DNA encoding clostridium perfringens alpha-toxin peptides

Abstract

The present invention provides novel peptides and vaccines containing them capable or inducing production of antibodies directed against Clostridium perfringens alph-toxin (CPa) in animals to which the) arc administered and thereby providing pro-phylazis against infection by Clostridium pefringens and/or the alpha-toxin itself. Particularly the present invention provides such a vaccine that is relatively safe and simple to produce. e.g. by genetic engineering means. Preferred peptides comprise theo amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 247 to 370 but lack the epitopes necessary for phos-pholipase C and/or sphingomyelin hydrolysing activity round between amino acids 1 to 240 of that sequence. Further provided are antisera and antibodies raised to the peptides and vaccines of the present invention, and particularly monoclonal antibodies and hybridoma cell lines for their production.

Description

The present invention relates to novel peptides capable of illiciting an immunological response that is protective against Clostridium perfringens in man or animals; more particularly to novel peptides capable of illiciting such protective response against the alpha-toxin of that organism, and antibodies and antisera raised thereto. Preferred agents enable prophylaxis and treatment of Clostridium perfringens induced disease states in both humans and other animals.

Clostridium perfringens (C. perfringens) is ubiquitous in the environment and has been found in the soil, decaying organic matter and as part of the gut flora in man and animals. Different strains of C. perfringens can be assigned to one of five biotypes (A-E) depending on the spectrum of toxins produced (McDonel (1986) Pharmacology of Bacterial Toxins; F Dorner and J Drews (Editors) Pergamon Press, Oxford). Biotype A strains are of particular importance as the etiological agents of gas gangrene in man. The disease is of increasing significance in the elderly and in diabetic populations, especially in those who have undergone lower limb surgery, where impaired blood supply to tissues can lead to anoxic conditions suitable for multiplication of the bacterium. The disease can also arise in patients who have undergone surgery of the gastrointestinal tract when contamination of damaged tissues with gut contents can result in its establishment. A more periodic increase in the incidence of gas gangrene has been shown to occur during armed conflicts when deep tissue wounds are contaminated with soil and the failure to promptly treat such injuries resulted in the death of several hundred thousand combatants during World War I.

The pathogenesis of gas gangrene can be largely attributed to the production of potent exotoxins by the bacterium, of which the alpha-toxin has received attention as the major contributor to the disease. The toxin may act peripherally to the initial focus of infection by damaging and reducing the blood supply to tissues thus promoting the conditions required for spread of the infection.

In the later stages of the disease the toxin may act sytemically causing death. A crude C. perfringens toxoid vaccine was demonstrated to provide protection against experimentally induced gas gangrene as long ago as 1937 (Penfold and Tolhurst (1937) Medical Journal of Australia, pp 604) and subsequent studies suggested that the effective component of this vaccine was derived from the alpha-toxin (Robertson and Keppie (1943), Lancet 2 p311; Boyd et al (1972) J. Med. Microbiol 5, p467; Kameyama (1975t) Japanese Journal of Medicine, Science and Biology 25, p200). In spite of these advances a vaccine has not been developed for use in humans and current treatment for gas gangrene usually involves the removal of the affected limb or tissues.

C. perfringens has also been identified, or implicated, as the causative agent of other diseases, for example in colic and enterotoxaemia, in horses, rabbit, cattle, sheep and poultry. Vaccines for use in such animals have been described in a number of prior patent applications, eg U.S. Pat. No. 42,654,588, U.S. Pat. No. 4,292,307, GB 2030451, SU 152943, GB 968199. GB 958575, GB 958574 and GB 958564; all being formal toxoids or equivalents.

The present inventors have previously isolated the gene encoding the alpha-toxin (Titball et al (1989) Infection and Immunity, Vol 57, p357-376) and examined structure-function relationships of the protein Titball and Rubidge 1990; Titball et al (1991) Infection and Immunity, Vol 59, p1872-1874). As part of these studies the location of some antibody epitopes were determined (Logan et al (1992) Infection and Immunity, Vol 59, p4338-4382).

It is an object of the present invention to provide novel vaccines capable of inducing production of protective antibodies directed against C. perfringens alpha-toxin (CPa) when administered to animals or man and thereby providing prophylaxis against infection by C. perfringens, disease states resulting from such infection, and/or the alpha-toxin itself. It is a particular aim of the present invention to provide such a vaccine that is relatively safe and simple to produce. Antibodies and antisera so raised are also provided capable of use in therapy for at least some, if not all, disease states, where alpha toxin is essential for the organisms effect or viability.

A further object of the present invention is to provide isolated vaccine peptides and conjugates capable of inducing production of antibodies to CPa such that they might also be used as tools to study the role of the alpha-toxin in the pathogenesis of gas gangrene; such vaccine peptides being free of other toxoided C. perfringens activity. In order to achieve these objects the present inventors have provided novel peptides capable of being used in such vaccines as the active immunising agent or agents. Thus in its broadest embodiment the present invention provides a peptide or peptide conjugate comprising the amino acid sequence of epitopes of C. perfringens alpha-toxin from amino acid 261 to 300 but lacking epitopes/amino acid sequences necessary for phospholipase C and/or sphingomyelin hydrolysing activity that are found between amino acids 1 to 240 of the alpha-toxin; said peptide being capable of inducing an immune response protective against the alpha-toxin when administered to humans or animals. Titball et al (1991) broadly describes the unwanted regions.

Preferably the peptides of the present invention comprise the amino acid sequence of C. perfringens alpha-toxin from amino acid 261 to amino acid 370; most preferably from 247 to 370. Particularly provided are such peptides as derived from C. perfringens Biotype A alphatoxin DNA.

In a most preferred form the peptides of the present invention consist of only amino acid 247 to amino acid 370 of the amino acid sequence of C. perfringens alpha-toxin or that amino acid sequence in the form of a fusion peptide with another amino acid sequence, that not being that of amino acid 1 to amino acid 246 of the alpha-toxin, or in the form of a conjugate with an agent having other desired effect. The term other amino acid sequence will be understood by the person skilled in the art to include complete proteins as well as relatively short sequences as appropriate to the needs of the user. For example a non-C. perfringens antigenic protein may be included fused to the aforesaid sequence for the purpose of providing other immunity or labelling.

In a further embodiment the present invention provides vaccine compositions comprising suitable doses of the peptides or conjugates of the present invention, these being optionally complemented as necessary by further agents for optimising protection, eg. adjuvants and carriers. Some such suitable agents will be those as disclosed in the patents referred to on page 2. Freunds incomplete or complete adjuvant may be used as typical adjuvants, but other suitable candidates such as those described in WO 9203164 will occur to those skilled in the art. Carrier function may be fulfilled merely by saline solutions.

The present inventors and coworkers have determined that the neither the N-terminal (amino acids 1-249=Cpa.sub.249) nor C-terminal (amino acids 250-370) domains are capable of lethal effect on their own. This is surprising in the light of findings that the phospholipase activity was found to be entirely present in the N-terminal domain while known sphingomyelinase related epitopes were found to be lacking in the sequence of the C-terminal domain. Further experimentation by these workers has showed that the N-terminal domain on its own is not capable of inducing a protective response in spite of the fact that antibodies directed at these N-terminal domain epitopes can neutralise the effects of the toxin. Thus it may readily be seen that the finding that the relatively inactive C-terminal domain can illicit a protective response where the relatively active N-terminal cannot is an entirely surprising result.

The positions of C-terminal epitopes have been mapped previously by the present inventors and their coworkers and found to lie at approximately position 273-275 and 295-297 in the alpha-toxin amino acid sequence. It is to be expected that the position or nature of these epitopes might vary slightly from isolate to isolate while maintaining functional activity and thus such variation are included in the scope of the invention where a protective response is retained.

It will be clear to a worker skilled in the art from the aforesaid disclosure that certain sequences within the C-terminal domain will be far more effective than others in providing the necessary immunogenic activity. This is because the protective effect is typically somewhat dependent upon the tertiary arrangement of the peptide in orienting the epitopes of interest to each other. This is further evidenced by the fact that the active epitope holding N-terminal domain is not lethal on its own, indicating that the C-terminal is necessary for correct orientation of these epitopes also. It is also clear that given the information herein the skilled worker will be able to screen the various sequences of the invention for necessary activity and that these various sequences may readily be provided using standard genetic engineering techniques such as polymerase chain reaction and gene cloning to provide sequences lacking the unwanted phospholipase and sphingomyelitical activity. These `unwanted` regions are described in detail in papers by the present authors and coworkers (Shuttleworth et al (1988) `Epitope mapping of Clostridium perfringens alpha-toxin` in F J Fehrenbach et al (Editors) bacterial Protein Toxins, Gustav Fischer Verlag, Stuttgart, p 65-66. Titball et al (1989) Infection and Immunity. Vol 57, p357-376; Titball et al (1991) Infection and Immunity, Vol 59, 9, p1872-1874; Logan et al (1991) Infection and Immunity. Vol 59, 12, p 4338-4382).

In further aspects of the present invention there is provided recombinant DNA encoding for the peptides of the invention, plasmids comprising such DNA and cell lines comprising these plasmids or the recombinant DNA itself such that expression of the peptides may be achieved. Such recombinant DNA is conveniently provided by PCR amplification of the DNA encoding for the desired sequence, eg. Cpa..sub.247-370 or Cpa.sub.261-370, using primers targeted at respective ends of the double stranded sequence of which it forms one half. Alternatively suitable restriction enzymes might be used on larger quantities of native alpha-toxin encoding DNA. The derived DNA is ligated into a suitable vector, optionally contiguously running with a sequence comprising the remainder of a desired fusion peptide, and the vector inserted into a suitable host cell eg. such as E. coli. A desired peptide expressing cell line may be selected in the known way, eg. by Western Blotting using antibodies directed at the peptide, alpha toxin or a conjugated peptide such as GST.

It should be noted that selection of certain fusion peptides may facilitate isolation of the peptide by provision of a relatively large fraction which can be cleaved to yield the alpha-toxin related peptide after initial purification.

In a further aspect of the present invention there are provided antisera raised to the peptides of the invention and antibodies derived therefrom. Furthermore, the present invention provides monoclonal antibodies to the peptides of the invention and hybridoma cells for production thereof.

The antisera of the invention are readily prepared by injecting a host animal (eg. a mouse, pig or rabbit) with a peptide of the invention and then isolating serum from it after a waiting suitable period for antibody production, eg. 14 to 28 days. Antibodies may be isolated from the blood of the animal or its sera by use of any suitable known method, eg. by affinity chromatography using immobilised peptides of the invention or the peptides they are conjugated to, eg. GST, to retain the antibodies. Similarly monoclonal antibodies may be readily prepared using known procedures to produce hybridoma cell lines expressing antibodies to peptides of the invention. Such monoclonals antibodies may also be humanised eg. using further known procedures which incorporate mouse monoclonal antibody light chains from antibodies raised to the peptides of the present invention with human antibody heavy chains.

In order to assist the skilled worker there are now provided Figures and illustrative examples of peptides and peptide vaccines of the present invention. These are intended as non-limiting examples for provision of data regarding the efficacy of the basic C-terminal domain peptides from which skilled workers may draw their own conclusions regarding possible variations within the scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-C show the relative positions of major epitopes mapped on the complete alpha-toxin sequence (Cpa.sub.1-370)=A; a C-terminal domain peptide of the invention (Cpa.sub.247-370)=B and a fusion peptide of the invention (GST-Cpa.sub.247 -370)=C. Numbers indicate the approximate positions of the epitope.

FIG. 2: shows the log.sub.10 antibody titre v days after initial injection (i.p.) with test vaccines. Booster injections are indicated by anotation on the x plot. Titres are independent of protection. O=alphatoxin (SEQ ID NO: 1); Square=GST; Triangles-open=Cpa.sub.247-370 (SEQ ID NO: 4); --closed=Cpa.sub.247-370 GST.

SEQUENCE LISTING:

SEQ ID NO: 1 is the complete DNA sequence coding for the C. perfringens alpha-toxin; this being one strand of the double stranded sequence.

SEQ ID NO: 2 is the amino acid sequence of alpha-toxin encoded by SEQ ID NO 1.

SEQ ID NO 3: is the DNA sequence coding for Cpa.sub.247-370 ; the preferred peptide of the invention that has been identified herein.

SEQ ID NO 4: is the amino acid sequence of Cpa.sub.247-370.

EXAMPLES.

Example 1

Generation of C-terminal (Cpa247-370) peptide of alpha-toxin of C. perfringens and its conjugates.

All chemicals were obtained from BDH Chemical Company or the Sigma Chemical Company unless otherwise stated. Vaccine peptide against the alpha-toxin of C. perfringens was generated by expressing, in Escherichia coli, a fragment of the alpha-toxin gene which would encode the C-terminal domain of the alpha-toxin (amino acids 247-370=Cpa.sub.247-370).

The fragment of the alpha-toxin gene was generated by polymerase chain reaction (PCR) amplification of the region between nucleotides 823 and 1194 of the alpha-toxin gene sequence previously reported by Titball et al. Oligonucleotides (30-mers) were designed from the nucleotide sequence of the alpha-toxin gene (Cpa) of C. perfringens NCTC 8237 (see Titball et al (1989) Infect. Immun. 57, 367-376) synthesised on a Biosystems 392 DNA Synthesiser with 6 additional nucleotides at the 5' ends containing restriction endonuclease sites; the PCR primer homologous with the region starting at nucleotide 823 incorported a nucleotide tail (GGG ATG) to facilitate cloning and expression of the gene fragment. The NCTC 8237 Cpa was cloned into a plasmid (as Titball; ibid) linearised and used as template DNA (40 ng) in the PCR. A DNA fragment encoding the Cpa.sub.247-370 was produced as product after 20 amplification cycles (LEP Prem thermal cycler) purified by agarose gel electrophoresis and digested with SmaI and HindIII, The purified fragment was ligated with SmaI-HindIII digested pBluescript SK+ (Stratagene) and transformed into E. coli JM109 cells (see method Hanahan (1985) DNA cloning; a practical approach Vol 1 (Glover Ed) pp 109-135, IRL Press, Oxford). The verification of the authenticity of the nucleotide sequence of the cloned fragment was carried out using routine methods (Maniatis et al, 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press.). A recombinant plasmid was generated (pCTH1) for the sequencing and cloning work.

Expression was achieved by isolating the Cpa.sub.247-370 encoding fragment (SmaI--Hind III fragment) from the pBluescript clone using Smal and HindIII, purifying it, blunt ending the HindIII site using Klenow fragment (Sambrook et al: Molecular Cloning-as above) and ligating this fragment with SmaI digested pGEX-3X expression vector DNA (LKB-Pharmacia Biotechnology). The resultant recombinant plasmid expressed Cpa.sub.247-370 as a fusion protein with the vector encoded glutathione-S-transferase (=GST-Cpa.sub.247-370) when transformed intgo. E. coli JM 109 (as Hanahan-above). Transformants were screened using PCR and a colony isolated containing the plasmid pGEX3-13 (also called pB3X13). Expressed protein was then purified according to the procedure suggested by the plasmid manufacturers for the purification of GST.

Nucleotide sequencing was carried out by generating single stranded DNA from cells containing pCTH1 by co-infecting the cells with the helper bacteriophage M13K07 (see Sambrook-Molecular cloning-as above) wherein single stranded DNA is purified and used for dideoxy--termination sequencing reactions using alpha.sup.35 S-dCTP and the reaction products are separated by electrophoresis and visualised by autoradiography.

Expression and purification of GST-Cpa.sub.247-370 and Cpa.sub.247-370 :

Protocol 1: E. coli containing the plasmid pGEX3X-13 was cultured in 10 .times.100 ml volumes of BHI broth in 250 ml Erlenmeyer flasks at 37.degree. C. with shaking at 150 rpm. Fusion protein expression, expressed from the tac promoter, was induced by addition of IPTG (1 mM final concentration) to cultures that had reached an OD.sub.600 of 0.6. After a further 5 hours of growth the cells were harvested by centrifugation and resuspended in 3 ml of phosphate buffered saline (PBS. Oxoid), lysozyme solution (80 .mu.l, 10 mg/ml) was added to the suspension and, after incubation (10 min, 22.degree. C.) 30 .mu.l of Triton X-100 was added. The cell suspension was frozen (-20.degree. C.), thawed and sonicated for 12.times.30 seconds (Braun Sonicator, Maximum power, 25 mm probe) on ice. After centrifugation (10,000 x g, 4.degree. C.) the supernatant was mixed with 2 ml of glutathione-sepharose gel (Pharamacia) previously washed three times with PBS+0.1% Triton X-100. The mixture was stirred for 18 hours at 4.degree. C., packed into a chromatography column and the column washed with 20ml PBS+0.1% Triton X-100 followed by 10 ml tris buffer (10 mM, pH to 8.0 with HCl) containing 5 mM reduced glutathione. Fractions collected (2 ml) were analysed for the presence of fusion protein by SDS-polyacrylamide gel electrophoresis (Pharmacia Phast System, 10-15% gradient gels) and staining with Coomasie Blue P250. To generate Cpa.sub.247-370 the GST-Cpa.sub.247-370 fusion protein (2 mg) was cleaved for 18 hours (22.degree. C.) with factor X (BCL; 30 .mu.g) according to the manufacturer's datasheet. The mixture was applied to a 1 ml minicolumn of glutathione sepharose and the column eluted with 3 ml PBS. Fractions (1 ml) were analysed for Cpa.sub.247-370 as described above and SDS-poly-acrylamide gel analysis showed that pure Cpa.sub.247-370 was obtained.

Protocol 2: E. coli containing pGEX3X-13 was cultured in 1 liter of L-broth +ampicillin at 37.degree. C. 150 rpm until the optical density of the respective culture (600 nm ) was approximately 0.3. IPTG was added to a final concentration of 1 mM and the culture grown for a further 4 hrs. A total cell lysate was prepared by resuspending the cells in 30 ml PBS +triton x100 (1%) and sonicated for 5.times.30 seconds on ice using a Braun Labsonic sonicator. The supernatant obtained after centrifugation was purified by selective elution from a column of glutathione-sepharose LKB-Pharmacia). For isolation of the Cpa.sub.247-370 fragment alone the GST-Cpa.sub.247-370 peptide (approx 10 mg in 800 .mu.l) was digested with factor X, (15U) overnight at room temperature, and the Cpa.sub.247-370 fragment separated from the GST by passage through a glutathione-sepharose column.

Immunological properties of Cpa.sub.247-370 :

To establish whether isolated and purified C-terminal domain of Cpa.sub.247-370 was immunologically similar to that region of the complete alpha-toxin, it was used as an immunogen in mice, see below, and the resulting antiserum reacted with overlapping peptides derived from primary amino acid sequence in the C-terminal domain of the toxin. The results indicated that the pattern of reactivity did not differ from that obtained when antiserum to the whole toxin was reacted with these peptides (see method Logan et al (1991) Infect. Immun. 59. 4338-4342. suggesting that no new and significant sequential antibody binding regions were created and that correct folding and structure identity with the C-terminal in the complete toxin was present.

Biochemical properties of Cpa.sub.247-370. Purified Cpa.sub.247-370 was tested in a number of enzyme assays wherein it was determined that it lacked sphingomyelinase activity and did not cause haemolysis of mouse erythrocytes, as distinct from the complete toxin which exhibits these. As the folding has been shown to be the same it is considered that no coding for this activity is present.

Cellular effects: While 1.25 .mu.g/ml alpha-toxin is toxic for mouse lymphocytes, rising to a dose response maxima at 2.5 .mu.g/ml tissue culture volume and after 20 hours, neither Cpa.sub.1-249 nor Cpa.sub.247-370 were toxic at these concentrations; Cpa.sub.247-370 not being toxic in 10 .mu.g injections to mice whereas 1 .mu.g alpha-toxin causes death within in 24 hours. However, when Cpa.sub.1-249 and Cpa.sub.247 -370 were used together haemolyis of lymphocytes occured, but not when used sequentially. As B. cereus PC-PCL.sub.1-249 and Cpa.sub.247 -370 do not have this effect it would appear that the two Cpa truncates interact to provide the enzymic effects.

______________________________________Biological Activity peptide amount activity______________________________________PhospholipaseC Cpa 0.04 nmol 0.079 U/minpNPPChydrolysis.sup.a Cpa.sub.247-370 0.94 nmol <0.001 U/minSphingomyelinase Cpa 0.34 nmol 1003 U/minTNPALhydrolysis.sup.b Cpa.sub.247-370 0.34 nmol <0.01 U/minSphingomyelinase Cpa 0.06 nmol hydrolysisTLC assay.sup.c Cpa.sub.247-370 0.17 nmol no hydrolysisHaemolytic.sup.d Cpa 0.017 nmol 1.05 Hu/min Cpa.sub.247-370 0.05 nmol <0.007 Hu/min______________________________________ Cpa = alphatoxin; Cpa.sub.247-370 = preferred truncate of the invention .sup.a =pnitrophenolphosphorylcholine (pNPPC) hydrolysing activity 1 U catalysed hydrolysis of 1 nmol of substrate. .sup.b =Nomega-trinitrophenyllaurylsphingosylphosphorylcholine (TNPAL) hydrolysing activity. 1 U catalysed hydrolysis of 1 nmol substrate .sup.c =Hydrolysis of bovine brain or erythrocyte or chicken egg yolk sphingomyelin assessed by TLC. .sup.d =Haemolytic activity. 1 Haemolytic unit (Hu) caused 50% lysis of 100 .mu.l of a 5% v/v mouse erythrocyte suspension. Toxicity of candidate vaccines:

Barrier-bred female 6-week old Balb/cmice, free of mouse pathogens, were obtained from Charles River Laboratories, Margate, Kent UK, and wre used throughout these studies.

The toxicity of the vaccine fusion peptide was determined by intra --peritoneal inoculation of 10 .mu.g amounts into a groups of 6 mice. The vaccine was non-lethal at these doses and mice showed no signs of acute or chronic toxicity for up to two weeks post inoculation.

Antibody responses to vaccines:

The candidate vaccines were administered to groups of 6 mice by intra-peritoneal inoculation with adjuvant (Incomplete Freunds Adjuvant-IFA). The appearance of antibody against the alpha-toxin was monitored by ELISA. Cpa.sub.247-370 or GST-Cpa.sub.247-370 induced a strong antibody response against the alpha-toxin which increased after booster inoculations (FIG. 2). The alpha-toxin antibody response against Cpa.sub.247-370 was not affected by the fusion of this polypeptide with glutathione-S-transferase. The magnitude of the antibody response against Cpa.sub.249 (N-terminal domain), Cpa.sub.247-370 or GST-Cpa.sub.247-370 was similar to that observed when a crude formaldehyde alpha-toxoid was administered.

Properties of antibodies raised against vaccines:

The ability of serum from animals immunised with Cpa.sub.249, Cpa.sub.247-370 or GST-Cpa.sub.247-370 to neutralise, in vitro, biological activities associated with the alpha-toxin was investigated. All effectively inhibited the phospholipase C activity of the toxin; however only antiserum generated against Cpa.sub.247-370 or GST-Cpa.sub.247 -370 inhibited the haemolytic activity of the toxin.

Protection against toxin challenge.

Animals which were immunised with formol-toxoid, Cpa.sub.249, Cpa.sub.247-370, GST-Cpa.sub.247-370 or CST alone were challenged intraperitonally with 5 .mu.g of purified alpha-toxin (approximately 50 LD.sub.50 doses ). Control mice and mice immunised with GST died within 24 hr and 4 of 6 mice immunised with Cpa.sub.249 died during this time. Mice immunised with the formol --toxoid, Cpa .sub.247-370 or GST-Cpa.sub.247-370 survived and showed no signs of intoxication.

Protection against organism challenge:

To investigate the possibility that the formol-toxoid, Cpa.sub.247-370 or GST-Cpa.sub.247-370 could also induce protection against experimental gas-gangrene, groups of six mice, which had been immunised with these candidate vaccines, were challenged intramuscularly with 10.sup.10 viable cells of C. perfringens NCTC 8237. All of the immunised animals survived this challenge whereas 3/6 control animals which had not been immunised died with 48 hrs.

TABLE 2: Protection against challenge with alpha-toxin afforded by immunisation with candidate vaccines. Groups of six Balb/C mice received 6.times.10 .mu.g intraperitoneal doses of antigen mixed with Freunds incomplete adjuvant over a period of 80 days. The mice were challenged intraperitoneally with 10 .mu.g of purified alpha-toxin and deaths recorded up to 24 hr.

______________________________________ Challenge with alpha-toxinAntigen dose (.mu.g) survivors______________________________________none 10 0/6formol toxoid 10 6/6Cpa.sub.247-370 10 6/6GST-Cpa.sub.247-370 10 6/6______________________________________

Conclusions: The most easily genetically engineered vaccine generated during this study, Cpa.sub.247-370 represents the C-terminal domain of the alpha-toxin. This protein appears to be non-toxic in the mouse in doses up to 10 .mu.g. The repeated inoculation of mice with this protein induced a strong antibody response which protects animals against the alpha-toxin and against challenge with C. perfringens. This vaccine offers several potential advantages over the formol-toxoid: it is much more easily prepared and because it is free from formaldehyde, other toxoided C. perfringens toxins and partially toxoided materials it is inherently safer for vaccine application and less reactogenic.

COMPARATIVE EXAMPLES: A number of other vaccine candidates were prepared that encompassed a region of the alpha toxin recognised by a phospholipase-C neutralising antibody (this region being Cpa.sub.193-198) with additional regions that might be required for correct presentation of this region, using models to ensure that complete helices would be included. A BamHI-HindIII fragment from Cpa encoding a 20.5 kDalton (kDa) fragment of the protein containing six predicted helices was expressed as a cro-.beta.-galactosidase (cro-.beta.-gal-Cpa.sub.99-249). A plasmid was also constructed encoding a 9 kDa fragment containing three predicted helices (cro-.beta.-gal-Cpa.sub.179-249). All were purified and this checked by SDS-PAGE. All proteins reacted with antibodies raised to neutralise the phospholipase C activity, but cro-.beta.-galactosidase alone did not.

Neither of the Cpa.sub.99-249 nor Cpa.sub.179-249 produced a measurable antitoxin titre. Cpa.sub.249 gave similar titre to the formol toxoid yet failed to prevent haemolytic activity in vitro and all alpha-toxin challenged animals died in in vivo tests. Only the formol toxoid and Cpa.sub.247-370 peptide family immunised animals survived. It should be noted that the unconjugated peptide gave superior protection to GST-conjugate when 10.sup.9 viable C. perfringens cells were injected intramuscularly in 100 .mu.l saline.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1113 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: unknown(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Clostridium perfringens(B) STRAIN: double(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..1110(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 736..1110(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TGGGATGGAAAGATTGATGGAACAGGAACTCATGCTATGATTGTAACT48TrpAspGlyLysIleAspGlyThrGlyThrHisAlaMetIleValThr151015CAAGGGGTTTCAATCTTAGAAAATGATCTGTCCAAAAATGAACCAGAA96GlnGlyValSerIleLeuGluAsnAspLeuSerLysAsnGluProGlu202530AGTGTAAGAAAAAACTTAGAGATTTTAAAAGAGAACATGCATGAGCTT144SerValArgLysAsnLeuGluIleLeuLysGluAsnMetHisGluLeu354045CAATTAGGTTCTACTTATCCAGATTATGATAAGAATGCATATGATCTA192GlnLeuGlySerThrTyrProAspTyrAspLysAsnAlaTyrAspLeu505560TATCAAGATCATTTCTGGGATCCTGATACAGATAATAATTTCTCAAAG240TyrGlnAspHisPheTrpAspProAspThrAspAsnAsnPheSerLys65707580GATAATAGTTGGTATTTAGCTTATTCTATACCTGACACAGGGGAATCA288AspAsnSerTrpTyrLeuAlaTyrSerIleProAspThrGlyGluSer859095CAAATAAGAAAATTTTCAGCATTAGCTAGATATGAATGGCAAAGAGGA336GlnIleArgLysPheSerAlaLeuAlaArgTyrGluTrpGlnArgGly100105110AACTATAAACAAGCTACATTCTATCTTGGAGAGGCTATGCACTATTTT384AsnTyrLysGlnAlaThrPheTyrLeuGlyGluAlaMetHisTyrPhe115120125GGAGATATAGATACTCCATATCATCCTGCTAATGTTACTGCCGTTGAT432GlyAspIleAspThrProTyrHisProAlaAsnValThrAlaValAsp130135140AGCGCAGGACATGTTAAGTTTGAGACTTTTGCAGAGGAAAGAAAAGAA480SerAlaGlyHisValLysPheGluThrPheAlaGluGluArgLysGlu145150155160CAGTATAAAATAAACACAGCAGGTTGCAAAACTAATGAGGCTTTTTAT528GlnTyrLysIleAsnThrAlaGlyCysLysThrAsnGluAlaPheTyr165170175ACTGATATCTTAAAAAACAAAGATTTTAATGCATGGTCAAAAGAATAT576ThrAspIleLeuLysAsnLysAspPheAsnAlaTrpSerLysGluTyr180185190GCAAGAGGTTTTGCTAAAACAGGAAAATCAATATACTATAGTCATGCT624AlaArgGlyPheAlaLysThrGlyLysSerIleTyrTyrSerHisAla195200205AGCATGAGTCATAGTTGGGATGATTGGGATTATGCAGCAAAGGTAACT672SerMetSerHisSerTrpAspAspTrpAspTyrAlaAlaLysValThr210215220TTAGCTAACTCTCAAAAAGGAACAGCGGGATATATTTATAGATTCTTA720LeuAlaAsnSerGlnLysGlyThrAlaGlyTyrIleTyrArgPheLeu225230235240CACGATGTATCAGAGGGTAATGATCCATCAGTTGGAAAGAATGTAAAA768HisAspValSerGluGlyAsnAspProSerValGlyLysAsnValLys245250255GAACTAGTAGCTTACATATCAACTAGTGGTGAGAAAGATGCTGGAACA816GluLeuValAlaTyrIleSerThrSerGlyGluLysAspAlaGlyThr260265270GATGACTACATGTATTTTGGAATCAAAACAAAGGATGGAAAAACTCAA864AspAspTyrMetTyrPheGlyIleLysThrLysAspGlyLysThrGln275280285GAATGGGAAATGGACAACCCAGGAAATGATTTTATGACTGGAAGTAAA912GluTrpGluMetAspAsnProGlyAsnAspPheMetThrGlySerLys290295300GACACTTATACTTTCAAATTAAAAGATGAAAATCTAAAAATTGATGAT960AspThrTyrThrPheLysLeuLysAspGluAsnLeuLysIleAspAsp305310315320ATACAAAATATGTGGATTAGAAAAAGAAAATATACAGCATTCTCAGAT1008IleGlnAsnMetTrpIleArgLysArgLysTyrThrAlaPheSerAsp325330335GCTTATAAGCCAGAAAACATAAAGATAATAGCAAATGGAAAAGTTGTA1056AlaTyrLysProGluAsnIleLysIleIleAlaAsnGlyLysValVal340345350GTGGACAAAGATATAAACGAGTGGATTTCAGGAAATTCAACTTATAAT1104ValAspLysAspIleAsnGluTrpIleSerGlyAsnSerThrTyrAsn355360365ATAAAATAA1113IleLys370(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 370 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:TrpAspGlyLysIleAspGlyThrGlyThrHisAlaMetIleValThr151015GlnGlyValSerIleLeuGluAsnAspLeuSerLysAsnGluProGlu202530SerValArgLysAsnLeuGluIleLeuLysGluAsnMetHisGluLeu354045GlnLeuGlySerThrTyrProAspTyrAspLysAsnAlaTyrAspLeu505560TyrGlnAspHisPheTrpAspProAspThrAspAsnAsnPheSerLys65707580AspAsnSerTrpTyrLeuAlaTyrSerIleProAspThrGlyGluSer859095GlnIleArgLysPheSerAlaLeuAlaArgTyrGluTrpGlnArgGly100105110AsnTyrLysGlnAlaThrPheTyrLeuGlyGluAlaMetHisTyrPhe115120125GlyAspIleAspThrProTyrHisProAlaAsnValThrAlaValAsp130135140SerAlaGlyHisValLysPheGluThrPheAlaGluGluArgLysGlu145150155160GlnTyrLysIleAsnThrAlaGlyCysLysThrAsnGluAlaPheTyr165170175ThrAspIleLeuLysAsnLysAspPheAsnAlaTrpSerLysGluTyr180185190AlaArgGlyPheAlaLysThrGlyLysSerIleTyrTyrSerHisAla195200205SerMetSerHisSerTrpAspAspTrpAspTyrAlaAlaLysValThr210215220LeuAlaAsnSerGlnLysGlyThrAlaGlyTyrIleTyrArgPheLeu225230235240HisAspValSerGluGlyAsnAspProSerValGlyLysAsnValLys245250255GluLeuValAlaTyrIleSerThrSerGlyGluLysAspAlaGlyThr260265270AspAspTyrMetTyrPheGlyIleLysThrLysAspGlyLysThrGln275280285GluTrpGluMetAspAsnProGlyAsnAspPheMetThrGlySerLys290295300AspThrTyrThrPheLysLeuLysAspGluAsnLeuLysIleAspAsp305310315320IleGlnAsnMetTrpIleArgLysArgLysTyrThrAlaPheSerAsp325330335AlaTyrLysProGluAsnIleLysIleIleAlaAsnGlyLysValVal340345350ValAspLysAspIleAsnGluTrpIleSerGlyAsnSerThrTyrAsn355360365IleLys370(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 374 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: unknown(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Clostridium perfringens(B) STRAIN: double(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..374(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:AATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATA48AsnAspProSerValGlyLysAsnValLysGluLeuValAlaTyrIle151015TCAACTAGTGGTGAGAAAGATGCTGGAACAGATGACTACATGTATTTT96SerThrSerGlyGluLysAspAlaGlyThrAspAspTyrMetTyrPhe202530GGAATCAAAACAAAGGATGGAAAAACTCAAGAATGGGAAATGGACAAC144GlyIleLysThrLysAspGlyLysThrGlnGluTrpGluMetAspAsn354045CCAGGAAATGATTTTATGACTGGAAGTAAAGACACTTATACTTTCAAA192ProGlyAsnAspPheMetThrGlySerLysAspThrTyrThrPheLys505560TTAAAAGATGAAAATCTAAAAATTGATGATATACAAAATATGTGGATT240LeuLysAspGluAsnLeuLysIleAspAspIleGlnAsnMetTrpIle65707580AGAAAAAGAAAATATACAGCATTCTCAGATGCTTATAAGCCAGAAAAC288ArgLysArgLysTyrThrAlaPheSerAspAlaTyrLysProGluAsn859095ATAAAGATAATAGCAAATGGAAAAGTTGTAGTGGACAAAGATATAAAC336IleLysIleIleAlaAsnGlyLysValValValAspLysAspIleAsn100105110GAGTGGATTTCAGGAAATTCAACTTATAATATAAAATA374GluTrpIleSerGlyAsnSerThrTyrAsnIleLys115120125(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 124 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:AsnAspProSerValGlyLysAsnValLysGluLeuValAlaTyrIle151015SerThrSerGlyGluLysAspAlaGlyThrAspAspTyrMetTyrPhe202530GlyIleLysThrLysAspGlyLysThrGlnGluTrpGluMetAspAsn354045ProGlyAsnAspPheMetThrGlySerLysAspThrTyrThrPheLys505560LeuLysAspGluAsnLeuLysIleAspAspIleGlnAsnMetTrpIle65707580ArgLysArgLysTyrThrAlaPheSerAspAlaTyrLysProGluAsn859095IleLysIleIleAlaAsnGlyLysValValValAspLysAspIleAsn100105110GluTrpIleSerGlyAsnSerThrTyrAsnIleLys115120__________________________________________________________________________

Claims

1. A recombinant DNA which encodes a peptide which (a) comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 261 to amino acid 300 as set forth in SEQ ID NO:2, (b) lacks an amino acid sequence having phospholipase C and sphingomyelin hydrolyzing activity, and (c) induces an immune response protective against Clostridium perfringens in a human or animal.

2. The DNA according to claim 1 which encodes a peptide which comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 261 to amino acid 370 as set forth in SEQ ID NO:2.

3. The DNA according to claim 2 which encodes a peptide which comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 247 to amino acid 370 as set forth in SEQ ID NO:2.

4. The DNA according to claim 3 which encodes a fusion peptide comprising the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 247 to amino acid 370 as shown in SEQ ID NO:2 fused to a further amino acid sequence which is other than the sequence of amino acids 1 to 246 of the alpha-toxin.

5. The DNA according to claim 4 wherein said further amino acid sequence comprises a peptide which produces an immune response which is protective against a pathogen other than Clostridium perfringens, or which can act as a label.

6. The DNA according to claim 4 wherein said further amino acid sequence comprises the amino acid sequence of glutathione-S-transferase.

7. The DNA according to claim 1 which comprises a part of the nucleotide sequence of SEQ ID NO: 1.

8. The DNA according to claim 7 which comprises the nucleotide sequence of SEQ ID NO:3.

9. A plasmid comprising the recombinant DNA according to claim 1.

10. A cell line comprising the plasmid according to claim 9.

11. A cell line comprising the recombinant DNA according to claim 1.

12. An isolated DNA which encodes a peptide which (a) comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 261 to amino acid 300 as set forth in SEO ID NO:2, (b) lacks an amino acid sequence having phospholipase C and sphingomyelin hydrolyzing activity, and (c) induces an immune response protective against Clostridium perfringens in a human or animal.

13. The DNA according to claim 12 which encodes a peptide which comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 261 to amino acid 370 as set forth in SEQ ID NO:2.

14. The DNA according to claim 13 which encodes a peptide which comprises the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 247 to amino acid 370 as set forth in SEQ ID NO:2.

15. The DNA according to claim 14 which encodes a fusion peptide comprising the amino acid sequence of Clostridium perfringens alpha-toxin from amino acid 247 to amino acid 370 as set forth in SEQ ID NO:2 fused to a further amino acid sequence which is other than the sequence of amino acids 1 to 246 of the alpha-toxin.

16. The DNA according to claim 15 wherein said further amino acid sequence comprises a peptide which produces an immune response which is protective against a pathogen other than Clostridium perfringens, or which can act as a label.

17. The DNA according to claim 16 wherein the said further amino acid sequence comprises the amino acid sequence of glutathione-S-transferase.

18. The DNA according to claim 12 which comprises a part of the nucleotide sequence of SEQ ID NO: 1.

19. The DNA according to claim 18 which comprises the nucleotide sequence of SEQ ID NO:3.

20. A plasmid comprising the isolated DNA according to claim 12.

21. A cell line comprising the plasmid according to claim 20.

22. A cell line comprising the isolated DNA according to claim 12.