing adenine-rich sequences, whereby the adenine contents vary between 100 and 25% and the pyrimidine nucleotide contents are up to 20%.
Cloning Strategy:
Nucleotide primer sequences and cloning steps of artificial IRESes containing 16 copies of the AAAC and of the AAAU fragment, whereby the pyrimidine nucleotide content is 25% are presented in
Results
We have created a series of synthetic sequences (
RRL translation of bicistronic H-GFP-GUS containing artificial sequences as intercistronic spacers showed (
In vivo experiments on tobacco protoplasts (
Results with artificial sequences containing poly(A) and poly(G) sequences demonstrated that in contrast to the poly(G) sequence, the artificial IRES based on 100% content of adenine functions efficiently as an IRES (Table 1).
| Number | Date | Country | Kind |
|---|---|---|---|
| 101 43 237 | Sep 2001 | DE | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP02/09843 | 9/3/2002 | WO | 00 | 10/8/2004 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO03/020927 | 3/13/2003 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5139812 | Lebacq | Aug 1992 | A |
| 5474925 | Maliyakal et al. | Dec 1995 | A |
| 5576198 | McBride et al. | Nov 1996 | A |
| 5627059 | Capecchi et al. | May 1997 | A |
| 5670623 | Shoseyov et al. | Sep 1997 | A |
| 5723765 | Oliver et al. | Mar 1998 | A |
| 5877402 | Maliga et al. | Mar 1999 | A |
| 5910628 | Miller et al. | Jun 1999 | A |
| 6100448 | Thompson et al. | Aug 2000 | A |
| 6146845 | Kikly et al. | Nov 2000 | A |
| 6147278 | Rogers et al. | Nov 2000 | A |
| 6174700 | Haynes et al. | Jan 2001 | B1 |
| 6300545 | Baszczynski et al. | Oct 2001 | B1 |
| 6331416 | Shani et al. | Dec 2001 | B1 |
| 6331661 | Baszczynski et al. | Dec 2001 | B1 |
| 6376745 | Atabekov et al. | Apr 2002 | B1 |
| 6781033 | Staub et al. | Aug 2004 | B2 |
| 6833254 | Dasgupta et al. | Dec 2004 | B2 |
| 20030049228 | Santa-Cruz et al. | Mar 2003 | A1 |
| 20030188337 | Day et al. | Oct 2003 | A1 |
| 20040055037 | Gleba et al. | Mar 2004 | A1 |
| 20040083499 | Eibl et al. | Apr 2004 | A1 |
| 20040088764 | Gleba et al. | May 2004 | A1 |
| 20040137631 | Herz et al. | Jul 2004 | A1 |
| 20040191788 | Gleba et al. | Sep 2004 | A1 |
| 20040221330 | Klimyuck et al. | Nov 2004 | A1 |
| 20040244073 | Klimyuck et al. | Dec 2004 | A1 |
| 20040255347 | Klimyuck et al. | Dec 2004 | A1 |
| 20050014150 | Atabekov et al. | Jan 2005 | A1 |
| 20050015829 | Koop et al. | Jan 2005 | A1 |
| 20050015830 | Dorokhov et al. | Jan 2005 | A1 |
| 20050059004 | Atabekov et al. | Mar 2005 | A1 |
| 20050066384 | Klimyuck et al. | Mar 2005 | A1 |
| 20050091706 | Klimyuck et al. | Apr 2005 | A1 |
| 20060253924 | Turk et al. | Nov 2006 | A1 |
| Number | Date | Country |
|---|---|---|
| 0270 248 | Jun 1988 | EP |
| 1 045 037 | Oct 2000 | EP |
| WO 8700551 | Jan 1987 | WO |
| WO 9416089 | Jul 1994 | WO |
| WO 9534668 | Dec 1995 | WO |
| WO 9617954 | Jun 1996 | WO |
| WO 9809505 | Mar 1998 | WO |
| WO 9844097 | Oct 1998 | WO |
| WO 9854342 | Dec 1998 | WO |
| WO 9925821 | May 1999 | WO |
| WO 9925855 | May 1999 | WO |
| WO 9936516 | Jul 1999 | WO |
| WO 0017365 | Mar 2000 | WO |
| WO 0020611 | Apr 2000 | WO |
| WO 0032799 | Jun 2000 | WO |
| WO 0068391 | Nov 2000 | WO |
| WO 0068431 | Nov 2000 | WO |
| WO 0070019 | Nov 2000 | WO |
| WO 0077174 | Dec 2000 | WO |
| WO 0077175 | Dec 2000 | WO |
| WO 0078985 | Dec 2000 | WO |
| WO 0111020 | Feb 2001 | WO |
| WO 0155369 | Aug 2001 | WO |
| WO 0159138 | Aug 2001 | WO |
| WO 0181600 | Nov 2001 | WO |
| WO 0212522 | Feb 2002 | WO |
| WO 0229068 | Apr 2002 | WO |
| WO 0246438 | Jun 2002 | WO |
| WO 0246440 | Jun 2002 | WO |
| WO 02055651 | Jul 2002 | WO |
| WO 02057466 | Jul 2002 | WO |
| WO 02068664 | Sep 2002 | WO |
| WO 02077246 | Oct 2002 | WO |
| WO 02079481 | Oct 2002 | WO |
| WO 02088369 | Nov 2002 | WO |
| WO 02101060 | Dec 2002 | WO |
| WO 03001900 | Jan 2003 | WO |
| WO 03004658 | Jan 2003 | WO |
| WO 03020927 | Mar 2003 | WO |
| WO 03020928 | Mar 2003 | WO |
| WO 03020938 | Mar 2003 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 20050059004 A1 | Mar 2005 | US |