DNA sequence coding for enhancin polypeptide which enhances virus infection of host insects

REFERENCE TO RELATED APPLICATIONS
This is a continuation-in-part patent application of a copending parent provisional patent application Ser. No. 60/002,743, filed Aug. 24, 1995 now abandoned.
FIELD OF THE INVENTION
The invention relates to the cloning and sequencing of novel viral genes from certain baculoviruses for insect control. More particularly, the invention relates to an isolated and cloned DNA from a virus which encodes an amino acid sequence of a polypeptide isolated from occlusion bodies of certain baculoviruses and which enhance baculovirus infectivity, termed herein as "enhancins".
BACKGROUND OF THE INVENTION
The Baculoviridae, comprised of the nucleopolyhedroviruses (NPV) and granuloviruses (GV), are a family of viruses that primarily infect insects. Autographa californica multiple NPV (AcMNPV) is the best studied insect virus. Well developed in vitro systems have permitted extensive molecular characterization. In addition, it is utilized as a tool for foreign gene expression and an alternative to chemical pesticides
In 1959 a protein, the synergistic factor (SF), was identified that increased the susceptibility of Pseudaletia unipuncta larvae to a dual infection by both PsunGV-H and a PsunNPV (Tanada, 1959). The SF was estimated to be present at levels up to 5% of the granulin protein (Tanaria, 1985). The granules of the cabbage looper granulovirus, Trichoplusia ni, TnGV, also contain a protein, the enhancin (Derksen & Granados, 1988; Corsaro et al., 1993) that enhances infections of AcMNPV and other viral species like the T. ni single enveloped nucleopolyhedrovirus TnSNPV (Greenspan Gallo et al., 1991).
The exact mechanisms of enhancement are unknown, but two different modes of action have been proposed. The PsunGV-H enhancin was reported to interact with viral particles and increase the binding of the latter to the insect midgut microvilli (Tanada, 1985). Studies on the mode of action of the VEF isolated from Trichoplusia ni (cabbage looper) granulovirus virus (TnGV) showed that the VEF caused rapid degradation of the peritrophic membrane which lines the midgut lumen of lepidopteran larvae. Larval bioassays suggested that this alteration made the peritrophic membrane more permeable to invading baculoviruses resulting in at least a 25-fold increase in larval mortality.
Closely related to, or identical with, the VEF protein is a lipoprotein, originally isolated in crude form from a Hawaiian strain of Pseudaletia unipuncta granulovirus virus (PuGV-H), but not cloned or sequenced. It is described by Tanaria and co-workers as the "synergistic factor" (SF) and as having a calculated molecular weight between 90 K and 160 K. The SF was released from the capsule upon dissolution in the midgut, and was the localized to the microvillar surface of the midgut cell membrane where it caused an apparent increase in the uptake of enveloped nucleocapsids. The binding of SF to the midgut membrane was found to be specific with a calculated equilibrium constant of 1.57.times.10 sup-9 M.
It was postulated that the two proteins (VEF and SF) are closely related and have similar dual modes-of-action: peritrophic membrane disruption and increased virus uptake. Evidence to support this relationship comes from southern hybridization's of PuGV-H genomic DNA with the VEF gene and western blots of dissolved PuGV-H occlusion bodies with an anti-VEF polyclonal antiserum. Tanada determined that this SF in the capsule of PuGV-H increased the larval susceptibility to P. unipuncta nuclear polyhedrosis virus (PuNPV). This was confirmed by the sequence similarity shown in U.S. Pat. No. 5,475,050.
These proteins are referred to herein generally as "enhancins", but are also referred to as virus enhancing factors (VEF) and/or as synergistic factors (SF). Genes encoding enhancins (VEF and SF) and pest control compositions comprising this factor and nuclear polyhedrosis viruses are the subject matter of U.S. Pat. Nos. 5,475,090, 4,973,667, and 5,011,685. Since viral enhancing proteins are important at early stages of host infection, it is important to identify and locate the genes for other similar proteins within the viral genome. A need, therefore, exists to clone and sequence the genes of other related proteins. It is an object of this invention to satisfy such a need.
SUMMARY OF THE INVENTION
The invention relates to the cloning and sequencing of novel viral genes from certain baculoviruses for insect control. More particularly, the invention relates to an isolated and cloned DNA from a granulovirus virus which comprises an amino acid sequence of the viral gene encoding a polypeptide isolated from occlusion bodies of certain baculoviruses and which polypeptide possesses the biological activity of enhancing baculovirus infectivity. This invention also relates to isolated and purified baculovirus proteins which are characterized by enhancing the infectivity of baculoviruses. Such proteins termed herein as "enhancins" are found within the viral occlusion body, have a disruptive effect on the insect peritrophic membrane (PM) proteins, and/or interact with the midgut epithelium in such a manner as to permit the increased adsorption, penetration and uptake of virus particles by midgut cells with a concomitant increase in host mortality. The invention relates to the cloning and sequencing of a novel viral gene.
The present invention includes a recombinant DNA sequence which codes for the enhancin protein of the Helicoverpa armigera granulovirus virus. The DNA sequence is shown in SEQ. ID. NO.: 1 and the open reading frame is shown in SEQ. ID. NO.: 1: base pairs 271-2976. The amino acid sequence of the enhancin protein is shown in SEQ. ID. NO.: 2: base pairs 1-901, which has two domains one stretching from residues 1-550, and the other from 551-901.
A recombinant protein can be produced from this newly isolated DNA sequence with an expression vector comprising the DNA sequence and a suitable promoter which, when put into a suitable host will be capable of resulting in the expression of an amino acid sequence having the physical, chemical, and/or biological properties of the enhancin protein of the Helicoverpa armigera granulovirus virus. The expression vector can be either a recombinant plasmid adapted for transformation of a microbial host or recombinant baculovirus.
A recombinant plasmid which includes a recombinant DNA sequence which codes for the enhancin protein of the Helicoverpa armigera granulovirus virus was used to transform E. coli and deposited at the Agricultural Research Service Culture Collection (NRRL), Northern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Ill. 61604 and assigned accession number: NRRL B-21614.
The recombinant enhancin protein, and/or the recombinant baculovirus for expressing the enhancin protein can be used in a composition toxic to insects along with a compound toxic to insects. The activity of the composition is partially through the action of the enhancin, the enhancin having a disruptive effect on the insect peritrophic membrane proteins such that it interacts with the midgut epithelium in such a manner as to enhance the increased absorption, penetration, and/or uptake of virus by midgut cells with a corresponding increase in host mortality.
A more complete appreciation of the invention and the advantages thereof will be apparent as the same becomes better understood by reference to the following details of description when considered in connection with the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWING
FIGS. 1a and 1b show a comparison of the amino acid sequences of the Pseudaletia unipuncta, Trichoplusia ni and Helicoverpa armigera enhancins.

DESCRIPTION OF THE PREFERRED EMBODIMENT
One of the discoveries of the present invention is the cloning and sequencing of the enhancin gene found in the Helicoverpa (Heliothis) armigera granulovirus (HearGV). While, the enhancin gene found in the PsunGV-H virus is virtually identical to the previously characterized Trichoplusia ni GV (TnGV) enhancin gene, a comparison of the predicted amino-acid (aa) sequences of TnGV enhancin (901 aa) with the HearGV enhancin (902 aa) revealed herein demonstrated an overall identity of only 80%, with greater conservation (88%), and hence higher homology, from amino-acids 1-550. The addition of the newly discovered HearGV enhancin to an AcMNPV inoculom increased the infectivity of baculoviruses in insect larvae. This discovery will aid in the effort to control certain pests without the use of pesticides.
Moreover, the host range of the Helicoverpa (Heliothis) armigera granulovirus is significantly broader than that of other known granulovirus viruses, such as TnGV or PuGV, which suggests that the HearGV enhancin disclosed herein may have broader biological activity, increasing its potential effectiveness in the control of insects (John J. Harem, 1982, incorporated herein by reference). A pathogen, here a insect baculovirus, that is an effective microbial control against several species of economically damaging insects, as is HearGV due to its broad specificity, is much more useful against a complex of insects attacking a crop and therefore more economically viable as a commercially useful insect pathogen than a similar enhancin with a narrower insect target range.
I. Identification of Enhancins in Granulovirus Species
Proteins from eight different granuloviruses that infected 4 different Lepidopteran families were analyzed by SDS-PAGE and Western blotting in an attempt to identify novel enhancin proteins. The granulovirus (GV) species used in this study were: CpGV, Estigmene acrea (EsacGV), Heliocoverpa armigera (HearGV), PlinGV, Pieris rapae (PiraGV), PsunGV-H, Scotogramma trifiolii (SctrGV) and TnGV. Viral stocks were maintained in the lab as granule suspensions and/or infectious hemolymph isolated from previously infected larvae. Larval infections, purification of granules and enhancin was as previously described (Derksen & Granados, 1988; Greenspan & Gallo et at., 1991, both incorporated herein by reference).
For the SDS-PAGE and Western blot analysis granules were dissolved in 100 mM NaHCO.sub.3 (pH 10.5) and incubated at room temperature for 15 minutes. The protein concentration was determined using the Bradford assay kit (Promega Corp., Madison, WI). Approximately 10 .mu.g of each GV solution was analyzed on SDS-PAGE. Gels were silver stained. A duplicate gel was transferred onto PVDF membrane (NEN Research Products, Dupont, Boston, MA) using a protocol provided by the manufacturer (Biorad, Melville, NY). Western blots were analyzed using a rabbit anti-VEF-TrpE polyclonal antibody at a dilution of 1:5000. Cross-reactive bands were visualized using goat anti-rabbit alkaline phosphatase conjugated secondary antibody, this was done at a dilution of 1:3000 (Sigma, St. Louis, MO).
Five different GV species, four infecting the Noctuidae family and one infecting the Pieridae family, were found to contain proteins that did cross-react with the anti-enhancin polyclonal antibodies already mentioned. However, PlinGV, which infects indian meal moth larvae (Noctuidae), CpGV, that infects codling moth larvae (Torticidae) and EsacGV, that infects saltmarsh caterpillar larvae (Arctiidae), were not seen to have crossreacting proteins. Two granulovirus species, C. pomonella GV, and E. acrea GV, were previously identified as having an enhancin, and were used as positive controls in the research herein disclosed. We also used standard neonate bioassays performed with both EaGV and CpGV, in attempt to demonstrate enhancin activity therein, however, neither displayed any ability to enhance the infectivity of baculovirus.
The enhancins can be subdivided into of three different groups based on their respective molecular weights, and migration patterns: 104 kD for the TnGV, PsunGV-H and PiraGV enhancins, 108-110 kD for HearGV enhancin and 120 kD for SctrGV enhancin. In standard T. ni neonate bioassays HearGV, PsunGV-H and SctrGV demonstrated an ability to "enhance" the level AcMNPV infectivity, confirming the presence of an enhancin. PsunGV-H, was the first granulovirus for which the presence of an enhancin in its occlusion body was described and documented.
A. Cloning and Sequencing
Vital genomic DNA was isolated from granules as described by Smith and Summers (1982), incorporated herein by reference. All of the restriction endonucleases and modifying enzymes were purchased from Promega Corp. (Madison, WI). Restriction endonucleases were routinely used in DNA digests using a universal enzyme restriction endonuclease buffer (10x=0.33 M Tris/Acetate pH 7.85, 0.65 M Potassium acetate, 0.1 M Magnesium acetate, 0.04 M Spermidine Tri-Chloride, 5 mM Dithiothreitol). DNA gel electrophoresis, Southern blotting and hybridization were performed as described (Hashimoto et al., 1991). Viral genomic DNA was cloned into either plJC18/19 (YanischPerron et at., 1985) or Bluescript SK (Stratagene, La Jolla, CA).
The complete HearGV enhancin gene was identified through hybridization of a 1.75 Kb KpnI fragment of the HearGV gene, that crosshybridized to a TnGV internal enhancin fragment on a blot, where the HearGV genomic DNA had been digested with BamHI, EcoRI, HindlII and KpnI. A cross-hybridizing BamHI fragment with an estimated size of 5.2 Kb was cloned into the pUC18 expression vector and a DNA restriction map was thereafter generated. The KpnI fragment already mentioned, as well as the 1.45 Kb SstII-BamHI fragment, and deletion fragments derived thereof, were sequenced on both strands.
HearGV genomic clones were sequenced using cesium chloride purified DNA and a commercially available sequencing kit (United States Biochemical Corp., Cleveland, OH). Deletion clones were generated by Bal31 digestion as described, the Erase-a-Base ExolII/S1 digestion kit (Promega Corp., Madison, WI) or an ExolII/Mung bean nuclease kit (Stratagene). Sequence products were analyzed on gels prepared with 6% Sequagel Rapid Sequencing Solution (National Diagnostics, Atlanta, GA). Sequence information from the generated genomic clones was developed through the use of the Sequence Analysis Software Package of the Genetics Computer Group (Madison, WI, Versions 7.2 and 7.3).
The enhancin gene from HearGV was cloned and sequenced as described above. Every nucleotide on both strands of the enhancin gene sequence was sequenced a minimum of 2 times. The DNA sequence and deduced amino acid sequence of the HearGV gene is shown in SEQ. ID. NO: 1 and SEQ. ID. NO: 2, respectively. Sequence data analysis of the HearGV DNA revealed an open reading frame (ORF) of 2706 nucleotides that encodes a protein containing 902 amino acids and a mass of 104.6 kD. Similarly, PsunGV-H clones have an ORF of 2703 bp that encodes a protein of 901 amino acids with a mass of 104.2 kD. (Please note that the DNA and amino acid sequence for PsunGV-H and TnGV enhancins are presented in the Sequence Listing of U.S. Pat. No. 5,475,090).
B. Isolation of RNA and Primer Extension Analysis
Total RNA was isolated from HearGV infected T. ni larvae at dally intervals from 0-8 days post infection (p.i.), using guanidine isothiocyanate (GIT) as described (Sambrook et at., 1989 inc. by ref.). Four to eight larvae were collected for each timepoint, frozen in liquid nitrogen and then ground in a glass Potter tube in the presence of 4 ml of GIT. The resulting larval suspension was layered onto a CsCI gradient and spun for 16 hours at 35 K. The RNA pellet was then collected, precipitated, washed, dried and quantified.
For primer extension analysis of the enhancin promoter, a primer (HAZR2) 5' CAC GGC GGC AGC ACG G 3' complementary to nucleotides 43-28 downstream of the AUG initiator codon of the enhancin gene was used. Approximately 100 ng of the primer was labeled using 100 mCi of g-ATP (Dupont Company, Boston, MA) and T4 polynucleotide kinase (Promega Corp., Madison. WI). Five nanograms of the primer were incubated with 50 .mu.g of total RNA isolated from HearGV infected T. ni larvae isolated at 1, 4, 5, 6, 7 and 8 days post infection. The primer extension reaction was according to Ausubel et at., (1989 inc. by ref.) with two modifications: the AMV reverse transcriptase (RVT) (Promega, Madison, WI) was incubated at 50.degree. C. and actinomycin D was added at a final concentration of 75 .mu.g/ml to inhibit the DNA-dependent DNA polymerase activity of the RVT. Reaction products were analyzed on a 6% polyacrylamide (PAA)-gel and compared to a sequencing ladder of clone HABAM, that contains a 5.2 Kb BamHI fragment from the HearGV genome and has the complete enhancin coding sequence also sequenced with the same primer.
C. Generating the Plasmid
For the analysis of the 5' end of the HearGV enhancin message, a 800 bp NcoI fragment from clone HABAM was subcloned in vector pSL1180 (Pharmacia, Piscataway, NJ) to yield pHANCO. A 470 bp MunI-BamHI fragment (425 bp HearGV sequences and 45 bp pSL1180 multilinker) was subcloned into Bluescript KS+digested with EcoRI and BamHI to yield pHAMB. To generate a probe complementary to the 5' end of the HearGV enhanein gene, plasmid pHAMB was linearized at the HindIII multilinker site, which lies upstream of the MunI/EcoRI fusion site. Transcription with T7-RNA polymerase (Gibco BRL, Gaithersburg, MD) was according to the manufacturer's protocol in the presence of 20 .mu.Ci UTP. After transcription, the template was digested for 15 minutes at 37.degree. C. by adding 2 .mu.l RNase free DNase (10,000 U/ml; Boehringer Mannheim, Indianapolis, IN). Following digestion, 100 .mu.l TSE (TE plus 0.5% SDS) was added, followed by extraction with PCI (phenol/chloroform/isoamyl alcohol, 25:24:1). The probe was further purified by elution from a Nick G-50 gravity flow column (Pharmacia, Piscataway, NJ). Two microliters of the resulting purified probe were analyzed on a 6% polyacrylamide-gel. The presence of several premature stops further necessitated purification on a 6% PAA gel. The full length probe (530 nucleotides) was isolated from this gel.
For analysis of the 3' end of the enhancin message, clone HASB, which has a 1.45 Kbp SstII-BamHI fragment of the HearGV enhancin gene cloned into Bluescript SK-, was cut with MluI. An antisense T7 RNA probe was synthesized and purified as described above. Upon gel analysis the probe was found to be >95% full length (372 nucleotides) and used without further purification.
The HearGV gene inserted into the plasmid vector was transfected into E. coli and deposited under the Budapest Treaty on Aug. 22, 1996 at the Agricultural Research Service Culture Collection (NRRL), Northern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Ill. 61604 and assigned accession number: NRRL B-21614. The applicant agrees to be bound by the terms of the Budapest Treaty regarding availability.
D. RNAse Protection Analysis
For RNase protection analysis, 20 .mu.g of total RNA were mixed with 105 cpm of antisense RNA probe, precipitated and resuspended in 30 .mu.l of hybridization buffer (80% formamide, 40 mM PIPES, 400 mM NaCl, 1 mM EDTA). After heating for 10 minutes at 80.degree. C., the mixture was left to hybridize overnight at 50.degree. C. Following hybridization, unprotected RNA was digested by adding 350 .mu.l RNase mix (10 mM Tris pH 7.5, 5 mM EDTA, 0.3 M NaCl, 2 .mu.l 10 mg/ml RNase A, 5 .mu.l 100,000 U/ml RNase T1) and incubated at 30.degree. C. for 60 minutes. The digestion was stopped by adding SDS to a final concentration of 0.5%. Samples were further purified by digestion with Proteinase K (3 .mu.l of a 15 mg/ml premix; Boehringer Mannheim) for 30 minutes at 37.degree. C. The samples were extracted twice with 400 .mu.l PCI and precipitated at room temperature (RT) for 30 minutes by addition of 1 ml of 96% ethanol. Samples were spun at room temperature, washed twice with 70% ethanol at room temperature, dried briefly and resuspended in 20 .mu.l loading buffer (50% formamide, BFB and XCFF 0.05%).
Reaction products were analyzed on 6% polyacrylamide sequencing (3' analysis) or slab gels (5' analysis). Product sizes were estimated by comparison to a sequencing ladder of clone HABAM sequenced with primer HAZR2 and comparison to a 123 bp ladder (GIBCO BRL). Gels were exposed to XAR 5 film in cassettes with intensifying screens (Kodak, Rochester, NY).
The RNase protection analysis of the 3'end of the HearGV enhancin offers some evidence both for transcription termination and transcriptional read through into the second ORF. No canonical polyadenylation signal AAUAAA, was present upstream of the transcription termination signal. An alternative poly(A) sequence closely resembling the poly(A) sequence, AACAAA, was present between nucleotides 3003-3008. It has been reported that the presence of a similar sequence downstream of the .beta.-thalassaemia gene or other alternative poly(A) like sequences results in elongated and unstable transcripts and changes to the steady state levels of mRNA. This may explain why, apart from the two major protected RNA species during RNase protection, several minor protected species appeared to be protected. Alternatively, it is possible that the HearGV enhancin gene transcript does not have a poly(A) tail. This would not be unique for baculoviruses. Recently, a convincing case has been made for the absence of a poly(A) tail on Spodoptera exigua NPV polyhedrin mRNA.
The 3' RNase protection assay also indicated that the enhancin ORF and the downstream ORF maybe on one message. The occurrence of bi-cistronic messengers is not uncommon for baculoviruses. Analysis of the HindlII-M region of Orgyia pseudotsugata NPV for instance, has shown that hi,- and multi-cistronic messages originated from baculovirus late promoter motifs that had different 5' ends but the same 3' end.
E. Transcriptional Analysis of the Enhancin Genes
Transcriptional analysis of the HearGV gene reveals several more interesting features of enhancin genes. Of the three baculovirus late promoter motifs conforming to the consensus NTAAG sequence, present in the region upstream of the enhancin ORF the one that is predominantly used, TTAAG, is positioned only 3 nucleotides from the translational AUG start codon. Transcriptional analysis of the TnGV enhancin gene has also shown that the ATAAG motif present at -8 to -4 relative to the AUG initiator codon serves as the only transcriptional initiation point.
From our work it has become clear that the AUG closest to the promoter is the translation initiation codon. That this codon is the translation initiator codon is based on several observations seen infra. First, the context of the initiator codon -3 AUCAUGC+4 is similar to the Kozak consensus sequence for translation initiation, -3 A/GYYAUGG+4. The pyrimidine C present at position +4 in the HearGV gene, and in all enhancin genes sequenced so far, is the only notable exception to the Kozak consensus. It has been found through mutation studies that replacement of the consensus G in position +4 acts to downregulate eukaryotic translation. Second, the mass of the protein observed in protein gels corresponds well with the first AUG in the ORF acting as the translational initiator codon. Third, the next possible AUG lies 240 nucleotides downstream in the coding region and does not confer to Kozak rules at all.
The observation that a baculovirus late promoter in the HearGV gene is present so proximal to the start codon that upon transcription it gives rise to a 5' leader with a maximum length of 7 nucleotides, is unique to the enhancin genes, and has only been previously reported for the TnGV enhancin gene. Leaders of eukaxyotic messages are seldom shorter than 7-10 nucleotides and usually average between 25 and 50 nucleotides. Deletion studies of the 5' non-coding region on the translational efficiency of phosphoglycerate kinase mRNA in yeast, for instance, have shown that even if the leader length is decreased to 7 nucleotides, translation at 50% of the optimal rate still occurs. The observation that a shorter leader impairs the fidelity of initiation by eukaryotic ribosomes, has been confirmed using an in vitro transcription and translation system (Kozak, 1991, inc. by ref.). This negative effect on fidelity of initiation, however, can be almost completely eliminated by the presence, or through the introduction of, secondary structure with a DG of -19 kcal/mol in the mRNA at an optimal distance of 14 nucleotides from the AUG initiator codon (see, Kozak, 1990, 1991).
Transcription of the HearGV enhancin gene also results in a short 5' leader sequence with considerable secondary structure (DG -16.7 kcal/mol: GCG MFold analysis) within the first 100 nucleotides of the mRNA. The total amount of enhancin present in granules has been estimated to be 5% of total protein. This suggests that enhanein gene promoters are rather strong. The combination of promoter proximity, suboptimal AUG context and secondary structure downstream of the AUG initiator codon, may very well result in a complex mechanism of transcription regulation, mRNA stability, and translation efficiency unique to baculoviruses
II. Comparisons of Homology
After sequencing the HearGV enhancin gene, as laid out above, it was determined that it shared significant sequence homology with both the TnGV and PsunGV-H enhancin genes (see Table 1 below). Analysis of this similarity in sequence between the PsunGV-H and HearGV enhancin genes at the DNA and deduced amino acid sequence level, and thereafter comparison with the TnGV enhancin gene sequence revealed several interesting characteristics of the genes, and their respective homology. The TnGV and PsunGV-H enhancin genes are virtually identical from 325 nucleotides upstream of the enhancin ORF and throughout the partial ORF identified downstream of the enhancin gene. Since in HindIII digests of TnGV and PsunGV-H genomic DNA, 19 of the 26 visible fragments comigrate the observed conservation of homology suggests that both granuloviruses are strongly related and may have only recently evolved divergently.
TABLE 1__________________________________________________________________________Comparison of the TnGV, PsunGV-H and HearGVDNA and amino acid sequences__________________________________________________________________________Nucleotide Sequence Identity Upstream Upstream Upstream Overall Intergenic DownstreamVirus Compare 450-325 n 334-65 n 65-1 n ATG-Stop Region ORF__________________________________________________________________________Ha .times. Tn ND ND 40% 77% 46% 73%Ha .times. Pu ND 38% 40% 77% 46% 69%Pu .times. Tn 35% 94% 100% 99% 100% 98%__________________________________________________________________________Amino Acid Sequence Identity Overall Amino Acid Amino Acid Downstream DownstreamVirus Compare 1-end 1-551 551-end ORF ORF 20-end ID SIM ID SIM ID SIM ID SIM ID SIM__________________________________________________________________________Ha .times. Tn 80% 90% 88% 94% 68% 83% 82% 89% 93% 98%Ha .times. Pu 81% 90% 89% 95% 69% 84% 78% 86% 95% 100%Pu .times. Tn 98% 99% 99% 99% 97% 99% 94% 97% 100% 100%__________________________________________________________________________ ND: Not Determined ID: Identity SIM: Similarity n: nucleotide
A comparison of the PsunGV-H and TnGV enhancin genes (FIG. 1 & Table 1), showed that they are virtually identical at both the DNA and the amino acid sequence level over almost their entire length. The amino acid sequences differ in only fifteen amino acids. Seven changes are caused by a 21 nucleotide reciprocal frameshift (reflected by the dissimilarity in amino acids 652-658, FIG. 4). The remaining eight amino acid changes are caused by point mutations in the PsunGV-H enhancin gene. The DNA homology from -450 through -325 nucleotides upstream of the translational initiator codon is 35%. This increases to 94% from -325 to -1 and 98% for the remaining DNA. There is a 98 % identity for the peptide sequences.
When the HearGV and PsunGV-H enhancin genes are compared, virtual identity is not present (FIG. 1 & Table 1). For 270 nucleotides upstream of the translational start codon the homology is 40%. This increases to an overall homology of 77% within the ORF, decreases to 46% for the intergenic region and increases again to 69% for the putative downstream ORF. Comparison of the amino acid sequences of the two enhancins revealed that the overall identity and similarity are 81% and 90% respectively. Amino acids 1-550 show an identity and similarity of 89% and 95%. This similarity decreases to 69% and 84%, when amino acids 551-902, respectively, are compared. While amino acid sequences 1-550 score significantly above the similarity average, the amino acids 551-901 scored significantly below it, when the GCG PlotSim software program is used to generate a similarity comparison.
A. Genetic Analysis
The above analysis demonstrates that enhancins have two distinct domains. This may be a reflection of the fact that two activities have been found to be associated with enhancins, namely the breakdown of peritrophic membranes through a proteolytic activity and the enhancement of viral binding to receptors present in the midgut microvilli.
The HearGV gene has a consensus baculovirus late promoter motif shared with the PsunGV-H gene (PsunGV-H: ATAAG; HearGV: TTAAG,) at positions -8 through -4 relative to the translational start codon. Two other late motifs, GTAAG and ATAAG, were present in the HearGV sequence within 270 basepairs upstream of the ATG. The PsunGV-H sequence has no other late promoter motifs within 400 nucleotides upstream of the AUG. A second late promoter motif, ATAAG was present at 36-32 nucleotides upstream of the enhancin translational stop codon (positions 2991-2993) with the start codon of a putative ORF (PsunGV-H: 3057-3059; HearGV: 3051-3053) downstream of it. No canonical polyadenylation consensus sequences were identifiable in the short intergenic region between the translational stop codon of the enhancin gene and the translational start codon of the downstream ORF. It was noted however, that the HearGV DNA sequence here is relatively AT rich, and the PsunGV-H enhancin gene has two sequential stop condons, TAATAA. Either of these DNA sequences may meet the requirements for polyadenylation sites.
B. Genetic Divergence HearGV Enhancin Gene Sequence
The HearGV enhancin gene has several baculovirus late promoters upstream of the enhancin ORF and encodes a significantly different protein from previously described enhancins, one which differs in both mass and deduced amino acid sequence from the enhancin of TnGV and PsunGV-H. Therefore it is a separate and novel gene product from previously described genes.
While the HearGV enhancin has 902 amino acids and a mass of 104.6 kD, it migrates at a higher than expected mass of 108-110 kD. We hypothesize that this variant migration behavior may be caused by the presence of a sequential stretch of proline residues at the C-terminal end of this sequence (positions 880-883), that is lacking from the PsunGV-H sequence.
Comparison of the partial amino acid sequence of the downstream ORF (HearGV: AUG=3051, PsunGV-H: AUG=3057) shows an identity and similarity of 82 and 89%, respectively (FIG. 5; Table 1). Analysis of the amino acid sequences with a GCG program that recognizes signal sequences with a probability of 95% and an accuracy of 75% at a score level of 3.5, revealed that the first twenty amino acids of both the HearGV and the PsunGV-H downstream ORF, most likely encode a similar signal sequence (the signal cleave scores are 8.8 and 7.3 respectively). The PsunGV-H downstream ORF has been shown to be open for at least 170 amino acids.
The organization, transcription and translation of these enhancin genes hold several special features that can be modulated to serve as useful alternatives to the application of chemical pesticides for insect management. As Table 2, below, demonstrates that the use of enhancin proteins, specifically the HearGV enhancin protein, dramatically affects the mortality of host larvae (see Table 2 below). Also as seen in Table 2, the amounts of the enhancins needed to substantially increase insect host mortality are very small.
TABLE 2______________________________________The Use of Various Enhancin Proteins to Increase the Infectivity ofBaculoviruses, and Thereby the Mortality in Treated Insect LarvaeEnhancin Percent MortalityConcentration Tn Ha St Pu______________________________________Trial 1 0.1 ng 100% 100% 100% 100% 0.01 ng 97% 90% 90% 97%Trial 2 0.1 ng 90% 100% 97% 100% 0.01 ng 97% 90% 90% 100%______________________________________ Percent mortality in T. Ni neonate larvae following ingestion of one AcMNPV OB per larva at two different concentrations of enhancin derived from four different granulovirus viruses. AcMNPV control at 1 OB/larva wa 50% and 47% for 2 replications; Tn= Trichoplusia ni GV; Ha = Heliothis armigera GV; St = Scotogramma trifolii GV; Pu = Pseudaletia unipuncta GV.
Accordingly, it is to be understood that the embodiments of the invention herein described are merely illustrative of the application of the principles of the invention. Reference herein to details of the illustrated embodiments are not intended to limit the scope of the claims, which themselves recite those features regarded as essential to the invention.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3186 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicoverpa armigera granulosis virus(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 271..2976(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:CTATATGTGGTAAGATTGATTGAATGTTCGTTTGCTCTCGCGTTGTTTAAAAAACGCAAC60AAACACCGGTATTAGCGGAGCGGTCTCCTGTATCCGGCAGCGGACTGTCGCGTTAGCGTG120CACCACTACGCCGGCCGGAACGCGACCGTGTTTGAGCGCCAACCAATTGTCCTGTGGCCT180CAAATAAGGCGGCACTGCTAAAGATGGTACCGGTAGAATAATGGAAGTTTTGTTCTTTCA240CACAACATTACGCTGTCTTAAATTAAGATTATGTCGTACAACGTAATTGTGCCT294MetSerTyrAsnValIleValPro15ACTACCGTGCTGCCGCCGTGGCTGAGGATCGGTCAAAATTGGATATTC342ThrThrValLeuProProTrpLeuArgIleGlyGlnAsnTrpIlePhe101520GCTAGACACAGACGCACCGAAGTCGGTGTGGTGTTACCTGCAAACACA390AlaArgHisArgArgThrGluValGlyValValLeuProAlaAsnThr25303540AAGTTTCGGGTTCGAGCCGATTTCGCTAAATGGGGCATCACGAGGCCC438LysPheArgValArgAlaAspPheAlaLysTrpGlyIleThrArgPro455055GTGATCGTGCGCCTCTTGAACAACAACCGTAACACCGAGCGCGAGATA486ValIleValArgLeuLeuAsnAsnAsnArgAsnThrGluArgGluIle606570AATTTAACCAACGACCAATGGATAGAGATGGAGCACGAGCACGAGTGT534AsnLeuThrAsnAspGlnTrpIleGluMetGluHisGluHisGluCys758085GTGCCGTTCGTCGACTGGCCGGTGGGTGAAAAAAACACCATGGCCGAG582ValProPheValAspTrpProValGlyGluLysAsnThrMetAlaGlu9095100GTACACTTTGAAATCGACGGACCACACATACCGCTTCCCGTGTACGTG630ValHisPheGluIleAspGlyProHisIleProLeuProValTyrVal105110115120TTCAACACGAGACCCGTGGAAAACTTTAAGAGCGAGTACCGCCAGAGT678PheAsnThrArgProValGluAsnPheLysSerGluTyrArgGlnSer125130135TCGTCGGGCTACTGCTTCCTGTATTTGGACCTGGTGTGTATTTTGGTG726SerSerGlyTyrCysPheLeuTyrLeuAspLeuValCysIleLeuVal140145150CCGCCGGCTAGTAAAAACGTGTTACTAGACACGGACCTGTTTGAGCTC774ProProAlaSerLysAsnValLeuLeuAspThrAspLeuPheGluLeu155160165CATCAATTTTATAACGAAATTATTAATTACTATGACGATTTGTGCGGT822HisGlnPheTyrAsnGluIleIleAsnTyrTyrAspAspLeuCysGly170175180TTGGTCGAGGACCCGTACGCAGACACTGTGGATTCAAACCTACCCAAC870LeuValGluAspProTyrAlaAspThrValAspSerAsnLeuProAsn185190195200AAGGCGGCATTCGTGAAAGCCGACGGTGGTGGTCCCGGCGGTGCTTAT918LysAlaAlaPheValLysAlaAspGlyGlyGlyProGlyGlyAlaTyr205210215TACGGGGCATTCTGGACGGCTCCCGCCAGCACAAATCTAGGCGAATAT966TyrGlyAlaPheTrpThrAlaProAlaSerThrAsnLeuGlyGluTyr220225230CTCCGGGTGTCGCCCACCAATTGGATGGTTATTCACGAGCTGGGTCAC1014LeuArgValSerProThrAsnTrpMetValIleHisGluLeuGlyHis235240245GCGTACGATTTCGTGTTTACTGTGAACACTCGCCTTATAGAAATCTGG1062AlaTyrAspPheValPheThrValAsnThrArgLeuIleGluIleTrp250255260AACAACTCGTTCTGCGATCGGATACAATACACGTGGATGAACAAAACC1110AsnAsnSerPheCysAspArgIleGlnTyrThrTrpMetAsnLysThr265270275280AAGCGACAGCAACTGGCTCGCATTTACGAGAACCAACGACCCCAGAAG1158LysArgGlnGlnLeuAlaArgIleTyrGluAsnGlnArgProGlnLys285290295GAGGCGGCTATTCAAGCGCTAATCGACAACAATGTACCGTTTGATAAT1206GluAlaAlaIleGlnAlaLeuIleAspAsnAsnValProPheAspAsn300305310TGGGATTTTTTTGAGAAACTCAGCATTTTTGCATGGCTGTACAATCCG1254TrpAspPhePheGluLysLeuSerIlePheAlaTrpLeuTyrAsnPro315320325CAAAGGGGACTGGACACTTTGCGTAATATCAATCATTCGTACAGGTTG1302GlnArgGlyLeuAspThrLeuArgAsnIleAsnHisSerTyrArgLeu330335340CACGCTGCCCGCAATCCAGTTACGCCATACCCGCAAATTTGGGCATGG1350HisAlaAlaArgAsnProValThrProTyrProGlnIleTrpAlaTrp345350355360TTGATGAGTTGTGGTTACGACAACTTTTGGTTGTACTTTAATCGAATA1398LeuMetSerCysGlyTyrAspAsnPheTrpLeuTyrPheAsnArgIle365370375GGTTTGTACCCTGCCGATTTTTACATTAACGAACACAATAAAGTCGTG1446GlyLeuTyrProAlaAspPheTyrIleAsnGluHisAsnLysValVal380385390CATTTCAATCTGCACATGCGCGCCTTAGCGCTGGGACAGAGTGTGCGT1494HisPheAsnLeuHisMetArgAlaLeuAlaLeuGlyGlnSerValArg395400405TACCCTATCAAATATATTATTACCGACTTTGATTTATTGCAAAAGAAC1542TyrProIleLysTyrIleIleThrAspPheAspLeuLeuGlnLysAsn410415420TACGACATAAAGCAATATTTAGAGAGTAACTTTGATCTTGTAATACCG1590TyrAspIleLysGlnTyrLeuGluSerAsnPheAspLeuValIlePro425430435440GAAGAGTTGAGACAGACCGATCTGGTTGCGGACGTACGAGTGGTGTGC1638GluGluLeuArgGlnThrAspLeuValAlaAspValArgValValCys445450455GTCATCGACGACCCATCACAAATTATAGGTGAACCGTTTAGTTTGTAC1686ValIleAspAspProSerGlnIleIleGlyGluProPheSerLeuTyr460465470GACGGTAACGAACGAGTTTTTGAGAGCACAGTAGCCACGGATGGTAAC1734AspGlyAsnGluArgValPheGluSerThrValAlaThrAspGlyAsn475480485ATGTATTTAGTTGGCGTGGGTCCGGGAGTGTACACTCTACGCGCGCCC1782MetTyrLeuValGlyValGlyProGlyValTyrThrLeuArgAlaPro490495500CGCGGCAAAGACAAACGCTACAAACTCCACTTGGCACACTCGCCCAAC1830ArgGlyLysAspLysArgTyrLysLeuHisLeuAlaHisSerProAsn505510515520GAGCCGGTTCATCCGGCTAACGATCACATGTATCTACTCGTGACATAT1878GluProValHisProAlaAsnAspHisMetTyrLeuLeuValThrTyr525530535CCATATTACAATCAAACGTTAACCTACACACGATATATAACTTCGGAC1926ProTyrTyrAsnGlnThrLeuThrTyrThrArgTyrIleThrSerAsp540545550CTTGCAATAGACGCGGCCCACTTATTCGGTACCGACCGCTTGTATGTG1974LeuAlaIleAspAlaAlaHisLeuPheGlyThrAspArgLeuTyrVal555560565GCCACGATATATTTCGACGCATTACAGCAGACTGTGACCGTGTATCTG2022AlaThrIleTyrPheAspAlaLeuGlnGlnThrValThrValTyrLeu570575580AACAATATTCGCACTGGCAGGGAAAACAACACCACCTTGTATTTTGAA2070AsnAsnIleArgThrGlyArgGluAsnAsnThrThrLeuTyrPheGlu585590595600ATGGAAATACATAATCCGTTTATTGGCACTTCTTCGAAATTTACTTTG2118MetGluIleHisAsnProPheIleGlyThrSerSerLysPheThrLeu605610615TTAGAGGATAACGTCACGATGCGCCAGGGATATTATAAATTTCCGGCG2166LeuGluAspAsnValThrMetArgGlnGlyTyrTyrLysPheProAla620625630GTCACCTTTAGCTCGATTCGTTTACACATAAGAGATGACAACAGACTA2214ValThrPheSerSerIleArgLeuHisIleArgAspAspAsnArgLeu635640645ATGCTGGTAGATAAATATTTACCAGCGGGCGACACGTTGCTGTTCATG2262MetLeuValAspLysTyrLeuProAlaGlyAspThrLeuLeuPheMet650655660TTTCCCAATCAAATCGTTGACAATAATATATTTCCCGATGGGTCAATA2310PheProAsnGlnIleValAspAsnAsnIlePheProAspGlySerIle665670675680TTGACCAGCACATACAACCGTATAAAAGAACAAGCTGCTTTCATCGAA2358LeuThrSerThrTyrAsnArgIleLysGluGlnAlaAlaPheIleGlu685690695AACCATAAACAGCTGTTGTACATTGAAAACGAATTACGCGACAGCATA2406AsnHisLysGlnLeuLeuTyrIleGluAsnGluLeuArgAspSerIle700705710TACTTGGCGTCACAATTTGTGAATAGTGATTCCAACGAATTTTTAAAG2454TyrLeuAlaSerGlnPheValAsnSerAspSerAsnGluPheLeuLys715720725TATTTTCCTGATTATTTTAGAGACCCTCATACGTTCTCATACCTGTTT2502TyrPheProAspTyrPheArgAspProHisThrPheSerTyrLeuPhe730735740CGGTTCAGAGGCTTGGGTGATTTCATGTTGCTAGAATTACAAATTGTG2550ArgPheArgGlyLeuGlyAspPheMetLeuLeuGluLeuGlnIleVal745750755760CCTATACTAAATTTGGCTTCGGTACGTGTAGGTAACCATCACAACGGG2598ProIleLeuAsnLeuAlaSerValArgValGlyAsnHisHisAsnGly765770775CCCCACTCGTATTTCAATACAACGTATCTATCGGTGGAAGTGCGCGAC2646ProHisSerTyrPheAsnThrThrTyrLeuSerValGluValArgAsp780785790ACAAGCGGTGGTGTTGTGTTTTCGTATTCACGCCTCGGTAACGAACCG2694ThrSerGlyGlyValValPheSerTyrSerArgLeuGlyAsnGluPro795800805ATGACACACGAACATCACAAATTCGAAGTGTTCAAAGATTATACAATA2742MetThrHisGluHisHisLysPheGluValPheLysAspTyrThrIle810815820CACTTGTTCATACAAGAACCTGGCCAAAGGTTACAATTAATAGTCAAC2790HisLeuPheIleGlnGluProGlyGlnArgLeuGlnLeuIleValAsn825830835840AAAACACTCGACACGGCGCTGCCCAACTCTCAAAACATTTACGCTCGC2838LysThrLeuAspThrAlaLeuProAsnSerGlnAsnIleTyrAlaArg845850855CTCACGGCCACGCAATTAGTAGTGGGAGAACAGAGCATTATCATTAGC2886LeuThrAlaThrGlnLeuValValGlyGluGlnSerIleIleIleSer860865870GACGATAACGACTTTGTACCGCCACCACCACGCGTTAATTGTGGCGAC2934AspAspAsnAspPheValProProProProArgValAsnCysGlyAsp875880885CAGCAGATAAGAGTAGTGGAAACTTTAAAAATGATAGCGTTC2976GlnGlnIleArgValValGluThrLeuLysMetIleAlaPhe890895900TAGAAATTTTTTAACAAAACACAAAGTGAATTGCAGTCGCTTGTTATCTTTGGCCACGGT3036ATGGCGCGCGCTTCGTATTATGTGCTACTACTATCCTTGGTGGTGTTATCGGTTAATGGA3096TATTCGTTTTATTCGTCCATCGAAGCCCTACTTTTGAACGATCGCACACAAATCTGCATT3156GGCGATTGTTACGAGCGCAACGGTCAACAT3186(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 902 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetSerTyrAsnValIleValProThrThrValLeuProProTrpLeu151015ArgIleGlyGlnAsnTrpIlePheAlaArgHisArgArgThrGluVal202530GlyValValLeuProAlaAsnThrLysPheArgValArgAlaAspPhe354045AlaLysTrpGlyIleThrArgProValIleValArgLeuLeuAsnAsn505560AsnArgAsnThrGluArgGluIleAsnLeuThrAsnAspGlnTrpIle65707580GluMetGluHisGluHisGluCysValProPheValAspTrpProVal859095GlyGluLysAsnThrMetAlaGluValHisPheGluIleAspGlyPro100105110HisIleProLeuProValTyrValPheAsnThrArgProValGluAsn115120125PheLysSerGluTyrArgGlnSerSerSerGlyTyrCysPheLeuTyr130135140LeuAspLeuValCysIleLeuValProProAlaSerLysAsnValLeu145150155160LeuAspThrAspLeuPheGluLeuHisGlnPheTyrAsnGluIleIle165170175AsnTyrTyrAspAspLeuCysGlyLeuValGluAspProTyrAlaAsp180185190ThrValAspSerAsnLeuProAsnLysAlaAlaPheValLysAlaAsp195200205GlyGlyGlyProGlyGlyAlaTyrTyrGlyAlaPheTrpThrAlaPro210215220AlaSerThrAsnLeuGlyGluTyrLeuArgValSerProThrAsnTrp225230235240MetValIleHisGluLeuGlyHisAlaTyrAspPheValPheThrVal245250255AsnThrArgLeuIleGluIleTrpAsnAsnSerPheCysAspArgIle260265270GlnTyrThrTrpMetAsnLysThrLysArgGlnGlnLeuAlaArgIle275280285TyrGluAsnGlnArgProGlnLysGluAlaAlaIleGlnAlaLeuIle290295300AspAsnAsnValProPheAspAsnTrpAspPhePheGluLysLeuSer305310315320IlePheAlaTrpLeuTyrAsnProGlnArgGlyLeuAspThrLeuArg325330335AsnIleAsnHisSerTyrArgLeuHisAlaAlaArgAsnProValThr340345350ProTyrProGlnIleTrpAlaTrpLeuMetSerCysGlyTyrAspAsn355360365PheTrpLeuTyrPheAsnArgIleGlyLeuTyrProAlaAspPheTyr370375380IleAsnGluHisAsnLysValValHisPheAsnLeuHisMetArgAla385390395400LeuAlaLeuGlyGlnSerValArgTyrProIleLysTyrIleIleThr405410415AspPheAspLeuLeuGlnLysAsnTyrAspIleLysGlnTyrLeuGlu420425430SerAsnPheAspLeuValIleProGluGluLeuArgGlnThrAspLeu435440445ValAlaAspValArgValValCysValIleAspAspProSerGlnIle450455460IleGlyGluProPheSerLeuTyrAspGlyAsnGluArgValPheGlu465470475480SerThrValAlaThrAspGlyAsnMetTyrLeuValGlyValGlyPro485490495GlyValTyrThrLeuArgAlaProArgGlyLysAspLysArgTyrLys500505510LeuHisLeuAlaHisSerProAsnGluProValHisProAlaAsnAsp515520525HisMetTyrLeuLeuValThrTyrProTyrTyrAsnGlnThrLeuThr530535540TyrThrArgTyrIleThrSerAspLeuAlaIleAspAlaAlaHisLeu545550555560PheGlyThrAspArgLeuTyrValAlaThrIleTyrPheAspAlaLeu565570575GlnGlnThrValThrValTyrLeuAsnAsnIleArgThrGlyArgGlu580585590AsnAsnThrThrLeuTyrPheGluMetGluIleHisAsnProPheIle595600605GlyThrSerSerLysPheThrLeuLeuGluAspAsnValThrMetArg610615620GlnGlyTyrTyrLysPheProAlaValThrPheSerSerIleArgLeu625630635640HisIleArgAspAspAsnArgLeuMetLeuValAspLysTyrLeuPro645650655AlaGlyAspThrLeuLeuPheMetPheProAsnGlnIleValAspAsn660665670AsnIlePheProAspGlySerIleLeuThrSerThrTyrAsnArgIle675680685LysGluGlnAlaAlaPheIleGluAsnHisLysGlnLeuLeuTyrIle690695700GluAsnGluLeuArgAspSerIleTyrLeuAlaSerGlnPheValAsn705710715720SerAspSerAsnGluPheLeuLysTyrPheProAspTyrPheArgAsp725730735ProHisThrPheSerTyrLeuPheArgPheArgGlyLeuGlyAspPhe740745750MetLeuLeuGluLeuGlnIleValProIleLeuAsnLeuAlaSerVal755760765ArgValGlyAsnHisHisAsnGlyProHisSerTyrPheAsnThrThr770775780TyrLeuSerValGluValArgAspThrSerGlyGlyValValPheSer785790795800TyrSerArgLeuGlyAsnGluProMetThrHisGluHisHisLysPhe805810815GluValPheLysAspTyrThrIleHisLeuPheIleGlnGluProGly820825830GlnArgLeuGlnLeuIleValAsnLysThrLeuAspThrAlaLeuPro835840845AsnSerGlnAsnIleTyrAlaArgLeuThrAlaThrGlnLeuValVal850855860GlyGluGlnSerIleIleIleSerAspAspAsnAspPheValProPro865870875880ProProArgValAsnCysGlyAspGlnGlnIleArgValValGluThr885890895LeuLysMetIleAlaPhe900__________________________________________________________________________

Number	Name	Date
4904645	Puritch et al.	Feb 1990
4973667	Granados	Nov 1990
5011685	Granados	Apr 1991
5475090	Granados et al.	Dec 1995

DNA sequence coding for enhancin polypeptide which enhances virus infection of host insects

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

US Referenced Citations (4)

Non-Patent Literature Citations (13)

Entry
Hoshimoto et al, 1991, J. Gen. Virology, v. 72 pp. 2645-2651.
Roelvink, P.W. et al, 1995, Characterization of the Helicoverpa armigera and Pseudaletia unipuncta granulovirus enhancing genes, Jnl. Of Gen. Virology, 76: 2693-2705.
Hamm, J.J., 1982, Extension of the Host Range for a Granulosis Virus from Heliothis armiger from South Africa, Environmental Entomology, vol. II, No. 1, pp. 159-160.
Derksen, A.C. et al, 1988, Alteration of a Lepidopteran Peritrophic Membrane by Baculoviruses and Enhancement of Viral Infectivity, Virology, 167:242-250.
Tanada, Y., et al, 1975, Enzyme synergistic for insect viruses, Nature, Nol. 254:328-329.
Tanada, Y, et al, 1985, A Synopsis of Studies on the Synergistic Property of an Insect Baculovirus: A Tribute to Edward A. Steinhaus, Jnl. Of Invert. Pathology, 45: 125-138.
Tanada, Y., et al, 1959, Synergism between Two Viruses of the Armyworm, Pseudalertia unipuncta (Haworth) (Lepidoptera, Noctuidae).sup.1, Jnl. Of Insect Pathology 1:215-231.
Blissard, G.W. et al, 1990, Baculovirus Diversity and Molecular Biology, Annu. Rev. Entomo., 35:125-125.
Wood, H.A. et al, 1991, Genetically Engineered Baculoviruses as Agents For Pest Control, Annu. Rev. Microbiol., 45:69-87.
Corsaro, B. Et al, Baculovirus Enhancing Proteins as Determinants of Viral Pathogenesis, Paraasites and Pathogens of Insects, vol. 2, pp. 127-145.
Miller. L.K. 1988, Baculoviruses as Gene Expression Vectors, Ann. Rev. Microbiol. 42: 177-99.
Westwood, J. Et al, 1993, Analyses of Alternative Poly (A) Signals for Use in Baculovirus Expression Vectors, Virology 195, 90-99.
Gallo, L.G. et al, 1994, In Vivo Enhancement of Baculovirus Infection by the Viral Enhancing Factor of a Granulosis Virus of the Cabbage Looper, Trichoplusis ni (Lepidopters: Noctuidae), Jnl. Of Invertebrate Pathology 58, 203-210.