DNA sequences and secreted proteins encoded thereby

FIELD OF THE INVENTION
The present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utilities for these polynucleotides and proteins.
BACKGROUND OF THE INVENTION
Technology aimed at the discovery of protein factors (including e.g., cytokines, such as lymphokines, interferons, CSFs and interleukins) has matured rapidly over the past decade. The now routine hybridization cloning and expression cloning techniques clone novel polynucleotides "directly" in the sense that they rely on information directly related to the discovered factor (i.e., partial DNA/amino acid sequence of the factor in the case of hybridization cloning; activity of the factor in the case of expression cloning). More recent "indirect" cloning techniques such as signal sequence cloning, which isolates DNA sequences based on the presence of a now well-recognized secretory leader sequence motif, as well as various PCR-based or low stringency hybridization cloning techniques, have advanced the state of the art by making available large numbers of DNA/amino acid sequences for factors that are known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to these factors and the polynucleotides encoding them that the present invention is directed.
SUMMARY
In one embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:1 from nucleotide 38 to nucleotide 1447;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:1 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:2;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:2 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:1; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In another embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:3 from nucleotide 52 to nucleotide 2034;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:3 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:4;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:4 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:4; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In another embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:5 from nucleotide 76 to nucleotide 474;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:5 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:6;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:6 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:5; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In another embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:7 from nucleotide 67 to nucleotide 348;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:7 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:8;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:8 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:7; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In another embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:9 from nucleotide 75 to nucleotide 356;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:9 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:10;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:10 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:9; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In another embodiment, the present invention provides a composition comprising an isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO:11 from nucleotide 86 to nucleotide 54412;
(b) a polynucleotide comprising a fragment of the nucleotide sequence of SEQ ID NO:11 encoding a protein having biological activity;
(c) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO:12;
(d) a polynucleotide encoding a protein comprising a fragment of the amino acid sequence of SEQ ID NO:12 having biological activity;
(e) a polynucleotide which is an allelic variant of SEQ ID NO:11; and
(f) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(e).
In certain preferred embodiments, the polynucleotide is operably linked to an expression control sequence. The invention also provides a host cell, including bacterial, yeast, insect and mammalian cells, transformed with such polynucleotide compositions.
Processes are also provided for producing a protein, which comprise:
(a) growing a culture of the host cell transformed with such polynucleotide compositions in a suitable culture medium; and
(b) purifying the protein from the culture.
The protein produced according to such methods is also provided by the present invention.
Compositions comprising a protein biological activity are also disclosed. In preferred embodiments the protein comprises an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO:2;
(b) fragments of the amino acid sequence of SEQ ID NO:2;
(c) the amino acid sequence of SEQ ID NO:4;
(d) fragments of the amino acid sequence of SEQ ID NO:4;
(e) the amino acid sequence of SEQ ID NO:6;
(f) fragments of the amino acid sequence of SEQ ID NO:6;
(g) the amino acid sequence of SEQ ID NO:8;
(h) fragments of the amino acid sequence of SEQ ID NO:8;
(i) the amino acid sequence of SEQ ID NO:12; and
(j) fragments of the amino acid sequence of SEQ ID NO:12;
the protein being substantially free from other mammalian proteins.
Such compositions may further comprise a pharmaceutically acceptable carrier. Compositions comprising an antibody which specifically reacts with such protein are also provided by the present invention.
Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.

BRIEF DESCRIPTION OF FIGURES
FIG. 1 is an autoradiograph evidencing the expression of clone J5 in COS cells (indicated by arrows). J5 is processed into multiple bands, with the major band at approximately 58 kD.
FIG. 2 is an autoradiograph evidencing the expression of clone L105 in COS cells (indicated by arrows).
FIG. 3 is an autoradiograph evidencing the expression of clone H174 in COS cells (indicated by arrows).
FIG. 4 is an autoradiograph evidencing the expression of clone B18 in COS cells (indicated by arrows).

DETAILED DESCRIPTION
ISOLATED PROTEINS AND POLYNUCLEOTIDES
The sequence of a polynucleotide encoding one protein of the present invention is set forth in SEQ ID NO:1, with the coding region extending from nucleotides 38 to 1447. This polynucleotide has been identified as "clone J5" The amino acid sequence of the protein encoded by clone J5 is set forth in SEQ ID NO:2. Clone J5 was deposited with the American Type Culture Collection on Aug. 11, 1995 and given the accession number ATCC 69885. SEQ ID NO:1 represents a spliced combination of sequence obtained from an isolated clone identified as "J5.sub.-- 3.sub.-- fl", with additional 5' sequence obtained from a second double stranded clone. Clone J5 was isolated from a human activated peripheral blood mononuclear cell (PBMC) library using a trap which selects for nucleotides encoding secreted proteins; therefore, clone J5 does encode a secreted factor. J5 encodes a novel protein; BLASTN/BLASTX or FASTA searches revealed no exact sequence matches. However, a BLASTX search revealed homology between the J5 protein (in the approximate region of amino acids 62-129 of SEQ ID NO:2), epididymal apical proteins (including without limitation, epididymal apical protein I-precursor (Macaca fascicularis) (accession X66139)) and several snake venom haemorrhagic peptides (disintegrins) (including without limitation those assigned accession U01235-1237, X68251, and M89784). Analysis of the full-length J5 sequences revealed that the disintegrin domain was incomplete and that this clone did not contain an EGF-domain, as with some of the other disintegrin family members. J5 does contain a conserved metallo-proteinase domain. Based upon these homologies, J5 and these homologous proteins are expected to share at least some activities.
The sequence of a polynucleotide encoding another protein of the present invention is set forth in SEQ ID NO:3, with the coding region extending from nucleotides 52 to 2034. This polynucleotide has been identified as "clone J422" The amino acid sequence of the protein encoded by clone J422 is set forth in SEQ ID NO:4. Clone J422 was deposited with the American Type Culture Collection on Aug. 11, 1995 and given the accession number ATCC 69884 SEQ ID NO:3 represents a spliced combination of sequence obtained from an isolated clone identified as "J422.sub.-- fl", with additional 5' sequence obtained from a second double stranded clone. Clone J422 was isolated from a human activated peripheral blood mononuclear cell (PBMC) library using a trap which selects for nucleotides encoding secreted proteins; therefore, clone J422 does encode a secreted factor. J422 encodes a novel protein; BLASTN/BLASTX or FASTA searches revealed no exact sequence matches. However, a FASTA search revealed homology between the J422 protein (in the approximate region of amino acids 34-156 of SEQ ID NO:4) and a number of Drosophila leucine-rich repeat (LRR) proteins. Analysis of the full-length J422 sequences revealed that the conserved EGF-domain found in a number of LRR family members was not present in J422. Based upon these homologies, J422 and these homologous proteins are expected to share at least some activities.
The sequence of a polynucleotide encoding another protein of the present invention is set forth in SEQ ID NO:5, with the coding region extending from nucleotides 76 to 474. This polynucleotide has been identified as "clone L105" The amino acid sequence of the protein encoded by clone L105 is set forth in SEQ ID NO:6. Clone L105 was deposited with the American Type Culture Collection on Aug. 11, 1995 and given the accession number ATCC 69883 Clone L105 was isolated from a murine adult thymus library using a trap which selects for nucleotides encoding secreted proteins; therefore, clone L105 does encode a secreted factor. L105 encodes a novel protein; BLASTN/BLASTX or FASTA searches revealed no exact sequence matches. However, a BLASTX search revealed homology between the L105 protein (particularly in the approximate region of amino acids 73-91 of SEQ ID NO:6), various monocyte and other chemoattractant proteins (including without limitation those assigned accession M577441, X71087, X72308, X14768 and M24545) and a chicken (Gallus gallus) cytokine (accession L34553). Based upon these homologies, L105 and these homologous proteins are expected to share at least some activities.
The sequence of polynucleotides encoding another protein of the present invention is set forth in SEQ ID NO:7 and SEQ ID NO:9, with the coding regions extending from nucleotides 67 to 348 and nucleotides 75 to 356, respectively. These polynucleotides have been identified as "clone H174-10" and "clone H174-43", respectively (collectively referred to herein as "H174"). The amino acid sequence of the protein encoded by clones H174 is set forth in SEQ ID NO:8 and SEQ ID NO:10. Clone H174 was deposited with the American Type Culture Collection on Aug. 11, 1995 and given the accession number ATCC 69882 Clones H174 were isolated from a human activated peripheral blood mononuclear cell (PBMC) library using a trap which selects for nucleotides encoding secreted proteins; therefore, H174 does encode a secreted factor. H174 encodes a novel protein; BLASTN/BLASTX or FASTA searches revealed no exact sequence matches. However, a BLASTX search revealed homology between the H174 protein, human IP-10 (accession M33266) and murine CRG-2 (accession M86820) (species homologs). Based upon these homologies, H174 and these homologous proteins are expected to share at least some activities.
The sequence of a polynucleotide encoding another protein of the present invention is set forth in SEQ ID NO:11, with the coding region extending from nucleotides 86 to 544. This polynucleotide has been identified as "B18" The amino acid sequence of the protein encoded by clone B18 is set forth in SEQ ID NO:12. Clone B18 was deposited with the American Type Culture Collection on Jul. 6, 1995 and assigned accession number ATCC 69868. Clone B18 was isolated from a human activated peripheral blood mononuclear cell (PBMC) library using a trap which selects for nucleotides encoding secreted proteins; therefore, clone B18 does encode a secreted factor. B18 encodes a novel protein; BLASTN/BLASTX or FASTA searches revealed no exact sequence matches. However, a BLASTX search revealed that the region from amino acid 29 to amino acid 163 of B18 (SEQ ID NO:12) shows marked homology to portions of murine CTLA-8 (amino acids 18 to 150, accession L13839) and herpesvirus Saimiri ORF13 ("herpes CTLA-8") (amino acids 19 to 151, accession X64346). Based upon these homologies, B18 is believed to be the human homolog of murine and herpes CTLA-8 (i.e., "human CTLA-8"). B 18 may demonstrate proinflammatory activity, particularly in development of T-cell dependent immune responses. B18 is also expected to possess other activities specified herein.
Clones J5, L105, H174 and B18 were each transfected into COS cells labelled with .sup.35 S-methionine and protein was expressed. Autoradiographs evidencing expression of the proteins in conditioned media are presented in FIGS. 1, 2, 3 and 4, respectively. The bands of protein expressed from the relevant clone are indicated by arrows.
Polynucleotides hybridizing to the polynucleotides of the present invention under stringent conditions and highly stringent conditions are also part of the present invention. As used herein, "highly stringent conditions" include, for example, at least about 0.2.times. SSC at 65.degree. C.; and "stringent conditions" include, for example, at least about 4.times. SSC at 65.degree. C. or at least about 50% formamide, 4.times. SSC at 42.degree. C. Allelic variants of the polynucleotides of the present invention are also encompassed by the invention.
Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H. U. Saragovi, et al., Bio/Technology 10, 773-778 (1992) and in R. S. McDowell, et al., J. Amer. Chem. Soc. 114, 9245-9253 (1992), both of which are incorporated herein by reference. Such fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valency of protein binding sites. For example, fragments of the protein may be fused through "linker" sequences to the Fc portion of an immunoglobulin. For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule. Other immunoglobulin isotypes may also be used to generate such fusions. For example, a protein--IgM fusion would generate a decavalent form of the protein of the invention.
The isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the protein recombinantly. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein "operably linked" means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of the protein. Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK or Jurkat cells.
Alternatively, it may be possible to produce the protein in lower eukaryotes such as yeast or in prokaryotes such as bacteria. Potentially suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins. Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.
The protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, Calif., U.S.A. (the MaxBac.RTM. kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incorporated herein by reference. As used herein, an insect cell capable of expressing a polynucleotide of the present invention is "transformed."
The protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein. The resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the protein may also include an affinity column containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl.RTM. or Cibacrom blue 3GA Sepharose.RTM.; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.
Alternatively, the protein of the invention may also be expressed in a form which will facilitate purification. For example, it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New England BioLab (Beverly, Mass.), Pharmacia (Piscataway, N.J.) and InVitrogen, respectively. The protein can also be tagged with an epitope and subsequently purified by using a specific antibody directed to such epitope. One such epitope ("Flag") is commercially available from Kodak (New Haven, Conn.).
Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein. The protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein."
The protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.
The protein may also be produced by known conventional chemical synthesis. Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art. The synthetically-constructed protein sequences, by virtue of sharing primary, secondary or tertiary structural and/or conformational characteristics with proteins may possess biological properties in common therewith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.
The proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally provided or deliberately engineered. For example, modifications in the peptide or DNA sequences can be made by those skilled in the art using known techniques. Modifications of interest in the protein sequences may include the replacement, insertion or deletion of a selected amino acid residue in the coding sequence. For example, one or more of the cysteine residues may be deleted or replaced with another amino acid to alter the conformation of the molecule. Mutagenic techniques for such replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Pat. No. 4,518,584).
Other fragments and derivatives of the sequences of proteins which would be expected to retain protein activity in whole or in part and may thus be useful for screening or other immunological methodologies may also be easily made by those skilled in the art given the disclosures herein. Such modifications are believed to be encompassed by the present invention.
USES AND BIOLOGICAL ACTIVITY
The polynucleotides of the present invention and the proteins encoded thereby are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
RESEARCH TOOL UTILITY
The polynucleotides provided by the present invention can be used by the research community for various purposes. The polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers (when labeled) to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out" known sequences in the process of discovering other novel polynucleotides; to raise anti-protein antibodies using DNA immunization techniques; and as an antigen to raise anti-DNA antibodies or elicit another immune response. Where the polynucleotide encodes a protein which binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the polynucleotide can also be used in interaction trap assays (such as, for example, that described in Gyuris et al., Cell 75:791-803 (1993)) to identify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction.
The proteins provided by the present invention can similarly be used to raise antibodies or to elicit another immune response; as a reagent (including the labelled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate correlative receptors or ligands. Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.
Any or all of these "research tool" utilities are capable of being developed into reagent grade or kit format for commercialization as "research products."
CYTOKINE AND CELL PROLIFERATION/DIFFERENTIATION ACTIVITY
A protein of the present invention may exhibit cytokine, cell proliferation (either inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may induce production of other cytokines in certain cell populations. Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine activity. The activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, 32D, DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G, M+(preB M+), 2E8, RB5, DA1,123, T1165, HT2, CTLL2, TF-1, Mo7e and CMK.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986; Bertagnolli et al., J. Immunol. 145:1706-1712, 1990; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783, 1992; Bowman et al., J. Immunol. 152: 1756-1761, 1994.
Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in: Polyclonal T cell stimulation, Kruisbeek, A. M. and Shevach, E. M. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons, Toronto. 1994; and Measurement of mouse and human Interferon .gamma., Schreiber, R. D. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons, Toronto. 1994.
Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L. S. and Lipsky, P. E. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.3.1-6.3.12, John Wiley and Sons, Toronto. 1991; deVries et al., J. Exp. Med. 173:1205-1211, 1991; Moreau et al., Nature 336:690-692, 1988; Greenberger et al., Proc. Natl. Acad. Sci. U.S.A. 80:2931-2938, 1983; Measurement of mouse and human interleukin 6--Nordan, R. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons, Toronto. 1991; Smith et al., Proc. Natl. Acad. Sci. U.S.A. 83:1857-1861, 1986; Measurement of human Interleukin 11--Bennett, F., Giannotti, J., Clark, S. C. and Turner, K. J. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.15.1 John Wiley and Sons, Toronto. 1991; Measurement of mouse and human Interleukin 9--Ciarletta, A., Giannotti, J., Clark, S. C. and Turner, K. J. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 1991.
Assays for T-cell clone responses to antigens (which will identify, among others, proteins that affect APC-T cell interactions as well as direct T-cell effects by measuring proliferation and cytokine production) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach, W Strober Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans); Weinberger et al., Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger et al., Eur. J. Immun. 11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988.
IMMUNE STIMULATING/SUPPRESSING ACTIVITY
A protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein. A protein may be useful in the treatment of various immune deficiencies and disorders (including severe combined immunodeficiency (SCID)), e.g. , in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cytolytic activity of NK cells and other cell populations. These immune deficiencies may be genetic or be caused by viral (e.g., HIV) as well as bacterial or fungal infections, or may result from autoimmune disorders. More specifically, infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpes viruses, mycobacteria, leshmania, malaria and various fungal infections such as candida. Of course, in this regard, a protein of the present invention may also be useful where a boost to the immune system generally would be indicated, i.e., in the treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present invention include, for example, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease. Such a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma or other respiratory problems. Other conditions, in which immune suppression is desired (including, for example, asthma and related respiratory conditions), may also be treatable using a protein of the present invention.
A protein of the present invention may also suppress chronic or acute inflammation, such as, for example, that associated with infection (such as septic shock or systemic inflammatory response syndrome (SIRS)), inflammatory bowel disease, Crohn's disease or resulting from over production of cytokines such as TNF or IL-1 (such as the effect demonstrated by IL-11).
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al., Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al., J. Immunol. 128: 1968-1974, 1982; Handa et al., J. Immunol. 135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Herrmann et al., Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974, 1982; Handa et al., J. Immunol. 135:1564-1572, 1985; Takai et al., J. Immunol. 137:3494-3500, 1986; Bowmanet al., J. Virology 61:1992-1998; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Brown et al., J. Immunol. 153:3079-3092, 1994.
Assays for T-cell-dependent immunoglobulin responses and isotype switching (which will identify, among others, proteins that modulate T-cell dependent antibody responses and that affect Th1/Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J. J. and Brunswick, M. In Current Protocols in Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto. 1994.
Mixed lymphocyte reaction (MLR) assays (which will identify, among others, proteins that generate predominantly Th1 and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., J. Immunol. 149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins expressed by denritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al., J. Immunol. 134:536-544, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079, 1995; Porgador et al., Journal of Experimental Medicine 182:255-260, 1995; Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965, 1994; Macatonia et al., Journal of Experimental Medicine 169: 1255-1264, 1989; Bhardwaj et al., Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al., Journal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al., Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research 53: 1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991; Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993; Gorczyca et al., International Journal of Oncology 1:639-648, 1992.
Assays for proteins that influence early steps of T-cell commitment and development include, without limitation, those described in: Antica et al., Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
HEMATOPOIESIS REGULATING ACTIVITY
A protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myclo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentarily to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above-mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria), as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in-vivo or ex-vivo (i.e. in conjunction with bone marrow transplantation) as normal cells or genetically manipulated for gene therapy.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for proliferation and differentiation of various hematopoietic lines are cited above.
Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embyronic differentiation hematopoiesis) include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81:2903-2915, 1993.
Assays for stem cell survival and differentiation (which will identify, among others, proteins that regulate lympho-hematopoiesis) include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M. G. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, N.Y. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992; Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, I. K. and Briddell, R. A. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 23-39, Wiley-Liss, Inc., New York, N.Y. 1994; Neben et al., Experimental Hematology 22:353-359, 1994; Cobblestone area forming cell assay, Ploemacher, R. E. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc., New York, N.Y. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, N.Y. 1994; Long term culture initiating cell assay, Sutherland, H. J. In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, N.Y. 1994.
TISSUE GENERATION/REGENERATION ACTIVITY
A protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair, and in the treatment of burns, incisions and ulcers.
A protein of the present invention, which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals. Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
A protein of this invention may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells. A protein of the invention may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes.
Another category of tissue regeneration activity that may be attributable to the protein of the present invention is tendon/ligament formation. A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair. The compositions of the invention may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
The protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions which may be treated in accordance with the present invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.
It is expected that a protein of the present invention may also exhibit activity for generation of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition of fibrotic scarring to allow normal tissue to regenerate.
A protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. WO95/16035 (bone, cartilage, tendon); International Patent Publication No. W095/05846 (nerve, neuronal); International Patent Publication No. WO91/07491 (skin, endothelium ).
ACTIVIN/INHIBIN ACTIVITY
A protein of the present invention may also exhibit activin- or inhibin-related activities. Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FSH). Thus, a protein of the present invention, alone or in heterodimers with a member of the inhibin .alpha. family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these mammals. Alternatively, the protein of the invention, as a homodimer or as a heterodimer with other protein subunits of the inhibin-.beta.group, may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, U.S. Pat. No. 4,798,885. A protein of the invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for activin/inhibin activity include, without limitation, those described in: Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-782, 1986; Vale et al., Nature 321:776-779, 1986; Mason et al., Nature 318:659-663, 1985; Forage et al., Proc. Natl. Acad. Sci. USA 83:3091-3095, 1986.
CHEMOTACTIC/CHEMOKINETIC ACTIVITY
A protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, neutrophils, T-cells, mast cells, eosinophils and/or endothelial cells. Chemotactic and chemokinetic proteins can be used to mobilized or attract a desired cell population to a desired site of action. Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population if it can stimulate, directly or indirectly, the directed orientation or movement of such cell population. Preferably, the protein or peptide has the ability to directly stimulate directed movement of cells. Whether a particular protein has chemotactic activity for a population of cells can be readily determined by employing such protein or peptide in any known assay for cell chemotaxis.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assays for chemotactic activity (which will identify proteins that induce or prevent chemotaxis) consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population. Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 6.12, Measurement of alpha and beta Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest. 95:1370-1376, 1995; Lind et al. APMIS 103: 140-146, 1995; Muller et al Eur. J. Immunol. 25: 1744-1748; Gruber et al. J. of Immunol. 152:5860-5867, 1994; Johnston et al. J. of Immunol. 153: 1762-1768, 1994.
HEMOSTATIC AND THROMBOLYTIC ACTIVITY
A protein of the invention may also exhibit hemostatic or thrombolytic activity. As a result, such a protein is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes. A protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction or stroke).
The activity of a protein of the invention may, among other means, be measured by the following methods:
Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res. 45:413-419, 1987; Humphrey et al., Fibrinolysis 5:71-79 (1991); Schaub, Prostaglandins 35:467-474, 1988.
RECEPTOR/LIGAND ACTIVITY
A protein of the present invention may also demonstrate activity as receptors, receptor ligands or inhibitors or agonists of receptor/ligand interactions. Examples of such receptors and ligands include, without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and development of cellular and humoral immune responses). Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. A protein of the present invention (including, without limitation, fragments of receptors and ligands) may themselves be useful as inhibitors of receptor/ligand interactions.
The activity of a protein of the invention may, among other means, be measured by the following methods:
Suitable assays for receptor-ligand activity include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-6868, 1987; Bierer et al., J. Exp. Med. 168:1145-1156, 1988; Rosenstein et al., J. Exp. Med. 169:149-160 1989; Stoltenborg et al., J. Immunol. Methods 175:59-68, 1994; Stitt et al., Cell 80:661-670, 1995.
OTHER ACTIVITIES
A protein of the invention may also exhibit one or more of the following additional activities or effects: killing infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, weight, hair color, eye color, skin or other tissue pigmentation, or organ size (such as, for example, breast augmentation or diminution); effecting the processing of dietary fat, protein or carbohydrate; effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects; promoting differentiation and growth of ebryonic stem cells in lineages other than hematopoietic lineages; and in the case of enzymes, correcting deficiencies of the enzyme and treating related diseases.
ADMINISTRATION AND DOSING
A protein of the present invention (from whatever source derived, including without limitation from recombinant and non-recombinant sources) may be used in a pharmaceutical composition when combined with a pharmaceutically acceptable carrier. Such a composition may also contain (in addition to protein and a carrier) diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration. The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IFN, TNF0, TNF1, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell factor, and erythropoietin. The pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with protein of the invention, or to minimize side effects. Conversely, protein of the present invention may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
A protein of the present invention may be active in multimers (e.g., heterodimers or homodimers) or complexes with itself or other proteins. As a result, pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.
The pharmaceutical composition of the invention may be in the form of a complex of the protein(s) of present invention along with protein or peptide antigens. The protein and/or peptide antigen will deliver a stimulatory signal to both B and T lymphocytes. B lymphocytes will respond to antigen through their surface immunoglobulin receptor. T lymphocytes will respond to antigen through the T cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigen(s) to T lymphocytes. The antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly signal T cells. Alternatively antibodies able to bind surface immunolgobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention.
The pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Pat. No. 4,235,871; U.S. Pat. No. 4,501,728; U.S. Pat. No. 4,837,028; and U.S. Pat. No. 4,737,323, all of which are incorporated herein by reference.
As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
In practicing the method of treatment or use of the present invention, a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated. Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, protein of the present invention may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the present invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant. The tablet, capsule, and powder contain from about 5 to 95% protein of the present invention, and preferably from about 25 to 90% protein of the present invention. When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of protein of the present invention, and preferably from about 1 to 50% protein of the present invention.
When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such parenterally acceptable protein solutions, having due regard to pH, isotonicity, stability, and the like, is within the skill in the art. A preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to protein of the present invention, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
The amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.01 .mu.g to about 100 mg (preferably about 0.1 .mu.g to about 10 mg, more preferably about 0.1 .mu.g to about 1 mg) of protein of the present invention per kg body weight.
The duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the protein of the present invention will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
Protein of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen. The peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Methods for synthesizing such peptides are known in the art, for example, as in R. P. Merrifield, J. Amer. Chem. Soc. 85, 2149-2154 (1963); J. L. Krstenansky, et al., FEBS Lett. 211, 10 (1987). Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein. Neutralizing monoclonal antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved. In the case of cancerous cells or leukemic cells, neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein.
For compositions of the present invention which are useful for bone, cartilage, tendon or ligament regeneration, the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than a protein of the invention which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention. Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein- containing composition to the site of bone and/or cartilage damage, providing a structure for the developing bone and cartilage and optimally capable of being resorbed into the body. Such matrices may be formed of materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the compositions will define the appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
Presently preferred is a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 150 to 800 microns. In some applications, it will be useful to utilize a sequestering agent, such as carboxymethyl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl- methylcellulose, and carboxymethylcellulose, the most preferred being cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and poly(vinyl alcohol). The amount of sequestering agent useful herein is 0.5-20 wt%, preferably 1-10 wt% based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.
In further compositions, proteins of the invention may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-.alpha. and TGF-.beta.), and insulin-like growth factor (IGF).
The therapeutic compositions are also presently valuable for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to humans, are desired patients for such treatment with proteins of the present invention.
The dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone growth and/or repair, for example, X-rays, histomorphometric determinations and tetracycline labeling.
Polynucleotides of the present invention can also be used for gene therapy. Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA).
Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells. Treated cells can then be introduced in vivo for therapeutic purposes.
Patent and literature references cited herein are incorporated by reference as if fully set forth.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 12(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2209 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 38..1447(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GAGAAGATAAAACTGGACACTGGGGAGACACAACTTCATGCTGCGTGGGATCTCC55MetLeuArgGlyIleSer15CAGCTACCTGCAGTGGCCACCATGTCTTGGGTCCTGCTGCCTGTACTT103GlnLeuProAlaValAlaThrMetSerTrpValLeuLeuProValLeu101520TGGCTCATTGTTCAAACTCAAGCAATAGCCATAAAGCAAACACCTGAA151TrpLeuIleValGlnThrGlnAlaIleAlaIleLysGlnThrProGlu253035TTAACGCTCCATGAAATAGTTTGTCCTAAAAAACTTCACATTTTACAC199LeuThrLeuHisGluIleValCysProLysLysLeuHisIleLeuHis404550AAAAGAGAGATCAAGAACAACCAGACAGAAAAGCATGGCAAAGAGGAA247LysArgGluIleLysAsnAsnGlnThrGluLysHisGlyLysGluGlu55606570AGGTATGAACCTGAAGTTCAATATCAGATGATCTTAAATGGAGAAGAA295ArgTyrGluProGluValGlnTyrGlnMetIleLeuAsnGlyGluGlu758085ATCATTCTCTCCCTACAAAAAACCAAGCACCTCCTGGGGCCAGACTAC343IleIleLeuSerLeuGlnLysThrLysHisLeuLeuGlyProAspTyr9095100ACTGAAACATTGTACTCACCCAGAGGAGAGGAAATTACCACGAAACCT391ThrGluThrLeuTyrSerProArgGlyGluGluIleThrThrLysPro105110115GAGAACATGGAACACTGTTACTATAAAGGAAACATCCTAAATGAAAAG439GluAsnMetGluHisCysTyrTyrLysGlyAsnIleLeuAsnGluLys120125130AATTCTGTTGCCAGCATCAGTACTTGTGACGGGTTGAGAGGATACTTC487AsnSerValAlaSerIleSerThrCysAspGlyLeuArgGlyTyrPhe135140145150ACACATCATCACCAAAGATACCAGATAAAACCTCTGAAAAGCACAGAC535ThrHisHisHisGlnArgTyrGlnIleLysProLeuLysSerThrAsp155160165GAGAAAGAACATGCCGTCTTTACATCTAACCAGGAGGAACAAGACCCA583GluLysGluHisAlaValPheThrSerAsnGlnGluGluGlnAspPro170175180GCTAACCACACATGTGGTGTGAAGAGCACTGACGGGAAACAAGGCCCA631AlaAsnHisThrCysGlyValLysSerThrAspGlyLysGlnGlyPro185190195ATTCGAATCTCTAGATCACTCAAAAGCCCAGAGAAAGAAGACTTTCTT679IleArgIleSerArgSerLeuLysSerProGluLysGluAspPheLeu200205210CGGGCACAGAAATACATTGATCTCTATTTGGTGCTGGATAATGCCTTT727ArgAlaGlnLysTyrIleAspLeuTyrLeuValLeuAspAsnAlaPhe215220225230TATAAGAACTATAATGAGAATCTAACTCTGATAAGAAGCTTTGTGTTT775TyrLysAsnTyrAsnGluAsnLeuThrLeuIleArgSerPheValPhe235240245GATGTGATGAACCTACTCAATGTGATATATAACACCATAGATGTTCAA823AspValMetAsnLeuLeuAsnValIleTyrAsnThrIleAspValGln250255260GTGGCCTTGGTAGGTATGGAAATCTGGTCTGATGGGGATAAGATAAAG871ValAlaLeuValGlyMetGluIleTrpSerAspGlyAspLysIleLys265270275GTGGTGCCCAGCGCAAGCACCACGTTTGACAACTTCCTGAGATGGCAC919ValValProSerAlaSerThrThrPheAspAsnPheLeuArgTrpHis280285290AGTTCTAACCTGGGGAAAAAGATCCACGACCATGCTCAGCTTCTCAGC967SerSerAsnLeuGlyLysLysIleHisAspHisAlaGlnLeuLeuSer295300305310GGGATTAGCTTCAACAATCGACGTGTGGGACTGGCAGCTTCAAATTCC1015GlyIleSerPheAsnAsnArgArgValGlyLeuAlaAlaSerAsnSer315320325TTGTGTTCCCCATCTTCGGTTGCTGTTATTGAGGCTAAAAAAAAGAAT1063LeuCysSerProSerSerValAlaValIleGluAlaLysLysLysAsn330335340AATGTGGCTCTTGTAGGAGTGATGTCACATGAGCTGGGCCATGTCCTT1111AsnValAlaLeuValGlyValMetSerHisGluLeuGlyHisValLeu345350355GGTATGCCTGATGTTCCATTCAACACCAAGTGTCCCTCTGGCAGTTGT1159GlyMetProAspValProPheAsnThrLysCysProSerGlySerCys360365370GTGATGAATCAGTATCTGAGTTCAAAATTCCCAAAGGATTTCAGTACA1207ValMetAsnGlnTyrLeuSerSerLysPheProLysAspPheSerThr375380385390TCTTGCCGTGCACATTTTGAAAGATACCTTTTATCTCAGAAACCAAAG1255SerCysArgAlaHisPheGluArgTyrLeuLeuSerGlnLysProLys395400405TGCCTGCTGCAAGCACCTATTCCTACAAATATAATGACAACACCAGTG1303CysLeuLeuGlnAlaProIleProThrAsnIleMetThrThrProVal410415420TGTGGGAACCACCTTCTAGAAGTGGGAGAAGACTGTGATTGTGGCTCT1351CysGlyAsnHisLeuLeuGluValGlyGluAspCysAspCysGlySer425430435CCTAAGGAGTGTACCAATCTCTGCTGTGAAGCCCTAACGTGTAAACTG1399ProLysGluCysThrAsnLeuCysCysGluAlaLeuThrCysLysLeu440445450AAGCCTGGAACTGATTGCGGAGGAGATGCTCCAAACCATACCACAGAG1447LysProGlyThrAspCysGlyGlyAspAlaProAsnHisThrThrGlu455460465470TGAATCCAAAAGTCTGCTTCACTGAGATGCTACCTTGCCAGGACAAGAACCAAGAACTCT1507AACTGTCCCAGGAATCTTGTGAATTTTCACCCATAATGGTCTTTCACTTGTCATTCTACT1567TTCTATATTGTTATCAGTCCAGGAAACAGGTAAACAGATGTAATTAGAGACATTGGCTCT1627TTGTTTAGGCCTAATCTTTCTTTTTACTTTTTTTTTTCTTTTTTCTTTTTTTTTAAAGAT1687CATGAATTTGTGACTTAGTTCTGCCCTTTGGAGAACAAAAGAAAGCAGTCTTCCATCAAA1747TCACCTTAAAATGCACGGCTAAACTATTCAGAGTTAACACTCCAGAATTGTTAAATTACA1807AGTACTATGCTTTAATGCTTCTTTCATCTTACTAGTATGGCCTATAAAAAAAATAATACC1867ACTTGATGGGTGAAGGCTTTGGCAATAGAAAGAAGAATAGAATTCAGGTTTTATGTTATT1927CCTCTGTGTTCACTTCGCCTTGCTCTTGAAAGTGCAGTATTTTTCTACATCATGTCGAGA1987ATGATTCAATGTAAATATTTTTCATTTTATCATGTATATCCTATACACACATCTCCTTCA2047TCATCATATATGAAGTTTATTTTGAGAAGTCTACATTGCTTACATTTTAATTGAGCCAGC2107AAAGAAGGCTTAATGATTTATTGAACCATAATGTCAATAAAAACACAACTTTTGAGGCAA2167AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2209(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 470 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetLeuArgGlyIleSerGlnLeuProAlaValAlaThrMetSerTrp151015ValLeuLeuProValLeuTrpLeuIleValGlnThrGlnAlaIleAla202530IleLysGlnThrProGluLeuThrLeuHisGluIleValCysProLys354045LysLeuHisIleLeuHisLysArgGluIleLysAsnAsnGlnThrGlu505560LysHisGlyLysGluGluArgTyrGluProGluValGlnTyrGlnMet65707580IleLeuAsnGlyGluGluIleIleLeuSerLeuGlnLysThrLysHis859095LeuLeuGlyProAspTyrThrGluThrLeuTyrSerProArgGlyGlu100105110GluIleThrThrLysProGluAsnMetGluHisCysTyrTyrLysGly115120125AsnIleLeuAsnGluLysAsnSerValAlaSerIleSerThrCysAsp130135140GlyLeuArgGlyTyrPheThrHisHisHisGlnArgTyrGlnIleLys145150155160ProLeuLysSerThrAspGluLysGluHisAlaValPheThrSerAsn165170175GlnGluGluGlnAspProAlaAsnHisThrCysGlyValLysSerThr180185190AspGlyLysGlnGlyProIleArgIleSerArgSerLeuLysSerPro195200205GluLysGluAspPheLeuArgAlaGlnLysTyrIleAspLeuTyrLeu210215220ValLeuAspAsnAlaPheTyrLysAsnTyrAsnGluAsnLeuThrLeu225230235240IleArgSerPheValPheAspValMetAsnLeuLeuAsnValIleTyr245250255AsnThrIleAspValGlnValAlaLeuValGlyMetGluIleTrpSer260265270AspGlyAspLysIleLysValValProSerAlaSerThrThrPheAsp275280285AsnPheLeuArgTrpHisSerSerAsnLeuGlyLysLysIleHisAsp290295300HisAlaGlnLeuLeuSerGlyIleSerPheAsnAsnArgArgValGly305310315320LeuAlaAlaSerAsnSerLeuCysSerProSerSerValAlaValIle325330335GluAlaLysLysLysAsnAsnValAlaLeuValGlyValMetSerHis340345350GluLeuGlyHisValLeuGlyMetProAspValProPheAsnThrLys355360365CysProSerGlySerCysValMetAsnGlnTyrLeuSerSerLysPhe370375380ProLysAspPheSerThrSerCysArgAlaHisPheGluArgTyrLeu385390395400LeuSerGlnLysProLysCysLeuLeuGlnAlaProIleProThrAsn405410415IleMetThrThrProValCysGlyAsnHisLeuLeuGluValGlyGlu420425430AspCysAspCysGlySerProLysGluCysThrAsnLeuCysCysGlu435440445AlaLeuThrCysLysLeuLysProGlyThrAspCysGlyGlyAspAla450455460ProAsnHisThrThrGlu465470(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2582 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 52..2034(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:ATTTCTCAGCTCCAAGCATTAGGTAAACCCACCAAGCAATCCTAGCCTGTGATGGCG57MetAlaTTTGACGTCAGCTGCTTCTTTTGGGTGGTGCTGTTTTCTGCCGGCTGT105PheAspValSerCysPhePheTrpValValLeuPheSerAlaGlyCys51015AAAGTCATCACCTCCTGGGATCAGATGTGCATTGAGAAAGAAGCCAAC153LysValIleThrSerTrpAspGlnMetCysIleGluLysGluAlaAsn202530AAAACATATAACTGTGAAAATTTAGGTCTCAGTGAAATCCCTGACACT201LysThrTyrAsnCysGluAsnLeuGlyLeuSerGluIleProAspThr35404550CTACCAAACACAACAGAATTTTTGGAATTCAGCTTTAATTTTTTGCCT249LeuProAsnThrThrGluPheLeuGluPheSerPheAsnPheLeuPro556065ACAATTCACAATAGAACCTTCAGCAGACTCATGAATCTTACCTTTTTG297ThrIleHisAsnArgThrPheSerArgLeuMetAsnLeuThrPheLeu707580GATTTAACTAGGTGCCAGATTAACTGGATACATGAAGACACTTTTCAA345AspLeuThrArgCysGlnIleAsnTrpIleHisGluAspThrPheGln859095AGCCATCATCAATTAAGCACACTTGTGTTAACTGGAAATCCCCTGATA393SerHisHisGlnLeuSerThrLeuValLeuThrGlyAsnProLeuIle100105110TTCATGGCAGAAACATCGCTTAATGGGCCCAAGTCACTGAAGCATCTT441PheMetAlaGluThrSerLeuAsnGlyProLysSerLeuLysHisLeu115120125130TTCTTAATCCAAACGGGAATATCCAATCTCGAGTTTATTCCAGTGCAC489PheLeuIleGlnThrGlyIleSerAsnLeuGluPheIleProValHis135140145AATCTGGAAAACTTGGAAAGCTTGTATCTTGGAAGCAACCATATTTCC537AsnLeuGluAsnLeuGluSerLeuTyrLeuGlySerAsnHisIleSer150155160TCCATTAAGTTCCCCAAAGACTTCCCAGCACGGAATCTGAAAGTACTG585SerIleLysPheProLysAspPheProAlaArgAsnLeuLysValLeu165170175GATTTTCAGAATAATGCTATACACTACATCTCTAGAGAAGACATGAGG633AspPheGlnAsnAsnAlaIleHisTyrIleSerArgGluAspMetArg180185190TCTCTGGAGCAGGCCATCAACCTAAGCCTGAACTTCAATGGCAATAAT681SerLeuGluGlnAlaIleAsnLeuSerLeuAsnPheAsnGlyAsnAsn195200205210GTTAAAGGTATTGAGCTTGGGGCTTTTGATTCAACGGTCTTCCAAAGT729ValLysGlyIleGluLeuGlyAlaPheAspSerThrValPheGlnSer215220225TTGAACTTTGGAGGAACTCCAAATTTGTCTGTTATATTCAATGGTCTG777LeuAsnPheGlyGlyThrProAsnLeuSerValIlePheAsnGlyLeu230235240CAGAACTCTACTACTCAGTCTCTCTGGCTGGGAACATTTGAGGACATT825GlnAsnSerThrThrGlnSerLeuTrpLeuGlyThrPheGluAspIle245250255GATGACGAAGATATTAGTTCAGCCATGCTCAAGGGACTCTGTGAAATG873AspAspGluAspIleSerSerAlaMetLeuLysGlyLeuCysGluMet260265270TCTGTTGAGAGCCTCAACCTGCAGGAACACCGCTTCTCTGACATCTCA921SerValGluSerLeuAsnLeuGlnGluHisArgPheSerAspIleSer275280285290TCCACCACATTTCAGTGCTTCACCCAACTCCAAGAATTGGATCTGACA969SerThrThrPheGlnCysPheThrGlnLeuGlnGluLeuAspLeuThr295300305GCAACTCACTTGAAAGGGTTACCCTCTGGGATGAAGGGTCTGAACTTG1017AlaThrHisLeuLysGlyLeuProSerGlyMetLysGlyLeuAsnLeu310315320CTCAAGAAATTAGTTCTCAGTGTAAATCATTTCGATCAATTGTGTCAA1065LeuLysLysLeuValLeuSerValAsnHisPheAspGlnLeuCysGln325330335ATCAGTGCTGCCAATTTCCCCTCCCTTACACACCTCTACATCAGAGGC1113IleSerAlaAlaAsnPheProSerLeuThrHisLeuTyrIleArgGly340345350AACGTGAAGAAACTTCACCTTGGTGTTGGCTGCTTGGAGAAACTAGGA1161AsnValLysLysLeuHisLeuGlyValGlyCysLeuGluLysLeuGly355360365370AACCTTCAGACACTTGATTTAAGCCATAATGACATAGAGGCTTCTGAC1209AsnLeuGlnThrLeuAspLeuSerHisAsnAspIleGluAlaSerAsp375380385TGCTGCAGTCTGCAACTCAAAAACCTGTCCCACTTGCAAACCTTAAAC1257CysCysSerLeuGlnLeuLysAsnLeuSerHisLeuGlnThrLeuAsn390395400CTGAGCCACAATGAGCCTCTTGGTCTCCAGAGTCAGGCATTCAAAGAA1305LeuSerHisAsnGluProLeuGlyLeuGlnSerGlnAlaPheLysGlu405410415TGTCCTCAGCTAGAACTCCTCGATTTGGCATTTACCCGCTTACACATT1353CysProGlnLeuGluLeuLeuAspLeuAlaPheThrArgLeuHisIle420425430AATGCTCCACAAAGTCCCTTCCAAAACCTCCATTTCCTTCAGGTTCTG1401AsnAlaProGlnSerProPheGlnAsnLeuHisPheLeuGlnValLeu435440445450AATCTCACTTACTGCTTCCTTGATACCAGCAATCAGCATCTTCTAGCA1449AsnLeuThrTyrCysPheLeuAspThrSerAsnGlnHisLeuLeuAla455460465GGCCTACCAGTTCTCCGGCATCTCAACTTAAAAGGGAATCACTTTCAA1497GlyLeuProValLeuArgHisLeuAsnLeuLysGlyAsnHisPheGln470475480GATGGGACTATCACGAAGACCAACCTACTTCAGACCGTGGGCAGCTTG1545AspGlyThrIleThrLysThrAsnLeuLeuGlnThrValGlySerLeu485490495GAGGTTCTGATTTTGTCCTCTTGTGGTCTCCTCTCTATAGACCAGCAA1593GluValLeuIleLeuSerSerCysGlyLeuLeuSerIleAspGlnGln500505510GCATTCCACAGCTTGGGAAAAATGAGCCATGTAGACTTAAGCCACAAC1641AlaPheHisSerLeuGlyLysMetSerHisValAspLeuSerHisAsn515520525530AGCCTGACATGCGACAGCATTGATTCTCTTAGCCATCTTAAGGGAATC1689SerLeuThrCysAspSerIleAspSerLeuSerHisLeuLysGlyIle535540545TACCTCAATCTGGCTGCCAACAGCATTAACATCATCTCACCCCGTCTC1737TyrLeuAsnLeuAlaAlaAsnSerIleAsnIleIleSerProArgLeu550555560CTCCCTATCTTGTCCCAGCAGAGCACCATTAATTTAAGTCATAACCCC1785LeuProIleLeuSerGlnGlnSerThrIleAsnLeuSerHisAsnPro565570575CTGGACTGCACTTGCTCGAATATTCATTTCTTAACATGGTACAAAGAA1833LeuAspCysThrCysSerAsnIleHisPheLeuThrTrpTyrLysGlu580585590AACCTGCACAAACTTGAAGGCTCGGAGGAGACCACGTGTGCAAACCCG1881AsnLeuHisLysLeuGluGlySerGluGluThrThrCysAlaAsnPro595600605610CCATCTCTAAGGGGAGTTAAGCTATCTGATGTCAAGCTTTCCTGTGGG1929ProSerLeuArgGlyValLysLeuSerAspValLysLeuSerCysGly615620625ATTACAGCCATAGGCATTTTCTTTCTCATAGTATTTCTATTATTGTTG1977IleThrAlaIleGlyIlePhePheLeuIleValPheLeuLeuLeuLeu630635640GCTATTCTGCTATTTTTTGCAGTTAAATACCTTCTCAGGTGGAAATAC2025AlaIleLeuLeuPhePheAlaValLysTyrLeuLeuArgTrpLysTyr645650655CAACACATTTAGTGCTGAAGGTTTCCAGAGAAAGCAAATAAGTGTGCTT2074GlnHisIle660AGCAAAATTGCTCTAAGTGAAAGAACTGTCATCTGCTGGTGACCAGACCAGACTTTTCAG2134ATTGCTTCCTGGAACTGGGCAGGGACTCACTGTGCTTTTCTGAGCTTCTTACTCCTGTGA2194GTCCCAGAGCTAAAGAACCTTCTAGGCAAGTACACCGAATGACTCAGTCCAGAGGGTCAG2254ATGCTGCTGTGAGAGGCACAGAGCCCTTTCCGCATGTGGAAGAGTGGGAGGAAGCAGAGG2314GAGGGACTGGGCAGGGACTGCCGGCCCCGGAGTCTCCCACAGGGAGGCCATTCCCCTTCT2374ACTCACCGACATCCCTCCCAGCACCACACACCCCGCCCCTGAAAGGAGATCATCAGCCCC2434CACAATTTGTCAGAGCTGAAGCCAGCCCACTACCCACCCCCACTACAGCATTGTGCTTGG2494GTCTGGGTTCTCAGTAATGTAGCCATTTGAGAAACTTACTTGGGGACAAAGTCTCAATCC2554TTATTTTAAATGAAAAAAAAAAAAAAAA2582(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 661 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetAlaPheAspValSerCysPhePheTrpValValLeuPheSerAla151015GlyCysLysValIleThrSerTrpAspGlnMetCysIleGluLysGlu202530AlaAsnLysThrTyrAsnCysGluAsnLeuGlyLeuSerGluIlePro354045AspThrLeuProAsnThrThrGluPheLeuGluPheSerPheAsnPhe505560LeuProThrIleHisAsnArgThrPheSerArgLeuMetAsnLeuThr65707580PheLeuAspLeuThrArgCysGlnIleAsnTrpIleHisGluAspThr859095PheGlnSerHisHisGlnLeuSerThrLeuValLeuThrGlyAsnPro100105110LeuIlePheMetAlaGluThrSerLeuAsnGlyProLysSerLeuLys115120125HisLeuPheLeuIleGlnThrGlyIleSerAsnLeuGluPheIlePro130135140ValHisAsnLeuGluAsnLeuGluSerLeuTyrLeuGlySerAsnHis145150155160IleSerSerIleLysPheProLysAspPheProAlaArgAsnLeuLys165170175ValLeuAspPheGlnAsnAsnAlaIleHisTyrIleSerArgGluAsp180185190MetArgSerLeuGluGlnAlaIleAsnLeuSerLeuAsnPheAsnGly195200205AsnAsnValLysGlyIleGluLeuGlyAlaPheAspSerThrValPhe210215220GlnSerLeuAsnPheGlyGlyThrProAsnLeuSerValIlePheAsn225230235240GlyLeuGlnAsnSerThrThrGlnSerLeuTrpLeuGlyThrPheGlu245250255AspIleAspAspGluAspIleSerSerAlaMetLeuLysGlyLeuCys260265270GluMetSerValGluSerLeuAsnLeuGlnGluHisArgPheSerAsp275280285IleSerSerThrThrPheGlnCysPheThrGlnLeuGlnGluLeuAsp290295300LeuThrAlaThrHisLeuLysGlyLeuProSerGlyMetLysGlyLeu305310315320AsnLeuLeuLysLysLeuValLeuSerValAsnHisPheAspGlnLeu325330335CysGlnIleSerAlaAlaAsnPheProSerLeuThrHisLeuTyrIle340345350ArgGlyAsnValLysLysLeuHisLeuGlyValGlyCysLeuGluLys355360365LeuGlyAsnLeuGlnThrLeuAspLeuSerHisAsnAspIleGluAla370375380SerAspCysCysSerLeuGlnLeuLysAsnLeuSerHisLeuGlnThr385390395400LeuAsnLeuSerHisAsnGluProLeuGlyLeuGlnSerGlnAlaPhe405410415LysGluCysProGlnLeuGluLeuLeuAspLeuAlaPheThrArgLeu420425430HisIleAsnAlaProGlnSerProPheGlnAsnLeuHisPheLeuGln435440445ValLeuAsnLeuThrTyrCysPheLeuAspThrSerAsnGlnHisLeu450455460LeuAlaGlyLeuProValLeuArgHisLeuAsnLeuLysGlyAsnHis465470475480PheGlnAspGlyThrIleThrLysThrAsnLeuLeuGlnThrValGly485490495SerLeuGluValLeuIleLeuSerSerCysGlyLeuLeuSerIleAsp500505510GlnGlnAlaPheHisSerLeuGlyLysMetSerHisValAspLeuSer515520525HisAsnSerLeuThrCysAspSerIleAspSerLeuSerHisLeuLys530535540GlyIleTyrLeuAsnLeuAlaAlaAsnSerIleAsnIleIleSerPro545550555560ArgLeuLeuProIleLeuSerGlnGlnSerThrIleAsnLeuSerHis565570575AsnProLeuAspCysThrCysSerAsnIleHisPheLeuThrTrpTyr580585590LysGluAsnLeuHisLysLeuGluGlySerGluGluThrThrCysAla595600605AsnProProSerLeuArgGlyValLysLeuSerAspValLysLeuSer610615620CysGlyIleThrAlaIleGlyIlePhePheLeuIleValPheLeuLeu625630635640LeuLeuAlaIleLeuLeuPhePheAlaValLysTyrLeuLeuArgTrp645650655LysTyrGlnHisIle660(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 588 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 76..474(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:CGGCCAAAGAGGCCTAAACTTGCGGCTGTCCATCTCACCTACAGCTCTGGTCTCATCCTC60AACTCAACCACAATCATGGCTCAGATGATGACTCTGAGCCTCCTTAGCCTG111MetAlaGlnMetMetThrLeuSerLeuLeuSerLeu1510GTCCTGGCTCTCTGCATCCCCTGGACCCAAGGCAGTGATGGAGGGGGT159ValLeuAlaLeuCysIleProTrpThrGlnGlySerAspGlyGlyGly152025CAGGACTGCTGCCTTAAGTACAGCCAGAAGAAAATTCCCTACAGTATT207GlnAspCysCysLeuLysTyrSerGlnLysLysIleProTyrSerIle303540GTCCGAGGCTATAGGAAGCAAGAACCAAGTTTAGGCTGTCCCATCCCG255ValArgGlyTyrArgLysGlnGluProSerLeuGlyCysProIlePro45505560GCAATCCTGTTCTCACCCCGGAAGCACTCTAAGCCTGAGCTATGTGCA303AlaIleLeuPheSerProArgLysHisSerLysProGluLeuCysAla657075AACCCTGAGGAAGGCTGGGTGCAGAACCTGATGCGCCGCCTGGACCAG351AsnProGluGluGlyTrpValGlnAsnLeuMetArgArgLeuAspGln808590CCTCCAGCCCCAGGGAAACAAAGCCCCGGCTGCAGGAAGAACCGGGGA399ProProAlaProGlyLysGlnSerProGlyCysArgLysAsnArgGly95100105ACCTCTAAGTCTGGAAAGAAAGGAAAGGGCTCCAAGGGCTGCAAGAGA447ThrSerLysSerGlyLysLysGlyLysGlySerLysGlyCysLysArg110115120ACTGAACAGACACAGCCCTCAAGAGGATAGCCCAGTAGCCCGCCTGG494ThrGluGlnThrGlnProSerArgGly125130AGCCCAGGAGATCCCCCACGAACTTCAAGCTGGGTGGTTCACGGTCCAACTCACAGGCAA554AGAGGGAGCTAGAAAACAGACTCAGGAGCCGCTA588(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 133 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetAlaGlnMetMetThrLeuSerLeuLeuSerLeuValLeuAlaLeu151015CysIleProTrpThrGlnGlySerAspGlyGlyGlyGlnAspCysCys202530LeuLysTyrSerGlnLysLysIleProTyrSerIleValArgGlyTyr354045ArgLysGlnGluProSerLeuGlyCysProIleProAlaIleLeuPhe505560SerProArgLysHisSerLysProGluLeuCysAlaAsnProGluGlu65707580GlyTrpValGlnAsnLeuMetArgArgLeuAspGlnProProAlaPro859095GlyLysGlnSerProGlyCysArgLysAsnArgGlyThrSerLysSer100105110GlyLysLysGlyLysGlySerLysGlyCysLysArgThrGluGlnThr115120125GlnProSerArgGly130(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 966 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 67..348(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:CTTCCAAGAAGAGCAGCAAAGCTGAAGTAGCAGCAACAGCACCAGCAGCAACAGCAAAAA60ACAAACATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTGATATTG108MetSerValLysGlyMetAlaIleAlaLeuAlaValIleLeu1510TGTGCTACAGTTGTTCAAGGCTTCCCCATGTTCAAAAGAGGACGCTGT156CysAlaThrValValGlnGlyPheProMetPheLysArgGlyArgCys15202530CTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAG204LeuCysIleGlyProGlyValLysAlaValLysValAlaAspIleGlu354045AAAGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATAGAAGTG252LysAlaSerIleMetTyrProSerAsnAsnCysAspLysIleGluVal505560ATTATTACCCTGAAAGAAAATAAAGGACAACGATGCCTAAATCCCAAA300IleIleThrLeuLysGluAsnLysGlyGlnArgCysLeuAsnProLys657075TCGAAGCAAGCAAGGCTTATAATCAAAAAAGTTGAAAGAAAGAATTTT348SerLysGlnAlaArgLeuIleIleLysLysValGluArgLysAsnPhe808590TAAAAATATCAAAACATATGAAGTCCTGGAAAAGGGCATCTGAAAAACCTAGAACAAGTT408TAACTGTGACTACTGAAATGACAAGAATTCTACAGTAGGAAACTGAGACTTTTCTATGGT468TTTGTGACTTTCAACTTTTGTACAGTTATGTGAAGGATGAAAGGTGGGTGAAAGGACCAA528AAACAGAAATACAGTCTTCCTGAATGAATGACAATCAGAATTCCACTGCCCAAAGGAGTC588CAACAATTAAATGGATTTCTAGGAAAAGCTACCTTAAGAAAGGCTGGTTACCATCGGAGT648TTACAAAGTGCTTTCACGTTCTTACTTGTTGTATTATACATTCATGCATTTCTAGGCTAG708AGAACCTTCTAGATTTGATGCTTACAACTATTCTGTTGTGACTATGAGAACATTTCTGTC768TCTAGAAGTTATCTGTCTGTATTGATCTTTATGCTATATTACTATCTGTGGTTACAGTGG828AGACATTGACATTATTACTGGAGTCAAGCCCTTATAAGTCAAAAGCACCTATGTGTCGTA888AAGCATTCCTCAAACATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA948AAAAAAAAAAAAAAAAAA966(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 94 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:MetSerValLysGlyMetAlaIleAlaLeuAlaValIleLeuCysAla151015ThrValValGlnGlyPheProMetPheLysArgGlyArgCysLeuCys202530IleGlyProGlyValLysAlaValLysValAlaAspIleGluLysAla354045SerIleMetTyrProSerAsnAsnCysAspLysIleGluValIleIle505560ThrLeuLysGluAsnLysGlyGlnArgCysLeuAsnProLysSerLys65707580GlnAlaArgLeuIleIleLysLysValGluArgLysAsnPhe8590(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1354 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 75..356(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:TTCTACTCCTTCCAAGAAGAGCAGCAAAGCTGAAGTAGCAGCAACAGCACCAGCAGCAAC60AGCAAAAAACAAACATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTG110MetSerValLysGlyMetAlaIleAlaLeuAlaVal1510ATATTGTGTGCTACAGTTGTTCAAGGCTTCCCCATGTTCAAAAGAGGA158IleLeuCysAlaThrValValGlnGlyPheProMetPheLysArgGly152025CGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGAT206ArgCysLeuCysIleGlyProGlyValLysAlaValLysValAlaAsp303540ATTGAGAAAGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATA254IleGluLysAlaSerIleMetTyrProSerAsnAsnCysAspLysIle45505560GAAGTGATTATTACCCTGAAAGAAAATAAAGGACAACGATGCCTAAAT302GluValIleIleThrLeuLysGluAsnLysGlyGlnArgCysLeuAsn657075CCCAAATCGAAGCAAGCAAGGCTTATAATCAAAAAAGTTGAAAGAAAG350ProLysSerLysGlnAlaArgLeuIleIleLysLysValGluArgLys808590AATTTTTAAAAATATCAAAACATATGAAGTCCTGGAAAAGGGCATCTGAAAAACCT406AsnPheAGAACAAGTTTAACTGTGACTACTGAAATGACAAGAATTCTACAGTAGGAAACTGAGACT466TTTCTATGGTTTTGTGACTTTCAACTTTTGTACAGTTATGTGAAGGATGAAAGGTGGGTG526AAAGGACCAAAAACAGAAATACAGTCTTCCTGAATGAATGACAATCAGAATTCCACTGCC586CAAAGGAGTCCAACAATTAAATGGATTTCTAGGAAAAGCTACCTTAAGAAAGGCTGGTTA646CCATCGGAGTTTACAAAGTGCTTTCACGTTCTTACTTGTTGTATTATACATTCATGCATT706TCTAGGCTAGAGAACCTTCTAGATTTGATGCTTACAACTATTCTGTTGTGACTATGAGAA766CATTTCTGTCTCTAGAAGTTATCTGTCTGTATTGATCTTTATGCTATATTACTATCTGTG826GTTACAGTGGAGACATTGACATTATTACTGGAGTCAAGCCCTTATAAGTCAAAAGCACCT886ATGTGTCGTAAAGCATTCCTCAAACATTTTTTCATGCAAATACACACTTCTTTCCCCAAA946TATCATGTAGCACATCAATATGTAGGGAAACATTCTTATGCATCATTTGGTTTGTTTTAT1006AACCAATTCATTAAATGTAATTCATAAAATGTACTATGAAAAAAATTATACGCTATGGGA1066TACTGGCAACAGTGCACATATTTCATAACCAAATTAGCAGCACCGGTCTTAATTTGATGT1126TTTTCAACTTTTATTCATTGAGATGTTTTGAAGCAATTAGGATATGTGTGTTTACTGTAC1186TTTTTGTTTTGATCCGTTTGTATAAATGATAGCAATATCTTGGACACATTTGAAATACAA1246AATGTTTTTGTCTACCAAAGAAAAATGTTGAAAAATAAGCAAATGTATACCTAGCAATCA1306CTTTTACTTTTTGTAATTCTGTCTCTTAGAAAAATACATAATCTAATT1354(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 94 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:MetSerValLysGlyMetAlaIleAlaLeuAlaValIleLeuCysAla151015ThrValValGlnGlyPheProMetPheLysArgGlyArgCysLeuCys202530IleGlyProGlyValLysAlaValLysValAlaAspIleGluLysAla354045SerIleMetTyrProSerAsnAsnCysAspLysIleGluValIleIle505560ThrLeuLysGluAsnLysGlyGlnArgCysLeuAsnProLysSerLys65707580GlnAlaArgLeuIleIleLysLysValGluArgLysAsnPhe8590(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 813 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 86..544(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:GGGAAGATACATTCACAGAAAGAGCTTCCTGCACAAAGTAAGCCACCAGCGCAACATGAC60AGTGAAGACCCTGCATGGCCCAGCCATGGTCAAGTACTTGCTGCTGTCGATA112MetValLysTyrLeuLeuLeuSerIle15TTGGGGCTTGCCTTTCTGAGTGAGGCGGCAGCTCGGAAAATCCCCAAA160LeuGlyLeuAlaPheLeuSerGluAlaAlaAlaArgLysIleProLys10152025GTAGGACATACTTTTTTCCAAAAGCCTGAGAGTTGCCCGCCTGTGCCA208ValGlyHisThrPhePheGlnLysProGluSerCysProProValPro303540GGAGGTAGTATGAAGCTTGACATTGGCATCATCAATGAAAACCAGCGC256GlyGlySerMetLysLeuAspIleGlyIleIleAsnGluAsnGlnArg455055GTTTCCATGTCACGTAACATCGAGAGCCGCTCCACCTCCCCCTGGAAT304ValSerMetSerArgAsnIleGluSerArgSerThrSerProTrpAsn606570TACACTGTCACTTGGGACCCCAACCGGTACCCCTCGGAAGTTGTACAG352TyrThrValThrTrpAspProAsnArgTyrProSerGluValValGln758085GCCCAGTGTAGGAACTTGGGCTGCATCAATGCTCAAGGAAAGGAAGAC400AlaGlnCysArgAsnLeuGlyCysIleAsnAlaGlnGlyLysGluAsp9095100105ATCTCCATGAATTCCGTTCCCATCCAGCAAGAGACCCTGGTCGTCCGG448IleSerMetAsnSerValProIleGlnGlnGluThrLeuValValArg110115120AGGAAGCACCAAGGCTGCTCTGTTTCTTTCCAGTTGGAGAAGGTGCTG496ArgLysHisGlnGlyCysSerValSerPheGlnLeuGluLysValLeu125130135GTGACTGTTGGCTGCACCTGCGTCACCCCTGTCATCCACCATGTGCAG544ValThrValGlyCysThrCysValThrProValIleHisHisValGln140145150TAAGAGGTGCATATCCACTCAGCTGAAGAAGCTGTAGAAATGCCACTCCTTACCCAGTGC604TCTGCAACAAGTCCTGTCTGACCCCCAATTCCCTCCACTTCACAGGACTCTTAATAAGAC664CTGCACGGATGGAAACAGAAAATATTCACAATGTATGTGTGTATGTACTACACTTTATAT724TTGATATCTAAAATGTTAGGAGAAAAATTAATATATTCAGTGCTAATATAATAAAGTATT784AATAATTTAAAAATAAAAAAAAAAAAAAA813(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 153 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:MetValLysTyrLeuLeuLeuSerIleLeuGlyLeuAlaPheLeuSer151015GluAlaAlaAlaArgLysIleProLysValGlyHisThrPhePheGln202530LysProGluSerCysProProValProGlyGlySerMetLysLeuAsp354045IleGlyIleIleAsnGluAsnGlnArgValSerMetSerArgAsnIle505560GluSerArgSerThrSerProTrpAsnTyrThrValThrTrpAspPro65707580AsnArgTyrProSerGluValValGlnAlaGlnCysArgAsnLeuGly859095CysIleAsnAlaGlnGlyLysGluAspIleSerMetAsnSerValPro100105110IleGlnGlnGluThrLeuValValArgArgLysHisGlnGlyCysSer115120125ValSerPheGlnLeuGluLysValLeuValThrValGlyCysThrCys130135140ValThrProValIleHisHisValGln145150__________________________________________________________________________

DNA sequences and secreted proteins encoded thereby

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Foreign Referenced Citations (1)

Non-Patent Literature Citations (4)

Entry
Fossiez et al., Microbial Evasion and Subversion of Immunity 544:3222 (Abstract) no date available.
Lebecque "Human CTLA-8, a Cytokine That Has Been Hijacked by the T-Cell Transforming Herpes" (AACR Special Conference Cytokines and Cytokine Receptors Oct. 14-18, 1995).
Rouvier et al. J. Immunol. 150:5445-5456 (1993).
Creighton, T. E. "Proteins: Structures and Molecular Properties" Second Edition, 1993, W. H. Freeman and Company, New York, pp. 10-109 and 133, 1993.