DNA sequences coding for the human proteins Tx and Ty related to the interleukin-1.beta. converting enzyme

The present invention relates to a DNA sequence coding for a new human protein Tx related to the interleukin-1beta converting enzyme, the protein Tx, their production process, the pharmaceutical compositions containing it and their uses as medicaments.
Interleukin-1beta (IL-1.beta.) is a pro-inflammatory cytokine involved in the pathogenesis of multiple acute or chronic inflammatory illnesses such as rheumatoid arthritis, inflammatory illnesses of the intestines or the septic shock (Dinarello et al., 1992, Immunological Reviews, 127, 119-146).
The human monocytes and macrophages synthesize IL-1.beta. in the form of an inactive precursor of 31 kDa (pIL-1.beta.). The pIL-1.beta. does not have the conventional signal sequence and can only be secreted efficiently by the cell after cleavage between the aspartic acid 116 and the alanine 117. This cleavage, which generates the active IL-1.beta. form of 17 kDa, is carried out by a specific enzyme called interleukin-1beta converting enzyme (ICE) (Thornberry et al., 1992, Nature, 356, 768-774; Cerretti et al., 1992, Science, 256, 97-100). This enzyme has been characterized and cloned in man and in mice (Nett et al., 1992, Journal of Immunology, 149, 3254-3259; Molineaux et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 1809-1813). It is a unique cysteine protease which has no homology with other known thiol-proteases. It also possesses a particular specificity for certain Asp-X peptide bonds of pIL-1.beta..
The ICE enzyme is composed of two sub-units of 20 kDa (p20) and 10 kDa (p10) whose combination is necessary for enzymatic activity. These sub-units originate from the proteolytic cleavage of a pro-enzyme form of 45 kDa (p45). The ICE enzyme itself is capable of cleaving its precursor p45 or the p30 form of 30 kDa, which does not have the 119 amino acids of the N-terminal part of the pro-enzyme, in the p20 plus the p10 active form. The complete sequence of p45 has been characterized by its cDNA as well as the amino acid sequence (Thornberry et al. already quoted). The characterization of the gene of human ICE has been described (Cerretti et al., 1994, Genomics, 20, 468-473).
Recent work has revealed a possible role of ICE in the regulation of programmed cellular death or apoptosis (Yuan et al., 1993, Cell, 75, 641-652). In fact, ICE has a 28% homology with Ced-3, a protein of C. elegans involved in apoptosis and the superexpression of murine ICE in rat fibroblasts which triggers apoptosis (Miura et al., 1993, Cell, 75, 653-660). Moreover, the expression of the protein crmA, an inhibiting viral serpine of ICE, in ganglioneurons of transfected chickens protects these cells from death by apoptosis induced by the suppression of growth factor (nerve growth factor) (Gagliardini et al., 1994, Science, 263, 826-828). These observations suggest that ICE or homologues of this protein could be involved in the regulation of programmed cellular death observed in particular in degenerative neuronal illnesses such as Alzheimer's disease or Parkinson's disease as well as in cerebral ischemia (Barinaga, M, Science, 259, 762, 1993).
The revelation of new proteins related to ICE playing a role either in the maturation of IL-1.beta. or in apoptosis may contribute to the development of new therapeutic or diagnostic agents in situations in which IL-1.beta. or apoptosis are involved.
The present invention relates to a new human protein Tx which has an approximately 52% homology with the human precursor p45 of ICE and which does not allow the maturation of the precursor of IL-1.beta. into active cytokine. The protein Tx has two unexpected functions: on the one hand, it is a protease and it is in particular capable of cleaving the precursor p30 of ICE into sub-units p10 and p20 and on the other hand, it is capable of inducing apoptosis in cells, for example in transfected Cos cells.
These biological properties allow the use of the protein Tx to be anticipated in the treatment of pathological situations which respond to IL-1.beta. or in which apoptosis occurs.
The present invention also relates to a new human protein Ty which has a homology of greater than 70% with the protein Tx. The protein Ty is capable of inducing apoptosis in cells, for example, in transfected Cos cells. The protein Ty is a protease which is capable of self-cleaving in an intermolecular manner.
Therefore a subject of the present invention is a DNA sequence containing a DNA sequence coding for a human polypeptide having a protease activity and having the nucleotide sequence of the sequence SEQ ID NO: 1:
GCTCTTTCCA ACGCTGTAAA AAAGGACAGA GGCTGTTCCC T ATG GCA GAA GGC 53 Met Ala Glu Gly 1 - AAC CAC AGA AAA AAG CCA CTT AAG GTG TTG GAA TCC CTG GGC AAA GAT101 Asn His Arg Lys Lys Pro Leu Lys Val Leu Glu Ser Leu Gly Lys Asp 5 10 15 20 - TTC CTC ACT GGT GTT TTG GAT AAC TTG GTG GAA CAA AAT GTA CTG AAC149 Phe Leu Thr Gly Val Leu Asp Asn Leu Val Glu GLn Asn Val Leu Asn 25 30 35 - TGG AAG GAA GAG GAA AAA AAG AAA TAT TAC GAT GCT AAA ACT GAA GAC197 Trp Lys Glu Glu Glu Lys Lys Lys Tyr Tyr Asp Ala Lys Thr Glu Asp 40 45 50 - AAA GTT CGG GTC ATG GCA GAC TCT ATG CAA GAG AAG CAA CGT ATG GCA245 Lys Val Arg Val Met Ala Asp Ser Met Gln Glu Lys Gln Arg Met Ala 55 60 65 - GGA CAA ATG CTT CTT CAA ACC TTT TTT AAC ATA GAC CAA ATA TCC CCC293 Gly Gln Met Leu Leu Gln Thr Phe Phe Asn Ile Asp Gln Ile Ser Pro 70 75 80 -AAT AAA AAA GCT CAT CCG AAT ATG GAG GCT GGA CCA CCT GAG TCA GGA 341 Asn Lys Lys Ala His Pro Asn Met Glu Ala Gly Pro Pro Glu Ser Gly 85 90 95 100 - GAA TCT ACA GAT GCC CTC AAG CTT TGT CCT CAT GAA GAA TTC CTG AGA389 Glu Ser Thr Asp Ala Leu Lys Leu Cys Pro His Glu Glu Phe Leu Arg 105 110 115 - CTA TGT AAA GAA AGA GCT GAA GAG ATC TAT CCA ATA AAG GAG AGA AAC437 Leu Cys Lys Glu Arg Ala Glu Glu Ile Tyr Pro Ile Lys Glu Arg Asn 120 125 130 - AAC CGC ACA CGC CTG GCT CTC ATC ATA TGC AAT ACA GAG TTT GAC CAT485 Asn Arg Thr Arg Leu Ala Leu Ile Ile Cys Asn Thr Glu Phe Asp His 135 140 145 - CTG CCT CCG AGG AAT GGA GCT GAC TTT GAC ATC ACA GGG ATG AAG GAG533 Leu Pro Pro Arg Asn Gly Ala Asp Phe Asp Ile Thr Glu Met Lys Glu 150 155 160 - CTA CTT GAG GGT CTG GAC TAT AGT GTA GAT GTA GAA GAG AAT CTG ACA581 Leu Leu Glu Gly Leu Asp Tyr Ser Val Asp Val Glu Glu Asn Leu Thr 165 170 175 180 - GCC AGG GAT ATG GAG TCA GCG CTG AGG GCA TTT GCT ACC AGA CAA GAG629 Ala Arg Asp Met Glu Ser Ala Leu Arg Ala Phe Ala Thr Arg Pro Glu 185 190 195 - CAC AAG TCC TCT GAC AGC ACA TTC TTG GTA CTC ATG TCT CAT GGC ATC677 His Lys Ser Ser Asp Ser Thr Phe Leu Val Leu Met Ser His Gly Ile 200 205 210 - CTG GAG GGA ATC TGC GGA ACT GTG CAT GAT GAG AAA AAA CCA GAT GTG725 Leu Glu Gly Ile Cys Gly Thr Val His Asp Glu Lys Lys Pro Asp Val 215 220 225 - CTG CTT TAT GAC ACC ATC TTC CAG ATA TTC AAC AAC CGC AAC TCG CTC773 Leu Leu Tyr Asp Thr Ile Phe Gln Ile Phe Asn Asn Arg Asn Cys Leu 230 235 240 - AGT CTG AAG GAC AAA CCC AAG GTC ATC ATT GTC CAG GCC TGC AGA GGT821 Ser Leu Lys Asp Lys Pro Lys Val Ile Ile Val Gln Ala Cys Arg Gly 245 250 255 260 - GCA AAC CGT GGG GAA CTG TGG GTC AGA GAC TCT CCA GCA TCC TTG GAA869 Ala Asn Arg Gly Glu Leu Trp Val Arg Asp Ser Pro Ala Ser Leu Glu 265 270 275 - GTG GCC TCT TCA CAG TCA TCT GAG AAC CTG GAG GAA GAT GCT GTT TAC917 Val Ala Ser Ser Gln Ser Ser Glu Asn Leu Glu Glu Asp Ala Val Tyr 280 285 290 - AAG ACC CAC GTG GAG AAG GAC TTC ATT GCT TTC TGC TCT TCA ACG CCA965 Lys Thr His Val Glu Lys Asp Phe Ile Ala Phe Cys Ser Ser Thr Pro 295 300 305 - CAC AAC GTG TCC TGG AGA GAC AGC ACA ATG GGC TCT ATC TTC ATC ACA1013 His Asn Val Ser Trp Arg Asp Ser Thr Met Gly Ser Ile Phe Ile Thr 310 315 320 - CAA CTC ATC ACA TGC TTC CAG AAA TAT TCT TGG TGC TGC CAC CTA GAG1061 Glu Leu Ile Thr Cys Phe Gln Lys Tyr Ser Trp Cys Cys His Leu Glu 325 330 335 340 - GAA GTA TTT CGG AAG GTA CAG CAA TCA TTT GAA ACT CCA AGG GCC AAA1109 Glu Val Phe Arg Lys Val Gln Gln Ser Phe Glu Thr Pro Arg Ala Lys 345 350 355 - GCT CAA ATG CCC ACC ATA GAA CGA CTG TCC ATG ACA AGA TAT TTC TAC1557 Ala Gln Met Pro Thr Ile Glu Arg Leu Ser Met Thr Arg Tyr Phe Tyr 360 365 370 - CTC TTT CCT GGC AAT TGAAAATGGA AGCCACAAGC AGCCCAGCCC TCCTTAATCA1212 Leu Phe Pro Gly Asn 375 - ACTTCAAGGA GCACCTTCAT TAGTACAGCT TGCATATTTA ACATTTTGTA TTTCAATAAA1272 - AGTGAAGACA AAAAAAAAA1291
as well as a DNA sequence containing a DNA sequence coding for a human polypeptide having the capacity to induce apoptosis and having the nucleotide sequence of the sequence SEQ ID NO: 1 above.
A particular subject of the invention is a DNA sequence coding for a human polypeptide having a protease activity and capable of inducing apoptosis and having the nucleotide sequence of the sequence SEQ ID NO: 1 above.
The above DNA sequence which codes for a protein having 377 amino acids is a cDNA sequence which can be obtained by amplification using PCR, starting from the RNA of monocytes activated by LPS or of human polynuclear cells or placenta, thanks to the oligonucleotide derivatives of the sequence of ICE and the sequence of homologous genes identified previously, according to the operating conditions a precise description of which is given further on.
The revelation of protease activity as well as that of the capacity to induce apoptosis are illustrated further on in the experimental part.
A more particular subject of the invention is a DNA sequence coding for a human polypeptide having a protease activity and capable of inducing apoptosis having the sequence which begins at nucleotide 42 and ends at nucleotide 1172 of the sequence SEQ ID NO: 1 as well as DNA sequences which hybridize with it and having the same function.
Within sequences which hybridize, DNA sequences are included which hybridize under high stringency conditions and which code for a polypeptide having the same activity. The stringency conditions include for example a hybridization at 65.degree. C., for 18 hours in a 5.times.SSPE; 10.times.Denhardt; 100 .mu.g/ml DNAss; 1% SDS solution followed by 3 washings for 5 minutes with 2.times.SSC; 0.05% SDS, then 3 washings for 15 minutes at 65.degree. C. in 1.times.SSC; 0.1% SDS, according to Maniatis et al., Molecular cloning, Cold Spring Harbor Laboratory Press, 1989.
A quite particular subject of the invention is the DNA sequence having the sequence beginning at nucleotide 42 and ending at nucleotide 1172 of the sequence SEQ ID NO: 1.
Knowledge of the sequence SEQ ID NO: 1 allows the present invention to be reproduced for example by known methods of chemical synthesis or by screening of a gene library or a cDNA library using synthetic oligonucleotide probes by known hybridization techniques.
The invention also relates to a human polypeptide having a protease activity and capable of inducing apoptosis and having the amino acid sequence of the sequence SEQ ID NO: 2:
Met Ala Glu Gly Asn His Arg Lys Lys Pro Leu Lys Val Leu Glu Ser 1 5 10 15 - Leu Gly Lys Asp Phe Leu Thr Gly Val Leu Asp Asn Leu Val Glu Gln 20 25 30 - Asn Val Leu Asn Trp Lys Glu Glu Glu Lys Lys Lys Tyr Tyr Asp Ala 35 40 45 - Lys Thr Glu Asp Lys Val Arg Val Met Ala Asp Ser Met Gln Glu Lys 50 55 60 - Gln Arg Met Ala Gly Gln Met Leu Leu Gln Thr Phe Phe Asn Ile Asp 65 70 75 80 - Gln Ile Ser Pro Asn Lys Lys Ala His Pro Asn Met Glu Ala Gly Pro 85 90 95 - Pro Glu Ser Gly Glu Ser Thr Asp Ala Leu Lys Leu Cys Pro His Glu 100 105 110 - Glu Phe Leu Arg Leu Cys Lys Glu Arg Ala Glu Glu Ile Tyr Pro Ile 115 120 125 - Lys Glu Arg Asn Asn Arg Thr Arg Leu Ala Leu Ile Ile Cys Asn Thr 130 135 140 - Glu Phe Asp His Leu Pro Pro Arg Asn Gly Ala Asp Phe Asp Ile Thr 145 150 155 160 - Gly Met Lys Glu Leu Leu Glu Gly Leu Asp Tyr Ser Val Asp Val Glu 165 170 175 - Glu Asn Leu Thr Ala Arg Asp Met Glu Ser Ala Leu Arg Ala Phe Ala 180 185 190 - Thr Arg Pro Glu His Lys Ser Ser Asp Ser Thr Phe Leu Val Leu Met 195 200 205 - Ser His Gly Ile Leu Glu Gly Ile Cys Gly Thr Val His Asp Glu Lys 210 215 220 - Lys Pro Asp Val Leu Leu Tyr Asp Thr Ile Phe Gln Ile Phe Asn Asn 225 230 235 240 - Arg Asn Cys Leu Ser Leu Lys Asp Lys Pro Lys Val Ile Ile Val Gln 245 250 255 - Ala Cys Arg Gly Ala Asn Arg Gly Glu Leu Trp Val Arg Asp Ser Pro 260 265 270 - Ala Ser Leu Glu Val Ala Ser Ser Gln Ser Ser Glu Asn Leu Glu Glu 275 280 285 - Asp Ala Val Tyr Lys Thr His Val Glu Lys Asp Phe Ile Ala Phe Cys 290 295 300 - Ser Ser Thr Pro His Asn Val Ser Trp Arg Asp Ser Thr Met Gly Ser 305 310 315 320 - Ile Phe Ile Thr Gln Leu Ile Thr Cys Phe Gln Lys Tyr Ser Trp Cys 325 330 335 - Cys His Leu Glu Glu Val Phe Arg Lys Val Gln Gln Ser Phe Glu Thr 340 345 350 - Pro Arg Ala Lys Ala Gln Met Pro Thr Ile Glu Arg Leu Ser Met Thr 355 360 365 - Arg Tyr Phe Tyr Leu Phe Pro Gly Asn 370 375
as well as the alleles and analogues of this sequence.
Within alleles and analogues, sequences are included which are modified by the substitution, deletion or addition of one or more amino acids in sofar as these products retain the same function.
A special subject of the invention is the polypeptide having the amino acid sequence of the sequence SEQ ID NO: 2 and designated protein Tx.
One of the aspects of the invention also relates to a polypeptide according to the invention as obtained by the expression in a host cell of a DNA coding for the amino acid sequence of the sequence SEQ ID NO: 2.
When the polypeptide according to the invention is obtained by expression in a host cell, it is carried out according to known methods of genetic engineering and cell culture.
The expression can be carried out in a prokaryotic cell, for example E. coli or in a eukaryotic cell, for example a Cos cell containing the DNA sequence coding for the polypeptide of the invention preceded by a suitable promoter sequence.
The invention relates in particular to a polypeptide according to the invention as obtained by the expression in a eukaryotic host cell.
Quite particularly the invention relates to a polypeptide according to the invention the protease activity of which corresponds to the capacity for maturation of the conversion enzyme of IL-1beta. An example of determination of this particular protease activity is described further on.
A subject of the invention is also an expression vector containing a DNA sequence coding for a human polypeptide having a protease activity and capable of inducing apoptosis as well as a host cell transformed by an above vector.
Expression vectors are known vectors which allow the expression of the protein under the control of a suitable promoter. For prokaryotic cells, the promoter can be for example the lac promoter, the trp promoter, the tac promoter, the .beta.-lactamase promoter or the PL promoter. For yeast cells, the promoter can be for example the PGK promoter or the AD promoter. For mammalian cells, the promoter can be for example the SV40 promoter or promoters of the adenovirus. Baculovirus-type vectors can also be used for expression in insect cells.
The host cells are for example prokaryotic cells or eukaryotic cells. The prokaryotic cells are for example E. coli, Bacillus or Streptomyces. The eukaryotic host cells include yeasts as well as cells of higher organisms, for example mammalian cells or insect cells. The mammalian cells are for example fibroblasts such as hamster CHO or BHK cells and monkey Cos cells. The insect cells are for example SF9 cells.
The invention relates to a process which includes the expression of the protein Tx in a host cell transformed by a DNA coding for the amino acid sequence of the sequence SEQ ID NO: 2 and in particular a process in which the host cell is a eukaryotic cell.
A subject of the invention is also antibodies directed against the polypeptide according to the invention.
The polyclonal or monoclonal antibodies according to the invention can be prepared according to known methods and can be used for example for the assay of the protein Tx, for example in an ELISA test, and as diagnosis agents.
The new protein Tx according to the invention has remarkable biological properties, in particular a protease activity, notably the capacity to mature the conversion enzyme of IL-1beta as well as the capacity to induce apoptosis, as shown by the results given further on.
These biological properties render the protein Tx according to the invention of use for example in the treatment of auto-immune diseases, in the healing of wounds or in the reduction of the side-effects of irradiation treatments in which IL-1.beta. is involved or for example in the area of cancers and infection in which apoptosis is involved.
Therefore a subject of the present invention is, as medicaments, the polypeptide according to the invention.
The invention extends to the pharmaceutical compositions containing as active ingredient a medicament defined above and particularly relates to pharmaceutical compositions for modulating the production of IL-1beta or for modulating apoptosis.
The active ingredient can be incorporated with the usual excipients for the preparation of the above pharmaceutical compositions. The compositions can be administered by parenteral, oral or local route.
The polypeptides according to the invention also allow new therapeutic agents to be envisaged constituted by inhibitors of these polypeptides and their use as a medicament, for example in the treatment of inflammation associated with auto-immune diseases, septic shock or neurodegenerative diseases.
A subject of the invention is also a DNA sequence hybridizing with the DNA sequence beginning at nucleotide 42 and ending at nucleotide 1172 of sequence SEQ ID NO: 1 and having the same function.
The hybridization is obtained for example in a buffer containing 5.times.SSC, 10.times.Denhardt, 100 microg/ml DNA of salmon sperm, 1% SDS, overnight at 65.degree. C. Washings are then carried out for example in a buffer containing 1.times.SSC, 0.1% SDS, twice for 30 mn at 60.degree. C.
The invention particularly relates to the DNA sequence coding for a polypeptide having a protease activity and capable of inducing apoptosis and having the nucleotide sequence of the sequence SEQ ID NO: 22 and more particularly the sequence beginning at nucleotide 104 and ending at nucleotide 1195 of the sequence SEQ ID NO: 22.
The DNA sequence SEQ ID NO: 22 above, which codes for a protein having 364 amino acids, is a cDNA sequence which can be obtained, for example, by amplification using PCR, from the cDNA of human spleen or placenta, thanks to the oligonucleotide derivatives of the Tx cDNA sequence (SEQ ID NO: 1). A detailed preparation example is given further on in the experimental part. The knowledge of the sequence SEQ ID NO: 22 allows the present invention to be reproduced for example by known methods of chemical synthesis or screening of gene libraries or cDNA libraries by oligonucleotide probes using hybridization techniques.
A subject of the invention is also a human polypeptide having a protease activity and capable of inducing apoptosis and having the amino acid sequence of the sequence SEQ ID NO: 23 and designated protein Ty.
One of the aspects of the invention also relates to a polypeptide according to the invention as obtained by the expression in a host cell of a DNA coding for the amino acid sequence of the sequence SEQ ID NO: 23.
The invention also includes the host cells, the expression vectors which allow the expression of the protein Ty to be obtained and examples of which have been indicated above for the expression of the protein Tx.
The invention also relates to a process which includes the expression of the protein Ty in a host cell transformed by a DNA coding for the amino acid sequence of the sequence SEQ ID NO: 23.
The invention also includes polyclonal antibodies or monoclonal antibodies directed against the protein Ty.
The invention also relates to the pharmaceutical compositions containing the protein Ty as a medicament.

BRIEF DESCRIPTION OF THE DRAWINGS
The attached figures illustrate certain aspects of the invention:
FIG. 1 represents the detection of sequences homologous to ICE by Southern Blot in human genomic DNA originating from PBMC digested by the restriction enzymes BglII (line A); PstI (line B); HindIII (line C); BamH1 (line D). The detection is carried out by hybridization with an ICE exon 6 probe labelled with .sup.32 P.
FIG. 2 represents the nucleotide sequence of exon 6 of the gene T2 (SEQ ID NO: 5).
FIG. 3 represents the nucleotide sequence of the Tx cDNA (SEQ ID NO: 1) and the corresponding amino acid sequence (SEQ ID NO: 2).
FIG. 4 represents the detection of Tx mRNA by Northern Blot in tissues of the spleen (line A); the thymus (line B); the prostate (line C); the testicle (line D); the ovary (line E); the small intestine (line F); the colon (line G); the peripheral leucocytes (line H). The detection is carried out by hybridization with a "Tx exon 6" probe labelled with .sup.32 P.
FIGS. 5A and B represents the secretion of mature IL-1.beta. in Cos-1 cells containing constitutively pIL-1.beta. and transfected by the vector pcDL-SRalpha296 containing ICE p45 (line 2) or Tx (line 3), the vector pcDL-SRalpha296 alone (line 4), the vector pcDNAI/Amp alone (line 5), the vector pcDNAI/Amp containing Tx (line 6) or ICE p30 (line 7) compared to a control culture without DNA (line 1). The mature IL-1.beta. is measured in pg/ml of cellular supernatant using ELISA (A: incubation for 16 hours; B: incubation for 24 hours).
FIG. 6 represents the cleavage of the precursor ICE p30 in Cos-1 cells transfected by the vector pcDL-SRalpha296 alone (line A) or containing the labelled mutant T7-ICEp30C285S (line B) or co-transfected with the vector pcDL-SRalpha296 containing the labelled mutant T7-ICEp30C285S and the vector containing ICE p30 (line C) or ICE p45 (line D) or Tx (line E). The detection is carried out using Western Blot with the anti-T7 antibody with a control corresponding to a transfection by the vector pcDL-SRalpha296 containing Tx alone (line F).
FIGS. 7A-D represents the induction of apoptosis by the protein Tx in Cos-1 cells transfected by the vector pcDL-SRalpha296 alone (7B) or containing Tx (7C) or ICE p45 (7D) compared to a control culture without DNA (7A) after culture for 22 hours (magnification.times.400).
FIG. 8 represents the DNA of Cos-1 cells transfected by the vector pcDL-SRalpha296 containing ICE p45 (line B) or Tx (line C) or by the vector alone (line D) compared to a control culture without DNA (line A). The detection is carried out by staining with BET after migration on an agarose gel with DNA size markers of the lambda phage digested by HindIII (M1) and DNA of phage .phi.X174 digested by HindIII (M2).
FIG. 9 represents the cleavage of the mutated protein Ty (T7TY.DELTA.67C245S) in Cos-1 cells, either transfected by the vector pcDL-SRalpha296 alone (line B) or the vector pcDNAI/Amp alone (line C) or the vector pT7TY.DELTA.67C245S (line E), or co-transfected by the vector pT7TY and the vector pT7TY.DELTA.67C245S (line F; 23 hours and line G; 43 hours). The detection is carried out by Western Blot compared to a control culture without DNA (line A) and molecular weight markers (line D; non-detectable).
The following examples illustrate the invention without limiting it.

EXAMPLE 1
Identification of the Sequence Tx
A--Revelation of Genes Homologous to Human ICE
Genes homologous to ICE were identified by Southern Blot using a DNA probe corresponding to exon 6 of the ICE gene.
a) Preparation of the Exon 6 ICE Probe
The limits of the exon 6 of human ICE have been described as well as the complete intron/exon organization of the human ICE gene (Cerretti et al. already quoted). Exon 6 (235 bp) corresponds to nucleotides 635 to 868 of the cDNA sequence p45 of the described ICE (Thornberry et al. already quoted).
The exon 6 ICE probe was prepared by PCR amplification with the following oligonucleotides:
ICE 6.5: ACATGACTAC AGAGCTGGAG (SEQ ID NO: 3)
ICE 6.3: CACCACGGCA GGCCTGGATG (SEQ ID NO: 4)
which were chosen by using the published data (Thornberry et al. already quoted), synthesized and used to amplify by RT-PCR the RNA originating from human blood monocytes, extracted and purified using an RNA.TM. kit (Bioprobe), under the following amplification conditions: Enzyme Biotaq (BioProbe); 30 cycles (94.degree. C., 1 mn; 60.degree. C., 1 mn; 72.degree. C., 1 mn); PCR apparatus: Perkin-Elmer (GeneAmp PCRsystem 9600).
The DNA exon 6 obtained was purified by centrifugation on a Spin X column (Costar) and labelled with .sup.32 P using the random priming technique by means of the Oligolabelling kit (Pharmacia Biotech).
b) Hybridization to the Genomic DNA: Southern Blot
The radiolabelled exon 6 ICE probe obtained was used as a hybridization probe on a human genomic DNA.
The human genomic DNA was prepared from peripheral blood mononuclear cells (PBMC) with the TurboGen kit (Invitrogen) then cleaved by the restriction enzymes BglII, PstI, HindIII or BamHI (Boehringer Mannheim) respectively, migrated on a 0.9% agarose gel in 1.times. TAE, transferred onto a nylon GeneScreen Plus membrane (NEN Dupont) then hybridized with the exon 6 ICE probe.
The hybridization conditions are those described by Maniatis et al. (already quoted) carried out in 5.times.SSPE, 10.times.Denhart, 100 .mu.g/ml DNAss, 1% SDS, overnight at 65.degree. C. followed by washings carried out successively in 2.times.SSC, 0.05% SDS, 30 mn at ambient temperature then 1.times.SSC, 0.1% SDS, 30 mn at 65.degree. C., which corresponds to high stringency. The washing buffer is prepared from the following stock solutions. 20.times.SSC: 3 M aqueous solution of sodium chloride, 0.3 M sodium citrate.
10% SDS: aqueous solution of sodium dodecyl sulphate,
After washing, the membrane is exposed with a Hyperfilm-MP film (Amersham).
As is shown in FIG. 1, for each of the restriction enzymes three to four different bands are observed corresponding to DNA fragments of different size which probably, for certain of them, correspond to genes which are highly homologous to ICE but different from the latter since a single gene can only produce one or at most two distinct bands during a hybridization with a probe corresponding to a single exon.
B--Cloning of Genes Homologous to ICE
a) Cloning of Genomic Sequences Homologous to ICE
In order to identify the different fragments of DNA obtained above, the fragments of human genomic DNA extracted from peripheral blood mononuclear cells (PBMC) then digested by the HindIII enzyme (Boehringer Mannheim) were separated by preparative electrophoresis in 1.5% agarose gel, 1.times.TAE, according to the conditions described by Maniatis et al. (already quoted). The gel was cut into 20 fractions in the area corresponding to the molecular weights which are lower than 2.3 kb then amplification using PCR was carried out on the DNA eluted from each of the fractions using oligonucleotides ICE 6.5 (SEQ ID NO: 3) and ICE 6.3 (SEQ ID NO: 4) described above, using the following amplification conditions: 94.degree. C., 1 mn; 55.degree. C., 1 mn; 72.degree. C., 1 mn; 30 cycles; BioTaq polymerase.
Among the above 20 fractions, eight fractions having produced the best amplification using PCR were retained. The amplified material was cloned using the T4-DNA ligase enzyme in the vector pCRII according to the supplier's instructions with the TA Cloning kit (Invitrogen) and sequenced by the Sanger technique with the Sequenase enzyme using the Macrophor electrophoresis equipment (Pharmacia System). The sequences determined were analyzed by means of GCG software (Devereux et al. Nucleic Acids Research 12, 387-395 (1984)).
Among the nucleotide sequences obtained, we have identified a sequence called T2 which has a 92% identity of nucleotides with the sequence of exon 6 of ICE.
The nucleotide sequence T2 has an open reading frame over all of the exon 6 (SEQ ID NO: 5) represented in FIG. 2, which leads to an attempt to identify the messenger RNA's coding for a protein T2 and to clone the cDNA corresponding to T2.
b) Cloning of the cDNA Homologous to ICE
The total RNA's were extracted and purified using a RNA.TM. kit (Bioprobe) starting with either monocytes activated by LPS for 18 hours, or placenta, or polynuclear cells isolated from peripheral blood. Each corresponding cDNA was synthesized using a poly-dT oligonucleotide and the reverse transcriptase enzyme using the GeneAmp RNA PCR Kit (Perkin Elmer) according to the supplier's instructions then amplified using PCR using the following two oligonucleotides:
T2.A: CTACAGAGCTGGAGGCATTTGCT (SEQ ID NO: 6)
chosen from the sequence coding for exon 6 of T2, so as to specifically amplify a sequence of T2 type but not an ICE sequence, and
ICE45.3 TTAATGTCCTGGGAAGAGGTAGAA (SEQ ID NO: 7)
chosen from the 3' end of the coding region of the cDNA of ICE (complementary strand).
A fragment of approximately 600 base pairs was obtained respectively from each of the 3 RNA preparations using the following amplification conditions: 94.degree. C., 30 s; 60.degree. C., 30 s; 72.degree. C., 30 s; 30 cycles with the GeneAmp RNA PCR Kit (Perkin Elmer). The fragment was cloned using the TA Cloning kit (Invitrogen) and sequenced as indicated above. The nucleotide sequence thus determined does not correspond to an expected T2 cDNA but to a new cDNA which we have called Tx.
C--Identification of the Tx cDNA
a) Determination of the Consensus Sequence of Tx cDNA
The nucleotide sequences of the 5' and 3' ends of the cDNA of Tx were obtained by the anchored PCR technique from a cDNA of the placenta.
The 5' end of the cDNA of Tx was amplified using the 5'-Race-Ready cDNA kit (Human Quick-Clone cDNA) (Clontech) and the following amplification oligonucleotides:
TxPCR5A: GAGGCAGTTG CGGTTGTTGA A (SEQ ID NO: 8)
TxPCR5B: CTCTGACCCA CAGTTCCCCA C (SEQ ID NO: 9)
The 3' end of the Tx cDNA was amplified using the 3' RACE System kit (Gibco-BRL), and the following amplification oligonucleotides:
TxA: AACTGTGCAT GATGAGA (SEQ ID NO: 10)
TxB: AGATGCTGTG TACAAGACC (SEQ ID NO: 11)
These two respective pairs of primers were defined from the partial sequence of Tx obtained above.
The amplification fragments obtained were then cloned using the TA Cloning kit (Invitrogen) and sequenced as indicated above.
The nucleotide sequences were confirmed thanks to the use of the TxA oligonucleotides (SEQ ID NO: 10) and TxB oligonucleotides (SEQ ID NO: 11) above and the following oligonucleotides:
TxC: GCCTGGACAA TGATGAC (SEQ ID NO: 12)
TxD: TGATGAAGAT AGAGCCC (SEQ ID NO: 13)
Tx1: CGGGTCATGG CAGACTC (SEQ ID NO: 14)
Tx2: GTTTGAAGAA GCATTTG (SEQ ID NO: 15)
Tx3: CCTGAGTCAG GAGAATC (SEQ ID NO: 16)
Tx4: AGTCTCAGGA ATTCTTC (SEQ ID NO: 17)
Tx5: AGCTGACTTT GACATCA (SEQ ID NO: 18)
Tx6: GCGCTGACTC CATATCC (SEQ ID NO: 19)
which were chosen from the sequence coding for Tx (coding strand or complementary strand).
The compilation of all of the sequences obtained produces the consensus nucleotide sequence of the Tx cDNA (SEQ ID NO: 1) represented in FIG. 3. The sequence thus determined comprises 1291 nucleotides ending with a polyadenylation sequence. It has an open reading frame beginning with a methionine initiator at nucleotide 42 and ending with a termination codon at nucleotide 1172. The result is an open reading frame of 1131 nucleotides coding for a protein of 377 amino acids.
b--Cloning of the Coding Region of the Tx cDNA
The coding region of the Tx cDNA (SEQ ID NO: 1) was amplified by RT-PCR from the total RNA either of monocytes, or of polynuclear cells or of placenta using the following oligonucleotides:
TxP5: CGCGGATCCACCATGGCAGAAGGCAACCACAGA (SEQ ID NO: 20)
TxP3: GGCTCTAGACTCGAGTTATCAATTGCCAGGAAAGAGGTA (SEQ ID NO: 21)
These amplification primers were chosen according to the Tx cDNA consensus sequence previously determined (or the complementary strand) and synthesized by adding BamH1 and Nco1 cloning sites for the oligonucleotide TxP5 and Xba1 and Xho1 cloning sites for the oligonucleotide TxP3 respectively.
The amplified product obtained having a length of approximately 1150 base pairs was digested by the enzymes BamH1 and Xba1 (Boehringer Mannheim) and cloned, by using the Amersham ligation kit, in the vector pcDNAI/Amp (Invitrogen) digested beforehand by the same restriction enzymes BamH1 and Xba1. The cloned product was entirely sequenced over the two strands, by means of the oligonucleotides TxA, TxB, TxC, TxD, Tx1, Tx2, Tx3, Tx4, Tx5 and Tx6 above.
For each starting RNA used, the nucleotide sequence obtained is identical to the sequence coding for the Tx cDNA consensus sequence (SEQ ID NO: 1) above. Therefore no difference is observed between the different tissues used which originate from different individuals.
The coding region of the Tx cDNA codes for the protein Tx the derived amino acid sequence of which (SEQ ID NO: 2) is shown in FIG. 3. The sequence of the protein Tx includes 377 amino acids having a calculated molecular weight of 43.26 kDa.
The homology of the sequence of the protein Tx with the precursor ICE p45 is at most 52% identicalin terms of amino acids by introducing discontinuities in the alignment of the sequences.
A sample of E. coli XL-1 blue containing the region coding for the Tx cDNA (SEQ ID NO: 1) in the vector pcDNAI/Amp (Tx cDNA/pcDNAI 13/07/94) was deposited at the CNCM on Jul. 29, 1994 under the number I-1462.
c--Expression of the Tx mRNA in Various Human Tissues
The expression of the mRNA coding for the protein Tx was studied in eight different tissues by Northern Blot using a DNA probe corresponding to the part of Tx which is aligned with exon 6 of ICE ("Tx exon 6"). This probe corresponds to nucleotides 595 to 811 of the sequence SEQ ID NO: 1.
The probe "Tx exon 6" was prepared by amplifying this sequence starting from the plasmid containing the Tx cDNA using as primers the oligonucleotides T2.A (SEQ ID NO: 6) and TxC (SEQ ID NO: 12) above.
This probe was labelled with .sup.32 P by the method of random priming with the Oligolabelling kit (Pharmacia BioTech) then used to detect by hybridization the Tx mRNA's on a membrane containing 2 .mu.g of RNA polyA+ respectively of different human tissues on a Multiple Tissue Northern Blot II membrane (Clontech) according to the hybridization conditions provided by the supplier.
As is shown in FIG. 4, an mRNA signal is detected in most of the tissues tested with variable intensities. The peripheral blood leucocytes (H) produce the strongest signal. The spleen (A), the small intestine (F), the thymus (B) and the ovary (E) produce intermediate signals. The prostate (C) and the colon (G) produce a very weak signal and finally no signal is detected in testicle mRNA (D).
The mRNA coding for the protein Tx is therefore expressed in many tissues and quite particularly in blood cells.
EXAMPLE 2
Study of the Function of the Protein Tx
A--Cleavage of the Pre-IL-1.beta.
The capacity of the protein Tx to optionally cleave the precursor of human IL-1.beta. was tested in a eukaryotic cell transfection system with one or other of the expression vectors pcDNAI/Amp and pcDL-SRalpha296.
The region coding for the Tx cDNA (SEQ ID NO: 1) was first cloned at the BamH1 and Xba1 sites of the eukaryotic expression vector pcDNAI/Amp (Invitrogen). After digestion with the enzymes BamH1 and Xba1, an insert of about 1150 base pairs was isolated then purified. The restriction sites of the ends were filled using T4 DNA Polymerase (Boehringer Mannheim). The cDNA obtained was sub-cloned using a ligation kit (Amersham) in the vector pcDL-SRalpha296 (Takebe et al., Molecular and Cellular Biology, Vol. 8, 466, 1988) opened by the Xba1 enzyme then the ends of which were filled by T4 DNA Polymerase. After purification using the plasmid maxi kit (QIAGEN), Tx plasmid DNA preparations in the two vectors were obtained.
The eukaryotic cells used for the transfection are a Cos-1 cell line which constitutively expresses pIL-1.beta. and which was obtained by transfection of a plasmid containing the gene of human pIL-1.beta.. The synthesis of pIL-1.beta. is maintained in this line by cultivating the cells in the presence of 0.5 mg/ml of G-418 sulphate in a DMEM, 10% FCS, glutamine, P/S, pyruvate, HEPES culture medium.
3.times.10.sup.6 Cos-1 cells are incubated at 37.degree. C. in a humid atmosphere with 5% CO.sub.2 in Petri dishes and transfected by 15 .mu.g of plasmid DNA previously mixed with 200 .mu.l of DEAE-DEXTRAN and diluted with 4 ml of PBS before being added to the dishes. After incubation of the cells at 37.degree. C. for 30 minutes and the addition of 8 ml of an 80 .mu.M chloroquine solution in DMEM without serum, the cells are incubated for 2.5 hours. The supernatant solution is then aspirated and the cells are treated for two minutes with DMSO at 10% in DMEM without serum. After washing with the medium without serum, 10 ml of the above complete culture medium is added. After incubation, the supernatant of the transfected cells is collected at different times comprised between 16 and 45 hours.
The mature IL-1.beta. present in the supernatants is measured using an ELISA IL1-.beta. test (R&D Systems) which allows the specific detection of mature IL-1.beta..
The transfection was carried out with the coding region of the Tx cDNA inserted in one or other of the two vectors above in comparison with transfections containing the coding region of the cDNA of ICE p45 or ICE p30 respectively as well as a control transfection with the corresponding vector alone not containing plasmid.
As is shown in FIG. 5, the transfection of the cDNA of ICE p45 (column 2) or p30 (column 7) confers on the cells the capacity to secrete mature IL-1.beta.. By contrast, when the Tx cDNA is transfected under the same conditions (columns 3 and 6), no secretion of IL-1.beta. is observed as for the control transfections (columns 1, 4, 5). Similar results are obtained with the two expression vectors whatever the incubation time (16 h: FIG. 5A; 24 h: FIG. 5B; 29 h and up to 44 h) after the transfection.
The protein Tx does not possess the convertase property of IL-1.beta..
B--Protease Activity of the Protein Tx: Cleavage of the 30 kDa Precursor of ICE
The capacity of the protein Tx to optionally cleave the 30 kDa precursor of ICE (ICE p30) was tested in a co-transfection system in eukaryotic cells by simultaneously introducing into Cos-1 cells a vector containing the coding region of the Tx cDNA (SEQ ID NO: 1) and a vector containing a DNA coding for a modified ICE protein, each DNA being respectively inserted into the expression vector pcDL-SRalpha296 above.
The protein ICE was doubly modified: On the one hand, to allow a specific detection of the protein ICE in the presence of the protein Tx, a small T7 peptide was fused to the N terminal end of the protein ICE p30. The protein thus marked or its maturation products are detectable by Western Blotting with a monoclonal antibody specific to the T7 peptide (Tsai et al., Proc. Natl. Acad. Sci., 89, 8864, 1992). On the other hand to express the enzyme in a form which is incapable of inducing its own maturation, a mutant of ICE p30 was used, the cysteine Cys 285 of the active site of which was replaced by a serine (Wilson, K. P. et al. Nature, 370, Jul. 28, 1994, 270-275). This enzyme is thus inactive and incapable of inducing its own maturation or cleaving pIL-1.beta.. The mutant was prepared by site-directed mutagenesis using the appropriate oligonucleotides and the Transformer.TM. site-directed mutagenesis kit (Clontech). The sequence obtained was entirely verified. In this way the marked and mutated ICE p30 is obtained designated T7-ICEp30C285S.
Cos-1 cells were transfected either with the vector pcDL-SRalpha296 containing T7-ICEp30C285S, or with the vector pcDL-SRalpha296 container Tx or co-transfected with the two vectors, following the above operating conditions. After culture for 22 hours, the cells were collected, washed and lysed in a buffer containing 10 mM NaCl, 10 mM Hepes, pH 7.4, 1 mM EDTA, 50 mM NaF, 0.2% Triton X-100, 1 .mu.g/ml leupeptin, 20 u/.mu.l aprotinin and 1 mM PMSF. The cellular lysate was centrifuged at 400 g and 4.degree. C. then the supernatant was subjected to an electrophoresis on a 16% polyacrylamide gel using SDS-PAGE. The proteins of the gel were then transferred onto a nitrocellulose membrane and incubated with the anti-T7 mouse monoclonal antibody (Novagen) for 2 hours at ambient temperature. The membrane was washed then incubated for 1 hour at ambient temperature with a mouse anti-immunoglobulin goat antibody conjugated with alkaline phosphatase. The antibodies fixed to the membrane are then revealed by the alkaline phosphatase substrate (Promega).
Co-transfections were carried out in the same manner with the vector pcDL-SRalpha296 containing T7-ICEp30C285S and the vector pcDL-SRalpha296 containing either ICE p30, or ICE p45 in place of Tx.
As is shown in FIG. 6, when the mutated protein ICE p30 (T7-ICEp30C285S) is expressed alone in the transfected Cos cells, the T7-p30 form of the enzyme (apparent MW 35 kDa) can be detected (line B).
The absence of a band corresponding to the p20 form shows that the mutated enzyme is incapable of self-cleavage. When the cells are co-transfected by the vector containing the ICE p30 enzyme (line C) or the p45 enzyme (line D), a band is observed at an apparent MW of 26 kDa corresponding to the cleavage product of T7-p20 by the active enzyme. When the cells are co-transfected by the vector containing Tx (line E), the appearance of a major band is also observed at an apparent MW of 26 kDa accompanied by two minor bands of approximately 31 kDa and 28 kDa. The different bands correspond to the cleavage products of the p30 form of the ICE by the protein Tx expressed in the cells.
These results show that the protein Tx, on the one hand is expressed in the transfected Cos cells, and on the other hand has a protease activity. In addition, the protein Tx is capable of cleaving the 30 KDa precursor of ICE and can thus contribute to the maturation in vivo of the pro-enzyme of ICE and to the generation of the enzyme in active form.
C--Induction of Apoptosis by the Protein Tx
The capacity of the protein Tx to induce apoptosis was tested by transfection in Cos cells and by morphological examination of the cultured cells.
The transfection of ICE in different cell types leading to the death of these cells by apoptosis has been described (Miura et al. already quoted).
The transfection of Cos-1 cells by the vector pcDL-SRalpha296 containing the coding region of the Tx cDNA (SEQ ID NO: 1) as well as transfection with the vector pcDL-SRalpha296 containing ICE p45 was carried out as described above. The morphology of the cells was observed after an incubation of 22 hours.
As is shown in FIG. 7, the appearance of round cells is observed which detach themselves from the support and the morphological appearance of which is characteristic of cells in apoptosis in the Cos cell cultures transfected by the cDNA of ICE (7D). The same change in morphology is observed in Cos cell cultures transfected by Tx cDNA (7C).
Identical morphological results were obtained when the above vector pcDNAI/Amp is used to express ICE and Tx in transfected Cos-1 cells.
These results were confirmed by observation of the DNA isolated from transfected Cos-1 cells and incubated 40 hours after transfection. The DNA of the cells was prepared with the microTurboGen kit (Invitrogen), migrated on 1.5% agarose gel and stained with BET.
As shown in FIG. 8, the DNA of the cells transfected with ICE p45 (line B) and with Tx (line C) have the characteristic "scalariform" appearance of cells in apoptosis.
Cells transfected without DNA (7A and 8A) or with the vector not containing cDNA (7B and 8D) have neither the morphology nor the DNA of cells in apoptosis.
These results show that the protein Tx is involved in the induction of apoptosis.
EXAMPLE 3
Identification of the Ty Sequence
A--Cloning of Genes Homologous to Tx
The human genomic DNA extracted from peripheral blood mononuclear cells was digested by the Hind III enzyme (Boehringer Mannheim), then the fragments were separated by preparative electrophoresis in 1% agarose, 1.times.TAE gel, according to the conditions described by Maniatis et al., already quoted. The gel was cut into 24 fractions in the area of the deposition wells corresponding to molecular weights greater than 1.9 kb then amplification using PCR was carried out on the DNA eluted from each of the fractions using the T2A (SEQ ID NO: 6) and TxC (SEQ ID NO: 12) oligonucleotides already described and using the following amplification conditions: 94.degree. C., 30 sec.; 55.degree. C., 30 sec.; 72.degree. C., 1 mn; 30 cycles; BioTaq polymerase (BioProbe).
Among the above 24 fractions, 10 fractions which produced the best amplification using PCR were retained. The amplified material was purified on agarose gel and was cloned in the vector PCRII with the TA Cloning kit (Invitrogen) and sequenced by the Sanger technique with the Sequenase enzyme (Version 2.0 DNA Sequencing Kit) using the Macrophor electrophoresis system (Pharmacia System). The determined sequences were analyzed by means of GCG software as indicated in Example 1.
A nucleotide sequence was identified called Ty which has a 94.9% identity in terms of nucleotides with the Tx cDNA sequence (SEQ ID NO: 1) and which leads an attempt to clone the cDNA corresponding to Ty.
B--Cloning and Identification of Ty cDNA
a) Determination of the Consensus Sequence of Ty cDNA
The nucleotide sequences of the 5' and 3' ends of the cDNA of Ty were obtained from the cDNA of human spleen and placenta respectively using the anchored PCR technique.
The 3' end of the cDNA of Ty was amplified using the 3'RACE System kit (Gibco-BRL), and the following amplification oligonucleotides:
Ty 3.2: CATGTCTCATGGCATCCTA (SEQ ID NO: 24)
and
Ty 3.1: CTGCGGAACTGCGCATAAAA (SEQ ID NO: 25).
These two primers were defined from the partial sequence of the exon 6 of the Ty sequence obtained above. The amplified fragments were purified on agarose gel, cloned in the vector pCRII and sequenced as indicated above. Compilation of the sequences obtained allowed the 3' part of the coding region of the Ty cDNA as well as the non-coding 3' region to be defined.
The 5' end of the cDNA of Ty was been amplified using the Human Spleen 5'-RACE-Ready cDNA kit (Clontech) and the following amplification oligonucleotides:
Ty5A1: GGCTCTAGACTCGAGGTGCTCTTTGATGTTGACAG (SEQ ID NO: 26)
and
Ty5A4: CTTCTCCTCGTGGATCTTGC (SEQ ID NO: 27).
These two primers were defined from the sequence of the 3' region of the Ty cDNA obtained above by adding the restriction sites Xba1 and Xho1 for Ty5A1. The amplification fragments were then cloned using the TA Cloning kit (Invitrogen) and sequenced as indicated above.
The nucleotide sequences were confirmed by using the Ty5A1 (SEQ ID NO: 26) and Ty 3.1 (SEQ ID NO: 25) oligonucleotides above and the following oligonucleotides:
Ty 2: AGATGTTCTTCATGGT (SEQ ID NO: 28)
Ty 4: CTTCTCAATATGGACCA (SEQ ID NO: 29)
Ty 5: CCTGGCTCTCATCATAT (SEQ ID NO: 30)
Ty 6: ATTTGCTGCCAGACCAGA (SEQ ID NO: 31)
Ty 7: GCCTGCAGAGGTGAAAAAC (SEQ ID NO: 32)
Ty 8: GCTCCATCTTCATTACGGA (SEQ ID NO: 33)
Ty 0: GATTTCTGTACCTTCCG (SEQ ID NO: 34)
Ty A: TTTATGCGCAGTTCCG (SEQ ID NO: 35)
Ty B: GTCATAGTGAGCCCCATT (SEQ ID NO: 36)
Ty C: CTTCACGAGGACAAAGT (SEQ ID NO: 37)
Ty D: TCGCAAAGAGTCTACCA (SEQ ID NO: 38)
These oligonucleotides were chosen from the coding sequence of Ty (coding strand or complementary strand).
Compilation of all the sequences obtained produces the consensus nucleotide sequence of the Ty cDNA (SEQ ID NO: 22).
b) Cloning of the Coding Region of Ty cDNA
The coding region of the Ty cDNA (SEQ ID NO: 22) was amplified using PCR starting from the cDNA of human spleen or placenta using the corresponding 5'-RACE-Ready cDNA kit (Clontech), the oligonucleotide Ty5A1 (SEQ ID NO: 26) above and the following oligonucleotide:
TyP5: CGCGGATCCAAGATGTTGGAATACCTGGGCAAA (SEQ ID NO: 39).
These amplification primers were chosen according to the consensus sequence of the Ty cDNA (SEQ ID NO: 22) determined above by adding the cloning site BamH1 for TyP5.
The product which had been amplified and purified on agarose gel and having a length of approximately 1100 base pairs was digested by the restriction enzymes BamH1 and Xba1 then cloned in the vector pcDNAI/Amp as described in Example 1 and sequenced as indicated above. The cloned product was entirely sequenced over the two strands using the oligonucleotides SEQ ID NO: 28 to SEQ ID NO: 38 defined above.
An identical sequence to the coding sequence of the consensus sequence Ty cDNA (SEQ ID NO: 22) was obtained. The homology of the coding sequence of the Ty cDNA with the codign sequence of the Tx cDNA obtained in Example 1 is 84% identity of nucleotides.
The coding region of the Ty cDNA codes for the Ty protein having the derived amino acid sequence SEQ ID NO: 23. The protein sequence contains 364 amino acids having a calculated molecular weight of 41.8 kDa.
The homology of sequence of the Ty protein with the Tx protein obtained in Example 1 is 75% identity of amino acids.
A sample of E. coli XL-1 blue containing the coding region of the Ty cDNA (SEQ ID NO: 22) in the vector PcDNAI/Amp (Ty cDNA/pcDNAI/Amp 30/6/95) was deposited at the CNCM on Jul. 5, 1995 under the No. I-1068.
EXAMPLE 4
Biological Activities of the Protein Ty
A--Induction of Apoptosis
The capacity of the protein Ty to induce apoptosis was tested according to the operating method indicated in Example 2, using Cos-1 cells transfected by the vector pcDL-SRalpha296 containing the coding region of the Ty cDNA (SEQ ID NO: 22) named pcDL-TY, and the preparation of which was carried out according to the conditions described in Example 2 for the sub-cloning of the Tx cDNA.
The morphology of the cells was observed after incubation for 23 hours and 43 hours and observation of the isolated DNA was carried out after incubation for 43 hours.
The results, obtained in comparison to cells transfected by the vector containing the coding region of Tx or ICE p45, are identical to those shown for the protein Tx in FIG. 7 and in FIG. 8 of Example 2.
These results show that the protein Ty as well as the protein Tx is involved in the induction of apoptosis.
B--Protease Activity of the Protein Ty
The capacity of the protein Ty to self-cleave in an intermolecular manner was tested in a co-transfection system in eukaryotic cells, under similar conditions to those to described for cleavage of the precursor of ICE by the protein Tx in Example 2, by simultaneously introducing into Cos-1 cells a vector containing the coding region of the Ty cDNA (SEQ ID NO: 22) and a vector containing a DNA coding for a modified protein Ty, each DNA being inserted in the expression vector pcDL-SRalpha296 and in the vector pcDNAI/Amp described in Example 2 respectively.
The protein Ty was doubly modified, on the one hand the Cys 245 codon was mutated into a Serine codon by the "overlapping" PCR method, on the other hand the epitope tag T7 (MASMTGGQQMG) was introduced into the N-terminal end of the Ty fragment corresponding to residues 68 to 364 of the sequence SEQ ID NO: 23.
The following pairs of primers were used to amplify the TY cDNA template:
a) on the one hand,
T7TY: CGCGGATCCACCATGGCTTCTATGACAGGAGGTCAACAAATGGGACAAAAGATCACCAGTG TAAAACC (SEQ ID NO: 40)
chosen from the coding sequence of Ty and synthesized by adding a restriction site BamH1 followed by the nucleotide sequence coding for tag T7 and
TYC245SR: ATGTTTTTCACCTCTGGAGGCCTGGACAATGATGAC (SEQ ID NO: 41)
chosen from the coding sequence of Ty (complementary strand) with a C.fwdarw.G mutation in position 17,
b) on the other hand,
TYC245S: GTCATCATTGTCCAGGCCTCCAGAGGTGAAAAACAT (SEQ ID NO: 42)
chosen from the coding sequence of Ty with a G.fwdarw.C mutation in position 20 and Ty5A1 (SEQ ID NO: 26) above,
and using the following amplification conditions: 94.degree. C., 1 mn; 60.degree. C., 1 mn; 72.degree. C., 1 mn; 30 cycles; Vent polymerase (Biolabs). The two amplification products obtained respectively were combined and amplified by PCR by using primers T7Ty and Ty5A1 and the above conditions.
The amplification product was digested with the restriction enzymes BamH1 and Xba1 then cloned in the vector pcDNAI/Amp digested beforehand by the same restriction enzymes. The resulting plasmid is called pT7TY.DELTA.67C245S. The sequence obtained was entirely verified by DNA sequencing.
The expression vector pcDL-SRalpha296 in which the Ty cDNA sequence (SEQ ID NO: 22) was sub-cloned, called plasmid pcDL-TY, was prepared as indicated above.
Cos-1 cells were either transfected by the vector pT7TY.DELTA.67C245S, or co-transfected with this plasmid and the plasmid pcDL-TY then cultured for 23 hours or 43 hours, lysed and analyzed by electrophoresis on polyacrylamide gel and Western blot using the mouse anti-T7 monoclonal antibody, according to the operating conditions described in Example 2, but in which the mouse anti-immunoglobulin goat antibody is conjugated to horseradish peroxidase instead of the alkaline phosphatase. The antibodies linked to the membrane are then revealed with the ECL Western detection system (Amersham) using autoradiography.
Co-transfections were carried out in the same manner with the vector pcDL-SRalpha296 alone and the vector pcDNAI/Amp and the cells were cultured for 23 hours.
As shown in FIG. 9, when the mutated protein Ty is expressed alone in transfected Cos cells, the T7Ty form (apparent MW approximately 30 kDa) can be detected (line E). The absence of a band of lower MW shows that the mutated protein Ty is incapable of self-cleaving. When the cells are co-transfected with the vector containing Ty (lines F and G), the appearance of a major band is observed at an apparent MW of 20 kDa corresponding to the cleavage product of the protein Ty mutated by the protein Ty.
These results show that the protein Ty is on the one hand expressed in transfected Cos cells, and on the other hand has a protease activity and that it is in particular capable of self-cleaving in an intermolecular manner.
__________________________________________________________________________# SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 42 - - - - (2) INFORMATION FOR SEQ ID NO: 1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1291 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapi - #ens - - (ix) FEATURE: (A) NAME/KEY: CDS - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #1: - - GCTCTTTCCA ACGCTGTAAA AAAGGACAGA GGCTGTTCCC T ATG GCA - #GAA GGC 53 - # - # Met Ala Glu Gly - # - # 1 - - AAC CAC AGA AAA AAG CCA CTT AAG GTG TTG GA - #A TCC CTG GGC AAA GAT 101 Asn His Arg Lys Lys Pro Leu Lys Val Leu Gl - #u Ser Leu Gly Lys Asp 5 - # 10 - # 15 - # 20 - - TTC CTC ACT GGT GTT TTG GAT AAC TTG GTG GA - #A CAA AAT GTA CTG AAC 149 Phe Leu Thr Gly Val Leu Asp Asn Leu Val Gl - #u Gln Asn Val Leu Asn 25 - # 30 - # 35 - - TGG AAG GAA GAG GAA AAA AAG AAA TAT TAC GA - #T GCT AAA ACT GAA GAC 197 Trp Lys Glu Glu Glu Lys Lys Lys Tyr Tyr As - #p Ala Lys Thr Glu Asp 40 - # 45 - # 50 - - AAA GTT CGG GTC ATG GCA GAC TCT ATG CAA GA - #G AAG CAA CGT ATG GCA 245 Lys Val Arg Val Met Ala Asp Ser Met Gln Gl - #u Lys Gln Arg Met Ala 55 - # 60 - # 65 - - GGA CAA ATG CTT CTT CAA ACC TTT TTT AAC AT - #A GAC CAA ATA TCC CCC 293 Gly Gln Met Leu Leu Gln Thr Phe Phe Asn Il - #e Asp Gln Ile Ser Pro 70 - # 75 - # 80 - - AAT AAA AAA GCT CAT CCG AAT ATG GAG GCT GG - #A CCA CCT GAG TCA GGA 341 Asn Lys Lys Ala His Pro Asn Met Glu Ala Gl - #y Pro Pro Glu Ser Gly 85 - # 90 - # 95 - #100 - - GAA TCT ACA GAT GCC CTC AAG CTT TGT CCT CA - #T GAA GAA TTC CTG AGA 389 Glu Ser Thr Asp Ala Leu Lys Leu Cys Pro Hi - #s Glu Glu Phe Leu Arg 105 - # 110 - # 115 - - CTA TGT AAA GAA AGA GCT GAA GAG ATC TAT CC - #A ATA AAG GAG AGA AAC 437 Leu Cys Lys Glu Arg Ala Glu Glu Ile Tyr Pr - #o Ile Lys Glu Arg Asn 120 - # 125 - # 130 - - AAC CGC ACA CGC CTG GCT CTC ATC ATA TGC AA - #T ACA GAG TTT GAC CAT 485 Asn Arg Thr Arg Leu Ala Leu Ile Ile Cys As - #n Thr Glu Phe Asp His 135 - # 140 - # 145 - - CTG CCT CCG AGG AAT GGA GCT GAC TTT GAC AT - #C ACA GGG ATG AAG GAG 533 Leu Pro Pro Arg Asn Gly Ala Asp Phe Asp Il - #e Thr Gly Met Lys Glu 150 - # 155 - # 160 - - CTA CTT GAG GGT CTG GAC TAT AGT GTA GAT GT - #A GAA GAG AAT CTG ACA 581 Leu Leu Glu Gly Leu Asp Tyr Ser Val Asp Va - #l Glu Glu Asn Leu Thr 165 1 - #70 1 - #75 1 -#80 - - GCC AGG GAT ATG GAG TCA GCG CTG AGG GCA TT - #T GCT ACC AGA CCAGAG 629 Ala Arg Asp Met Glu Ser Ala Leu Arg Ala Ph - #e Ala Thr Arg Pro Glu 185 - # 190 - # 195 - - CAC AAG TCC TCT GAC AGC ACA TTC TTG GTA CT - #C ATG TCT CAT GGC ATC 677 His Lys Ser Ser Asp Ser Thr Phe Leu Val Le - #u Met Ser His Gly Ile 200 - # 205 - # 210 - - CTG GAG GGA ATC TGC GGA ACT GTG CAT GAT GA - #G AAA AAA CCA GAT GTG 725 Leu Glu Gly Ile Cys Gly Thr Val His Asp Gl - #u Lys Lys Pro Asp Val 215 - # 220 - # 225 - - CTG CTT TAT GAC ACC ATC TTC CAG ATA TTC AA - #C AAC CGC AAC TGC CTC 773 Leu Leu Tyr Asp Thr Ile Phe Gln Ile Phe As - #n Asn Arg Asn Cys Leu 230 - # 235 - # 240 - - AGT CTG AAG GAC AAA CCC AAG GTC ATC ATT GT - #C CAG GCC TGC AGA GGT 821 Ser Leu Lys Asp Lys Pro Lys Val Ile Ile Va - #l Gln Ala Cys Arg Gly 245 2 - #50 2 - #55 2 -#60 - - GCA AAC CGT GGG GAA CTG TGG GTC AGA GAC TC - #T CCA GCA TCC TTGGAA 869 Ala Asn Arg Gly Glu Leu Trp Val Arg Asp Se - #r Pro Ala Ser Leu Glu 265 - # 270 - # 275 - - GTG GCC TCT TCA CAG TCA TCT GAG AAC CTG GA - #G GAA GAT GCT GTT TAC 917 Val Ala Ser Ser Gln Ser Ser Glu Asn Leu Gl - #u Glu Asp Ala Val Tyr 280 - # 285 - # 290 - - AAG ACC CAC GTG GAG AAG GAC TTC ATT GCT TT - #C TGC TCT TCA ACG CCA 965 Lys Thr His Val Glu Lys Asp Phe Ile Ala Ph - #e Cys Ser Ser Thr Pro 295 - # 300 - # 305 - - CAC AAC GTG TCC TGG AGA GAC AGC ACA ATG GG - #C TCT ATC TTC ATC ACA 1013 His Asn Val Ser Trp Arg Asp Ser Thr Met Gl - #y Ser Ile Phe Ile Thr 310 - # 315 - # 320 - - CAA CTC ATC ACA TGC TTC CAG AAA TAT TCT TG - #G TGC TGC CAC CTA GAG 1061 Gln Leu Ile Thr Cys Phe Gln Lys Tyr Ser Tr - #p Cys Cys His Leu Glu 325 3 - #30 3 - #35 3 -#40 - - GAA GTA TTT CGG AAG GTA CAG CAA TCA TTT GA - #A ACT CCA AGG GCCAAA 1109 Glu Val Phe Arg Lys Val Gln Gln Ser Phe Gl - #u Thr Pro Arg Ala Lys 345 - # 350 - # 355 - - GCT CAA ATG CCC ACC ATA GAA CGA CTG TCC AT - #G ACA AGA TAT TTC TAC 1157 Ala Gln Met Pro Thr Ile Glu Arg Leu Ser Me - #t Thr Arg Tyr Phe Tyr 360 - # 365 - # 370 - - CTC TTT CCT GGC AAT TGAAAATGGA AGCCACAAGC AGCCCAGCC - #C TCCTTAATCA 1212 Leu Phe Pro Gly Asn 375 - - ACTTCAAGGA GCACCTTCAT TAGTACAGCT TGCATATTTA ACATTTTGTA TT -#TCAATAAA 1272 - - AGTGAAGACA AAAAAAAAA - # - # 129 - #1 - - - - (2) INFORMATION FOR SEQ ID NO: 2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 377 (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #2: - - Met Ala Glu Gly Asn His Arg Lys Lys Pro Le - #u Lys Val Leu Glu Ser 1 5 - # 10 - # 15 - - Leu Gly Lys Asp Phe Leu Thr Gly Val Leu As - #p Asn Leu Val Glu Gln 20 - # 25 - # 30 - - Asn Val Leu Asn Trp Lys Glu Glu Glu Lys Ly - #s Lys Tyr Tyr Asp Ala 35 - # 40 - # 45 - - Lys Thr Glu Asp Lys Val Arg Val Met Ala As - #p Ser Met Gln Glu Lys 50 - # 55 - # 60 - - Gln Arg Met Ala Gly Gln Met Leu Leu Gln Th - #r Phe Phe Asn Ile Asp 65 - # 70 - # 75 - # 80 - - Gln Ile Ser Pro Asn Lys Lys Ala His Pro As - #n Met Glu Ala Gly Pro 85 - # 90 - # 95 - - Pro Glu Ser Gly Glu Ser Thr Asp Ala Leu Ly - #s Leu Cys Pro His Glu 100 - # 105 - # 110 - - Glu Phe Leu Arg Leu Cys Lys Glu Arg Ala Gl - #u Glu Ile Tyr Pro Ile 115 - # 120 - # 125 - - Lys Glu Arg Asn Asn Arg Thr Arg Leu Ala Le - #u Ile Ile Cys Asn Thr 130 - # 135 - # 140 - - Glu Phe Asp His Leu Pro Pro Arg Asn Gly Al - #a Asp Phe Asp Ile Thr 145 1 - #50 1 - #55 1 -#60 - - Gly Met Lys Glu Leu Leu Glu Gly Leu Asp Ty - #r Ser Val Asp ValGlu 165 - # 170 - # 175 - - Glu Asn Leu Thr Ala Arg Asp Met Glu Ser Al - #a Leu Arg Ala Phe Ala 180 - # 185 - # 190 - - Thr Arg Pro Glu His Lys Ser Ser Asp Ser Th - #r Phe Leu Val Leu Met 195 - # 200 - # 205 - - Ser His Gly Ile Leu Glu Gly Ile Cys Gly Th - #r Val His Asp Glu Lys 210 - # 215 - # 220 - - Lys Pro Asp Val Leu Leu Tyr Asp Thr Ile Ph - #e Gln Ile Phe Asn Asn 225 2 - #30 2 - #35 2 -#40 - - Arg Asn Cys Leu Ser Leu Lys Asp Lys Pro Ly - #s Val Ile Ile ValGln 245 - # 250 - # 255 - - Ala Cys Arg Gly Ala Asn Arg Gly Glu Leu Tr - #p Val Arg Asp Ser Pro 260 - # 265 - # 270 - - Ala Ser Leu Glu Val Ala Ser Ser Gln Ser Se - #r Glu Asn Leu Glu Glu 275 - # 280 - # 285 - - Asp Ala Val Tyr Lys Thr His Val Glu Lys As - #p Phe Ile Ala Phe Cys 290 - # 295 - # 300 - - Ser Ser Thr Pro His Asn Val Ser Trp Arg As - #p Ser Thr Met Gly Ser 305 3 - #10 3 - #15 3 -#20 - - Ile Phe Ile Thr Gln Leu Ile Thr Cys Phe Gl - #n Lys Tyr Ser TrpCys 325 - # 330 - # 335 - - Cys His Leu Glu Glu Val Phe Arg Lys Val Gl - #n Gln Ser Phe Glu Thr 340 - # 345 - # 350 - - Pro Arg Ala Lys Ala Gln Met Pro Thr Ile Gl - #u Arg Leu Ser Met Thr 355 - # 360 - # 365 - - Arg Tyr Phe Tyr Leu Phe Pro Gly Asn 370 - # 375 - - - - (2) INFORMATION FOR SEQ ID NO: 3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Thornberry, - #Nancy A. Bull, Her - #bert G. Calaycay, - #Jimmy R. Chapman, - #Kevin T. Howard, A - #ndrew D. Kostura, - #Matthew J. Miller, D - #ouglas K. Molineaux, - #Susan M. Weidner, - #Jeffrey R. Aunins, J - #ohn (B) TITLE: A novel h - #eterodimeric cysteine protease is required - #for interleukin-1beta processing in monocytes (C) JOURNAL: Nature (D) VOLUME: 356 (F) PAGES: 768-774 (G) DATE: 30-APR-1992 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 3: FROM 1 TO 20 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #3: - - ACATGACTAC AGAGCTGGAG - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO: 4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Thornberry, - #Nancy A. Bull, Her - #bert G. Calaycay, - #Jimmy R. Chapman, - #Kevin T. Howard, A - #ndrew D. Kostura, - #Matthew J. Miller, D - #ouglas K. Molineaux, - #Susan M. Weidner, - #Jeffrey R. Aunins, J - #ohn (B) TITLE: A novel h - #eterodimeric cysteine protease is required - #for interleukin-1beta processing in monocytes (C) JOURNAL: Nature (D) VOLUME: 356 (F) PAGES: 768-774 (G) DATE: 30-APR-1992 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #4: - - CACCACGGCA GGCCTGGATG - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO: 5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 235 (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: Genomic DNA - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapi - #ens - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #5: - - GAAATGACTA CAGAGCTGGA GGCATTTGCT CACCGCCCAG AGCACAAGAC CT -#CTGACAGC 60 - - ACCTTCCCGG TGTTCTTGTC TCATGGTGTT CGGGAAGGCA TTTGTGGGAA GA -#AATACTCT 120 - - GAACAAGTCC CTGATATATT ACAATTCAAT GAAATATTTA AAATGTTGAA TA -#GCAAGAAC 180 - - TGCCCAAGTT TGAAGGACAA ACCCAAGGTG ATCATCTTCG AGGCCTGCTG TG - #GTG 235 - - - - (2) INFORMATION FOR SEQ ID NO: 6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 5 from 8 to 30 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #6: - - CTACAGAGCT GGAGGCATTT GCT - # - # 23 - - - - (2) INFORMATION FOR SEQ ID NO: 7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Thornberry, - #Nancy A. Bull, Her - #bert G. Calaycay, - #Jimmy R. Chapman, - #Kevin T. Howard, A - #ndrew D. Kostura, - #Matthew J. Miller, D - #ouglas K. Molineaux, - #Susan M. Weidner, - #Jeffrey R. Aunins, J - #ohn (B) TITLE: A novel h - #eterodimeric cysteine protease is required - #for interleukin-1beta processing in monocytes (C) JOURNAL: Nature (D) VOLUME: 356 (F) PAGES: 768-774 (G) DATE: 30-APR-1992 - - (xi) SEQUENCE DESCRIPTION: SEQ - #ID NO: 7: - - TTAATGTCCT GGGAAGAGGT AGAA - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO: 8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 753 - #to 773 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #8: - - GAGGCAGTTG CGGTTGTTGA A - # - # - #21 - - - - (2) INFORMATION FOR SEQ ID NO: 9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 829 - #to 849 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #9: - - CTCTGACCCA CAGTTCCCCA C - # - # - #21 - - - - (2) INFORMATION FOR SEQ ID NO: 10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 from 695 to 711 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #10: - - AACTGTGCAT GATGAGA - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #11: - - AGATGCTGTG TACAAGACC - # - # - # 19 - - - - (2) INFORMATION FOR SEQ ID NO: 12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 795 - #to 811 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #12: - - GCCTGGACAA TGATGAC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 995 - #to 1011 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #13: - - TGATGAAGAT AGAGCCC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 from 204 to 220 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #14: - - CGGGTCATGG CAGACTC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 249 - #to 265 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #15: - - GTTTGAAGAA GCATTTG - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 from 330 to 346 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #16: - - CCTGAGTCAG GAGAATC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 375 - #to 391 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #17: - - AGTCTCAGGA ATTCTTC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 from 503 to 519 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #18: - - AGCTGACTTT GACATCA - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 1 complementary from 587 - #to 603 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #19: - - GCGCTGACTC CATATCC - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #20: - - CGCGGATCCA CCATGGCAGA AGGCAACCAC AGA - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO: 21: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #21: - - GGCTCTAGAC TCGAGTTATC AATTGCCAGG AAAGAGGTA - # - # 39 - - - - (2) INFORMATION FOR SEQ ID NO: 22: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1310 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: cDNA - - (ix) FEATURE: (A) NAME/KEY: CDS - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #22: - - GAACAACGTG GCTGGACAAA CATCTATCCA GACCCTAGTA CCTAATACGG AT -#CAAAAGTC 60 - - GACCAGTGTA AAAAAAGACA ACCACAAAAA AAAAACAGTT AAG ATG TT - #G GAATAC 115 - # - # Met Leu Glu Ty -#r - # - # 1 - - CTG GGC AAA GAT GTT CTT CAT GGT GTT TTT AA - #T TAT TTG GCA AAACAC 163 Leu Gly Lys Asp Val Leu His Gly Val Phe As - #n Tyr Leu Ala Lys His 5 - # 10 - # 15 - # 20 - - GAT GTT CTG ACA TTG AAG GAA GAG GAA AAG AA - #A AAA TAT TAT GAT GCC 211 Asp Val Leu Thr Leu Lys Glu Glu Glu Lys Ly - #s Lys Tyr Tyr Asp Ala 25 - # 30 - # 35 - - AAA ATT GAA GAC AAG GCC CTG ATC TTG GTA GA - #C TCT TTG CGA AAG AAT 259 Lys Ile Glu Asp Lys Ala Leu Ile Leu Val As - #p Ser Leu Arg Lys Asn 40 - # 45 - # 50 - - CGC GTG GCT CAT CAA ATG TTT ACC CAA ACA CT - #T CTC AAT ATG GAC CAA 307 Arg Val Ala His Gln Met Phe Thr Gln Thr Le - #u Leu Asn Met Asp Gln 55 - # 60 - # 65 - - AAG ATC ACC AGT GTA AAA CCT CTT CTG CAA AT - #C GAG GCT GGA CCA CCT 355 Lys Ile Thr Ser Val Lys Pro Leu Leu Gln Il - #e Glu Ala Gly Pro Pro 70 - # 75 - # 80 - - GAG TCA GCA GAA TCT ACA AAT ATA CTC AAA CT - #T TGT CCT CGT GAA GAA 403 Glu Ser Ala Glu Ser Thr Asn Ile Leu Lys Le - #u Cys Pro Arg Glu Glu 85 - # 90 - # 95 - #100 - - TTC CTG AGA CTG TGT AAA AAA AAT CAT GAT GA - #G ATC TAT CCA ATA AAA 451 Phe Leu Arg Leu Cys Lys Lys Asn His Asp Gl - #u Ile Tyr Pro Ile Lys 105 - # 110 - # 115 - - AAG AGA GAG GAC CGC AGA CGC CTG GCT CTC AT - #C ATA TGC AAT ACA AAG 499 Lys Arg Glu Asp Arg Arg Arg Leu Ala Leu Il - #e Ile Cys Asn Thr Lys 120 - # 125 - # 130 - - TTT GAT CAC CTG CCT GCA AGG AAT GGG GCT CA - #C TAT GAC ATC GTG GGG 547 Phe Asp His Leu Pro Ala Arg Asn Gly Ala Hi - #s Tyr Asp Ile Val Gly 135 - # 140 - # 145 - - ATG AAA AGG CTG CTT CAA GGC CTG GGC TAC AC - #T GTG GTT GAC GAA AAG 595 Met Lys Arg Leu Leu Gln Gly Leu Gly Tyr Th - #r Val Val Asp Glu Lys 150 - # 155 - # 160 - - AAT CTC ACA GCC AGG GAT ATG GAG TCA GTG CT - #G AGG GCA TTT GCT GCC 643 Asn Leu Thr Ala Arg Asp Met Glu Ser Val Le - #u Arg Ala Phe Ala Ala 165 1 - #70 1 - #75 1 -#80 - - AGA CCA GAG CAC AAG TCC TCT GAC AGC ACG TT - #C TTG GTA CTC ATGTCT 691 Arg Pro Glu His Lys Ser Ser Asp Ser Thr Ph - #e Leu Val Leu Met Ser 185 - # 190 - # 195 - - CAT GGC ATC CTA GAG GGA ATC TGC GGA ACT GC - #G CAT AAA AAG AAA AAA 739 His Gly Ile Leu Glu Gly Ile Cys Gly Thr Al - #a His Lys Lys Lys Lys 200 - # 205 - # 210 - - CCG GAT GTG CTG CTT TAT GAC ACC ATC TTC CA - #G ATA TTC AAC AAC CGC 787 Pro Asp Val Leu Leu Tyr Asp Thr Ile Phe Gl - #n Ile Phe Asn Asn Arg 215 - # 220 - # 225 - - AAC TGC CTC AGT CTA AAG GAC AAA CCC AAG GT - #C ATC ATT GTC CAG GCC 835 Asn Cys Leu Ser Leu Lys Asp Lys Pro Lys Va - #l Ile Ile Val Gln Ala 230 - # 235 - # 240 - - TGC AGA GGT GAA AAA CAT GGG GAA CTC TGG GT - #C AGA GAC TCT CCA GCA 883 Cys Arg Gly Glu Lys His Gly Glu Leu Trp Va - #l Arg Asp Ser Pro Ala 245 2 - #50 2 - #55 2 -#60 - - TCC TTG GCA CTC ATC TCT TCA CAG TCA TCT GA - #G AAC CTG GAG GCAGAT 931 Ser Leu Ala Leu Ile Ser Ser Gln Ser Ser Gl - #u Asn Leu Glu Ala Asp 265 - # 270 - # 275 - - TCT GTT TGC AAG ATC CAC GAG GAG AAG GAC TT - #C ATT GCT TTC TGT TCT 979 Ser Val Cys Lys Ile His Glu Glu Lys Asp Ph - #e Ile Ala Phe Cys Ser 280 - # 285 - # 290 - - TCA ACA CCA CAT AAC GTG TCC TGG AGA GAC CG - #C ACA AGG GGC TCC ATC 1027 Ser Thr Pro His Asn Val Ser Trp Arg Asp Ar - #g Thr Arg Gly Ser Ile 295 - # 300 - # 305 - - TTC ATT ACG GAA CTC ATC ACA TGC TTC CAG AA - #A TAT TCT TGC TGC TGC 1075 Phe Ile Thr Glu Leu Ile Thr Cys Phe Gln Ly - #s Tyr Ser Cys Cys Cys 310 - # 315 - # 320 - - CAC CTA ATG GAA ATA TTT CGG AAG GTA CAG AA - #A TCA TTT GAA GTT CCA 1123 His Leu Met Glu Ile Phe Arg Lys Val Gln Ly - #s Ser Phe Glu Val Pro 325 3 - #30 3 - #35 3 -#40 - - CAG GCT AAA GCC CAG ATG CCC ACC ATA GAA CG - #A GCA ACC TTG ACAAGA 1171 Gln Ala Lys Ala Gln Met Pro Thr Ile Glu Ar - #g Ala Thr Leu Thr Arg 345 - # 350 - # 355 - - GAT TTC TAC CTC TTT CCT GGC AAT TGAAAATGAA AC - #CACAGGCA GCCCAGCCCT 1225 Asp Phe Tyr Leu Phe Pro Gly Asn 360 - - CCTCTGTCAA CATCAAAGAG CACATTTACC AGTATAGCTT GCATAGTCAA TA -#TTTGGTAT 1285 - - TTCAATAAAA GTAAAGACTG TATCT - # - # 1310 - - - - (2) INFORMATION FOR SEQ ID NO: 23: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 364 (B) TYPE: amino acid (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: protein - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #23: - - Met Leu Glu Tyr Leu Gly Lys Asp Val Leu Hi - #s Gly Val Phe Asn Tyr 1 5 - # 10 - # 15 - - Leu Ala Lys His Asp Val Leu Thr Leu Lys Gl - #u Glu Glu Lys Lys Lys 20 - # 25 - # 30 - - Tyr Tyr Asp Ala Lys Ile Glu Asp Lys Ala Le - #u Ile Leu Val Asp Ser 35 - # 40 - # 45 - - Leu Arg Lys Asn Arg Val Ala His Gln Met Ph - #e Thr Gln Thr Leu Leu 50 - # 55 - # 60 - - Asn Met Asp Gln Lys Ile Thr Ser Val Lys Pr - #o Leu Leu Gln Ile Glu 65 - # 70 - # 75 - # 80 - - Ala Gly Pro Pro Glu Ser Ala Glu Ser Thr As - #n Ile Leu Lys Leu Cys 85 - # 90 - # 95 - - Pro Arg Glu Glu Phe Leu Arg Leu Cys Lys Ly - #s Asn His Asp Glu Ile 100 - # 105 - # 110 - - Tyr Pro Ile Lys Lys Arg Glu Asp Arg Arg Ar - #g Leu Ala Leu Ile Ile 115 - # 120 - # 125 - - Cys Asn Thr Lys Phe Asp His Leu Pro Ala Ar - #g Asn Gly Ala His Tyr 130 - # 135 - # 140 - - Asp Ile Val Gly Met Lys Arg Leu Leu Gln Gl - #y Leu Gly Tyr Thr Val 145 1 - #50 1 - #55 1 -#60 - - Val Asp Glu Lys Asn Leu Thr Ala Arg Asp Me - #t Glu Ser Val LeuArg 165 - # 170 - # 175 - - Ala Phe Ala Ala Arg Pro Glu His Lys Ser Se - #r Asp Ser Thr Phe Leu 180 - # 185 - # 190 - - Val Leu Met Ser His Gly Ile Leu Glu Gly Il - #e Cys Gly Thr Ala His 195 - # 200 - # 205 - - Lys Lys Lys Lys Pro Asp Val Leu Leu Tyr As - #p Thr Ile Phe Gln Ile 210 - # 215 - # 220 - - Phe Asn Asn Arg Asn Cys Leu Ser Leu Lys As - #p Lys Pro Lys Val Ile 225 2 - #30 2 - #35 2 -#40 - - Ile Val Gln Ala Cys Arg Gly Glu Lys His Gl - #y Glu Leu Trp ValArg 245 - # 250 - # 255 - - Asp Ser Pro Ala Ser Leu Ala Leu Ile Ser Se - #r Gln Ser Ser Glu Asn 260 - # 265 - # 270 - - Leu Glu Ala Asp Ser Val Cys Lys Ile His Gl - #u Glu Lys Asp Phe Ile 275 - # 280 - # 285 - - Ala Phe Cys Ser Ser Thr Pro His Asn Val Se - #r Trp Arg Asp Arg Thr 290 - # 295 - # 300 - - Arg Gly Ser Ile Phe Ile Thr Glu Leu Ile Th - #r Cys Phe Gln Lys Tyr 305 3 - #10 3 - #15 3 -#20 - - Ser Cys Cys Cys His Leu Met Glu Ile Phe Ar - #g Lys Val Gln LysSer 325 - # 330 - # 335 - - Phe Glu Val Pro Gln Ala Lys Ala Gln Met Pr - #o Thr Ile Glu Arg Ala 340 - # 345 - # 350 - - Thr Leu Thr Arg Asp Phe Tyr Leu Phe Pro Gl - #y Asn 355 - # 360 - - - - (2) INFORMATION FOR SEQ ID NO: 24: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 685 to 703 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #24: - - CATGTCTCAT GGCATCCTA - # - # - # 19 - - - - (2) INFORMATION FOR SEQ ID NO: 25: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 712 to 731 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #25: - - CTGCGGAACT GCGCATAAAA - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO: 26: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #26: - - GGCTCTAGAC TCGAGGTGCT CTTTGATGTT GACAG - # -# 35 - - - - (2) INFORMATION FOR SEQ ID NO: 27: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 939 - #to 958 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #27: - - CTTCTCCTCG TGGATCTTGC - # - # - # 20 - - - - (2) INFORMATION FOR SEQ ID NO: 28: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 124 to 139 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #28: - - AGATGTTCTT CATGGT - # - # - # 16 - - - - (2) INFORMATION FOR SEQ ID NO: 29: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 290 to 306 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #29: - - CTTCTCAATA TGGACCA - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 30: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 472 to 488 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #30: - - CCTGGCTCTC ATCATAT - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 31: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 634 to 651 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #31: - - ATTTGCTGCC AGACCAGA - # - # - # 18 - - - - (2) INFORMATION FOR SEQ ID NO: 32: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 833 to 851 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #32: - - GCCTGCAGAG GTGAAAAAC - # - # - # 19 - - - - (2) INFORMATION FOR SEQ ID NO: 33: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 from 1020 to 1038 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #33: - - GCTCCATCTT CATTACGGA - # - # - # 19 - - - - (2) INFORMATION FOR SEQ ID NO: 34: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 1094 - # to 1110 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #34: - - GATTTCTGTA CCTTCCG - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 35: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 715 - #to 730 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #35: - - TTTATGCGCA GTTCCG - # - # - # 16 - - - - (2) INFORMATION FOR SEQ ID NO: 36: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 521 - #to 538 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #36: - - GTCATAGTGA GCCCCATT - # - # - # 18 - - - - (2) INFORMATION FOR SEQ ID NO: 37: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 385 - #to 401 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #37: - - CTTCACGAGG ACAAAGT - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 38: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (ix) FEATURE: (D) OTHER INFORMATION: - #SEQ ID NO: 22 complementary from 237 - #to 253 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #38: - - TCGCAAAGAG TCTACCA - # - # - # 17 - - - - (2) INFORMATION FOR SEQ ID NO: 39: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #39: - - CGCGGATCCA AGATGTTGGA ATACCTGGGC AAA - # - # 33 - - - - (2) INFORMATION FOR SEQ ID NO: 40: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 68 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #40: - - CGCGGATCCA CCATGGCTTC TATGACAGGA GGTCAACAAA TGGGACAAAA GA -#TCACCAGT 60 - - GTAAAACC - # - #- # 68 - - - - (2) INFORMATION FOR SEQ ID NO: 41: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #41: - - ATGTTTTTCA CCTCTGGAGG CCTGGACAAT GATGAC - #- # 36 - - - - (2) INFORMATION FOR SEQ ID NO: 42: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - #42: - - GTCATCATTG TCCAGGCCTC CAGAGGTGAA AAACAT - #- # 36__________________________________________________________________________

DNA sequences coding for the human proteins Tx and Ty related to the interleukin-1.beta. converting enzyme

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (1)

PRIOR APPLICATION

PCT Information

US Referenced Citations (1)

Non-Patent Literature Citations (2)

Entry
Alnemii et al. Cell 87:171, 1996.
Watson et al Molecular Biology of the Gene Bensamin Cummings Pub. Co. Inc. Menlo Park California 1987 pp. 88-89.