Patent Application
20240052325
The present disclosure relates to fusion proteins and methods of using the same. Specifically, the disclosure relates to fusion proteins comprising a DNA polymerase and an intein inserted at a designated position within the DNA polymerase, and methods of using the same for DNA synthesis.
PCR (polymerase chain reaction), isothermal amplification, reverse transcription (RT), and sequencing, catalyzed by DNA polymerases, are among the most common reactions conducted in life science, medical, and clinical laboratories. They have been widely used for numerous applications such as clinical diagnoses, biological technologies, molecular cloning, gene synthesis, etc., including the current COVID-19 coronavirus test kits. According to Allied Market Research, the global market value of PCR alone was over 7 billion USD in 2016. However, both PCR and isothermal amplification technologies suffer from nonspecific products of DNA polymerases, which could lead to low yield of the target product and ambiguous results. The inconclusive test results are particularly troublesome for clinical applications, in which accurate and specific results are essential for diagnosis and decision making. In February 2020, New York Times and CNN reported about flawed COVID-19 test kits that could not produce conclusive results. In consequence, the Centers for Disease Control had to recall and replace these test kits, which potentially delayed the testing of COVID-19 in the US. Moreover, the nonspecific activity of DNA polymerases restricts the number of samples that could be handled together, especially for clinical uses. This is due to that the increasing number of samples leads to more preparation time, which could result in nonspecific product accumulation. As more COVID-19 tests are required in the pandemic, this defect could have a greater impact on the healthcare system. Thus, the current COVID-19 pandemic creates an urgent need for technologies to suppress or eliminate nonspecific activities of DNA polymerases.
Currently, the nonspecific product problem is tackled by the strategy of “hot start”, which involves blocking the DNA polymerases at room temperature using external reagents such as physical blocking, chemical modifications, antibodies, aptamers, etc. According to BCC Research, among all the PCR technologies in the market, the emerging hot start PCR had expanded to 6.3% of the market share in 2015 and has the highest estimated CAGR of that time. However, these hot start technologies are restricted by defects such as incomplete inhibition, incomplete activation, reduced performance, low product yield, time consuming production, high cost, complicated handling, etc. Since the manufacture of many external reagents cannot be speedily scaled up, it is difficult to produce more hot start kits when the demand is increasing rapidly, such as during the current COVID-19 pandemic. Accordingly, there remains an urgent need for conditionally activated DNA polymerases that may be used in simple methods of DNA synthesis with high specificity.
In some aspects, provided herein are fusion proteins. In some embodiments, provided herein is a fusion protein comprising a target DNA polymerase and an intein. The intein is inserted at a designated position in the target DNA polymerase. In some embodiments, insertion of the intein at the designated position in the target DNA polymerase inhibits activity of the target DNA polymerase. For example, insertion of the intein at the designated position in the target DNA polymerase may inhibit polymerase activity and/or exonuclease activity of the target DNA polymerase. In some embodiments, the intein is inserted at a designated position in the target DNA polymerase such that binding of a substrate to an active site of the target DNA polymerase is inhibited.
The intein may be inserted in any suitable location of the target DNA polymerase in order to inhibit activity of the target DNA polymerase while facilitating activity (e.g. splicing) of the intein. In some embodiments, the intein is inserted within a flexible loop of the target DNA polymerase. In some embodiments, the flexible loop is within a thumb domain, a finger domain, a palm domain, or an exonuclease domain of the target DNA polymerase. In some embodiments, the intein is inserted between 10 to 50 Å from the active site of the target DNA polymerase.
Any suitable target DNA polymerase may be used in the fusion proteins described herein. In some embodiments, the target DNA polymerase is an A family DNA polymerase. For example, the target DNA polymerase may be selected from Taq polymerase, Tth polymerase, Tfl polymerase, Tfi polymerase, Tbr polymerase, Tca polymerase, Tma polymerase, Tne polymerase, Bst polymerase, Bsm polymerase, Bsu polymerase, E. coli DNA polymerase I, Bacteriophage T7 DNA polymerase, 3173 Pol, or variants thereof. In particular embodiments, the target DNA polymerase is Taq polymerase or a variant thereof. For example, the target DNA polymerase may comprise an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 2. For example, the target DNA polymerase may comprise the amino acid sequence of SEQ ID NO: 3.
In some embodiments, the target DNA polymerase is a B family DNA polymerase. For example, the target DNA polymerase may be selected from the group consisting of Pfu polymerase, Pst polymerase, Pab polymerase, Pwo polymerase, KOD polymerase, Tli polymerase, Tgo polymerase, 9° N DNA Polymerase, Tfu polymerase, Tpe polymerase, Tzi polymerase, T-NA1 polymerase, T-GT polymerase, Tag polymerase, Tce polymerase, Tmar polymerase, Tpa polymerase, Tthi polymerase, Twa polymerase, phi29 DNA polymerase, and variants thereof. In particular embodiments, the target DNA polymerase is Pfu polymerase or a variant thereof. For example, the target DNA polymerase may comprise an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 11. For example, the target DNA polymerase may comprise the amino acid sequence of SEQ ID NO: 12.
In some embodiments, the target DNA polymerase possesses reverse transcriptase activity. In some embodiments, the target DNA polymerase is a chimera. For example, the target DNA polymerase may be a chimera comprising at least one domain from an A family DNA polymerase and at least one domain from a different A family DNA polymerase. As another example, the target DNA polymerase may be a chimera comprising at least one domain from a B family DNA polymerase and at least one domain from a different B family DNA polymerase.
In some embodiments, the intein is inserted within a flexible loop between residues 311-320, residues 381-401, residues 546-597, or residues 782-786 of a Taq polymerase or a corresponding region in a different A family DNA polymerase. In some embodiments, the intein is inserted within a flexible loop between residues 671-686 or residues 734-737 of a Taq polymerase or a corresponding region in a different A family DNA polymerase. In some embodiments, the intein is inserted within a flexible loop between residues 452-545 of a Taq polymerase or a corresponding region in a different A family DNA polymerase.
In some embodiments, the intein is inserted within a flexible loop between residues 365-399 or residues 572-617 of a Pfu polymerase or a corresponding region in a different B family DNA polymerase. In some embodiments, the intein is inserted within a flexible loop between residues 499-508 or residues 417-448 of a Pfu polymerase or a corresponding region in a different B family DNA polymerase. In some embodiments, the intein is inserted within a flexible loop between residues 618-759 of a Pfu polymerase or a corresponding region in a different B family DNA polymerase. In some embodiments, the intein is inserted within a flexible loop between residues 145-156, residues 209-214, residues 243-248, residues 260-305, or residues 347-349 of a Pfu polymerase or a corresponding region in a different B family DNA polymerase.
For any of the fusion proteins described herein, the wild-type form of the target DNA polymerase may be found in a thermophilic organism. The target DNA polymerase may possess enzymatic activity at temperatures of greater than 50° C. The target DNA polymerase is stable at temperatures of greater than 60° C.
For the fusion proteins described herein, the intein may be a large intein, a mini-intein, or a split intein.
In some embodiments, protein splicing activity of the intein is regulated by one or more factors. In such embodiments, activation of protein splicing results in release of the target DNA polymerase from the fusion protein. In some embodiments, the released target DNA polymerase possesses increased activity compared to the activity of the target DNA polymerase when present in the fusion protein. For example, the released target DNA polymerase possesses increased DNA polymerase activity and/or increased exonuclease activity compared to the target DNA polymerase when present in the fusion portion. The one or more factors that regulate protein splicing activity of the intein may be temperature, pH, and/or divalent ions. For example, protein splicing activity of the intein may be activated by temperatures of 30° C. or greater. In some embodiments, splicing activity of the intein is activated by temperatures of 4° C. or greater. In still other embodiments, protein splicing activity of the intein is activated by temperatures of 50° C. or greater.
In some embodiments, the intein is selected from PI-PfuI intein, PI-PfuII intein, Tth-HB27 DnaE-1 intein, Neq Pol intein, Tmar Pol intein, Tfu Pol-1 intein, Tfu Pol-2 intein, Pab PolII intein, Pho PolII intein, Psp-GBD Pol intein, Pho CDC21-1 intein, Pab CDC21-1 intein, Tko CDC21-1 intein, Mja TFIIB intein, Mvu TFIIB intein, Pho RadA intein, Tsi RadA intein, Tvo VMA intein, Sce VMA intein, Ssp DnaE intein, Tsi PolII intein, Tga PolII intein, Tko PolII intein, Tba PolII intein, Mja KlbA intein, Pho CDC21-2 intein, Hsp CDC21 intein, Hsp PolII intein, Mxe GyrA intein, and variants thereof.
In some embodiments, the factor that regulates protein splicing activity of the intein is a divalent ion, wherein the presence of one or more divalent ions inhibits protein splicing activity of the intein. In some embodiments, the intein is selected from PI-PfuI intein, Neq Pol intein, Ssp DnaE intein, Msm DnaB-1 intein, Mtu RecA intein, and variants thereof.
In some embodiments, the intein is selected from PI-PfuI intein, PI-PfuII intein, Tth-HB27 DnaE-1 intein, Neq Pol intein, Tmar Pol intein, Tfu Pol-1 intein, Tfu Pol-2 intein, Pab PolII intein, Pho PolII intein, Tsi PolII intein, Tga PolII intein, Tko PolII intein, Tba PolII intein, Psp-GBD Pol intein, Pho CDC21-1 intein, Pab CDC21-1 intein, Tko CDC21-1 intein, Mja TFIIB intein, Mvu TFIIB intein, Pho RadA intein, Tsi RadA intein, Mja KlbA intein, Pho CDC21-2 intein, Hsp CDC21 intein, Hsp PolII intein, Mth RIR1 intein, Mxe GyrA intein, Tvo VMA intein, Tac VMA intein, Sce VMA intein, Ssp DnaE intein, Npu DnaE intein, Ssp DnaB intein, Npu DnaB intein, Msm DnaB-1 intein, Mtu RecA intein, gp41-1 intein, Tko Pol-2 intein, Cth BIL intein, Cne PRP8 intein, and variants thereof.
In some embodiments, the intein comprises an amino acid sequence having at least 80% sequence identity with an amino acid sequence provided in Table 1, Table 2, or Table 3. In some embodiments, wild-type form of the intein is found in a thermophilic organism. The intein may be stable at temperatures of greater than 50° C. In some embodiments, the intein comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6. In some embodiments, the intein comprises the amino acid sequence of SEQ ID NO: 5. In some embodiments, the intein comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 4.
The fusion proteins described herein may further comprise a purification tag. The purification tag may be inserted within the intein.
In some embodiments, the fusion protein comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 10.
The fusion proteins described herein may be formulated into a composition. In some embodiments, the composition further comprises a nucleic acid template. In some embodiments, the composition further comprises a reaction buffer. Such compositions may be used in methods for amplifying nucleic acid (e.g. amplifying the nucleic acid template). In some embodiments, compositions are in methods of polymerase chain reaction (PCR), reverse-transcription PCR (RT-PCR), isothermal amplification, reverse transcription, or sequencing. For example, compositions described herein may be used in one-step RT-PCR or two-step RT-PCR.
In some aspects, provided herein are methods of amplifying nucleic acid. The methods are performed using a composition comprising a fusion protein as described herein. In some embodiments, methods for amplifying nucleic acid providing a composition comprising a nucleic acid template and a fusion protein comprising a target DNA polymerase and an intein inserted at a designated position in the target DNA polymerase. Insertion of the intein at the designated position inhibits activity of the target DNA polymerase. The methods further comprise changing one or more factors to induce release of the target DNA polymerase from the fusion protein. The released target DNA polymerase possesses increased activity compared to the target DNA polymerase containing the inserted intein. The methods further comprise amplifying the nucleic acid template in the composition. In some embodiments, the protein splicing activity of the intein is regulated by the one or more factors. Modification of the one or more factors thereby induces activation of protein splicing, resulting in release of the target DNA polymerase from the fusion protein.
In nature, DNA is replicated or synthesized by DNA polymerases using either DNA or RNA as a template. DNA polymerases sequentially add deoxyribonucleotides into the newly synthesized strand using deoxyribonucleoside triphosphates (dNTPs). This process is catalyzed by divalent metal ions coordinated by conserved residues at the DNA polymerase active site, which is powered from the hydrolysis of dNTPs. The DNA synthesizing functions of DNA polymerases have been developed into numerous biotechnologies such as Polymerase Chain Reaction (PCR), isothermal amplification, reverse transcription (RT), DNA sequencing, gene synthesis, clinical diagnoses, etc. However, the nonspecific products generated by DNA polymerases diminish the accuracy, specificity, and yield of these applications, which creates an urgent need for technologies to suppress nonspecific DNA polymerase activities.
An intein (intervening protein) is a protein that can, under the appropriate conditions, autocatalytically excise itself from a protein precursor through the cleavage of two peptide bonds, and concomitantly ligate the flanking protein fragments through the formation of a new peptide bond to produce a mature host protein (referred to as an extein, or external protein). This intein catalyzed process is called protein splicing. This protein splicing process requires no external energy source. Although the diverse sequences of inteins lead to different precise splicing processes, they all share similar structural folding and a similar splicing mechanism.
In a basic sense, the splicing process starts with the peptide bond cleavage between intein and −1 residue, which is the extein residue linking to the N-terminus of the intein (the residue linking to the N-terminus of −1 residue is −2 residue, and so on). A (thio)ester bond is subsequently formed between −1 residue and the side chain of +1 residue, which is the extein residue linking to the C-terminus of the intein (the residue linking to the C-terminus of +1 residue is +2 residue, and so on). The +1 residue is cysteine, serine, or threonine in all known inteins. Afterward, the peptide bond between intein and +1 residue is cleaved, leading to the releasing of the intein. Finally, the (thio)ester bond between −1 residue and the side chain of +1 residue breaks, and the peptide bond between −1 and +1 residues forms, resulting in the mature extein. During the splicing process, inteins can also generate side products such as the free N- or C-terminal exteins (the extein fragment linked to the N- or C-terminal of intein) by N- or C-terminal cleavage, respectively.
In some aspects, provided herein are fusion proteins comprising a target DNA polymerase and an intein, and methods of using the same. The intein may be inserted at a suitable position within the DNA polymerase to suppress activity of the DNA polymerase while the intein is present. The activity (e.g. splicing) of the intein may be regulated by one or more external factors, thereby producing an intein-controlled DNA polymerase that is active only when the intein is excised from the fusion protein and the DNA polymerase is freed.
For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the disclosure relates.
Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
The use of the terms “a” and “an” and “the” and “at least one” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.
The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context.
As used herein, the term “about” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result. In some embodiments, “about” may refer to variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount.
As used herein, the terms “comprise”, “include”, and linguistic variations thereof denote the presence of recited feature(s), element(s), method step(s), etc. without the exclusion of the presence of additional feature(s), element(s), method step(s), etc.
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise-indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure.
The term “amino acid” refers to natural amino acids, unnatural amino acids, and amino acid analogs, all in their D and L stereoisomers, unless otherwise indicated, if their structures allow such stereoisomeric forms.
Natural amino acids include alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), Lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).
Unnatural amino acids include, but are not limited to, azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, naphthylalanine (“naph”), aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisbutyric acid, 2-aminopimelic acid, tertiary-butylglycine (“tBuG”), 2,4-diaminoisobutyric acid, desmosine, 2,2′-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, homoproline (“hPro” or “homoP”), hydroxylysine, allo-hydroxylysine, 3-hydroxyproline (“3Hyp”), 4-hydroxyproline (“4Hyp”), isodesmosine, allo-isoleucine, N-methylalanine (“MeAla” or “Nime”), N-alkylglycine (“NAG”) including N-methylglycine, N-methylisoleucine, N-alkylpentylglycine (“NAPG”) including N-methylpentylglycine. N-methylvaline, naphthylalanine, norvaline (“Norval”), norleucine (“Norleu”), octylglycine (“OctG”), ornithine (“Orn”), pentylglycine (“pG” or “PGly”), pipecolic acid, thioproline (“ThioP” or “tPro”), homoLysine (“hLys”), and homoArginine (“hArg”).
The term “amino acid analog” refers to a natural or unnatural amino acid where one or more of the C-terminal carboxyl group, the N-terminal amino group and side-chain bioactive group has been chemically blocked, reversibly or irreversibly, or otherwise modified to another bioactive group. For example, aspartic acid-(beta-methyl ester) is an amino acid analog of aspartic acid; N-ethylglycine is an amino acid analog of glycine; or alanine carboxamide is an amino acid analog of alanine. Other amino acid analogs include methionine sulfoxide, methionine sulfone, S-(carboxymethyl)-cysteine, S-(carboxymethyl)-cysteine sulfoxide and S-(carboxymethyl)-cysteine sulfone.
As used herein, a “conservative” amino acid substitution refers to the substitution of an amino acid in a peptide or polypeptide with another amino acid having similar chemical properties, such as size or charge. For purposes of the present disclosure, each of the following eight groups contains amino acids that are conservative substitutions for one another:
Naturally occurring residues may be divided into classes based on common side chain properties, for example: polar positive (or basic) (histidine (H), lysine (K), and arginine (R)); polar negative (or acidic) (aspartic acid (D), glutamic acid (E)); polar neutral (serine (S), threonine (T), asparagine (N), glutamine (Q)); non-polar aliphatic (alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M)); non-polar aromatic (phenylalanine (F), tyrosine (Y), tryptophan (W)); proline and glycine; and cysteine. As used herein, a “semi-conservative” amino acid substitution refers to the substitution of an amino acid in a peptide or polypeptide with another amino acid within the same class.
In some embodiments, unless otherwise specified, a conservative or semi-conservative amino acid substitution may also encompass non-naturally occurring amino acid residues that have similar chemical properties to the natural residue. These non-natural residues are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include, but are not limited to, peptidomimetics and other reversed or inverted forms of amino acid moieties. Embodiments herein may, in some embodiments, be limited to natural amino acids, non-natural amino acids, and/or amino acid analogs.
Non-conservative substitutions may involve the exchange of a member of one class for a member from another class.
The term “consensus sequence” as used herein refers to the −3, −2, −1, +1, +2, and +3 extein residues. The desired consensus sequence may exist naturally or may be engineered (e.g. by one or more mutations in the DNA polymerase). These residues support the function of the intein (e.g. support intein splicing).
The term “intein” as used herein refers to a protein that can autocatalytically excise itself from a protein precursor and concomitantly ligate the flanking protein fragments to produce a mature protein. The term “extein” as used herein refers to the mature protein produced as a result of such a process. The autocatalytic excision process performed by the intein to produce the mature protein is referred to herein as “splicing” or “protein splicing”.
“Identical” or “identity,” as used herein in the context of two or more polypeptide, amino acid, or polynucleotide sequences, can mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of the single sequence are included in the denominator but not the numerator of the calculation.
“Variant” is used herein to describe a protein (e.g. a polymerase, an intein) that differs from a reference protein in amino acid sequence by the insertion, deletion, or substitution of amino acids, but retains at least one biological activity of the reference protein. Representative examples of “biological activity” include the ability to perform a typical enzymatic function associated with that protein (e.g. for polymerases, to retain polymerase and/or exonuclease activity and for inteins, to retain protein splicing ability). For example, a variant of a polymerase may differ in amino acid sequence from the wild-type polymerase, but still retains at least one biological activity (e.g. functional polymerase activity, functional exonuclease activity) compared to the wild-type. As another example, a variant of an intein may differ in amino acid sequence from the wild-type intein, but still retain at least one biological activity (e.g. functional protein splicing) compared to the wild-type. A “variant” may also be referred to as a “mutant” or an “engineered” version herein.
In one aspect, provided herein are engineered fusion proteins comprising a target DNA polymerase and an intein. Any suitable target DNA polymerase may be used in the fusion proteins described herein. Currently, DNA polymerases are classified into A, B, C, D, X, Y, and RT (reverse transcriptase) families according to sequence similarity. A, B, C, D, X, and Y family DNA polymerases mainly utilize DNA as the template for DNA synthesis, while RT family DNA polymerases mainly utilize RNA as the template for DNA synthesis (reverse transcription). All DNA polymerases synthesize DNA by transferring deoxyribonucleotides from dNTPs onto the 3′-OH group of the newly synthesized strand, catalyzing the 5′ to 3′ polymerase activity. The fusion protein may comprise an A family, B family, C family, D family, X family, Y family, or RT family DNA polymerase.
Despite the sequence diversity among polymerase families, activity centers of all DNA polymerases contain palm, thumb, and finger domains. Conserved residues in the palm domain coordinate divalent metal ions to catalyze the polymerase reaction. The finger domain mainly binds the incoming dNTP. The thumb domain is critical for the proper interaction between the DNA duplex and the DNA polymerase. In addition to the polymerase activity, many DNA polymerases have other activities, such as nuclease activity and strand displacement activity, which are generally catalyzed by additional regions or domains. In some embodiments, the DNA polymerase comprises a palm domain, a thumb domain, and a finger domain. In some embodiments, the DNA polymerase comprises a palm domain, a thumb domain, a finger domain, and an exonuclease domain.
In some embodiments, the wild-type form of the target DNA polymerase is found in a thermophilic organism. The target DNA polymerase may possess enzymatic activity at temperatures usually employed for isothermal amplification, reverse transcription, polymerase chain reaction, etc. In some embodiments, the target DNA polymerase demonstrates enzymatic (e.g. polymerase) activity at temperatures of greater than 50° C., so long as the DNA polymerase is not bound to the intein. The temperature of 50° C. is not a lower limit, the target DNA polymerase may also possess enzymatic activity at temperatures of lower than 50° C. For example, the DNA polymerase may possess enzymatic activity at temperatures of 20° C., 30° C., 40° C., 50° C., and higher than 50° C. In some embodiments, the target DNA polymerase is stable at temperatures of greater than 60° C.
In some embodiments, target DNA polymerase is an A family DNA polymerase. Suitable A family DNA polymerases, including for example, Taq (UniProt ID: P19821, Thermus aquaticus DNA polymerase I), Tth (UniProt ID: P52028, Thermus thermophilus HB8 DNA polymerase I), Tfl (UniProt ID: P30313, the DNA polymerase isolated from Thermus flavus), Tfi (UniProt ID: O52225, Thermus filiformis DNA polymerase I), Tbr (UniProt ID: A0A1J0LQA5, Thermus brockianus DNA polymerase I, commercial name: DyNAzyme), Tca (UniProt ID: P80194, Thermus caldophilus DNA polymerase I), Tma (UniProt ID: Q9X1V4, Thermotoga maritima DNA polymerase I, commercial name: UITma DNA polymerase), Tne (UniProt ID: B9K7T2, Thermotoga neapolitana DNA polymerase I), Bst (UniProt ID: Q45458, Geobacillus stearothermophilus (previously Bacillus stearothermophilus) DNA polymerase I), Bsm (UniProt ID: Q08IE4, Bacillus smithii DNA polymerase I), Bsu (UniProt ID: O34996, Bacillus subtilis DNA polymerase I), Escherichia coli DNA polymerase I (UniProt ID: P00582), Bacteriophage T7 DNA polymerase (UniProt ID: P00581), 3173 Pol (GenBank: ADL99605.1, a viral DNA polymerase homologous to Thermocrinis albus Pol I (Genbank: ADC89878.1) and commercialized by Lucigen with names OmniAmp polymerase or PyroPhage 3173 DNA polymerase), and variants of any of the above. For example, variants of any of the above may comprise suitable amino acid mutations (e.g. substitutions, insertions, deletions, etc.) to improve one or more characteristics of the polymerase. For example, variants of the above may be employed to improve reaction fidelity, enhance DNA binding affinity, enhance thermal stability, or other desired characteristics of the DNA polymerase.
In some embodiments, the target DNA polymerase comprises an amino acid sequence having 80% or more sequence identity with an A family target DNA polymerase, such as an A family target DNA polymerase listed above. For example, the target DNA polymerase may comprise an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with an A family target DNA polymerase.
In some embodiments, the target DNA polymerase is Taq or a variant thereof. The amino acid sequence of wild-type Taq is:
In some embodiments, the target DNA polymerase comprises an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) with SEQ ID NO: 2.
In some embodiments, the target DNA polymerase is a B family DNA polymerase. Unlike Taq, the B family DNA polymerases, such as the commonly used Pfu polymerase, contain a functional 3′-5′ exonuclease domain for proofreading to remove misincorporated nucleotides. Thus, they have a lower error rate and are often used as high-fidelity DNA polymerases.
Suitable B family DNA polymerases include, for example, Pfu (UniProt ID: P61875, Pyrococcus furiosus DNA polymerase), Pst (UniProt ID: Q51334, Pyrococcus sp. (strain GB-D) DNA polymerase, commercialized with the name Deep Vent DNA polymerase), Pab (UniProt ID: P0CL76, Pyrococcus abyssi DNA polymerase, commercial name: Isis DNA polymerase), Pwo (UniProt ID: P61876, Pyrococcus woesei DNA polymerase), KOD (UniProt ID: D0VWU9, Thermococcus kodakarensis (previously Pyrococcus kodakaraensis)), Tli (UniProt ID: P30317, Thermococcus litoralis DNA polymerase, commercial name: Vent DNA polymerase), Tgo (UniProt ID: P56689, Thermococcus gorgonarius DNA polymerase), 9° N DNA Polymerase (UniProt ID: Q56366, Thermococcus sp. (strain 9oN-7) DNA polymerase), Tfu (UniProt ID: P74918, Thermococcus fumicolans DNA polymerase), Tpe (UniProt ID: A0A142CUB2, Thermococcus peptonophilus DNA polymerase), Tzi (UniProt ID: Q1WDM7, Thermococcus zilligii DNA polymerase, commercialized as a fusion version with name Pfx50 DNA polymerase), T-NA1 (UniProt ID: Q2Q453, Thermococcus onnurineus DNA polymerase), T-GT (UniProt ID: Q1WDM6, Thermococcus sp. GT DNA polymerase), Tag (UniProt ID: 033845, Thermococcus aggregans DNA polymerase), Tce (UniProt ID: E9KLD9, Thermococcus celer DNA polymerase), Tmar (UniProt ID: C7AIP4, Thermococcus marinus DNA polymerase), Tpa (UniProt ID: A0A218P6T6, Thermococcus pacificus DNA polymerase), Tthi (UniProt ID: A0SXL5, Thermococcus thioreducens DNA polymerase), Twa (UniProt ID: H9CW54, Thermococcus waiotapuensis DNA polymerase), and phi29 DNA polymerase (UniProt ID: P03680, Bacteriophage phi-29 DNA polymerase), and variants of any of the above.
In some embodiments, the target DNA polymerase comprises an amino acid sequence having 80% or more sequence identity with a B family target DNA polymerase, such as a B family target DNA polymerase listed above. For example, the target DNA polymerase may comprise an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a B family target DNA polymerase.
In some embodiments, the target DNA polymerase is Pfu or a variant thereof. The amino acid sequence of wild-type Pfu is:
In some embodiments, the target DNA polymerase comprises an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) with SEQ ID NO: 11.
In some embodiments, the target DNA polymerase comprises one or more mutations. For example, one or more residues may be mutated to a glycine to support intein splicing. Selection of which particular residues may be mutated to glycine may depend on the designated position for intein insertion. For example, one or residues proximal to (e.g. within 5 amino acids) the intein insertion site (e.g. proximal to the N-terminal amino acid of the inserted intein and/or proximal to the C-terminal amino acid of the inserted intein) may be mutated to a glycine. For example, to support intein splicing it may be desirable that the −5, −4, −3, −2, −1, +1, +2, +3, +4, and/or +5 residue is a glycine and suitable mutations may be made in order to accomplish this.
In some embodiments, the amino acid immediately proximal to the N-terminal amino acid of the inserted intein (e.g. the −1 residue) may be a glycine. This may occur naturally (e.g. the intein insertion site may be selected such that the −1 residue is a glycine) or the residue may be mutated to a glycine. In some embodiments, the −1 residue and the −2 residue may be a glycine (e.g. naturally or by mutation). In some embodiments, the −1 residue, the −2 residue, and the −3 residue may be a glycine (e.g. naturally or by mutation). In some embodiments, the +2 and/or +3 residue is mutated to be a glycine to support intein splicing.
In some embodiments, the +1 residue (e.g. the residue immediately proximal to the C-terminal amino acid of the intein) is a cysteine, a serine, or threonine. This may occur naturally. For example, the intein insertion site may be selected such that the +1 residue is known to be a cysteine, a serine, or a threonine. In other embodiments, the +1 residue may be mutated to be a cysteine, a serine, or a threonine. In some embodiments, an intein naturally containing a +1 residue that is already a cysteine, a serine, or a threonine may be mutated that the +1 residue is changed from the existing cysteine, serine, or threonine to a different option of these three amino acids. For example, a +1 cysteine could be changed to a +1 serine or a +1 threonine. As another example, a +1 serine could be changed to a +1 cysteine or a +1 threonine.
In some embodiments, the target DNA polymerase comprises an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) with SEQ ID NO: 3. In some embodiments, the target DNA polymerase comprises the amino acid sequence of SEQ ID NO: 3.
In some embodiments, the target DNA polymerase comprises an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) with SEQ ID NO: 12. In some embodiments, the target DNA polymerase comprises the amino acid sequence of SEQ ID NO: 12.
In some embodiments, the target DNA polymerase is possesses reverse transcriptase activity. For example, the target DNA polymerase may be an RT family DNA polymerase, or may be a polymerase from a different family (e.g. an A family polymerase) that can use RNA as a template. The most widely used reverse transcriptases are AMV (Avian Myeloblastosis Virus Reverse Transcriptase) and M-MLV (Moloney Murine Leukemia Virus Reverse Transcriptase). Some A family DNA polymerases can use RNA as the template, therefore they have been developed for reverse transcription, including Taq polymerase, Tth polymerase, Tfl polymerase, 3173 Pol, Bst polymerase, Bsm polymerase, Bsu polymease and Escherichia coli DNA polymerase I. In some embodiments, the DNA polymerase may be modified (e.g. by one or more mutations) such that it possesses reverse transcriptase activity or to improve innate reverse transcriptase ability. For example, KOD polymerase variants processing reverse transcriptase activity may be used. As another example, Taq may be modified to improve its reverse transcription activity.
In some embodiments, the target DNA polymerase is a chimera. The chimera may comprise at least one domain from one DNA polymerase, and at least one domain from a different DNA polymerase. In some embodiments, the chimera comprises at least one domain from an A family DNA polymerase. In some embodiments, the chimera comprises at least one domain from an A family DNA polymerase and at least one domain from a different A family DNA polymerase. Suitable A family DNA polymerases are described above, including Taq polymerase, Tth polymerase, Tfl polymerase, Tfi polymerase, Tbr polymerase, Tca polymerase, Tma polymerase, Tne polymerase, Bst polymerase, Bsm polymerase, Bsu polymerase, Escherichia coli DNA polymerase I, Bacteriophage T7 DNA polymerase, 3173 Pol, and variants thereof.
In some embodiments, the chimera comprises at least one domain from a B family DNA polymerase. In some embodiments, the chimera comprises at least one domain from a B family DNA polymerase and at least one domain from a different B family DNA polymerase. Suitable B family DNA polymerases are described above, including Pfu polymerase, Pst polymerase, Pab polymerase, Pwo polymerase, KOD polymerase, Tli polymerase, Tgo polymerase, 9° N DNA polymerase, Tfu polymerase, Tpe polymerase, Tzi polymerase, T-NA1 polymerase, T-GT polymerase, Tag polymerase, Tce polymerase, Tmar polymerase, Tpa polymerase, Tthi polymerase, Twa polymerase, phi29 polymerase, and variants thereof.
The fusion protein further comprises an intein inserted at a designated position in the target DNA polymerase. In some embodiments, insertion of the intein at the designated position inhibits activity of the target DNA polymerase. For example, insertion of the intein at the designated position in the target DNA polymerase may inhibit polymerase activity of the target DNA polymerase. As another example, insertion of the intein at the designated position in the target DNA polymerase may inhibit exonuclease activity of the target DNA polymerase. In some embodiments, insertion of the intein at the designated position in the target DNA polymerase may inhibit polymerase and exonuclease activity of the target DNA polymerase.
In some embodiments, the intein may be inserted at a designated position in the target DNA polymerase such that binding of a substrate (e.g. DNA) to the active site of the target DNA polymerase is inhibited. For example, the intein may be inserted at a suitable position within the target DNA polymerase to 1) physically block the DNA polymerase active site; and/or 2) compromise the DNA binding ability of the DNA polymerase; and/or 3) disrupt the function of DNA polymerase allosterically.
The intein may be inserted in any suitable location within the target DNA polymerase to. In general, a suitable insertion location within the target DNA polymerase should inhibit activity (e.g. polymerase activity, exonuclease activity, reverse transcriptase activity) of the target DNA polymerase activity when the intein is fused, support the intein protein splicing reaction, and result in a functional DNA polymerase after the intein is spliced.
To support the intein protein splicing reaction, the insert position should not affect the structure and function of the inserted intein. Moreover, the insert position should be able to provide the extein −3 to −1 and +1 to +3 residues (also referred to herein as the “consensus sequence”) that support intein splicing. If the extein −3 to −1 and +1 to +3 residues do not naturally exist in the DNA polymerase, such sequences may be inserted artificially into the DNA polymerase.
To result in a functional DNA polymerase after the intein is spliced, the insertion position should enable the release of the intein from the DNA polymerase. Moreover, the extein −3 to −1 and +1 to +3 residues remaining after protein splicing should have limited or no effect on the activity or function of the released DNA polymerase. Similarly, if the extein −3 to −1 and +1 to +3 residues are mutated to support protein splicing, the extein mutations should have limited or no effect on the activity or function of the released DNA polymerase.
In some embodiments, a short linker sequence or multiple short linker sequences may be added to enable the proper insertion of the intein. Such short linker(s) also should have limited or no effect on the activity or function of the DNA polymerase.
In some embodiments, the intein is inserted within a flexible loop of the target DNA polymerase. Since such loops are structurally flexible, they demonstrate more plasticity to support the intein for the protein splicing reaction. In addition, the flexibility of loops also decreases interference from other parts of the DNA polymerase. In some embodiments, the flexible loop is within the thumb domain, a finger domain, the palm domain, or the exonuclease domain of the target DNA polymerase. In particular embodiments, the intein may be inserted within a flexible loop proximal to the active site. In some embodiments, the intein may be inserted such that the intein is between 10 to 50 Å of the active site of the target DNA polymerase. For example, the insertion position may be about 10 Å, about 15 Å, about 20 Å, about 25 Å, about 30 Å, about 35 Å, about 40 Å, about 45 Å, or about 50 Å from the active site.
In some embodiments, the target DNA polymerase is an A family DNA polymerase or a chimera comprising at least one domain from an A family DNA polymerase. In some embodiments, the target DNA polymerase is Taq polymerase or a variant thereof. In some embodiments, the intein is inserted within a flexible loop between residues 311-320, residues 381-401, residues 546-597, or residues 782-786 of the Taq polymerase. These residues are found within the palm domain. In other embodiments, the intein is inserted within a flexible loop between residues 671-686 or residues 734-737 of the Taq polymerase. These residues are found within a finger domain. In still other embodiments, the intein is inserted within a flexible loop between residues 452-545 of the Taq polymerase. These residues are found within the thumb domain.
Although these residue numbers are specific for Taq polymerase, these residues may be used to determine the corresponding residues for suitable intein insertion locations in other A family DNA polymerases. Accordingly, the intein may be inserted at a flexible loop within the above-described residues of Taq polymerase or in a corresponding flexible loop of a different A family DNA polymerase. Sequence alignment may be used to determine appropriate corresponding locations. For example, the sequences of two DNA polymerases (e.g. Taq polymerase and another A family DNA polymerase) may be aligned, and the residues corresponding to the above-listed residues for Taq polymerase may be identified. In some embodiments, software may be used to perform the alignment and to identify residues predicted to have secondary structures vs. residues that are likely to be flexible loops. For sequences that do not completely align, residues ranges may be adjusted accordingly. For example, residues may be adjusted to account for extra residues, missing residues, etc. in one polymerase compared to the other. As one example, sequence alignment may be performed to determine that residues 782-786 of Taq polymerase correspond to residues 784-788 of Tth polymerase.
In some embodiments, flexible loops are considered the same loop topologically, although they may have different lengths and residue numbers. When protein sequences are aligned, the two flexible loops may not exemplify high level of alignment, but the regions surrounding the flexible loop are well aligned, thus confirming that the two flexible loops (e.g. the flexible loop in Taq polymerase and the flexible loop in another A family DNA polymerase) do indeed correspond to each other. In such embodiments, flexible loops identified as corresponding to any of the above-described flexible loops in Taq polymerase may be used as intein insertion sites in other A family DNA polymerases.
In some embodiments, the target DNA polymerase is a B family DNA polymerase or a chimera comprising at least one domain from a B family DNA polymerase. In some embodiments, the target DNA polymerase is Pfu polymerase or a variant thereof. In some embodiments, the intein may be inserted within a flexible loop between residues 365-399 or residues 572-617 of the Pfu polymerase. These residues are within the palm domain. In other embodiments, the intein is inserted within a flexible loop between residues 499-508 or residues 417-448 of the Pfu polymerase. These residues are found within a finger domain. In other embodiments, the intein is inserted within a flexible loop between residues 618-759 of Pfu polymerase. These residues are within the thumb domain. In still other embodiments, the intein is inserted within a flexible loop between residues 145-156, residues 209-214, residues 243-248, residues 260-305, or residues 347-349 of Pfu polymerase. These residues are within the exonuclease domain.
Although these residue numbers are specific for Pfu polymerase, these residues may be used to determine the corresponding residues for suitable intein insertion locations in other B family DNA polymerases. Sequence alignment may be used to determine appropriate corresponding locations. For example, the sequences of two DNA polymerases (e.g. Pfu polymerase and another B family DNA polymerase) may be aligned, and the residues corresponding to the above-listed residues for Pfu polymerase may be identified. In some embodiments, software may be used to perform the alignment and to identify residues predicted to have secondary structures vs. residues that are likely to be flexible loops. For sequences that do not completely align, residues ranges may be adjusted accordingly. For example, residues may be adjusted to account for extra residues, missing residues, etc. in one polymerase compared to the other.
In some embodiments, flexible loops are considered the same loop topologically, although they may have different lengths and residue numbers. When protein sequences are aligned, the two flexible loops may not exemplify high level of alignment, but the regions surrounding the flexible loop are well aligned, thus confirming that the two flexible loops (e.g. the flexible loop in Pfu polymerase and the flexible loop in another B family DNA polymerase) do indeed correspond to each other. In such embodiments, flexible loops identified as corresponding to any of the above-described flexible loops in Pfu polymerase may be used as intein insertion sites in other B family DNA polymerases.
Any suitable intein may be used in the fusion proteins described herein. The intein may be a large intein, a mini-intein, or a split intein. Large inteins consist of an intein domain and an endonuclease domain. The endonuclease domain is inserted within the intein domain, separating the intein domain into two parts. Mini inteins contain only the intein domain (e.g. no endonuclease domain). Split inteins are inteins that are split into two fragments, and are able to conduct splicing only when the two fragments are properly folded together.
In some embodiments, the splicing activity of the intein is regulated by one or more factors. These external factors include physical factors such as light and temperature, and chemical factors such as pH, salt, ligand binding, etc. Activation of protein splicing results in release of the target DNA polymerase from the fusion protein. The released target DNA polymerase possesses increased activity (e.g. increased DNA polymerase activity and/or increased exonuclease activity) compared to the activity of the target DNA polymerase when present in the fusion protein.
In some embodiments, the one or more factors are selected from temperature, pH, and divalent ions. For example, the factor may be temperature. In such embodiments, the intein selected is referred to as a “temperature-sensitive” intein. For example, the splicing activity of a temperature-sensitive intein may be activated by temperatures of 30° C. or greater. As another example, the splicing activity of a temperature-sensitive intein may be activated by temperatures of 40° C. or greater. As another example, the splicing activity of a temperature-sensitive intein may be activated by temperatures of 50° C. or greater. For example, intein splicing may be activated by temperatures of at least 30° C., at least 35° C., at least 40° C., at least 45° C., at least 50° C., at least 55° C., at least 60° C., at least 65° C., or greater than 70° C.
Suitable temperature-sensitive inteins that may be used in the disclosed fusion proteins include, for example, PI-PfuI intein (Pyrococcus furiosus, UniProt ID: E7FHX6 (residue C302-N755)), PI-PfuII intein (Pyrococcus furiosus, UniProt ID: E7FHX6 (residue C915-N1296)), Tth-HB27 DnaE-1 intein (Thermus thermophiles, Uniprot ID: Q72GP2 (residue C768-N1190)), Tmar Pol intein (Thermococcus marinus, UniProt ID: C7AIP4 (residue 5492-N1028)), Tfu Pol-1 intein (Thermococcus fumicolans, UniProt ID: P74918 (residue C407-N777)), Tfu Pol-2 intein (Thermococcus fumicolans, UniProt ID: P74918 (residue 5901-N1289)), Psp-GBD Pol intein (Pyrococcus sp. (strain GB-D), UniProt ID: Q51334 (residue 5493-N1029)), Mja TFIIB intein (Methanocaldococcus jannaschii, Uniprot ID: Q58192 (residue S100-N434)), Mvu TFIIB intein (Methanocaldococcus vulcanius, GenBank: ACX71902.1 (residue S93-N427)) and Sce VMA intein (alternative name: PI-SceI intein, Saccharomyces cerevisiae, UniProt ID: P17255 (residue C284-N737), PDB ID: 1DFA). Each of the above are large inteins. Each of the above may be used to create a corresponding mini intein by removing the endonuclease domain. Mini inteins derived from any of the above listed large inteins may be used in the fusion proteins described herein.
Additional suitable temperature-sensitive inteins include, for example, Pab PolII intein (Pyrococcus abyssi, UniProt ID: Q9V2F4 (residue C955-Q1139)) and Pho PolII intein (Pyrococcus horikoshii, GenBank ID: BAA29190.1 (residue C955-Q1120)). These are mini inteins. Other homologous inteins are potentially temperature sensitive, such as Tsi PolII intein (Thermococcus sibiricus, UniProt ID: C6A4U4 (residue C949-Q1114)), Tga PolII intein (Thermococcus gammatolerans, UniProt ID: C5A316 (residue C962-Q1125)), Tko PolII intein (Thermococcus kodakarensis, UniProt ID: Q5JET0 (residue C964-Q1437)), and Tba PolII intein (Thermococcus barophilus, UniProt ID: F0LKL3 (residue C952-N1426)).
Additional suitable temperature-sensitive inteins include, for example, Pho CDC21-1 intein (Pyrococcus horikoshii, GenBank ID: BAA29695.1 (residue C335-N502)), Pab CDC21-1 intein (Pyrococcus abyssi, GenBank ID CAB50345.1 (residue C335-N498)), and Tko CDC21-1 intein (Thermococcus kodakaraensis, GenBank: CAJ57164.1 (residue C1-N140)), Pho RadA intein (Pyrococcus horikoshii, UniProt ID: 058001 (residue C153-N324)), Tsi RadA intein (Thermococcus sibiricus, UniProt ID: C6A058 (residue C154-N321)) and Tvo VMA intein (Thermoplasma volcanium GSS1, UniProt ID: Q97CQ0 (residue C236-N421), PDB ID: 4O1S). These are mini inteins.
In some embodiments, a temperature-sensitive intein is a split intein. Suitable split inteins include Neq Pol intein (Nanoarchaeum equitans, GenBank: AAR38923.1 (5579-N676) and GenBank: AAR39369.1 (residue M1-N30)) and Ssp DnaE intein (Synechocystis sp. strain PCC6803, UniProt ID: P74750 (residue C775-K897 and M898-N933), PDB ID: 1ZD7).
Other suitable inteins which may be temperature-sensitive include Mja KlbA intein (Methanocaldococcus jannaschii, Uniprot ID: Q58191 (residue A405-N572)), Pho CDC21-2 intein (Pyrococcus horikoshii, GenBank ID: BAA29695.1 (residue C530-N789)), Hsp CDC21 intein (Halobacterium sp. NRC-1, GenBank ID: AAG20316.1 (residue C283-N464)), Hsp PolII intein (Halobacterium sp. NRC-1, UniProt ID: Q9HMX8 (residue C926-Q1120)) and Mxe GyrA intein (Mycobacterium xenopi, UniProt ID: P72065 (residue C66-N263), PDB ID: 1AM2).
Sce VMA intein (alternative name: PI-SceI intein, Saccharomyces cerevisiae, UniProt ID: P17255 (residue C284-N737), PDB ID: 1DFA) has been engineered to be active in the desired temperature range (Zeidler et al., 2004) and may also be used in the fusion proteins described herein.
In some embodiments, the factor is divalent ions (e.g. divalent metal ions). For example, the presence of one or more divalent ions may suppress intein activity. Addition of a suitable agent to remove or otherwise negate the divalent ions may thus disinhibit the intein, allowing for splicing to occur. For example, a chelating agent may be added to bind the metal ion, thus activating the splicing ability of the intein. In some embodiments, the intein is sensitive to the divalent metal ion Zn2+. In some embodiments, the intein is sensitive to an alternative or additional divalent metal ion (e.g. another metal ion in addition to Zn2+).
Suitable Zn2+ sensitive inteins include, for example, the large intein PI-PfuI intein (Pyrococcus furiosus, UniProt ID: E7FHX6 (residue C302-N755), PDB ID: 1DQ3), the large intein Mtu RecA intein (Mycobacterium Tuberculosis, GenBank: AMC51766.1 (residue C252-N691)), the mini intein Msm DnaB-1 intein (Mycolicibacterium smegmatis, GenBank: CKI67314.1 (residue A238-N376)), the split intein Ssp DnaE intein (Synechocystis sp. strain PCC6803, UniProt ID: P74750 (residue C775-K897 and M898-N933)), and the split intein Neq Pol intein (Nanoarchaeum equitans, GenBank: AAR38923.1 (5579-N676) and GenBank: AAR39369.1 (residue M1-N30)).
In some embodiments, the intein is selected from PI-PfuI intein (UniProt ID: E7FHX6 (residue C302-N755), PDB ID: 1DQ3), PI-PfuII intein (UniProt ID: E7FHX6 (residue C915-N1296)), Tth-HB27 DnaE-1 intein (Uniprot ID: Q72GP2 (residue C768-N1190)), Neq Pol intein (GenBank: AAR38923.1 (5579-N676) and GenBank: AAR39369.1 (residue M1-N30), PDB ID: 5OXZ), Tmar Pol intein (UniProt ID: C7AIP4 (residue S492-N1028)), Tfu Pol-1 intein (UniProt ID: P74918 (residue C407-N777)), Tfu Pol-2 intein (UniProt ID: P74918 (residue S901-N1289)), Pab PolII intein (UniProt ID: Q9V2F4 (residue C955-Q1139), PDB ID: 2LCJ), Pho PolII intein (GenBank ID: BAA29190.1 (residue C955-Q1120)), Tsi PolII intein (UniProt ID: C6A4U4 (residue C949-Q1114)), Tga PolII intein (UniProt ID: C5A316 (residue C962-Q1125)), Tko PolII intein (UniProt ID: QSJET0 (residue C964-Q1437)), Tba PolII intein (UniProt ID: F0LKL3 (residue C952-N1426)), Psp-GBD Pol intein (UniProt ID: Q51334 (residue S493-N1029)), Pho CDC21-1 intein (GenBank ID: BAA29695.1 (residue C335-N502), PDB ID: 6RPQ), Pab CDC21-1 intein (GenBank ID CAB50345.1 (residue C335-N498), PDB ID: 6RPP), Tko CDC21-1 intein (GenBank: CAJ57164.1 (residue C1-N140)), Mja TFIIB intein (Uniprot ID: Q58192 (residue S100-N434), Mvu TFIIB intein (GenBank: ACX71902.1 (residue S93-N427)), Pho RadA intein (UniProt ID: 058001 (residue C153-N324), PDB ID: 4E2T), Tsi RadA intein (UniProt ID: C6A058 (residue C154-N321)), Mja KlbA intein (Uniprot ID: Q58191 (residue A405-N572), PDB ID: 2JMZ), Pho CDC21-2 intein (GenBank ID: BAA29695.1 (residue C530-N789)), Hsp CDC21 intein (GenBank ID: AAG20316.1 (residue C283-N464)), Hsp PolII intein (UniProt ID: Q9HMX8 (residue C926-Q1120)), Mth RIR1 intein (GenBank: AAB85157.1 (residue C266-N399)), Mxe GyrA intein (UniProt ID: P72065 (residue C66-N263), PDB ID: 1AM2), Tvo VMA intein (UniProt ID: Q97CQ0 (residue C236-N421), PDB ID: 401S), Tac VMA intein (GenBank ID: BAB00608.1 (residue C236-N408)), Sce VMA intein (alternative name: PI-SceI intein UniProt ID: P17255 (residue C284-N737), PDB ID: 1DFA), Ssp DnaE intein (UniProt ID: P74750 (residue C775-K897 and M898-N933), PDB ID: 1ZD7), Npu DnaE intein (GenBank ID: ACC83218.1 (residue C775-N876) and GenBank ID: ACC83986.1 (residue M1-N36)), Ssp DnaB intein (UniProt ID: Q55418 (residue C381-N809)), Npu DnaB intein (GenBank ID: ACC81364.1 (residue C389-817N)), Msm DnaB-1 intein (GenBank: CKI67314.1 (residue A238-N376)), Mtu RecA intein (GenBank: AMC51766.1 (residue C252-N691)), gp41-1 intein (PDB ID: 6QAZ), Tko Pol-2 intein (GenBank: BAA06142.2 (residue S852-N1388), PDB ID: 2CW8), Cth BIL intein (GenBank: ABN53254.1 (residue C311-N445), PDB ID: 2LWY), Cne PRP8 intein (GenBank: AAX38543.1 (residue C1-N171), PDB ID: 6MX6).
In some embodiments, the intein is a pH sensitive intein. In some embodiments, the intein is sensitive to a plurality of factors. For example, the intein may be sensitive to temperature and pH. The intein may be sensitive to temperature and one or more divalent metal ions. The intein may be sensitive to temperature and pH and one or more divalent metal ions. The intein may be sensitive to pH and one or more divalent metal ions. The intein may be sensitive to additional factors not listed herein.
Any large intein may be made into a mini intein by removal of the endonuclease domain. The intein may comprise an amino acid sequence having 80% or more (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity with an intein described herein. For large inteins, the intein may comprise an amino acid sequence having 80% or more sequence identity with a mini intein derived from the large intein.
In some embodiments, the intein is PI-PfuI intein or a variant thereof. The sequence of wildtype PI-PfuI intein is:
In some embodiments, the intein comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 4. For example, the intein may comprise an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 4.
In some embodiments, the intein comprises a mini intein derived from the wild-type PI-PfuI intein (e.g. the large intein). For example, in some embodiments the intein comprises an amino acid sequence having at last 80% sequence identity with the PI-PfuI mini intein having the amino acid sequence:
In some embodiments, the intein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 6.
The amino acid sequences of other suitable inteins (e.g. suitable inteins described above) are provided below. Any intein comprising an amino acid sequence having at least 80% sequence identity with a sequence provided below may be used in the fusion proteins described herein.
PI-PfuII intein (UniProt ID: E7FHX6 (residue C915-N1296), intein domain: C915-S1055 and T1256-N1296). Full length large intein:
Mini intein derived from large intein:
Tth-HB27 DnaE-1 intein (Uniprot ID: Q72GP2 (residue C768-N1190), intein domain: C768-E874 and L1137-N1190). Full length large intein:
Mini intein derived from large intein:
Neq Pol intein (GenBank: AAR38923.1 (S579-N676) and GenBank: AAR39369.1 (residue M1-N30), PDB ID: 5OXZ). Natural split intein:
Mini intein derived from split intein:
Tmar Pol intein (UniProt ID: C7AIP4 (residue S492-N1028), intein domain: S492-E621 and S986-N1028). Full length large intein:
Mini intein derived from large intein:
Tfu Pol-1 intein (UniProt ID: P74918 (residue C407-N777), intein domain: C407-E518 and N718-N777). Full length large intein:
Mini intein derived from large intein:
Tfu Pol-2 intein (UniProt ID: P74918 (S901-N1289), intein domain: S901-V1042 and D1228-N1289). Full length large intein:
Mini intein derived from large intein:
Pab PolII intein (UniProt ID: Q9V2F4 (residue C955-Q1139), PDB ID: 2LCJ). Natural mini intein:
Pho PolII intein (GenBank ID: BAA29190.1 (residue C955-Q1120)). Natural mini intein:
Tsi PolII intein (UniProt ID: C6A4U4 (residue C949-Q1114)). Natural mini intein:
Tga PolII intein (UniProt ID: C5A316 (residue C962-Q1125)). Natural mini intein:
Tko PolII intein (UniProt ID: Q5JET0 (residue C964-Q1437), intein domain: C964-N1091 and K1386-Q1437). Full length large intein:
Mini intein derived from large intein:
Tba PolII intein (UniProt ID: F0LKL3 (residue C952-N1426), intein domain: C952-S1082 and T1373-N1426)
Full length large intein:
Mini intein derived from large intein:
Psp-GBD Pol intein (UniProt ID: Q51334 (residue S493-N1029), intein domain: S493-E622 and N987-N1029). Full length large intein:
Mini intein derived from large intein:
Pho CDC21-1 intein (GenBank ID: BAA29695.1 (residue C335-N502), PDB ID: 6RPQ). Natural mini intein:
Pab CDC21-1 intein (GenBank ID CAB50345.1 (residue C335-N498), PDB ID: 6RPP). Natural mini intein:
Tko CDC21-1 intein (GenBank: CAJ57164.1 (residue C1-N140)). Natural mini intein:
Mja TFIIB intein (Uniprot ID: Q58192 (residue S100-N434), intein domain: S100-K220 and R376-N434, PDB ID: 5O9J). Full length large intein:
Mini intein derived from large intein:
Mvu TFIIB intein (GenBank: ACX71902.1 (residue S93-N427), intein domain: S93-E220 and N376-N427, PDB ID: 5091). Full length large intein:
Mini intein derived from large intein:
Pho RadA intein (UniProt ID: 058001 (residue C153-N324), PDB ID: 4E2T). Natural mini intein:
Tsi RadA intein (UniProt ID: C6A058 (residue C154-N321)). Natural mini intein:
Mja KlbA intein (Uniprot ID: Q58191 (residue A405-N572), PDB ID: 2JMZ). Natural mini intein:
Pho CDC21-2 intein (GenBank ID: BAA29695.1 (residue C530-N789)). Natural mini intein:
Hsp CDC21 intein (GenBank ID: AAG20316.1 (residue C283-N464)). Natural mini intein:
Hsp PolII intein (UniProt ID: Q9HMX8 (residue C926-Q1120)). Natural mini intein:
Mth RIR1 intein (GenBank: AAB85157.1 (residue C266-N399)). Natural mini intein:
Mxe GyrA intein (UniProt ID: P72065 (residue C66-N263), PDB ID: 1AM2). Natural mini intein:
Tvo VMA intein (UniProt ID: Q97CQ0 (residue C236-N421), PDB ID: 401S). Natural mini intein:
Tac VMA intein (GenBank ID: BAB00608.1 (residue C236-N408)). Natural mini intein:
Sce VMA intein (alternative name: PI-SceI intein, UniProt ID: P17255 (residue C284-N737), intein domain: C284-P465 and A693-N737, PDB ID: 1DFA). Full length large intein:
Mini intein derived from large intein:
Ssp DnaE intein (UniProt ID: P74750 (residue C775-K897 and M898-N933), PDB ID: 1ZD7). Natural split intein:
Mini intein derived from split intein:
Npu DnaE intein (GenBank ID: ACC83218.1 (residue C775-N876) and GenBank ID: ACC83986.1 (residue M1-N36)). Natural split intein:
Mini intein derived from split intein:
Ssp DnaB intein (UniProt ID: Q55418 (residue C381-N809), intein domain: C381-L486 and S762-N809). Full length large intein:
Mini intein derived from large intein:
Npu DnaB intein (GenBank ID: ACC81364.1 (residue C389-817N), intein domain: C389-L481 and S779-N817). Full length large intein:
Mini intein derived from large intein:
Msm DnaB-1 intein (GenBank: CKI67314.1 (residue A238-N376)). Natural mini intein:
Mtu RecA intein (GenBank: AMC51766.1 (residue C252-N691), intein domain: C252-A345 and E654-N691). Full length large intein:
Mini intein derived from large intein:
gp41-1 intein (PDB ID: 6QAZ). Mini intein:
Tko Pol-2 intein (GenBank: BAA06142.2 (residue S852-N1388), intein domain: S852-E978 and G1347-N1388 PDB ID: 2CW8). Full length large intein:
Mini intein derived from large intein:
Cth BIL intein (GenBank: ABN53254.1 (residue C311-N445), PDB ID: 2LWY). Natural mini intein:
Cne PRP8 intein (GenBank: AAX38543.1 (residue C1-N171), PDB ID: 6MX6). Natural mini intein:
In some embodiments, the intein comprises an amino acid sequence having at least 80% sequence identity (at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity) with one or more of SEQ ID NO: 13-72.
Other suitable inteins are provided in Table 1 below. An intein used in the fusion proteins described herein may comprise an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity) with an amino acid sequence provided in Table 1 (e.g. one of SEQ ID NO: 73-127. The inteins in Table 1 satisfy the following criteria: 1) is from thermophilic organisms, and 2) the +1 position of extein is threonine (+1T-intein). The −1 and +1 extein residues are included for all sequences in the table. The inteins from thermophilic organisms may be temperature sensitive or may be engineered (e.g. mutated) to enhance temperature sensitivity and are thereby desirable for use in the fusion proteins described herein. The insertion positions contemplated herein contain a relatively conserved threonine, and therefore the +1T-inteins below can be directly used in the fusion proteins described herein without further engineering.
Other suitable inteins are provided in Table 2 below. An intein used in the fusion proteins described herein may comprise an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity) with an amino acid sequence provided in Table 2 (e.g. one of SEQ ID NO: 128-190). The inteins in Table 2 satisfy the following criteria: 1) is from thermophilic organisms, and 2) the +1 position of extein is serine (+1S-intein). −1 and +1 extein residues are included for all of the sequences below.
Other suitable inteins are provided in Table 3 below. An intein used in the fusion proteins described herein may comprise an amino acid sequence having at least 80% sequence identity (e.g. at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity) with an amino acid sequence provided in Table 3 (e.g. one of SEQ ID NO: 191-239). The inteins in Table 3 satisfy the following criteria: 1) is from thermophilic organisms, and 2) the +1 position of extein is cysteine (+1C-intein). −1 and +1 extein residues are included for all of them.
In some embodiments, the intein further comprises a linker. A linker attached to the intein is referred to herein as an “intein linker”. In some embodiments, the intein comprises an N-terminal linker and/or a C-terminal linker. Any suitable intein linker may be used. In some embodiments, the intein linker comprises 5 or less amino acids. In some embodiments, the intein linker comprises 5, 4, 3, 2, or 1 amino acid.
In some embodiments, the fusion protein further comprises a purification tag. Polyhistidine (His6) is a common purification tag and may be used. However, other suitable purification tags may be employed. In some embodiments, the purification tag further comprises a linker. A linker attached to the purification tag is referred to herein as a “tag linker”. In some embodiments, the purification tag comprises an N-terminal linker and/or a C-terminal linker. Any suitable tag linker may be used. In some embodiments, the tag linker comprises 5 or less amino acids. In some embodiments, the tag linker comprises 5, 4, 3, 2, or 1 amino acid. In some embodiments, the N-terminal tag linker comprises SG. In some embodiments, the C-terminal tag linker comprises GS.
In some embodiments, the purification tag is inserted within the intein. An appropriate insertion location should not affect the structure and function of the intein. Thus, flexible loops on the intein are preferred insertion positions for the purification tag. In some embodiments, the purification tag may be inserted within a flexible loop of an endonuclease domain in a large intein. In some embodiments, the purification tag may be inserted within a flexible loop within the sequence between the two fragments of a split intein or within the corresponding regions of a mini intein. In some embodiments, the purification tag is inserted within a flexible loop in a mini intein. In some embodiments, the purification is inserted within the mini intein to replace where the endonuclease domain would have been in the corresponding large intein. In some embodiments, the endonuclease domain of a large intein is replaced with a purification tag, thereby generating a mini intein containing the purification tag.
In some embodiments, the purification tag position on PI-PfuI intein is between residue Gly126 and Val418. This region is flexible and structurally conserved in some other inteins. Accordingly, this position may also be employed in other inteins besides the PI-PfuI intein.
In some embodiments, the intein comprises a PI-PfuI mini intein containing an N-terminal linker (e.g. SG, SEQ ID NO: 8), a C-terminal linker (e.g. GS, SEQ ID NO: 9), and a purification tag (e.g. HHHHHH (SEQ ID NO: 7)). Such a mini intein is set forth in the amino acid sequence of SEQ ID NO: 5.
In some embodiments, the intein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 5.
The amino acid sequence of an exemplary fusion protein containing an A family DNA polymerase is:
This exemplary fusion protein is referred to as an “auto hot start Taq” or “InTaq”. These terms are used interchangeably herein and refer to the same fusion protein. This auto hot start Taq used in the following experiments (SEQ ID NO:1) is created by inserting the modified PI-PfuI mini intein (SEQ ID NO:5) into a modified Taq polymerase (SEQ ID NO:3) between residues Gly502 and Thr503. The modified Taq polymerase (SEQ ID NO:3) is modified from wildtype Taq polymerase (SEQ ID NO:2) by mutations Lys505Gly and Glu507Gly to accommodate the inserted intein. The first three N-terminal residues of wildtype Taq polymerase (SEQ ID NO:2), Met1, Arg2 and Gly3 were removed during cloning.
The inserted modified PI-PfuI mini intein (SEQ ID NO:5) is created by inserting N-terminal linker (SEQ ID NO:8), His6 tag (SEQ ID NO:7), and C-terminal linker (SEQ ID NO:9) into a PI-PfuI mini intein (SEQ ID NO:6) between residues Gly131 and Gly132 of the mini intein. The PI-PfuI mini intein (SEQ ID NO:6) is derived from the wildtype PI-PfuI intein (SEQ ID NO:4).
In some embodiments, the fusion protein comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 1. In some embodiments, the fusion protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 1.
The amino acid sequence of an exemplary fusion protein containing a B family DNA polymerase is:
This exemplary fusion protein is referred to herein as “auto hot start Pfu” or “InPfu”. These terms are used interchangeably herein and refer to the same fusion protein. The exemplary auto hot start Pfu used in the following experiments (SEQ ID NO:10) is created by inserting the modified PI-PfuI mini intein (SEQ ID NO:5) into a modified Pfu polymerase (SEQ ID NO:12) between residues Gly709 and Thr710. The modified Pfu polymerase (SEQ ID NO:12) is modified from wildtype Pfu polymerase (SEQ ID NO:11) by mutations Asp708Thr and Pro710Lys, and inserting two glycines between Arg706 and Gly707 to accommodate the inserted intein.
In some embodiments, the fusion protein comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 10. In some embodiments, the fusion protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 10.
The fusion proteins described herein may be incorporated into compositions. Such compositions find use in a variety of methods. Suitable methods include, for example, PCR, RT-PCR, reverse transcription, isothermal amplification, genotyping, cloning, mutation detection, sequencing, microarrays, forensics, paternity testing, diagnostic PCR, and gene synthesis. In some embodiments, the composition further comprises a nucleic acid template (e.g. a nucleic acid intended to be amplified). In some embodiments, the composition further comprises a reaction buffer. Suitable reaction buffers may comprise reagents necessary to perform the desired method. For example, reaction buffers may contain dNTPs, primers, probes, degradation inhibitors, surfactants, PCR additives (e.g. ammonium sulfate, DMSO, formamide, glycerol, and Triton X-100), buffers (e.g. sequencing buffer, PCR buffer, RT-PCR buffer), and the like.
In some embodiments, the fusion proteins described herein may be incorporated into kits. For example, a kit may comprise a fusion protein and one or more additional components. The components of the kit may be packaged separately or together. The kit may additionally comprise instructions for using the kit. Instructions included in kits can be affixed to packaging material, can be included as a package insert, or can be viewed or downloaded from a particular website that is recited as part of the kit packaging or inserted materials. While the instructions are typically written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” can include the address of an internet site that provides the instructions. In some embodiments, the kit comprises a fusion protein as described herein and a suitable reaction buffer, depending on the intended use of the kit. For example, kits intended for use in RT-PCR (e.g. one-step RT-PCR, two-step RT-PCR) may additionally comprise a suitable PCR reaction buffer. Kits intended for use in two-step RT-PCR may additionally comprise a reverse transcriptase. In some embodiments, provided herein is a kit for one-step RT-PCR comprising a fusion protein comprising a DNA polymerase possessing reverse transcriptase activity. Such a kit may be particularly useful for rapid and specific diagnostic tests, such as for SARS-CoV-2 or influenza.
In some aspects, provided herein are methods of using the fusion proteins described herein. In some embodiments, provided herein is a method of amplifying nucleic acid. The method comprises providing a composition comprising a nucleic acid template and a fusion protein comprising as described herein. In some embodiments, the method comprises providing a composition comprising a nucleic acid template and a fusion protein comprising a target DNA polymerase and an intein inserted at a designated position in the target DNA polymerase. Insertion of the intein at the designated position inhibits activity of the target DNA polymerase. The method further comprises modifying one or more factors to induce release of the target DNA polymerase from the fusion protein. The released target DNA polymerase possesses increased activity compared to the target DNA polymerase containing the inserted intein. The method further comprises amplifying the nucleic acid template in the composition.
In some embodiments, protein splicing activity of the intein is regulated by the one or more external factors. As described above, these external factors may include physical factors such as light and temperature, and chemical factors such as pH, salt, ligand binding, etc. Activation of protein splicing as a result of modifying the one or more factors results in release of the target DNA polymerase from the fusion protein. The released target DNA polymerase possesses increased activity (e.g. increased DNA polymerase activity and/or increased exonuclease activity) compared to the activity of the target DNA polymerase when present in the fusion protein. Accordingly, the methods described herein allow for the target DNA polymerase to only perform its enzymatic function when desired characteristics are achieved. For example, the methods described herein allow for the target DNA polymerase to only perform its enzymatic function when a set temperature and/or pH is achieved, thereby activating the intein and inducing the splicing reaction, thereby freeing the DNA polymerase from the inhibition of the intein. As another example, the methods described herein allow for the target DNA polymerase to perform its enzymatic function when a suitable agent (e.g. chelating agent) is added to the composition disinhibit the intein from a divalent metal ion, thereby activating the splicing reaction and inducing release of the DNA polymerase from the fusion protein. Such methods are therefore useful in allowing for amplification of a nucleic acid template only when desired, thus reducing non-specific amplification.
In some embodiments, the fusion proteins or compositions comprising the same find use in methods involving reverse transcription. Reverse transcription (RT) is the process of synthesizing DNA from an RNA template. It can be followed by a PCR reaction to amplify the synthesized DNA. Reverse transcription-polymerase chain reaction (RT-PCR) is the coupling of reverse transcription reaction and PCR. This technology is widely used for synthesizing the cDNA from mRNA, or detecting specific target sequence from any RNA source such as viral genome RNA. The reaction starts with the reverse transcription catalyzed by a polymerase containing reverse transcriptase activity, which synthesizes the DNA fragment complementary to the RNA template. Then in the regular PCR step, a PCR compatible polymerase amplifies the target DNA fragment using the DNA template synthesized from the reverse transcription step.
In general, RT-PCR is performed using one reverse transcriptase (RT family DNA polymerases) for RT and one thermally stable DNA polymerase for PCR. Currently, the widely used reverse transcriptases from viruses can synthesize long DNA products at a high rate. However, these enzymes are not thermally stable and could inhibit PCR reaction. Additionally, these reverse transcriptases require a low temperature for RT, which leads to nonspecific DNA synthesis catalyzed by the DNA polymerase. Accordingly, the fusion proteins described herein would be advantageous over those currently used in the art due to their thermal stability and conditional activation (e.g. temperature sensitivity of the intein). In some embodiments, the fusion protein and compositions described herein may be used for one-enzyme RT-PCR (e.g. one-step RT-PCR). For example, fusion proteins comprising a DNA polymerase with both reverse transcriptase and DNA polymerase activity may be employed for one-enzyme RT-PCR methods (e.g. without the need for an additional reverse transcriptase). In other embodiments, the fusion proteins and compositions described herein may be used for two-enzyme RT-PCR (e.g. two-step RT-PCR), by using a separate enzyme with reverse transcriptase activity and subsequently using a fusion protein comprising a DNA polymerase as described herein.
An RNA extraction step is usually conducted before RT-PCR for virus detection. It denatures viral capsid to release viral RNA for detection and denatures RNases to protect RNA samples. It can be conducted using an RNA extraction kit or heat treatment to break the virus. This step could take 30 minutes or longer and part of the RNA sample could be lost during this process. The reason that heat-treated RNA extraction is typically a separate step is that common reverse transcriptases are not thermally stable. Therefore, they cannot withstand the heat during RNA extraction. Hence, a separated step is required, which adds complexity to the virus detection process and increases the odds of error. The denatured RNases could also refold between these steps and new RNases contamination could be introduced into the reaction. In contrast, in some embodiments, the fusion proteins provided herein may be used in heat-treatment RT-PCR. For example, for thermally stable DNA polymerases described herein that have reverse transcriptase activity, the heat-treatment RNA extraction step can be conducted directly in the RT-PCR reaction (referred to as heat-treatment RT-PCR, or HT-RT-PCR), since the polymerases can retain activity even after being boiled. Fusion proteins provided herein that find use in HT-RT-PCR possess numerous advantages. For example, since there is no transfer between the steps, all viral RNA is used directly for RT-PCR and the loss of the RNA sample could be minimized. In addition, handling time can be greatly shortened by cutting additional steps, and the risk of contamination is greatly reduced.
In some embodiments, the fusion protein may be mixed with other unmodified or modified DNA polymerases, such as an unmodified or modified Taq polymerase or Pfu polymerase, for its use.
In some embodiments, the fusion proteins described herein may be used in methods involving PCR. Polymerase Chain Reaction (PCR) is one of the most common reactions used in life sciences, medical, and clinical laboratories. It is used for synthesizing specific DNA sequences based on a template sequence through thermal cycles. A standard PCR thermal cycle contains three steps: denaturation, annealing, and synthesis. The denaturation step uses high temperature to generate the single strand template. Then, the annealing step lowers the temperature so that the designed oligonucleotide binds to the target position on the template. This designed oligonucleotide acts as the primer for DNA synthesis by providing the 3′-OH group and assigning the synthesis initiation position. During the synthesis step, the proper temperature is maintained for the DNA polymerase to catalyze DNA synthesis. New copies of DNA are generated in each thermal cycle, which are used as templates in the later cycles. Thus, repeating the three steps establishes a chain reaction to amplify the original DNA template. In quantitative PCR (qPCR, or real-time PCR), fluorescence is introduced during synthesis, so that the DNA products can be quantitatively measured in real-time. Many other PCR based technologies have also been developed for specific applications, such as digital PCR, solid-phase PCR, etc.
Standard PCR and modified versions have various applications, such as amplifying specific sequences, fusing sequences, generating mutations into DNA products, generating DNA sequence libraries, amplifying the whole genome, DNA de novo synthesis, introducing unnatural or modified nucleotides into DNA products, etc. Because the target sequence is amplified exponentially, PCR and PCR based technologies have been used to detect specific sequences, such as viral sequences, or single-nucleotide polymorphism (SNP) for clinical diagnoses. These applications have been routinely used in life sciences, medical, and clinical laboratories. The fusion proteins described herein may be used in any of these or other methods involving PCR.
In some embodiments, the fusion proteins and compositions described herein may be used in methods involving isothermal amplification. DNA polymerase based isothermal amplification is another technology for DNA synthesis. Isothermal amplification reactions are conducted at a constant temperature, which use the strand displacement activity of DNA polymerases, specifically designed primers, and additional enzymes to generate single-strand regions on the template for primer binding and DNA synthesis. Several isothermal amplification technologies have been commercialized: helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), multiple displacement amplification (MDA, also used for whole genome amplification, WGA), ramification amplification (RAM), etc. DNA polymerase based isothermal amplification technologies have been widely used for nucleic acids amplification and detection. The fusion proteins described herein may be used in any of these methods.
In some embodiments, the fusion proteins and compositions described herein may be used in methods involving sequencing. DNA or RNA sequencing is the technique to determine the sequence of nucleotides in DNA or RNA. DNA polymerase duplicates a template strand by probing the base information of the template strand and accordingly incorporating the correct nucleotides into the newly synthesized strand. Thus, DNA polymerase mediated synthesis can be used to sequentially extract nucleotide information of a template. So far, three generations of sequencing technologies have been developed. The first generation sequencing is Sanger sequencing, which is a PCR based sequencing technology. DNA polymerase randomly incorporates different fluorescence-labeled dideoxynucleotides that terminate DNA synthesis, producing fluorescence-labeled DNA products with all possible lengths. The fluorescence provides the base information of the nucleotide, and the length of the DNA product provides the position information of the nucleotide. The combination of both information results in the sequence of the template. The second generation sequencing, or next-generation sequencing (NGS, short-read NGS), is a high throughput sequencing technology. The sample is first broken down to small fragments, followed by PCR based clonal amplification of each fragment. Each fragment is then sequenced by different strategies and combined into the sequence of the template. The third generation sequencing (long-read NGS, single molecule sequencing) extends the read for each sequencing process and directly reads the sequence of the sample, while some third generation sequencing technologies use PCR to amplify the sample. Each of these sequencing technologies require DNA polymerases to amplify the sample by PCR (first, second, and some third generation), incorporate labeled nucleotides (first, some second, and some third generation), and generate reads by DNA synthesis (first, some second, and some third generation). The fusion proteins and compositions described herein may be used in any of these sequencing methods.
The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.
The modeled PI-PfuI mini intein was based on the structure of wild-type PI-PfuI intein (PDB ID: 1DQ3). The modeled InTaq was based on the modeled PI-PfuI mini intein and the structure of Taq DNA polymerase (PDB ID: 1TAQ). The modeled InPfu was based on the modeled PI-PfuI mini intein and the structure of Pfu DNA polymerase (PDB ID: 4AIL). Modeling was conducted using coot and Phenix. Figures generated using UCSF ChimeraX.
The DNA fragment of wildtype Taq DNA polymerase was amplified using primers forward 5′GGAATTCCATATGCGTGGTATGCTGCCGCTGTTTGAACCGAAAGGTCGTGTCCTC-3′ (SEQ ID NO: 240) and reverse 5′-ACGCGTCGACTTATTACTCCTTGGCGGAGAGCCAGT-3′ (SEQ ID NO: 241) and digested by NdeI and SalI. The fragment was inserted into pET21a vector between NdeI and XhoI sites, resulting in the construct named pET-Taq. The following DNA fragment was synthesized:
The synthesized fragment was digested by FseI and BamHI, and then inserted into pET-Taq between FseI and BamHI sites, resulting in the construct named pET-InTaq. The protein product expressed from pET-InTaq is auto hot start Taq DNA polymerase (InTaq).
The DNA fragment of wildtype Pfu DNA polymerase was amplified using primers forward 5′-GGAATTCCATATGATTTTAGATGTGGATTACATAACTGAAGAA-3′ (SEQ ID NO: 243) and reverse 5′-CCGCTCGAGTTATTAGGATTTTTTAATGTTAAGCCAGGAAGTTAG-3′ (SEQ ID NO: 244), and digested by NdeI and XhoI. The fragment was inserted into pET21a vector between NdeI and XhoI sites, resulting in the construct named pET-Pfu. The following DNA fragment was synthesized:
The synthesized fragment was digested by HindIII and XhoI, and then inserted into pET-Pfu between HindIII and XhoI sites, resulting in the construct named pET-InPfu. The protein product expressed from pET-InPfu is auto hot start Pfu DNA polymerase (InPfu).
The plasmids carrying the target genes were transferred into BL21 star (DE3) Rosetta 2. The strains were cultured in the presence of antibiotics for selection, and the glycerol stocks were prepared and used for the subsequent protein expression. The protein expression was started by incubating the glycerol stocks in 1 L Lysogeny broth media with antibiotics. The cell was cultured at 37° C. and induced with 0.5 mM Isopropyl 0-D-1-thiogalactopyranoside (IPTG) for protein expression. The cells were further cultured for 6 hours and collected for protein purification.
The collected cells were resuspended in lysis buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl) and lysed by passing microfluidizer 5 times. The lysate was then incubated at 60° C. for 25 min, followed by 5 min incubation on ice. The lysate was clarified by high speed centrifugation for 30 min at 4° C. The clarified supernatant was collected and loaded onto 5 ml HisTrap column pre-equilibrated with NiA buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 10 mM imidazole). The column was then extensively washed by NiA buffer, and the fusion proteins were eluted by NiB buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 300 mM imidazole). The eluted protein was diluted by 10 folds using dilution buffer (5 mM Tris-HCl pH 8.0) and then loaded onto 5 ml HiTrap Q column. The column was washed by QA buffer (20 mM Tris-HCl pH 8.0, 50 mM NaCl) and the target protein was eluted by NaCl gradient. The final purified target protein was exchanged to buffer (20 mM Tris-HCl pH 8.0, 50 mM KCl) and stored at −80° C. The protein concentration was determined by UV280 absorption and protein extinction coefficient (InTaq: 144160, InPfu: 160440).
The protein splicing activities of the fusion proteins were determined by the protein splicing assay. The purified protein was diluted to 0.5 mg/ml in different buffers and incubated with varying temperature and time. The reaction products are then examined by 8% SDS-PAGE gel. All gels were analyzed by Bio-Rad Quantity One to measure band intensity. Charts and fittings were generated by GraphPad Prism 6.
The DNA polymerase activities of the proteins were determined by the DNA elongation assay. The DNA substrate used in the assay contains the sequence 5′-CGAACGATGTGAACCTAATAACGTCTCTCGCGGCCGATCTGCCGGCCGCGAGAGAC GT-3′ (SEQ ID NO: 246). The substrate was dissolved in water at 100 μM and incubated at 95° C. for 5 min, followed by annealing on ice for 30 min. The different polymerases at 0.01 mg/ml were mixed with 0.5 μM DNA substrates and 0.25 mM each dNTP in 20 μl volume with standard Taq DNA polymerase reaction buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2) or standard Pfu DNA polymerase reaction buffer (120 mM Tris-HCl pH 8.8, 10 mM KCl, 6 mM ammonium sulfate, 1.5 mM MgCl2, 0.1% Triton X-100, 0.001% BSA). The pre-activation of the auto hot start DNA polymerases was conducted by incubation at 80° C. for 5 min followed by incubation on ice-water bath. The reactions were conducted at various temperatures and incubation time as indicated. After incubation, 20 μl 2×denature loading buffer (95% deionized formamide, 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol FF, 5 mM EDTA) was mixed with each reaction. The sample was incubated at 95° C. for 5 min and then loaded onto 10% 8 M Urea-PAGE gel. After electrophoresis, the gel was stained by ethidium bromide and imaged under ultraviolet light.
The 3′-5′ exonuclease activities of the proteins were determined by the exonuclease assay. The DNA substrate used in the assay contains the sequence 5′-TGTTCTCCTCTTCCGCTGCTCCCGCGATCTGCCGCGGGAGCAGCGGAAGAGGAGAAC A-3′ (SEQ ID NO: 247). The substrate was dissolved in water at 100 μM and incubated at 95° C. for 5 min, followed by annealing on ice for 30 min. The different polymerases at 0.01 mg/ml were mixed with 0.5 μM DNA substrates in 20 μl volume with standard Pfu DNA polymerase reaction buffer (120 mM Tris-HCl pH 8.8, 10 mM KCl, 6 mM ammonium sulfate, 1.5 mM MgCl2, 0.1% Triton X-100, 0.001% BSA). The pre-activation of the auto hot start DNA polymerases was conducted by incubation at 80° C. for 1 h followed by incubation on ice-water bath. The reactions were conducted at 50° C. for 1 h incubation. After incubation, 20 μl 2×denature loading buffer (95% deionized formamide, 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol FF, 5 mM EDTA) was mixed with each reaction. The sample was incubated at 95° C. for 5 min and then loaded onto 10% 8 M Urea-PAGE gel. After electrophoresis, the gel was stained by ethidium bromide and imaged under ultraviolet light.
The PCR capabilities of the fusion proteins were determined by PCR. InTaq or InPfu was mixed with 100 ng DNA templates, 10 pmol each primer, and 0.25 mM each dNTP in 50 μl volume with standard Taq DNA polymerase reaction buffer or standard Pfu DNA polymerase reaction buffer. The mixture was loaded onto PCR machine with the following program: first incubation at 80° C. for 5 min; followed by 30 thermal cycles of 94° C. for 30 sec, 55° C. for 30 sec, and 72° C. for 10 sec to 6 min depending on the target DNA length (1 kb/minute); then the temperature is kept at 72° C. for 5 min. After PCR, 5 μl sample was mixed with loading dye and loaded onto 1% agarose-TBE gel containing ethidium bromide. After electrophoresis, the gel was imaged under ultraviolet light.
Many A, B, and RT family DNA polymerases have been used for DNA amplification applications such as PCR and isothermal amplification, and Taq DNA polymerase is one of the most commonly used DNA polymerases. This A family DNA polymerase from Thermus aquaticus contains 5′ to 3′ polymerase activity and 5′ to 3′ exonuclease activity. Taq DNA polymerase has adequate stability and activity at high temperature to enable PCR. Accordingly, this widely-used DNA polymerase was selected to validate the design for A family DNA polymerase.
The structures of Taq DNA polymerase were critically investigated to look for an insertion location for the temperature-sensitive intein. The insertion position should inhibit DNA polymerase activity in the presence of the intein, support the intein protein splicing reaction, and result in a functional Taq DNA polymerase after the intein is spliced. The intein inhibition of the DNA polymerase activity could be achieved by physically blocking the Taq DNA polymerase active site, compromising its DNA binding ability, or disrupting its function allosterically. Multiple regions on different Taq DNA polymerase domains satisfy these criteria. Since it was desirable to create a design that is transferable to other A family DNA polymerases, structurally conserved regions of the Taq DNA polymerase catalytic core: thumb, finger, and palm domains were the focus of a suitable intein insertion location.
To support the intein protein splicing reaction, the insertion location should not compromise the intein structure and function. Moreover, to result in a functional Taq DNA polymerase after the intein is spliced, the insertion location should not hinder the release of the intein. Taq DNA polymerase does not naturally contain the extein consensus sequence that supports intein splicing, which needs to be created by mutation or insertion. Thus, the insertion location should minimalize the required modifications to have limited or no effect on the activity or function of Taq DNA polymerase. According to these criteria, the insertion location of the intein should be on flexible loops of Taq DNA polymerase, since loops are structurally flexible to allow the intein to conduct protein splicing and likely to minimize its interferences with other parts of Taq DNA polymerase. Thus, the insertion location was selected on a loop in the thumb domain of Taq DNA polymerase between residue Leu494 and Ala517 (H1H2 loop). The conformational changes of the thumb domain and the H1H2 loop are critical for the binding of the DNA substrate. Thus inserting a protein domain in this loop should not only physically block the entrance of the DNA substrate but also hinder the conformational changes required for building the interactions between the thumb domain and the DNA substrate (
To develop auto hot start Taq DNA polymerase, the intein needs to be capable of temperature-induced splicing (
To facilitate the purification of the auto hot start Taq DNA polymerase, a polyhistidine (His6) tag was inserted in the PI-PfuI mini intein so that only the intein-containing proteins are selected during affinity chromatography. This insertion should not affect the structure and function of the intein. Thus, the His6 tag was inserted between PI-PfuI intein residues Gly126 and Val418 to replace the deleted endonuclease domain (
The candidate auto hot start Taq DNA polymerase was modeled by fusing the structures of Taq DNA polymerase, PI-PfuI mini intein, and the His6 tag (
Besides Taq DNA polymerase and other A family DNA polymerases, many B family DNA polymerases are also widely used in PCR and other DNA amplification applications. These B family DNA polymerases usually contain a functional 3′-5′ exonuclease domain for proofreading to remove misincorporated nucleotides. Thus, they have a lower error rate and are often used as high-fidelity DNA polymerases. Pfu DNA polymerase from Pyrococcus furiosus, one of the most commonly used commercial B family DNA polymerases, was selected to validate the design for B family DNA polymerase. It has both 5′ to 3′ polymerase activity and 3′ to 5′ exonuclease activity. Pfu DNA polymerase has better thermal stability than Taq DNA polymerase but its activity is slower.
The structures of Pfu DNA polymerase were carefully inspected to look for an insertion location of PI-PfuI mini intein based on the criteria described above. The insertion location was chosen between residues Gly707 and Asp708 on the Leu705-Arg714 loop of Pfu DNA polymerase thumb domain. The candidate auto hot start Pfu DNA polymerase was modeled by fusing the structures of Pfu DNA polymerase, PI-PfuI mini intein, and the His6 tag (
Both InTaq and InPfu were readily expressed after IPTG induction. After harvesting the cells, the target proteins could be clearly identified in the whole cell lysate. These results have demonstrated that the insertion of PI-PfuI mini intein does not compromise the protein expression of both DNA polymerases. Since both the intein and the DNA polymerases are thermally stable, heat treatment was used before affinity chromatography, which denatured the majority of E. coli proteins. Affinity chromatography targeting His6 tag was then conducted to purify intein-containing DNA polymerases, which resulted in highly purified InTaq and InPfu. The fusion proteins were then further purified by ion-exchange chromatography and the final products were over 90% purity (
For functional auto hot start DNA polymerases, the inserted intein should be able to remove itself from the fusion proteins by protein splicing after a certain temperature is reached (
The results (
The inserted PI-PfuI mini intein should be able to inhibit the DNA substrate binding of the fusion proteins at room temperature. After protein splicing is triggered by increased temperature, the inhibition should be released to recover the substrate binding ability and activates DNA polymerases. This temperature-controlled activation is central for the auto hot start DNA polymerase design.
To examine whether the fusion proteins are inhibited by the inserted intein, DNA elongation assay was conducted using a hairpin substrate for both InTaq and InPfu under different conditions (
Many B family DNA polymerases contain the 3′-5′ exonuclease domain, which processively degrades ssDNA or dsDNA. Preventing the binding of the DNA substrate should block the polymerase activity as well as any other activities requiring DNA binding. To test this hypothesis, the exonuclease assay was conducted with intein-containing InPfu and wildtype Pfu DNA polymerase. With a hairpin substrate at 50° C. for 1 h, no DNA cleavage was detected in reactions with InPfu (
The auto hot start DNA polymerases described herein can suppress catalysis up to 24 hours at room temperature and rapidly regain activity above 50° C. These fusion proteins should also be able to conduct standard DNA amplification reactions such as PCR. To determine the PCR capability of InTaq and InPfu, these proteins were used to amplify a series of substrates following standard PCR protocol with 1 kb/minute amplification steps. DNA templates with lengths from 0.26 kb to 6.1 kb were tested. DNA amplification products were observed for all substrates by PCR (
PCR reaction buffer is routinely modified to cater to diverse needs. Many additives are used for different reactions. For example, DMSO is a common PCR enhancer to increase the reaction yield and specificity, especially for GC-rich substrates. To test the compatibility of the auto hot start DNA polymerases with different PCR buffers, the protein splicing assay was conducted at 80° C. for 1 hour under various conditions, including different pH, various ionic strengths, and in the presence of multiple common PCR additives, including ammonium sulfate, DMSO, formamide, glycerol, and Triton X-100 (
The optimal working pH of Taq DNA polymerase, Pfu DNA polymerase, and many other commercial DNA polymerases ranges between 7.0-9.0. The protein splicing results showed that the splicing activity for both InTaq and InPfu was optimal between pH 7.0-8.0, while pH 8.0-9.0 was well tolerated (
Divalent ions reversibly inhibit some inteins, but their effects on PI-PfuI intein or PI-PfuI mini intein have not been investigated. To examine the effect of divalent ions on the auto hot start DNA polymerases, the protein splicing activity of both InTaq and InPfu was tested at 80° C. for 1 hour in the presence of 1 mM common divalent metal ions (
Zn2+ inhibition of InTaq and InPfu was further investigated by conducting the protein splicing assay at 80° C. for 1 hour with various concentrations of ZnCl2 (
These results have demonstrated that the Zn2+ inhibition of both InTaq and InPfu was reversible, providing another method to control auto hot start DNA polymerases by regulating intein splicing.
RT-PCR is the reaction used to detect RNA, which is essential for detecting SARS-CoV-2 and other RNA-based viruses. Usually, such a reaction requires two enzymes: reverse transcriptase synthesizes DNA from RNA, which is then amplified by DNA polymerase in PCR. If DNA polymerases can conduct both reactions, it can simplify the reaction and potentially lower reaction time. Moreover, the auto hot start DNA polymerases described herein have the hot start function to enhance accuracy by eliminating nonspecific products. Accordingly, the auto hot start polymerases described herein may be developed into a novel single enzyme hot start test kit, such as for SARS-CoV-2 or Influenza.
Materials and Methods
RT-PCR:
The total RNA of 3 ml overnight cultured BL21 (DE3) was extracted using Trizol reagent. The purified RNA was dissolved in DEPC-water. 10 μg RNA was further treated by DNase I in 100 μl reaction at 37° C. for 1 h. The reaction was stopped by the addition of 5 mM EDTA followed by incubation at 75° C. for 10 min. 1 μl Dnase I treated RNA was added to 25 μl RT-PCR reaction containing 60 mM Tris-HCl pH 8.0, 2 mM (NH4)2SO4, 40 mM KCl, 2 mM MgCl2, 0.2 mM dNTPs each, 0.2 μM each primer, and 5 μg/ml InTaq DNA polymerase. The forward primer is 5′-CTCTTGCCATCGGATGTGCCCA-3′ (SEQ ID NO: 248). The reverse primer is 5′-CCAGTGTGGCTGGTCATCCTCTCA-3′ (SEQ ID NO: 249). A 105 bp fragment can be amplified using these two primers from E. coli rrsA gene or 16S rRNA. To evaluate possible genomic DNA containments, 1 μl Dnase I treated RNA or 1 μl BL21 (DE3) cell culture was added to 25 μl PCR reaction containing 120 mM Tris-HCl pH 8.8, 10 mM KCl, 6 mM ammonium sulfate, 1.5 mM MgCl2, 0.1% Triton X-100, 0.001% BSA, 0.2 mM dNTPs each, 0.2 μM each primer, and 1.25 units Pfu DNA polymerase. The mixtures were loaded onto PCR machine with the following program: first incubation at 80° C. for 1 min, 60° C. for 30 min, and 94° C. for 1 min; followed by 35 thermal cycles of 94° C. for 30 sec and 60° C. for 10 sec. After RT-PCR, 5 μl sample was mixed with loading dye and loaded onto 1% agarose-TBE gel containing ethidium bromide. After electrophoresis, the gel was imaged under ultraviolet light.
HT-RT-PCR:
The MS2 phage (ATCC 15597-B1) was cultured on agar plates according to the protocol from ATCC. The soft agar was scraped off the surface and centrifuged. The supernatant containing phage particles was collected as the stock. 1 μl phage stock was mixed with 9 μl 5 mM EDTA (pH 8.0). The diluted phage solution was used as the input sample. mM EDTA solution was used as the negative control sample. RT-PCR was performed as described above with MgCl2 concentration increased to 4 mM. 1 μl diluted phage solution or EDTA solution was added to the reaction. Two sets of primers were used to detect the MS2 genome RNA.
Set 1 and Set 2 primers amplify 112 bp and 113 bp fragments, respectively. The mixtures were loaded onto PCR machine with the following program: first incubation at 95° C. for 5 min, 60° C. for 30 min, and 94° C. for 1 min; followed by 35 thermal cycles of 94° C. for 30 sec and 60° C. for 10 sec. After RT-PCR, 5 μl sample was mixed with loading dye and loaded onto 1% agarose-TBE gel containing ethidium bromide. After electrophoresis, the gel was imaged under ultraviolet light.
Results
RT-PCR:
Multiple A family DNA polymerases also have reverse transcriptase activity, including Tth, Bst, and Taq DNA polymerases. Therefore, InTaq DNA polymerase should be able to catalyze the single enzyme hot start RT-PCR. To test this hypothesis, we used InTaq DNA polymerase to amplify a 105 bp fragment of 16S rRNA from E. coli total RNA under a published condition. The results showed that a single target DNA was amplified from the total RNA sample (
HT-RT-PCR:
Heat-treated RNA extraction is common for detecting viral RNA for RNA viruses. It is usually conducted as a separate step prior to RT-PCR. Since InTaq is thermally stable, it should be able to withstand heat-treated RNA extraction. Thus, heat-treated RNA extraction can be combined with RT-PCR (HT-RT-PCR) to accelerate the RNA virus detection procedure. To test this hypothesis, diluted MS2 phage was added directly to RT-PCR reaction containing InTaq DNA polymerase. Instead of a separate RNA extraction step, the reaction was heated at 95° C. for 5 min followed by standard RT-PCR. The target viral RNA was successfully amplified using this method (
All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
This application claims priority to U.S. Provisional Application No. 63/071,493, filed Aug. 28, 2020, the entire contents of which are incorporated herein by reference.
This invention was made with Government support under Federal Grant no. 1P01-AI104533-01A1 awarded by the National Institutes of Health (NIH). The Federal Government has certain rights to this invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/015129 | 1/26/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63071493 | Aug 2020 | US |
